HistoneDeacetylaseInhibitorsTargettheLeukemic ... · directly target cancer cells by increasing expression of many proteinsincludingthosethatregulatetumorsuppression,DNA repair, and

Histone Deacetylase Inhibitors Target the LeukemicMicroenvironment by Enhancing a Nherf1-ProteinPhosphatase 1�-TAZ Signaling Pathway in Osteoblasts*

Received for publication, May 28, 2015, and in revised form, October 20, 2015 Published, JBC Papers in Press, October 21, 2015, DOI 10.1074/jbc.M115.668160

Kimberly N. Kremer‡, Amel Dudakovic§, Allan D. Hess¶, B. Douglas Smith¶, Judith E. Karp¶, Scott H. Kaufmann�**,Jennifer J. Westendorf§‡‡, Andre J. van Wijnen§‡‡, and Karen E. Hedin‡1

From the Departments of ‡Immunology, §Orthopedic Surgery, �Oncology and **Molecular Pharmacology & ExperimentalTherapeutics and the ‡‡Center of Regenerative Medicine, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, Minnesota55905 and the ¶Sidney Kimmel Cancer Center at Johns Hopkins, Baltimore, Maryland 21287

Disrupting the protective signals provided by the bone mar-row microenvironment will be critical for more effective combi-nation drug therapies for acute myeloid leukemia (AML). Cellsof the osteoblast lineage that reside in the endosteal niche havebeen implicated in promoting survival of AML cells. Here, weinvestigated how to prevent this protective interaction. We pre-viously showed that SDF-1, a chemokine abundant in the bonemarrow, induces apoptosis of AML cells, unless the leukemiccells receive protective signals provided by differentiatingosteoblasts (8, 10). We now identify a novel signaling pathway indifferentiating osteoblasts that can be manipulated to disruptthe osteoblast-mediated protection of AML cells. Treating dif-ferentiating osteoblasts with histone deacetylase inhibitors(HDACi) abrogated their ability to protect co-cultured AMLcells from SDF-1-induced apoptosis. HDACi prominently up-regulated expression of the Nherf1 scaffold protein, whichplayed a major role in preventing osteoblast-mediated protec-tion of AML cells. Protein phosphatase-1� (PP1�) was identi-fied as a novel Nherf1 interacting protein that acts as the down-stream mediator of this response by promoting nuclearlocalization of the TAZ transcriptional modulator. Moreover,independent activation of either PP1� or TAZ was sufficient toprevent osteoblast-mediated protection of AML cells even in theabsence of HDACi. Together, these results indicate that HDACitarget the AML microenvironment by enhancing activation of theNherf1-PP1�-TAZ pathway in osteoblasts. Selective drug target-ing of this osteoblast signaling pathway may improve treatments ofAML by rendering leukemic cells in the bone marrow more suscep-tible to apoptosis.

For decades, research into drug treatments for acute myeloidleukemia (AML)2 has focused on directly targeting AML cells

for destruction. Even though complete remission rates haveimproved, relapse remains a problem in the majority of patientswith this disease. The bone marrow microenvironment hasgained attention as a protective environment that promotessurvival of AML stem cells, despite the killing of the majority ofAML cells by standard chemotherapeutics (1–5). The endos-teum, the tissue between the bone marrow and ossified surface,has been particularly implicated as a protective niche becauseAML stem cells are localized to this region following chemo-therapeutics (6, 7). Within the endosteal niche, cells of theosteoblast (bone-generating) lineage have been identified ascritical mediators of AML cell survival in the bone marrow (4,8). Transgenic mice expressing activated �-catenin specificallyin osteoblasts develop myeloid malignancy, consistent with theidea that osteoblasts promote this disease (9). Unfortunately,the molecular mechanisms responsible for osteoblast-medi-ated protection of AML cells are incompletely understood. Thislack of knowledge prevents effective therapeutic manipulationof the bone marrow microenvironment as a way to enhancetargeting of AML cells within the bone marrow.

We previously reported that SDF-1, a chemokine abundantlysecreted by multiple cell types within the bone marrow, inducesapoptosis of AML cell lines and patient isolates that expresshigh levels of its receptor CXCR4 (8, 10). Because AML cellsthrive in the bone marrow, this apparent contradiction indi-cated that a cell type within the bone marrow must providesignals that protect AML cells from SDF-1-induced apoptosis.Utilizing co-culture systems, we previously demonstrated thatco-culturing differentiating osteoblasts, but not earlier precur-sors of the osteoblast lineage, with the AML cells completelyabrogated SDF-1-induced apoptosis of the AML cells (8). Theseresults prompted us to utilize this co-culture system to identifystrategies to inhibit osteoblast-mediated protection of AMLcells.

HDACi are being explored as treatments for diverse malig-nancies. These drugs globally regulate gene expression viaincreasing acetylation of histones, proteins that control chro-matin accessibility to transcription factors. In AML, HDACihave shown efficacy in combination with standard chemother-apeutics such as cytarabine (11–14). HDACi are known to

* This work was supported by the Mayo Clinic Foundation for MedicalResearch, the Joanne G. and Gary N. Owen Fund in Immunology Research,the Alma B. Stevenson Endowment Fund for Medical Research, andNational Institutes of Health Grants R01 CA166741 (to S. H. K) and U01CA70095 (to J. E. K) and R01 AR049069 (to A. J. v. W.). The authors declarethat they have no conflicts of interest with the contents of this article.

1 To whom correspondence should be addressed: Guggenheim Building 3rdfloor, 200 First St. Southwest, Rochester, MN 55905. Tel.: 507-284-5365; Fax:507-284-4957; E-mail: [email protected].

2 The abbreviations used are: AML, acute myeloid leukemia; SDF-1, stromalcell-derived factor-1; HDACi, HDAC inhibitor; SAHA, suberoylanilide

hydroxamic acid; PP1�, protein phosphatase-1�; DMSO, dimethyl sulfox-ide; qRT, quantitative RT; APC, allophycocyanin.

crossmarkTHE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 290, NO. 49, pp. 29478 –29492, December 4, 2015

© 2015 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

29478 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290 • NUMBER 49 • DECEMBER 4, 2015

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

directly target cancer cells by increasing expression of manyproteins including those that regulate tumor suppression, DNArepair, and cell-cycle arrest. Because HDACi have also beenshown to alter expression of many genes within cells of theosteoblast lineage (15–18), we hypothesized that HDACi mightalso target the leukemic microenvironment. HDACi have beenpreviously shown to up-regulate Nherf1 (also known as EBP-50), a scaffold protein mutated in human hypophosphatemicnephrolithiasis/osteoporosis type 2. Nherf1 has been linkedwith TAZ, a ubiquitously expressed transcriptional modulator,in the regulation of osteoblast differentiation (19). Localizationof TAZ to the nucleus, where it increases expression of multiplegenes including those controlled by the TEAD and SMAD fam-ily of transcription factors, is regulated by phosphorylation.When TAZ is phosphorylated, it is localized to the cytoplasm.Dephosphorylation by PP1�, a ubiquitously expressed Ser/Thrprotein phosphatase, induces TAZ nuclear localization tomediate osteoblast differentiation (20 –26). Nherf1 knock-outmice display bone defects (19, 27, 28), however, the effects ofelevating Nherf1 expression and increasing TAZ localization tothe nuclei of osteoblasts were previously unknown.

Here, we show that HDACi inhibit the protective functionsof the bone marrow microenvironment in AML by targetingosteoblasts to increase expression of Nherf1, and that Nherf1up-regulation prevented osteoblast-mediated protection ofAML cells in co-cultures. We also show that increased Nherf1activates a novel signaling pathway in osteoblasts by bindingPP1�, which promotes TAZ nuclear localization and inhibitsthe ability of osteoblasts to protect AML cells from apopto-sis while having little effect on osteoblast differentiation.Together, these results identify several members of a novelmolecular signaling pathway within osteoblasts that could betargeted in AML to ameliorate the leukemic cell protectiveeffects of the endosteal niche.

Experimental Procedures

Materials—Reagents were obtained from the following sup-pliers: ascorbic acid, �-glycerophosphate, dimethyl sulfoxide(DMSO), and the protease inhibitor mixture (Sigma); SDF-1(R&D Systems), SAHA (Cancer Therapy Evaluation Program,National Cancer Institute); LBH-589 (Selleckchem.com); andlive/dead viability assay and Prolong Gold anti-fade with DAPI(Invitrogen).

Antibodies were obtained from the following suppliers: rab-bit polyclonal anti-acetylated H3 and anti-total H3 as well asS-protein agarose (Millipore); murine monoclonal anti-actin(Novus Biologicals); rabbit anti-Nherf1 (anti-EBP50); murinemonoclonal anti-PP1 and agarose-conjugated rabbit-anti-PP1� (Santa Cruz Biotechnology); murine monoclonal anti-TAZ and APC-conjugated annexin-V (BD Biosciences); APC-conjugated murine monoclonal CXCR4 (R&D Systems); rabbitanti-lamin A and C (Genscript); murine monoclonal anti-�-tubulin (Sigma); and Alexa Fluor 647-conjugated anti-mouseIgG (Invitrogen). Murine monoclonal anti-S peptide antibodywas generated as previously described (29).

