How to fingerprint a bat

School of Life Sciences Learning and Teaching, University of Dundee

Identify a suitable study organism for

small scale (Honours level) projects

Obtain a sequence resource

Do interesting science

› Marker identification

› Genome comparison

› Sequence assembly

› …

The Soprano Pipistrelle is

Scotland's most

common bat species.

Like all bats it is a

protected species.

No genome sequence

Locally accessible but

poorly understood biology and ecology

http://www.bats.org.uk/data/images/species/pipistrelle_soprano/Pip_Pyg.JPG

Potential for non-invasive monitoring by DNA analysis of faeces

Genomic DNA from a single donated

individual

1 library (197bp fragment)

1 lane on HiSeq (paired end)

› 140 million mate pairs, 101bp reads

› 28 billion bp.

› Estimated genome size : 2.5-3.0 Gbp

A

B

Forward primers Reverse primers

Target Length: 150-250bp fragment

SRA

› QC

› Filter

› Error correct

› Assemble

› Around 4.7 Million contigs

N50 ~11.5 kb

4.7 Million contigs

>400,000 repeats

Repeat search

with SciRoKo

7140 candidates

‘custom python

script’

1405 primer pairsPrimer 3

ACACACACACACACAC

Repeat >2

ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG

90bp < Repeat <200 bp

ACTGACTGACTGACTGACTG TGACTGACTGACTGACTGAC

Inter-repeat gaps > 150 bp

ACTGACTGACTGACTGACTG

1405 primer pairs

126 candidates

‘custom python

script’

22 primer pairs

‘manual

selection’

Lots of gelsOrder!

Common Tm 58-60 C

Amplified fragment 150-250bp

Filter for low self-annealing/hairpin score

High complexity (no simple sequence

repeats)

3 primer pairs from already published

data (Racey et al 2005)

7 primer pairs from other bat species

› Reported as potentially cross-species

22 novel primer pairs from our study

All with common PCR conditions.

Do the primers amplify cleanly?

› If not, do they have potential with tweaks

Are they heterogeneous?

› Test across DNA panel from 7 bats

Do they work on DNA isolated from

pellets?

› i.e. against a very noisy background

A:

Similar results seen on DNA extracted from

pellets but a few extra PCR cycles needed

Most of the putative cross species markers failed and

the 2 that worked gave products outwith size

constraints for analysis.

All of the previously identified Pipistrelle markers

amplified well but require a better resolution

technology to determine if they are informative

Primer set Total pairs Failed Heterozygous Homozygous Need work

Novel22 6 9 0 7

Cross sp.7 5 0 2 0

Racey et al3 0 2 1 0

1 HiSeq lane and straightforward

assembly is sufficient for candidate

marker identification

Careful selection at the bioinformatic

stage gives a good return of candidates.

>70% is an excellent result.

Optimise the conditions

› Mostly small tweaks

Multiplex for genotyping

› Fluorescent labelling

Apply to populations

› Collection of bat faeces

Thanks to:

Dr David Booth

Tayside Bat Group

Bat donors

School of Life Sciences Learning and Teaching