How to Install and Use a Standalone BLAST (B asic L ocal A lignment S earch T ool) Server Doug Davis Plant Science Division Univ. of Missouri 6/26/06
Dec 20, 2015
How to Install and Use a Standalone BLAST (Basic Local Alignment Search Tool) ServerDoug DavisPlant Science DivisionUniv. of Missouri6/26/06
Lab Premise
Bioinformatics research is typically web-based
Access to necessary URLs may be hampered by need for administrator permissions
Solution: Standalone BLAST (you will be provided a CD containing all necessary files at the lab’s conclusion)
Lab Goals
See where BLAST fits into the larger scheme of bioinformatics
Demonstrate installation of a standalone BLAST server on a Windows XP PC (should also work on a Windows 2000 PC)
Gain initial familiarity with available standalone BLAST parameters
Bioinformatics Defined
Study of biological questions using computers in place of traditional labware (e.g. test tubes, pH meters, electrophoretic equipment)
Dependent on databases containing molecular data generated over many decades
Millions of sequences are in these databases; best of all, tools like BLAST can search for sequences in such large databases very rapidly
What Is BLAST?
BLAST is a program that searches for similarities among molecular sequences- works with nucleic acids and proteins
It performs local (as opposed to global) alignments using a special set of scoring matrices
It calculates statistical significance for any matches it finds (allows you to evaluate the degree of similarity)
a very powerful tool for characterizing unknown sequences by using sequence alignments to known sequences
The usual way BLAST is employed… Requires an active internet connection to visit websites
where molecular databases reside (e.g. http://www.ncbi.nlm.nih.gov)- you have a lot of flexibility working over the web (many different databases and informatics tools can be rapidly accessed)
You specify a target database to be searched using the website’s BLAST server
You upload the query sequences (these are the sequences you want to learn more about) to a web-BLAST server; then these sequences are compared by the BLAST alignment algorithm to all sequences in the specified target database
If BLAST detects a match between query sequences anddatabase sequences, this indicates some meaningfulrelationship between the aligned sequences.
Target database sequences
This database contains manysequences which are al-
ready characterized, these arethe “knowns”
Query sequence(s)
These are sequences you wantto know more about. Consider
them as “unknowns”.
BLASTprogram
BLAST Session Setup
Here’s how the BLAST session looks in“Command Prompt” (this is the programyou will use in Windows to run BLAST):
Here’s the “Hit Table” Output from a BLASTSession- the Hit Table format is a stripped-downBLAST output
Hit Table Format of BLAST Output The output report fields are outlined here
# BLASTN 2.2.14 [May-07-2006]# Query: 5221 sequences# Database: maize_genes.txt# Fields: Query, Subject, %ID, AlignLngth, Mismatch, Gaps, Qry_start, Qry_end, Subj_start, Subj_end, e-val, bit_score
CK828121 TC279221 88.96 589 55 8 74 653 274 861 0.0 642CF624012 TC279225 94.03 318 19 0 143 460 411 94 4e-136 480CF624331 TC279227 99.25 665 4 1 1 665 846 183 0.0 1277CK826720 TC279296 100.00 28 0 0 1 28 1666 1639 3e-008 56.0CF623767 TC281097 81.85 292 39 13 283 567 1513 1229 3e-035 145
BLAST Report Field Explanations
mismatches- number of nucleotides that don’t match over the length of the aligned portion
gaps- a confusing field, as these can be caused both by truncation of sequence or when there are multiple, contiguous mismatches in the middle of an alignment- then the matching algorithm introduces a gap into the alignment
e-value- a statistic which indicates the probability of recovering the sequence of interest, given the size of the database searched; it is strongly influenced by the size of the database searched
bit score- a probability statistic which takes the size of the searched database into account (high scores indicate strong alignments); unaffected by the size of the database searched
Query= gi|44900833|gb|CK827378.1|CK827378 zmrsub1_0B20-006-a11.s4zmrsub1 Zea mays cDNA 3', mRNA sequence (609 letters) Score ESequences producing significant alignments: (bits) Value
TC280752 UP|Q9LLI2_MAIZE (Q9LLI2) Cellulose synthase-8, complete 32 0.34
>TC280752 UP|Q9LLI2_MAIZE (Q9LLI2) Cellulose synthase-8, complete Length = 3931
Score = 32.2 bits (16), Expect = 0.34 Identities = 22/24 (91%) Strand = Plus / Plus
Query: 531 cgaggcggaggacgccgtcgacga 554 ||||| |||||||| |||||||||Sbjct: 519 cgaggaggaggacggcgtcgacga 542
Default BLAST Output: Graphical Alignmentof Query Sequence to Subject Sequence inthe Target Database (nucleotide-nucleotide)
How Does BLAST Make the Alignments?