Cells—After informed consent was obtained on an IRBapproved protocol, samples of bone marrow were harvestedfrom AML patients prior to chemotherapy and utilized in co-

cultures as described (8). MC3T3 sc4 murine calvarial osteo-blasts (30) (ATCC) were cultured and differentiated asdescribed (8). Briefly, MC3T3 cells were maintained in MediumB (�-MEM without ascorbic acid (Invitrogen), 10% FCS, 1%penicillin/streptomycin). To induce differentiation (denoted asday 0), the culture medium of confluent MC3T3 cells wasreplaced with osteogenic medium (�-MEM, 50 �g/ml of ascor-bic acid, 4 mM �-glycerophosphate). The human bone marrow-derived tert-immortalized bone marrow stromal cell line(t-BMSC) (31) was a gift from Dario Campana (St. Jude, Mem-phis, TN) and was maintained as described (8). The CXCR4-expressing KG1a cells (KG1a-CXCR4) were generated via tran-sient transfection of a plasmid encoding a CXCR4-YFPfluorescent fusion protein (32) into the AML cell line KG1a(ATCC), as previously described (10).

siRNA, Plasmid Constructs, Transfection, and SubcellularFractionation of MC3T3 Cells—ON-TARGET Plus ControlsiRNA pool and Nherf1-specific siRNA pool were from GEHealthcare (Dharmacon). Nherf1-specific siRNA #2 (77422)was obtained from Ambion. pEYFP-N1 was from Clontech.pcDNA murine Nherf1 (33) was from Edward Weinman (Add-gene, 32705). GFP-Nherf1 was generated by subcloning murineNherf1 into pEGFP-C1 (Clontech). Nherf1 tagged with S pep-tide at its N terminus (S-Nherf1) was generated by subcloningmurine Nherf1 into pSPN (29). Using a plasmid encoding GFP-PP1� (34) from Angus Lamond and Laura Trinkle-Mulcahy(Addgene, 44224), GFP-PP1�T320A was generated by site-di-rected mutagenesis using a QuikChange II XL site-directedmutagenesis kit (Agilent Technologies). S peptide-PP1�(S-PP1�) was generated by subcloning murine PP1� intopSPN (29). TAZWT and TAZS89A plasmids (24) were fromMichael Yaffe (Addgene, 19025, 19026). S peptide-TAZWT(S-TAZWT) and S peptide-TAZS89A (S-TAZS89A) were gen-erated by subcloning into pSPN (29).

MC3T3 cells were transfected on day (�1) prior to differen-tiation as follows: a confluent layer of undifferentiated MC3T3cells was detached from plates via trypsin/EDTA, washed inMedium B, combined with the indicated siRNAs or plasmids,electroporated using a BTX square wave electroporator at 315V for 10 ms, and then replated. Six hours later, the medium wasremoved and replaced with fresh Medium B. The following day(day 0), osteoblast differentiation was initiated by replacing theculture medium with osteogenic medium. The transfectionefficiency was �40 –50%. Where indicated, MC3T3 weretreated or transfected, and on day 2 of differentiation theMC3T3 cells were washed with PBS and subcellular fraction-ation was performed as described (26).

Co-culture Assays, HDACi Treatment, and Apoptosis Anal-ysis—MC3T3 cells were prepared for co-culture as indicated viatransfection on day (�1), and differentiation was initiated onday 0. Where indicated, 0.1% DMSO (vehicle), 10 �M SAHA, or1 �M LBH-589 was added to the culture medium for the indi-cated times. MC3T3 cultures were then washed to removeresidual SAHA or LBH-589 and co-cultures were begun by add-ing 0.25 � 106 cells/ml of KG1a-CXCR4 AML cells. Co-cul-tures were maintained at 37 °C for 1 h, then 1.3 � 10�8 M SDF-1was added and cells were cultured for an additional 16 –18 h.On day 3, KG1a-CXCR4 AML cells were removed from the

HDAC Inhibitors Target Osteoblast-AML Interactions

DECEMBER 4, 2015 • VOLUME 290 • NUMBER 49 JOURNAL OF BIOLOGICAL CHEMISTRY 29479

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

co-cultures and assayed for apoptosis as previously described(8). Statistical analysis was via two-tailed t test (MicrosoftExcel). The means of two distributions were considered signif-icantly different if p � 0.05.

Detection of Osteogenic Markers by qRT-PCR—RNA was iso-lated via RNeasy Plus Kit and reverse transcribed into cDNA viathe SuperScript III First-strand Synthesis System (Invitrogen).Gene expression was measured using qRT-PCR. Reactionsincluded 25 ng of cDNA per 10 �l with QuantiTect SYBR GreenPCR Kit (Qiagen) and the CFX384 Real-time System (Bio-Rad).Transcript levels were normalized to the housekeeping geneGapdh. Gene expression levels were quantified using the 2��Ct

method. Gene-specific primer sequences are in Table 1.Immunoprecipitation and Mass Spectrometry—MC3T3 cells

treated and/or transfected as indicated on day 2 of differentia-tion were lysed with RIPA buffer (150 mM NaCl, 50 mM Tris (pH7.4), 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate,1% Triton X-100), immunoprecipitated with the indicatedantibodies, and analyzed via either SDS-PAGE and immuno-blotting or SDS-PAGE and silver stain followed by massspectrometry.

Immunofluorescence—Cells were imaged using a LSM780laser scanning confocal microscope (Carl Zeiss, Oberkochen,Germany). ZEN software (Carl Zeiss) was utilized for acquisi-tion of images. For live/dead assays, a 10�/0.45 M27 objectiveand the following wavelengths for excitation/emission wereutilized: 561/626 for dead (red) cells and 488/522 for live(green) cells. The percentage of dead cells was determined bydividing the number of red, dead cells by the total number oflive, green cells plus the number of red, dead cells. For visual-ization of Nherf1, PP1�, and TAZ, MC3T3 cells were fixed with4% paraformaldehyde, permeabilized with 0.15% Triton X-100,stained with DAPI to identify nuclei, and visualized with a100�/1.46 oil objective and laser/emission filter: 488/500 –554for GFP, 405/411– 481 for DAPI, and 633/660 –758 for AlexaFluor 647. Cells were scored positive for nuclear localization ifTAZ nuclear staining was stronger than TAZ cytoplasmicstaining.

Results

Osteoblasts Protect AML Isolates from Apoptosis in a Co-cul-ture Model of the Bone Marrow Microenvironment—We previ-ously demonstrated that AML patient isolates and cell linesexpressing high levels of CXCR4 underwent apoptosis inresponse to treatment with SDF-1 (10). Preliminary studiesconducted predominantly in AML cell lines also suggested thatosteoblasts protect AML cells expressing high levels of CXCR4from this SDF-1-induced apoptosis (8). Building on these stud-ies, SDF-1-responsive patient AML isolates were co-culturedeither with or without the well characterized, rapidly mineral-izing MC3T3 sc4 osteoblast cell line, and then analyzed forapoptosis via flow cytometric detection of annexin-V expres-sion. Fig. 1, A and B, show the increased percentage of patientAML cells expressing annexin-V in response to SDF-1. In con-trast, adding MC3T3 osteoblasts to co-cultures markedlyinhibited apoptosis of all SDF-1-responsive patient AML iso-lates examined to date (Fig. 1, A–C). These results indicate thatosteoblasts provide protective signals to AML cells within thebone marrow microenvironment.

Osteoblasts Treated with HDACi Fail to Protect AML Cellsfrom SDF-1-induced Apoptosis—To identify molecular mecha-nisms that prevent osteoblast-mediated protection of AMLcells, we utilized a more defined co-culture model of the bonemarrow microenvironment (8) that allows specific alteration ofthe microenvironment to identify key signaling pathways thatcould be modulated to inhibit the protection provided to AMLcells. This model (8, 10) utilizes the previously described differ-entiating MC3T3 osteoblasts, which can be pharmacologicallyor genetically altered to characterize the cellular mechanismsmediating protection of AML cells. Additionally, this modelutilizes the human KG1a AML cell line transiently transfectedwith CXCR4-YFP (KG1a-CXCR4 cells), which mimics primaryAML patient isolates that express cell-surface CXCR4 andrespond to SDF-1 by undergoing apoptosis. The YFP fluores-cent tag also permits unambiguous identification of KG1a-CXCR4 AML cells after co-culture (8, 10). We utilized this co-culture system as shown in Fig. 2A to determine whether

TABLE 1PCR primers used for qRT-PCR

Gene ID Forward primer Reverse primer

Gapdh CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAGAtf1 AACCTCATGGGTTCTCCAGCGA CTCCAACATCCAATCTGTCCCGSp1 CTCCAGACCATTAACCTCAGTGC CACCACCAGATCCATGAAGACCHprt1 CTGGTGAAAAGGACCTCTCGAAG CCAGTTTCACTAATGACACAAACGEzh1 CGAGTCTTCCACGGCACCTATT GCTCATCTGTTGGCAGCTTTAGGAkt1 CACACGTCAAGCGACCCATGAA TCTTCTCGCTCTCGTTCAGCAGRunx2 CCTGAACTCTGCACCAAGTCCT TCATCTGGCTCAGATAGGAGGGSp7 GGCTTTTCTGCGGCAAGAGGTT CGCTGATGTTTGCTCAAGTGGTCSatb2 CAAGAGTGGCATTCAACCGCAC TCCACTTCAGGCAGGTTGAGGAOgn CTCGTTACATTCGGGAGCGA GCTGCACTGATGGGGTTAGAOmd TGCACATTCAGCAACTCAACC TGCAGTCACAGCCTCAATGTSparc CCCCTCAGCAGACTGAAGTT ACAGGTACCCCTGTCTCCTCIbsp GAATGGCCTGTGCTTTCTCG CCGGTACTTAAAGACCCCGTTBglap GCAATAAGGTAGTGAACAGACTCC CCATAGATGCGTTTGTAGGCGGAlpl CCAGAAAGACACCTTGACTGTGG TCTTGTCCGTGTCGCTCACCATPbx-1 TCACAGCCACCAATGTGTCA GAAGGGTATCCACCCGCTGDlx-3 CCAAGTCGGAATATACCTACGGG TTCACCATGCGAACCTCGGCTTTwist1 GATTCAGACCCTCAAACTGGCG AGACGGAGAAGGCGTAGCTGAGPrrx1 GACCAACCGATTATCTCTCCTGG CAGTCTCAGGTTGGCAATGCTGNherf1 CAGCACGGGGACGTGGTGTC CCAGGGCTTCACGGCTGCTC

HDAC Inhibitors Target Osteoblast-AML Interactions

29480 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290 • NUMBER 49 • DECEMBER 4, 2015

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

treatment with the HDACi SAHA (suberoylanilide hydroxamicacid, also known as vorinostat) alters the ability of osteoblasts toprovide protective signals to AML cells. First, we initiatedosteogenic differentiation of MC3T3 cells on day 0. Beginning24 h later we added DMSO or 10 �M SAHA for 30 h. On day 2of MC3T3 differentiation (a time point we previously showed issufficient for these differentiating osteoblast cells to providemaximal AML cell protection in this co-culture system (8)), wewashed the MC3T3 to remove residual SAHA, added KG1a-CXCR4 AML cells, and added SDF-1 prior to incubation for anadditional 16 –18 h. SAHA treatment of osteoblasts inhibitedhistone deacetylation within differentiating MC3T3 osteo-blasts as expected, shown by increased acetylation of histone-3(Fig. 2B). On day 3, KG1a-CXCR4 cells were harvested from theco-cultures and analyzed for apoptosis via annexin-V, cleavedpoly(ADP-ribose) polymerase, or cleaved Caspase-3 stainingand flow cytometric analysis of gated YFP� cells. Fig. 2C showsrepresentative results, whereas Fig. 2, D–F, summarizes resultsof multiple experiments performed on different days. As previ-ously reported (8, 10), KG1a-CXCR4 cells cultured in theabsence of osteoblasts responded to SDF-1 treatment by signif-icantly increasing their apoptosis, whereas KG1a-CXCR4 cellsco-cultured with day 2 differentiated MC3T3 osteoblast cellswere protected (Fig. 2, C–F). Interestingly, SAHA pretreatmentof the differentiating MC3T3 cells prior to adding the KG1a-CXCR4 AML cells significantly prevented their ability to pro-

tect the AML cells from apoptosis both in the presence andabsence of SDF-1 (Fig. 2, C–F). To ensure that SAHA was notsimply killing the differentiating osteoblasts, we performed alive/dead assay to check for cell viability. SAHA did slightlyincrease the percent of dead MC3T3 cells from �1% in DMSO-treated cells to 6% in SAHA-treated cells. However, the SAHA-treated MC3T3 osteoblast cultures still formed a confluentmonolayer of predominantly live (green) cells (Fig. 2G).Extending the time of SAHA treatment of MC3T3 osteoblastsalso inhibited the osteoblasts from protecting AML cells (Fig.3A). Even MC3T3 cells maintained in differentiation mediumfor an extended time (14 days) and permitted to accumulateextracellular matrix and retain associated secreted factors stillresponded to a brief SAHA treatment by significantly decreas-ing their ability to protect AML cells (Fig. 3B).

To ensure that inhibition of osteoblast-mediated protectionof AML cells was not unique to a single HDACi, we tested anadditional HDACi, LBH-589 (also known as Panobinostat), inco-cultures performed as in Fig. 4, A–C. As expected, LBH-589treatment increased acetylation of Histone-3 in differentiatingMC3T3 osteoblast cells (Fig. 4A), whereas causing only mini-mal death of these cells that permitted the formation of a con-fluent layer of live (green) cells (Fig. 4C, dead cells: 1% forDMSO and 8% for LBH-589). LBH-589 acted similarly toSAHA, significantly inhibiting the ability of differentiatingMC3T3 cells to protect KG1a-CXCR4 AML cells from apopto-

FIGURE 1. Osteoblasts protect AML isolates from apoptosis in a co-culture model of the bone marrow microenvironment. A, bone marrow aspirateswere harvested from AML patients prior to chemotherapy and were cultured for 1–2 h prior to being added to t-BMSC �/� MC3T3 co-cultures. Beginning 1 hafter the cells were combined, co-cultures were treated with 5 � 10�8

M SDF-1 for 16 –18 h. Apoptosis of patient AML isolates was assayed via APC-conjugatedannexin-V staining and flow microfluorimetry. Results shown are from eight different patients. Samples 4, 10, and 14 were previously shown in Ref. 8. B,summary of the fold-increase of annexin-V positive cells in response to SDF-1 of the 8 different patient samples displayed in A. *, indicates p � 0.05 by two-tailedt test. C, patient information. a, “positive” indicates presence of activating mutation (internal tandem duplication or Asp-835 mutations), “negative” indicatesabsence of activating mutation. b, “positive” indicates CXCR4 cell-surface staining higher than control (unstained).

HDAC Inhibitors Target Osteoblast-AML Interactions

DECEMBER 4, 2015 • VOLUME 290 • NUMBER 49 JOURNAL OF BIOLOGICAL CHEMISTRY 29481

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

HDAC Inhibitors Target Osteoblast-AML Interactions

29482 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290 • NUMBER 49 • DECEMBER 4, 2015

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

sis in both the absence and presence of SDF-1 (Fig. 4B).Together, Figs. 2– 4 indicate that differentiating MC3T3 osteo-blasts are capable of protecting KG1a-CXCR4 AML cells fromapoptosis and that this protection can be significantly inhibitedby pretreating the differentiating osteoblasts with HDACidrugs.

The HDACi-induced Up-regulation of Nherf1 Inhibits Osteo-blast-mediated Protection of AML Cells in Response to SDF-1—Because HDACi cause global changes in gene expression pat-terns, we sought to identify the specific molecular mechanismresponsible for the effects of osteoblasts on AML cells. We pre-viously showed that multiple HDACi drugs, including SAHA,significantly increase expression of the Nherf1 scaffold proteinin osteoblasts (15, 16, 18). HDACi treatment of differentiatingMC3T3 cells in our co-culture system similarly increasedexpression of both Nherf1 mRNA and protein (Fig. 5, A and B).We therefore explored the role of Nherf1 in the mechanism bywhich osteoblasts protect AML cells. MC3T3 cells were trans-fected either with a Nherf1 siRNA pool or a control siRNA poolon day (�1). The MC3T3 cells were then differentiated on day0 and used in co-cultures as in Fig. 2, A–D. Nherf1 siRNA trans-fection successfully prevented Nherf1 protein up-regulation indifferentiating MC3T3 cells treated with SAHA and also signif-icantly reversed the effects on co-cultures of pretreating theseMC3T3 cells with SAHA (Fig. 5C). Similar results were

observed with a second Nherf1-specific siRNA (Nherf1 siRNA#2) (Fig. 5D). These results indicate that Nherf1 up-regulationis required for SAHA to inhibit osteoblast-mediated protectionof AML cells.

We next addressed whether increased Nherf1 expression inosteoblasts would be sufficient for inhibiting osteoblast-medi-ated protection of AML cells, independent of HDACi treat-ment. MC3T3 cells were transfected on day (�1) prior to dif-ferentiation with either a control plasmid vector or a plasmidencoding Nherf1. The MC3T3 cells were then differentiated onday 0 and used in co-cultures as in Fig. 2, A–D, except thatSAHA was not used. Remarkably, overexpression of Nherf1,but not empty vector, significantly reversed the inhibitory effectof the differentiating osteoblasts on SDF-1-induced apoptosisof KG1a-CXCR4 cells (Fig. 5E). This result was not due toNherf1 overexpression causing osteoblast death (Fig. 5F, deadcells: less than 1% for empty vector and Nherf1). Together,these results indicate that HDACi-induced Nherf1 up-regula-tion makes an important contribution to the modulatory effectsof HDACi on osteoblast-mediated protection of AML cellsfrom SDF-1-induced apoptosis.