C O E L A C A N T H
0 0 0 0 0 0 0 0 0 0 0
P 0 0 0 0 0 0 0 0 0 0 0
E 0 0 0 1 0 0 0 0 0 0 0
L 0 0 0 0 2 1 0 0 0 0 0
I 0 0 0 0 1 1 0 0 0 0 0
C 0 1 0 0 0 0 2 0 0 0 0
A 0 0 0 0 0 0 0 3 2 1 0
N 0 0 0 0 0 0 0 1 4 3 2
Answer: Local Alignment is based on the “Smith-Waterman Algorithm”
the local alignment produced by this algorithm is: ELACAN ELICAN
How to Calculate Smith-Waterman Matrix Values Matches are assigned a value of +1, mismatches are -1,
gaps (where there is no character to try matching with in one of the sequences) are also assigned a value of -1
Calculate the match score: sum of the score in the preceeding diagonal cell plus the gap penalty (+1 if no gap, -1 if there is a gap)
Calculate the horizontal gap score: sum of the cell to the left plus the gap penalty
Calculate the vertical gap score: sum of the cell above plus the gap penalty
The maximum score is never less than 0.
What Types of Questions Can BLAST Be Used to Answer?
Find genes in a genomic sequence
Predict a protein’s function
Predict the 3-D structure of a protein
Identify members of gene/protein families
Why install a Standalone Copy of BLAST? You don’t need administrator permissions to
run it
Easier to control the output format (you aren’t stuck with what the website decides you should have)
More user control (easier to construct custom BLAST queries)
Flow of Events in a BLAST Session
format the targetdatabase (protein ornucleic acid)
create a file that contains thequery sequences
create a blank file that will receive the
BLAST output
submit the BLASTjob using the
command promptreview the BLASToutput; formulatenew hypothesis
BLAST Installation Details: Part 1
Insert the provided CD and locate the file named “ncbi.ini” (this file contains the path to the BLAST\data subfolder)
Click the “Start” button on your desktop, then click on “My Computer”, then click on the C:\ drive
Open the WINDOWS, WINNT, or WINDOWS NT folder and drag the ncbi.ini file into either of these folders
BLAST InstallationDetails:Part 2
Go to C:\Program Files
Drag the BLAST folder on your CD into the C:\Program Files folder- be careful to not place it inside another folder that resides in C:\Program Files.
Open the BLAST folder and click the file named “blast-2.2.14-ia32-win32” to install the BLAST application
BLAST Installation Details: Part 3
Drag the .txt file “maize_genes” from the CD into the “C:\Program Files\BLAST\data” folder
Create and save a blank text (.txt) file named “query_seqs” in the “C:\Program Files\BLAST\data” folder
Open the .txt file named “Install_Lab_seqs” from the CD, and copy the contents; paste these into the file “query_seqs” then save the file
Create and save a .txt file named “output” in the “C:\Program Files\BLAST\data” folder- this file will receive the BLAST output
BLAST Installation Details: Part 4 Move the following files from the “C:\
Program Files\BLAST\bin” folder into the “C:\Program Files\BLAST\data” folder: “formatdb”, “blastall”, “blastclust”, and “megablast” (these are the “executable” files you will need to make BLAST run)
Click Start, select “All Programs”, then select “Accessories”; click the “Command Prompt” icon to open a “command line” session
Get Ready to BLAST
Type the following in at the command prompt: “formatdb –i maize_genes.txt –p F –o F” (this command will format the target database, maize_genes.txt, so that it can be searched by BLAST)
Using Standalone BLAST
At the command prompt, type the following: C:\Program Files\BLAST\data>megablast -i query_seqs.txt -d maize_genes.txt -o output.txt -F "m D" -D 3
Press the Enter button, then BLAST will start processing the commands
When the program terminates (you will get a new command prompt), open the output.txt file to inspect the results.
Different Types of BLAST
There are 5 types of BLAST available:
megaBLAST: very rapid (~12-fold faster than BLASTN), DNA query against DNA databases
BLASTN: same set-up as megaBLAST, slower, but more options for query construction
BLASTP: protein used to search protein databaseBLASTX: translated DNA search of protein databaseTBLASTN: protein used to search translated DNA
databaseTBLASTX: DNA translated in all 6 frames versus a
translated DNA database
We’ll look more at these this afternoon