Increased Nherf1 Expression Does Not Inhibit OsteoblastDifferentiation—We previously demonstrated that precursorsof osteoblasts, bone marrow-derived mesenchymal stromal/stem cells and osteoprogenitors, are unable to protect AML

FIGURE 2. Osteoblasts treated with the HDACi SAHA fail to protect AML cells from SDF-1-induced apoptosis. A, schematic of co-culture design. Onday 0, osteogenic differentiation media is added to a confluent layer of MC3T3 cells. 24 h later, 0.1% DMSO or 10 �M SAHA were added to the culture for30 h. On day 2, the MC3T3 cells were rinsed with PBS to remove residual SAHA and receive fresh RPMI medium supplemented with 10% FCS. ThenKG1a-CXCR4 cells were added to the co-culture, 1 h later 1.3 � 10�8

M SDF-1 was added, and the cells were then cultured for 16 –18 h prior to harvestof the KG1a-CXCR4 cells and analysis of apoptosis. B, MC3T3 cells were cultured as described in A and harvested on day 2 for analysis of acetylation ofHistone-3 (Ac-H3) via immunoblotting. The same membrane was stripped and re-blotted for total Histone-3 as a control, n � 3. C–F, the co-culture assaywas prepared as in A, and on day 3, KG1a-CXCR4 cells co-cultured alone or with DMSO- or SAHA-treated MC3T3 cells were assayed for apoptosis bystaining with APC-conjugated annexin-V, phycoerythrin-conjugated antibody to cleaved poly(ADP-ribose) polymerase (PARP), or phycoerythrin-con-jugated antibody to cleaved Casp-3 followed by flow microfluorimetry. Gating as shown was used to measure apoptosis only of KG1a cells expressingsimilar high levels of CXCR4-YFP (see “Experimental Procedures”). In panel C the results of one representative experiment are shown. Panels D–Fsummarize three independent experiments performed as in C. Each bar denotes the mean % of YFP� cells that stained positive for annexin-V, cleavedpoly(ADP-ribose) polymerase, or cleaved Casp-3. Error bars, S.E. *, indicates p � 0.05. G, MC3T3 cells were treated as in A, except on day 2 cells wererinsed, stained with the live/dead viability dye, and analyzed via confocal microscopy for confluence of live (green) cells and for the percentage of dead(red) cells. Images were acquired on 3 separate days for a total of 14 –30 images per condition.

FIGURE 3. Treatment with HDACi SAHA inhibits the ability of osteoblasts to protect AML cells from SDF-1-induced apoptosis. A, a confluent layer ofMC3T3 cells were differentiated on day 0, treated with DMSO or SAHA on day 1, rinsed on day 4, and co-cultured with KG1a-CXCR4 cells for 1 h prior to theaddition of SDF-1 for 16 –18 h. On day 5, apoptosis of KG1a-CXCR4 cells was analyzed as described in the legend to Fig. 2C, n � 3. B, MC3T3 cells weredifferentiated on day 0, and osteogenic medium was changed every 2–3 days. On day 14, DMSO or SAHA was added and 30 h later the cells were rinsed andco-cultured with KG1a-CXCR4 cells for 1 h prior to addition of SDF-1 for 16 –18 h. On day 16, apoptosis of KG1a-CXCR4 cells was analyzed as described in thelegend to Fig. 2C, n � 3. * in panels A and B indicates p � 0.05.

HDAC Inhibitors Target Osteoblast-AML Interactions

DECEMBER 4, 2015 • VOLUME 290 • NUMBER 49 JOURNAL OF BIOLOGICAL CHEMISTRY 29483

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

cells from SDF-1-induced apoptosis (8). We therefore assessedvia qRT-PCR whether Nherf1 overexpression inhibited osteo-blast-mediated protection of AML cells by preventing differen-tiation of MC3T3 cells even in the presence of differentiationmedium. Increased Nherf1 expression in day 2 differentiatedMC3T3 cells did not produce any significant difference inexpression levels of multiple osteogenic genes including Runx2,Dlx-3, Sp7, Bglap, Alpl, Pbx-1, Ogn, Sparc, Ibsp, Satb2, andTwist1, and caused only a 1.5-fold decrease in Omd (Fig. 6A).For comparison, the expression of several reference genes,including Atf-1, Sp1, Hprt1, and Ezh1, were not significantlyaltered with Nherf1 overexpression, whereas Akt1 displayedless than a 2-fold increase in expression (Fig. 6A). As expected,Nherf1 mRNA transcripts were significantly increased inNherf1-expressing MC3T3 cells compared with control cells(Fig. 6A). Similar results were seen even when Nherf1-overex-pressing MC3T3 cells were cultured for a longer time, 7 days,in differentiation medium (Fig. 6B). Thus, increased Nherf1expression does not inhibit osteogenic differentiation ofMC3T3 cells.

Nherf-1 Interacts with PP1� and the Constitutively ActiveForm of PP1� Inhibits Osteoblast-mediated Protection of AMLCells—To address the mechanism by which increased Nherf1expression inhibits osteoblast-mediated protection of AMLcells, we utilized mass spectrometry to identify proteins that

copurify with Nherf1. MC3T3 cells were differentiated andtreated with SAHA as in Fig. 2A, then lysed so that endoge-nously expressed Nherf1 could be isolated via immunoprecipi-tation. Interestingly, mass spectrometry identified multiplepeptides of the �, �, and � subunits of PP1 co-purifying withimmunoprecipitated Nherf1 in these cells (Fig. 7A). To confirmthis previously unidentified interaction between Nherf1 andPP1�, we transfected MC3T3 cells on day (�1) with a plasmidencoding GFP-PP1� with or without a plasmid encoding GFP-Nherf1, added differentiation medium on day 0, and harvestedthe cells on day 2. GFP-Nherf1 was present in PP1� immunecomplexes from cells co-expressing both GFP-Nherf1 andGFP-PP1� but not from cells expressing GFP-PP1� alone (Fig.7B). Similarly, immunoprecipitation with a Nherf1-specificantiserum resulted in coimmunoprecipitation of GFP-PP1�(Fig. 7B). To ensure that these results were not simply a conse-quence of GFP dimerization, the interaction was further con-firmed by pulling down S peptide-tagged versions of Nherf1and PP1� on S protein-agarose and examining the recovery ofthe GFP-tagged partner protein in the pulldowns (Fig. 7C). Col-lectively, results in Fig. 7, B and C, indicate Nherf1 and PP1�associate upon increased expression of Nherf1 in differentiat-ing osteoblasts. Examining the subcellular localization of GFP-PP1� and GFP-Nherf1 revealed that GFP-Nherf1 was largelycytoplasmic and excluded from nuclei, whereas GFP-PP1�localized to both compartments in differentiating MC3T3osteoblasts (Fig. 7D). These results indicate that Nherf1 andPP1� likely interact in the cytoplasm.

We next addressed whether PP1� might play a role in themechanism by which Nherf1 overexpression inhibits the osteo-blast-mediated protection of AML cells. Inhibiting PP1� is notexpected to be informative because PP1� is required for osteo-blast differentiation (20, 21), and we previously showed thatMC3T3 differentiation is required for protection of KG1a-CXCR4 AML cells (8). Thus, we utilized the approach of over-expressing either wild-type (PP1�WT) or constitutively activePP1� (PP1�T320A) in MC3T3 cells and examining the effectson the AML cells. Indeed, overexpression of PP1�T320A indifferentiating MC3T3 cells inhibited the ability of these cells toprotect the KG1a-CXCR4 cells from SDF-1-induced apoptosis(Fig. 7E). In contrast, PP1�-WT-expressing MC3T3 cells pro-tected AML cells to a similar level as control cells transfectedwith the vector alone (Fig. 7E). Overexpression of eitherPP1�WT or PP1�T320A was not toxic to the MC3T3 cells (Fig.7F, dead cells: less than 1% for PP1�WT and PP1�T320A).Together, the results in Fig. 7 suggest that the elevated Nherf1induced by SAHA treatment of osteoblasts interacts with PP1�and stimulates PP1� to inhibit osteoblast-mediated protectionof AML cells.

PP1�-T320A Overexpression, SAHA Pretreatment, or Up-regulation of Nherf1 in Osteoblasts Induces the Nuclear Local-ization of TAZ, Which Inhibits Osteoblast-mediated Protectionof AML Cells from SDF-1—We next determined whether PP1�inhibits the osteoblast-mediated protection of AML cells via amechanism involving TAZ, a transcriptional modulator previ-ously identified as a target of PP1� in osteoblasts. Upon dephos-phorylation of Ser-89 by PP1�, TAZ localizes to the nucleuswhere it drives expression of a large number of genes, including

FIGURE 4. LBH-589 inhibits osteoblast-mediated protection of AML cellsfrom SDF-1-induced apoptosis. A, MC3T3 cells were differentiated on day 0,received DMSO or 1 �M LBH-589 on day 1, and 30 h later were harvested forimmunoblotting of Ac-H3 and total H3, n � 3. B, MC3T3 cells were co-culturedas described in the legend to Fig. 2A. However, they received 1 �M LBH-589instead of SAHA. On day 3, KG1a-CXCR4 cells were analyzed for apoptosis asdescribed in the legend to Fig. 2C, n � 4. *, indicates p � 0.05. C, MC3T3 cellswere differentiated on day 0, treated with DMSO or LBH-589 on day 1, andassayed for viability as described in the legend to Fig. 2G, in 3 independentexperiments for a total of 28 images per condition.

HDAC Inhibitors Target Osteoblast-AML Interactions

29484 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290 • NUMBER 49 • DECEMBER 4, 2015

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

many required for osteoblast differentiation (20 –26). To deter-mine whether there is an association between PP1� and TAZthat is regulated by Nherf1, we transfected MC3T3 cells on day(�1) with plasmids encoding S-TAZWT and GFP-PP1�WTwith or without a plasmid encoding Nherf1, differentiated thecells on day 0, and isolated S-TAZWT complexes on day 2.Indeed, GFP-PP1� was pulled down on S protein-agarose with S-TAZWT, and this association was enhanced

with increased expression of Nherf1 (Fig. 8A). Consistent withPP1� acting via TAZ to inhibit osteoblast protection of AMLcells, overexpression of PP1�T320A, but not PP1�WT, in dif-ferentiated MC3T3 cells not only inhibited osteoblast protec-tion of AML cells (Fig. 7E) but also significantly increasednuclear localization of TAZ (Fig. 8, B and H) as detected byimmunofluorescence. Additionally, we utilized subcellularfractionation to confirm an increase in nuclear localization of

FIGURE 5. HDACi-induced up-regulation of Nherf1 inhibits osteoblast-mediated protection of AML cells in response to SDF-1. A, MC3T3 cells werecultured as described in the legend to Fig. 2A, and harvested on day 2. “Undifferentiated cells” (Undiff.) were MC3T3 cells that received culture medium Binstead of osteogenic medium on day 0. Nherf1 mRNA transcript levels were assayed via qRT-PCR. The results shown are normalized to the reference geneGapdh. Each bar denotes the fold-increase of mRNA expression compared with undifferentiated cells for three independent experiments. *, denotes signifi-cantly different Nherf1 mRNA transcript levels compared with undifferentiated cells. B, MC3T3 cells were cultured as in A and harvested on day 2 to detectNherf1 protein levels via immunoblotting. The same membrane was stripped and reprobed for �-actin (control), n � 3. C and D, MC3T3 cells were transfectedwith a control siRNA pool, a Nherf1-specific siRNA pool, or Nherf1-specific siRNA #2 on day (�1). The cells were differentiated on day 0 and received DMSO orSAHA on day 1. On day 2, the cells were either harvested to immunoblot for Nherf1 expression (inset) or washed and co-cultured with KG1a-CXCR4 cells for 1 hprior to addition of SDF-1 for 16 –18 h and analysis of apoptosis of KG1a-CXCR4 cells (graph) as described in the legend to Fig. 2C, n � 3. E and F, MC3T3 cellswere transfected with a control plasmid or a plasmid encoding Nherf1 on day (�1). The cells were then differentiated on day 0, and on day 2, the cells were (E)harvested to immunoblot for Nherf1 expression (inset) (E) washed, and utilized for co-culture with KG1a-CXCR4 cells for analysis of apoptosis of KG1a-CXCR4cells (graph) as described in the legend to Fig. 2C, or (F) analyzed for viability as in Fig. 2G, in 3 independent experiments for a total of 26 images per condition.

HDAC Inhibitors Target Osteoblast-AML Interactions

DECEMBER 4, 2015 • VOLUME 290 • NUMBER 49 JOURNAL OF BIOLOGICAL CHEMISTRY 29485

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

TAZ with expression of PP1�T320A compared with PP1�WT(Fig. 8C). In these experiments, TAZ in the nuclear fractionconsisted of multiple bands, likely reflecting posttranslationalmodifications, including phosphorylation at multiple residues,which occurs within the nucleus (20, 26, 35). As shown below(see Fig. 9C), the upper band comigrates with TAZS89A, a formof TAZ that is localized in nuclei and mimics dephosphoryla-tion of TAZ by PP1�. The lower band comigrates with TAZfound in the cytoplasm, likely indicating that this form of TAZwill be exported to the cytoplasm. Fig. 8C shows an increase ofthe band corresponding to TAZS89A in the nuclear fractionwith expression of PP1�T320A compared with PP1�WT, sug-gesting that constitutively active PP1�T320A enhances nuclear

localization of TAZ. Similarly enhanced TAZ nuclear localiza-tion was seen in differentiating MC3T3 osteoblasts followingeither SAHA-induced Nherf1 up-regulation (Fig. 8, D, E, andH) or overexpression of Nherf1 (Fig. 8, F–H), consistent withTAZ acting downstream of both SAHA and Nherf1. Theseresults suggest that Nherf1 up-regulation enhances the abilityof PP1� to drive nuclear localization of TAZ.

Because PP1�T320A overexpression, SAHA pretreatment,and overexpressed Nherf1 all inhibit osteoblast-mediated pro-tection of AML cells, while also driving nuclear localization ofTAZ, we finally asked if localizing TAZ to the nucleus of osteo-blasts is sufficient to inhibit the osteoblast-mediated protectionof AML cells. For this purpose we utilized TAZS89A, a form of

FIGURE 6. Increased Nherf1 expression does not inhibit osteoblast differentiation. A and B, MC3T3 cells were transfected on day (�1) with a control vectoror a plasmid encoding Nherf1 and differentiated on day 0. Cells were either harvested on (A) day 2 or (B) day 7 for analysis via qRT-PCR for mRNA transcript levelsfor the indicated genes. The results shown are normalized to the reference gene Gapdh, where Gapdh is set to 100. Each bar denotes the mean mRNA transcriptlevel for three independent experiments. *, indicates Nherf1-expressing cells are significantly different from vector-transfected cells for the indicate gene, p �0.05.

HDAC Inhibitors Target Osteoblast-AML Interactions

29486 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290 • NUMBER 49 • DECEMBER 4, 2015

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

FIGURE 7. Nherf-1 interacts with PP1�; and the constitutively active form of PP1� inhibits osteoblast-mediated protection of AML cells. A, MC3T3 cellswere differentiated and treated with SAHA as described in the legend to Fig. 2A. On day 2, cells were harvested for immunoprecipitation with a Nherf1 antibodyand analyzed via SDS-PAGE and silver stain. A 36-kDa band was isolated for mass spectrometry, and the indicated peptides were identified as PP1�, PP1�, andPP1�. The green and yellow highlighting indicates common sequences between the three different catalytic subunits, whereas the peptides in white indicateunique sequences to each subunit. B and C, MC3T3 cells were transfected with the indicated plasmids on day (�1). The cells were differentiated on day 0 andharvested on day 2 for immunoprecipitation for PP1�, Nherf1, or the S peptide tag and immunoblotted to reveal copurifying proteins, n � 3. The black lines onthe gel indicate removal of an irrelevant lane from the gel image. D, MC3T3 cells were transfected and cultured as in B and then fixed, permeabilized, stainedwith DAPI to identify nuclei, and visualized via confocal microscopy for analysis of localization of GFP-Nherf1 and GFP-PP1� in reference to the DAPI-stainednuclei, n � 3. E and F, MC3T3 cells were transfected with a vector control or a plasmid encoding either PP1�WT or the constitutively active form of PP1�,PP1�-T320A on day (�1). Cells were differentiated on day 0, and then on day 2 were (E) harvested for immunoblotting for PP1� (inset), (E) washed andco-cultured with KG1a-CXCR4 cells for analysis of apoptosis of KG1a-CXCR4 (graph) as in Fig. 2C, n � 3, or (F) analyzed for viability as described in the legendto Fig. 2G, in 3 independent experiments for a total of 14 images per condition.

HDAC Inhibitors Target Osteoblast-AML Interactions

DECEMBER 4, 2015 • VOLUME 290 • NUMBER 49 JOURNAL OF BIOLOGICAL CHEMISTRY 29487

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

TAZ that cannot be phosphorylated at Ser-89 and thereforeconstitutively localizes to the nucleus (20 –25) as confirmed inFig. 9, A–C. MC3T3 cells expressing TAZS89A were signifi-cantly impaired in their ability to protect AML cells from SDF-1-induced apoptosis as compared with MC3T3 cells expressingeither the vector or wild-type TAZ (TAZWT) (Fig. 9D). Over-expression of either TAZWT or TAZS89A did not inducedeath of MC3T3 cells (Fig. 9E, dead cells: less than 1% forTAZWT and TAZS89A). Together, the results in this articlesupport the model shown in Fig. 10 in which HDACi treatmentof osteoblasts increases their expression of Nherf1, thereby

activating a Nherf1-PP1�-TAZ signaling pathway that impairsosteoblast-mediated protection of AML cells.

Discussion

The AML stem cells that survive chemotherapeutics residein the endosteal region of the bone marrow microenvironment,suggesting that cells of the osteoblast lineage provide protectivesignals that promote the relapse of this disease (6, 7). Muchresearch has therefore focused on identifying and targeting theprotective cellular and molecular mechanisms of this cancermicroenvironment (2, 4 –7, 36). Osteoblast-secreted factors are

FIGURE 8. PP1�-T320A overexpression, SAHA pretreatment, or up-regulation of Nherf1 induces nuclear localization of TAZ. MC3T3 cells were differ-entiated on day 0 either after transfection on day (�1) with the indicated plasmids or before treatment with DMSO or SAHA on day 1 where indicated. A, on day2, the cells were harvested for immunoprecipitation for S-TAZWT and immunoblotted to reveal copurifying proteins, n � 2. B, D, and F, on day 2, the cells werefixed and permeabilized as described in the legend to Fig. 7D, and then stained with anti-TAZ antibody followed by Alexa Fluor 647-labeled anti-mouse IgG,whereas the nuclei were stained with DAPI. Panel H summarizes the results of images acquired in 3– 4 independent experiments for a total of 322–535 cells percondition. Each bar denotes the mean % of cells scoring positive for TAZ nuclear localization per experiment S.E. *, indicates p � 0.05. C, E, and G, on day 2,subcellular fractions were isolated and immunoblotted for the indicated proteins, n � 3.

HDAC Inhibitors Target Osteoblast-AML Interactions

29488 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290 • NUMBER 49 • DECEMBER 4, 2015

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

linked to worse prognosis of AML (37) and provide chemoresis-tance to AML cells (38). Genetic manipulation of cells of theosteoblast lineage in vivo promotes the development of AML (9,39). Furthermore, we previously demonstrated that differenti-ating osteoblasts potently protect AML cells from SDF-1-in-duced apoptosis, a chemokine abundantly expressed in thebone marrow (8). These findings indicate that osteoblasts pro-vide protective signals to AML cells and that disruption of theseprotective signals in combination with standard chemothera-peutics may be required to more completely eliminate AMLcells residing in the bone marrow.

Here, we show that osteoblast-mediated protection of AMLcells can be inhibited by HDACi and identify the molecularmechanisms responsible for this effect. In our co-culturemodel, SDF-1 induces apoptosis of AML cells expressing highlevels of CXCR4 unless these cells are co-cultured with differ-entiating osteoblasts, as previously described (8, 10). HDACiabrogated this osteoblast-mediated protection of AML cells viaup-regulation of Nherf1, which inhibited protection. We addi-

tionally identified PP1� as a novel Nherf1 interacting protein indifferentiating osteoblasts. We showed that enhancing eitherNherf1 expression or PP1� activity in osteoblasts inhibits theosteoblast-mediated protection of co-cultured AML cells bypromoting the nuclear localization of the transcriptional regu-lator TAZ. Moreover, we showed that TAZ nuclear localizationwas sufficient to inhibit osteoblast-mediated protection ofAML cells. Thus, we here describe a novel molecular signalingpathway that is capable of inhibiting the osteoblast-mediatedprotection of AML cells (Fig. 10).

Our results indicate that HDACi target the bone marrowmicroenvironment in addition to directly killing AML cells,which may help explain their efficacy in AML combinationtherapy (11, 13, 14). Disordered epigenetics within AML cellsoriginally suggested that HDACi may be useful for treatingAML (40, 41). HDACi kill AML cell lines and patient samples invitro (42– 44). Yet, HDACi drugs have displayed only limitedefficacy (12, 45, 46). In contrast, combining an HDACi (SAHA)with traditional chemotherapeutics (cytarabine and idarubicin)

FIGURE 9. Increased nuclear localization of TAZ inhibits osteoblast-mediated protection of AML cells. MC3T3 cells were transfected on day (�1) with acontrol vector or a plasmid encoding either TAZWT or the constitutively active, nuclear localized form of TAZ, TAZS89A. On day 2, the cells were (A and B) fixed,stained, and analyzed for TAZ nuclear localization as described in the legend to Fig. 8, B and H; C, fractionated and immunoblotted as described in the legendto Fig. 8C, n � 3; D, co-cultured with KG1a-CXCR4 followed by analysis of apoptosis of KG1a-CXCR4 cells as described in the legend to Fig. 2C, n � 3; or E,analyzed for viability as described in the legend to Fig. 2G, in 3 independent experiments for a total of 14 images per condition.

HDAC Inhibitors Target Osteoblast-AML Interactions

DECEMBER 4, 2015 • VOLUME 290 • NUMBER 49 JOURNAL OF BIOLOGICAL CHEMISTRY 29489

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

followed by maintenance therapy with SAHA produced morefavorable outcomes (40). Our results here suggest that SAHAmay be directly acting on the osteoblasts to inhibit their protec-tion of AML stem cells during induction and maintenancetherapy.

Although promising, HDACi alter expression of thousandsof proteins and the functions of many cellular signaling path-ways. Interestingly, we found that increased expression ofNherf1 alone caused inhibition of osteoblast-mediated protec-tion of AML cells similar to that of HDACi treatment. Addi-tionally, depletion of Nherf1 limited the HDACi-mediatedinhibition of protection. Thus, regulation of Nherf1 expressionappears to play a major role in osteoblast-mediated protectionof AML cells.

Our further studies investigated how Nherf1 affects SDF-1sensitivity. Nherf1 is a scaffold protein that exerts its effects byinteracting with numerous proteins (47, 48). Here, we show forthe first time that Nherf1 interacts with PP1�. PP1 specificityand phosphatase activity are regulated by formation of holoen-zymes with over 200 regulatory proteins that modulate bothPP1� interactions with target proteins and activity (49). Theinteraction between Nherf1 and PP1� may alter PP1� bindingto negative or positive regulatory subunits and thereby facilitatePP1�-mediated TAZ dephosphorylation.

Our results implicating TAZ in the process by which thebone marrow microenvironment mediates protection of leuke-mic cells suggest that other pathways regulating TAZ mightalso be useful drug targets in AML. We show here that nuclearlocalization of TAZ is sufficient to inhibit osteoblast-mediatedprotection of AML cells. TAZ activity is tightly regulated tomaintain development and homeostasis because TAZ regulatesthe proliferation, differentiation, adhesion, and apoptosis ofdiverse cell types (50, 51). Interestingly, TAZ phosphorylationon Ser-89 by the Hippo pathway kinase LATS promotes forma-

tion of a complex between TAZ and 14-3-3 that retains TAZ inthe cytoplasm (20, 26, 52). Thus, LATS kinase inhibitor drugs,currently under development (35, 49 –51, 53) or natural com-pounds (54) shown to promote dephosphorylation of TAZ may,like HDACi, be useful for AML combination therapy. Together,these results indicate novel molecular mechanisms that couldpotentially be targeted in conjunction with standard chemo-therapeutics to improve AML therapy via inhibiting osteoblast-mediated protection of AML cells.

Author Contributions—K. N. K. designed, performed, and analyzedexperiments, and wrote the manuscript with critical input fromA. D., S. H. K., J. J. W., A. J. W., and K. E. H. A. D. performed exper-iments. A. D. H., B. D. S., and J. E. K. obtained patient samples forthese studies and provided critical input on the manuscript.

Acknowledgments—We are grateful for the assistance of the MayoClinic Flow Cytometry Core Facility, the Mayo Medical GenomicsProteomics Core, and the Johns Hopkins Oncology Center SAC Lab;and the diligence of numerous clinical colleagues in providing theAML specimens used in this study.

References1. Tabe, Y., and Konopleva, M. (2014) Advances in understanding the leu-

kaemia microenvironment. Br. J. Haematol. 164, 767–7782. Nwajei, F., and Konopleva, M. (2013) The bone marrow microenviron-

ment as niche retreats for hematopoietic and leukemic stem cells. Adv.Hematol. 2013, 953982

3. Kojima, K., McQueen, T., Chen, Y., Jacamo, R., Konopleva, M., Shinojima,N., Shpall, E., Huang, X., and Andreeff, M. (2011) p53 activation of mes-enchymal stromal cells partially abrogates microenvironment-mediatedresistance to FLT3 inhibition in AML through HIF-1�-mediated down-regulation of CXCL12. Blood 118, 4431– 4439

4. Krause, D. S., Fulzele, K., Catic, A., Sun, C. C., Dombkowski, D., Hurley,M. P., Lezeau, S., Attar, E., Wu, J. Y., Lin, H. Y., Divieti-Pajevic, P., Hasser-jian, R. P., Schipani, E., Van Etten, R. A., and Scadden, D. T. (2013) Differ-

FIGURE 10. Proposed mechanism utilized by HDACi to inhibit osteoblast-mediated protection of AML cells. In an osteoblast undergoing differentiation(cell on left), Nherf1 is expressed at low levels and binds to PP1� to induce dephosphorylation of TAZ, which leads to the limited amount of TAZ nuclearlocalization required for the necessary gene transcription for osteoblast differentiation. In this scenario, the AML cells are protected from SDF-1 and prolifer-ating. Because HDACi affect many genes globally, it is possible that multiple mechanisms contribute to the HDACi-modulated osteoblast-mediated inhibitionof SDF-1-induced leukemia cell apoptosis. In the mechanism studied in detail here, HDACi-mediated increased expression of Nherf1 in differentiating osteo-blasts (cell on right) leads to more Nherf1 binding PP1�, which enhances PP1� dephosphorylation of TAZ and increases TAZ nuclear localization. Higher levelsof nuclear-localized TAZ alters gene transcription within osteoblasts such that the osteoblasts no longer protect the AML cells and the AML cells die in responseto SDF-1 or other chemotherapeutics if present.

HDAC Inhibitors Target Osteoblast-AML Interactions

29490 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290 • NUMBER 49 • DECEMBER 4, 2015

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

ential regulation of myeloid leukemias by the bone marrow microenviron-ment. Nat. Med. 19, 1513–1517

5. Chen, Y., Jacamo, R., Shi, Y. X., Wang, R. Y., Battula, V. L., Konoplev, S.,Strunk, D., Hofmann, N. A., Reinisch, A., Konopleva, M., and Andreeff, M.(2012) Human extramedullary bone marrow in mice: a novel in vivo modelof genetically controlled hematopoietic microenvironment. Blood 119,4971– 4980

6. Ishikawa, F., Yoshida, S., Saito, Y., Hijikata, A., Kitamura, H., Tanaka, S.,Nakamura, R., Tanaka, T., Tomiyama, H., Saito, N., Fukata, M., Miy-amoto, T., Lyons, B., Ohshima, K., Uchida, N., Taniguchi, S., Ohara, O.,Akashi, K., Harada, M., and Shultz, L. D. (2007) Chemotherapy-resistanthuman AML stem cells home to and engraft within the bone-marrowendosteal region. Nat. Biotechnol. 25, 1315–1321

7. Ninomiya, M., Abe, A., Katsumi, A., Xu, J., Ito, M., Arai, F., Suda, T., Ito,M., Kiyoi, H., Kinoshita, T., and Naoe, T. (2007) Homing, proliferation andsurvival sites of human leukemia cells in vivo in immunodeficient mice.Leukemia 21, 136 –142

8. Kremer, K. N., Dudakovic, A., McGee-Lawrence, M. E., Philips, R. L., Hess,A. D., Smith, B. D., van Wijnen, A. J., Karp, J. E., Kaufmann, S. H., West-endorf, J. J., and Hedin, K. E. (2014) Osteoblasts protect AML cells fromSDF-1-induced apoptosis. J. Cell Biochem. 115, 1128 –1137

9. Kode, A., Manavalan, J. S., Mosialou, I., Bhagat, G., Rathinam, C. V., Luo,N., Khiabanian, H., Lee, A., Murty, V. V., Friedman, R., Brum, A., Park, D.,Galili, N., Mukherjee, S., Teruya-Feldstein, J., Raza, A., Rabadan, R., Ber-man, E., and Kousteni, S. (2014) Leukaemogenesis induced by an activat-ing �-catenin mutation in osteoblasts. Nature 506, 240 –244

10. Kremer, K. N., Peterson, K. L., Schneider, P. A., Meng, X. W., Dai, H., Hess,A. D., Smith, B. D., Rodriguez-Ramirez, C., Karp, J. E., Kaufmann, S. H.,and Hedin, K. E. (2013) CXCR4 chemokine receptor signaling inducesapoptosis in acute myeloid leukemia cells via regulation of the Bcl-2 familymembers Bcl-XL, Noxa, and Bak. J. Biol. Chem. 288, 22899 –22914

11. Garcia-Manero, G., Tambaro, F. P., Bekele, N. B., Yang, H., Ravandi, F.,Jabbour, E., Borthakur, G., Kadia, T. M., Konopleva, M. Y., Faderl, S.,Cortes, J. E., Brandt, M., Hu, Y., McCue, D., Newsome, W. M., Pierce, S. R.,de Lima, M., and Kantarjian, H. M. (2012) Phase II trial of vorinostat withidarubicin and cytarabine for patients with newly diagnosed acute my-elogenous leukemia or myelodysplastic syndrome. J. Clin. Oncol. 30,2204 –2210

12. Garcia-Manero, G., Yang, H., Bueso-Ramos, C., Ferrajoli, A., Cortes, J.,Wierda, W. G., Faderl, S., Koller, C., Morris, G., Rosner, G., Loboda, A.,Fantin, V. R., Randolph, S. S., Hardwick, J. S., Reilly, J. F., Chen, C., Ricker,J. L., Secrist, J. P., Richon, V. M., Frankel, S. R., and Kantarjian, H. M. (2008)Phase 1 study of the histone deacetylase inhibitor vorinostat (suberoyla-nilide hydroxamic acid [SAHA]) in patients with advanced leukemias andmyelodysplastic syndromes. Blood 111, 1060 –1066

13. Gojo, I., Tan, M., Fang, H. B., Sadowska, M., Lapidus, R., Baer, M. R.,Carrier, F., Beumer, J. H., Anyang, B. N., Srivastava, R. K., Espinoza-Del-gado, I., and Ross, D. D. (2013) Translational phase I trial of vorinostat(suberoylanilide hydroxamic acid) combined with cytarabine and etopo-side in patients with relapsed, refractory, or high-risk acute myeloid leu-kemia. Clin. Cancer Res. 19, 1838 –1851

14. Kirschbaum, M., Gojo, I., Goldberg, S. L., Bredeson, C., Kujawski, L. A.,Yang, A., Marks, P., Frankel, P., Sun, X., Tosolini, A., Eid, J. E., Lubiniecki,G. M., and Issa, J. P. (2014) A phase 1 clinical trial of vorinostat in combi-nation with decitabine in patients with acute myeloid leukaemia or my-elodysplastic syndrome. Br. J. Haematol. 167, 185–193

15. Dudakovic, A., Camilleri, E. T., Lewallen, E. A., McGee-Lawrence, M. E.,Riester, S. M., Kakar, S., Montecino, M., Stein, G. S., Ryoo, H. M., Dietz,A. B., Westendorf, J. J., and van Wijnen, A. J. (2015) Histone deacetylaseinhibition destabilizes the multi-potent state of uncommitted adipose-derived mesenchymal stromal cells. J. Cell Physiol. 230, 52– 62

16. Dudakovic, A., Evans, J. M., Li, Y., Middha, S., McGee-Lawrence, M. E.,van Wijnen, A. J., and Westendorf, J. J. (2013) Histone deacetylase inhibi-tion promotes osteoblast maturation by altering the histone H4 epig-enome and reduces Akt phosphorylation. J. Biol. Chem. 288, 28783–28791

17. McGee-Lawrence, M. E., McCleary-Wheeler, A. L., Secreto, F. J., Razidlo,D. F., Zhang, M., Stensgard, B. A., Li, X., Stein, G. S., Lian, J. B., andWestendorf, J. J. (2011) Suberoylanilide hydroxamic acid (SAHA; vorinos-

tat) causes bone loss by inhibiting immature osteoblasts. Bone 48,1117–1126

18. Schroeder, T. M., Nair, A. K., Staggs, R., Lamblin, A. F., and Westendorf,J. J. (2007) Gene profile analysis of osteoblast genes differentially regulatedby histone deacetylase inhibitors. BMC Genomics 8, 362

19. Xing, W., Kim, J., Wergedal, J., Chen, S. T., and Mohan, S. (2010) EphrinB1 regulates bone marrow stromal cell differentiation and bone formationby influencing TAZ transactivation via complex formation with NHERF1.Mol. Cell Biol. 30, 711–721

20. Byun, M. R., Hwang, J. H., Kim, A. R., Kim, K. M., Hwang, E. S., Yaffe, M. B.,and Hong, J. H. (2014) Canonical Wnt signalling activates TAZ throughPP1A during osteogenic differentiation. Cell Death Differ. 21, 854 – 863

21. Byun, M. R., Sung, M. K., Kim, A. R., Lee, C. H., Jang, E. J., Jeong, M. G.,Noh, M., Hwang, E. S., and Hong, J. H. (2014) (�)-Epicatechin gallate(ECG) stimulates osteoblast differentiation via Runt-related transcriptionfactor 2 (RUNX2) and transcriptional coactivator with PDZ-binding motif(TAZ)-mediated transcriptional activation. J. Biol. Chem. 289, 9926 –9935

22. Hong, J. H., Hwang, E. S., McManus, M. T., Amsterdam, A., Tian, Y.,Kalmukova, R., Mueller, E., Benjamin, T., Spiegelman, B. M., Sharp, P. A.,Hopkins, N., and Yaffe, M. B. (2005) TAZ, a transcriptional modulator ofmesenchymal stem cell differentiation. Science 309, 1074 –1078

23. Hong, J. H., and Yaffe, M. B. (2006) TAZ: a �-catenin-like molecule thatregulates mesenchymal stem cell differentiation. Cell Cycle 5, 176 –179

24. Kanai, F., Marignani, P. A., Sarbassova, D., Yagi, R., Hall, R. A., Donowitz,M., Hisaminato, A., Fujiwara, T., Ito, Y., Cantley, L. C., and Yaffe, M. B.(2000) TAZ: a novel transcriptional co-activator regulated by interactionswith 14 –3-3 and PDZ domain proteins. EMBO J. 19, 6778 – 6791

25. Liu, C., Huang, W., and Lei, Q. (2011) Regulation and function of the TAZtranscription co-activator. Int. J. Biochem. Mol. Biol. 2, 247–256

26. Liu, C. Y., Lv, X., Li, T., Xu, Y., Zhou, X., Zhao, S., Xiong, Y., Lei, Q. Y., andGuan, K. L. (2011) PP1 cooperates with ASPP2 to dephosphorylate andactivate TAZ. J. Biol. Chem. 286, 5558 –5566

27. Liu, L., Alonso, V., Guo, L., Tourkova, I., Henderson, S. E., Almarza, A. J.,Friedman, P. A., and Blair, H. C. (2012) Na�/H� exchanger regulatoryfactor 1 (NHERF1) directly regulates osteogenesis. J. Biol. Chem. 287,43312– 43321

28. Wang, B., Yang, Y., Liu, L., Blair, H. C., and Friedman, P. A. (2013) NH-ERF1 regulation of PTH-dependent bimodal Pi transport in osteoblasts.Bone 52, 268 –277

29. Hackbarth, J. S., Lee, S. H., Meng, X. W., Vroman, B. T., Kaufmann, S. H.,and Karnitz, L. M. (2004) S-peptide epitope tagging for protein purifica-tion, expression monitoring, and localization in mammalian cells. Bio-Techniques 37, 835– 839

30. Wang, D., Christensen, K., Chawla, K., Xiao, G., Krebsbach, P. H., andFranceschi, R. T. (1999) Isolation and characterization of MC3T3-E1preosteoblast subclones with distinct in vitro and in vivo differentiation/mineralization potential. J. Bone Miner. Res. 14, 893–903

31. Mihara, K., Imai, C., Coustan-Smith, E., Dome, J. S., Dominici, M., Vanin,E., and Campana, D. (2003) Development and functional characterizationof human bone marrow mesenchymal cells immortalized by enforcedexpression of telomerase. Br. J. Haematol. 120, 846 – 849

32. Kumar, A., Humphreys, T. D., Kremer, K. N., Bramati, P. S., Bradfield, L.,Edgar, C. E., and Hedin, K. E. (2006) CXCR4 physically associates with theT cell receptor to signal in T cells. Immunity 25, 213–224

33. Weinman, E. J., Steplock, D., Wade, J. B., and Shenolikar, S. (2001) Ezrinbinding domain-deficient NHERF attenuates cAMP-mediated inhibitionof Na�/H� exchange in OK cells. Am. J. Physiol. Renal Physiol. 281,F374 –380

34. Trinkle-Mulcahy, L., Sleeman, J. E., and Lamond, A. I. (2001) Dynamictargeting of protein phosphatase 1 within the nuclei of living mammaliancells. J. Cell Sci. 114, 4219 – 4228

35. Johnson, R., and Halder, G. (2014) The two faces of Hippo: targeting theHippo pathway for regenerative medicine and cancer treatment. Nat. Rev.Drug Discov. 13, 63–79

36. Konopleva, M., Tabe, Y., Zeng, Z., and Andreeff, M. (2009) Therapeutictargeting of microenvironmental interactions in leukemia: mechanismsand approaches. Drug Resist. Updat. 12, 103–113

37. Liersch, R., Gerss, J., Schliemann, C., Bayer, M., Schwöppe, C., Biermann,

HDAC Inhibitors Target Osteoblast-AML Interactions

DECEMBER 4, 2015 • VOLUME 290 • NUMBER 49 JOURNAL OF BIOLOGICAL CHEMISTRY 29491

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

C., Appelmann, I., Kessler, T., Löwenberg, B., Büchner, T., Hiddemann,W., Müller-Tidow, C., Berdel, W. E., and Mesters, R. (2012) Osteopontinis a prognostic factor for survival of acute myeloid leukemia patients.Blood 119, 5215–5220

38. De Toni, F., Racaud-Sultan, C., Chicanne, G., Mas, V. M., Cariven, C.,Mesange, F., Salles, J. P., Demur, C., Allouche, M., Payrastre, B., Manenti,S., and Ysebaert, L. (2006) A crosstalk between the Wnt and the adhesion-dependent signaling pathways governs the chemosensitivity of acute my-eloid leukemia. Oncogene 25, 3113–3122

39. Raaijmakers, M. H., Mukherjee, S., Guo, S., Zhang, S., Kobayashi, T.,Schoonmaker, J. A., Ebert, B. L., Al-Shahrour, F., Hasserjian, R. P., Scad-den, E. O., Aung, Z., Matza, M., Merkenschlager, M., Lin, C., Rommens,J. M., and Scadden, D. T. (2010) Bone progenitor dysfunction inducesmyelodysplasia and secondary leukaemia. Nature 464, 852– 857

40. Prebet, T., and Vey, N. (2011) Vorinostat in acute myeloid leukemia andmyelodysplastic syndromes. Expert Opin. Investig. Drugs 20, 287–295

41. Garcia-Manero, G. (2012) Can we improve outcomes in patients withacute myelogenous leukemia? Incorporating HDAC inhibitors into front-line therapy. Best Pract. Res. Clin. Haematol. 25, 427– 435

42. Silva, G., Cardoso, B. A., Belo, H., and Almeida, A. M. (2013) Vorinostatinduces apoptosis and differentiation in myeloid malignancies: geneticand molecular mechanisms. PLoS ONE 8, e53766

43. Carew, J. S., Giles, F. J., and Nawrocki, S. T. (2008) Histone deacetylaseinhibitors: mechanisms of cell death and promise in combination cancertherapy. Cancer Lett. 269, 7–17

44. Petruccelli, L. A., Dupéré-Richer, D., Pettersson, F., Retrouvey, H., Skou-likas, S., and Miller, W. H., Jr. (2011) Vorinostat induces reactive oxygenspecies and DNA damage in acute myeloid leukemia cells. PLoS ONE 6,e20987

45. Giles, F., Fischer, T., Cortes, J., Garcia-Manero, G., Beck, J., Ravandi, F.,Masson, E., Rae, P., Laird, G., Sharma, S., Kantarjian, H., Dugan, M., Albi-tar, M., and Bhalla, K. (2006) A phase I study of intravenous LBH589, a

novel cinnamic hydroxamic acid analogue histone deacetylase inhibitor,in patients with refractory hematologic malignancies. Clin. Cancer Res.12, 4628 – 4635

46. Garcia-Manero, G., Assouline, S., Cortes, J., Estrov, Z., Kantarjian, H.,Yang, H., Newsome, W. M., Miller, W. H., Jr., Rousseau, C., Kalita, A.,Bonfils, C., Dubay, M., Patterson, T. A., Li, Z., Besterman, J. M., Reid, G.,Laille, E., Martell, R. E., and Minden, M. (2008) Phase 1 study of the oralisotype specific histone deacetylase inhibitor MGCD0103 in leukemia.Blood 112, 981–989

47. Bretscher, A., Chambers, D., Nguyen, R., and Reczek, D. (2000) ERM-Merlin and EBP50 protein families in plasma membrane organization andfunction. Annu. Rev. Cell Dev. Biol. 16, 113–143

48. Weinman, E. J., Hall, R. A., Friedman, P. A., Liu-Chen, L. Y., and Sheno-likar, S. (2006) The association of NHERF adaptor proteins with G pro-tein-coupled receptors and receptor tyrosine kinases. Annu. Rev. Physiol.68, 491–505

49. Choy, M. S., Page, R., and Peti, W. (2012) Regulation of protein phospha-tase 1 by intrinsically disordered proteins. Biochem. Soc. Trans. 40,969 –974

50. Piccolo, S., Dupont, S., and Cordenonsi, M. (2014) The biology of YAP/TAZ: hippo signaling and beyond. Physiol. Rev. 94, 1287–1312

51. Varelas, X. (2014) The Hippo pathway effectors TAZ and YAP in devel-opment, homeostasis and disease. Development 141, 1614 –1626

52. Lei, Q. Y., Zhang, H., Zhao, B., Zha, Z. Y., Bai, F., Pei, X. H., Zhao, S., Xiong,Y., and Guan, K. L. (2008) TAZ promotes cell proliferation and epithelial-mesenchymal transition and is inhibited by the hippo pathway. Mol. Cell.Biol. 28, 2426 –2436

53. Sun, G., and Irvine, K. D. (2013) Ajuba family proteins link JNK to Hipposignaling. Sci. Signal. 6, ra81

54. Byun, M. R., Jeong, H., Bae, S. J., Kim, A. R., Hwang, E. S., and Hong, J. H.(2012) TAZ is required for the osteogenic and anti-adipogenic activities ofkaempferol. Bone 50, 364 –372

HDAC Inhibitors Target Osteoblast-AML Interactions

29492 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290 • NUMBER 49 • DECEMBER 4, 2015

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

HedinKarp, Scott H. Kaufmann, Jennifer J. Westendorf, Andre J. van Wijnen and Karen E. Kimberly N. Kremer, Amel Dudakovic, Allan D. Hess, B. Douglas Smith, Judith E.

Osteoblasts-TAZ Signaling Pathway inαEnhancing a Nherf1-Protein Phosphatase 1

Histone Deacetylase Inhibitors Target the Leukemic Microenvironment by

doi: 10.1074/jbc.M115.668160 originally published online October 21, 20152015, 290:29478-29492.J. Biol. Chem. 

  10.1074/jbc.M115.668160Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/290/49/29478.full.html#ref-list-1

This article cites 54 references, 21 of which can be accessed free at

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from