Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2011 Herpes simplex virus type 1 (HSV-1) a versatile tool: Live events in the HSV-1 life cycle and applications on gene and protein delivery de Oliveira, A P Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-50606 Dissertation Accepted Version Originally published at: de Oliveira, A P. Herpes simplex virus type 1 (HSV-1) a versatile tool: Live events in the HSV-1 life cycle and applications on gene and protein delivery. 2011, University of Zurich, Faculty of Science.
109
Embed
Herpes simplex virus type 1 (HSV-1) - Zurich Open Repository and
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Zurich Open Repository andArchiveUniversity of ZurichMain LibraryStrickhofstrasse 39CH-8057 Zurichwww.zora.uzh.ch
Year: 2011
Herpes simplex virus type 1 (HSV-1) a versatile tool: Live events in theHSV-1 life cycle and applications on gene and protein delivery
de Oliveira, A P
Posted at the Zurich Open Repository and Archive, University of ZurichZORA URL: https://doi.org/10.5167/uzh-50606DissertationAccepted Version
Originally published at:de Oliveira, A P. Herpes simplex virus type 1 (HSV-1) a versatile tool: Live events in the HSV-1 lifecycle and applications on gene and protein delivery. 2011, University of Zurich, Faculty of Science.
Herpes Simplex Virus Type 1 (HSV-1) a Versatile Tool: Live Events in the HSV-1 Life Cycle
Live Visualization of Herpes Simplex Virus Type 1Compartment Dynamics�†
Anna Paula de Oliveira,1‡ Daniel L. Glauser,1‡ Andrea S. Laimbacher,1 Regina Strasser,1Elisabeth M. Schraner,2 Peter Wild,2 Urs Ziegler,3 Xandra O. Breakefield,4
Mathias Ackermann,1 and Cornel Fraefel1*Institute of Virology,1 Institute of Veterinary Anatomy,2 and Institute of Anatomy,3 University of Zurich, 8057 Zurich,
Switzerland, and Molecular Neurogenetics Unit, Department of Neurology, Massachusetts General Hospital,Harvard Medical School, Boston, Massachusetts4
Received 12 November 2007/Accepted 29 February 2008
We have constructed a recombinant herpes simplex virus type 1 (HSV-1) that simultaneously encodesselected structural proteins from all three virion compartments—capsid, tegument, and envelope—fused withautofluorescent proteins. This triple-fluorescent recombinant, rHSV-RYC, was replication competent, albeitwith delayed kinetics, incorporated the fusion proteins into all three virion compartments, and was comparableto wild-type HSV-1 at the ultrastructural level. The VP26 capsid fusion protein (monomeric red fluorescentprotein [mRFP]-VP26) was first observed throughout the nucleus and later accumulated in viral replicationcompartments. In the course of infection, mRFP-VP26 formed small foci in the periphery of the replicationcompartments that expanded and coalesced over time into much larger foci. The envelope glycoprotein H (gH)fusion protein (enhanced yellow fluorescent protein [EYFP]-gH) was first observed accumulating in a vesicularpattern in the cytoplasm and was then incorporated primarily into the nuclear membrane. The VP16 tegumentfusion protein (VP16-enhanced cyan fluorescent protein [ECFP]) was first observed in a diffuse nuclearpattern and then accumulated in viral replication compartments. In addition, it also formed small foci in theperiphery of the replication compartments which, however, did not colocalize with the small mRFP-VP26 foci.Later, VP16-ECFP was redistributed out of the nucleus into the cytoplasm, where it accumulated in vesicularfoci and in perinuclear clusters reminiscent of the Golgi apparatus. Late in infection, mRFP-VP26, EYFP-gH,and VP16-ECFP were found colocalizing in dots at the plasma membrane, possibly representing matureprogeny virus. In summary, this study provides new insights into the dynamics of compartmentalization andinteraction among capsid, tegument, and envelope proteins. Similar strategies can also be applied to assessother dynamic events in the virus life cycle, such as entry and trafficking.
The herpes simplex virus type 1 (HSV-1) virion consists ofthree different compartments, capsid, tegument, and envelope.The icosahedral capsid has a diameter of 125 nm and containsthe virus genome, a double-stranded DNA of 152 kbp. Thestructural basis of the capsid are the 162 capsomers, whichinclude 150 hexons and 12 pentons (47). The capsomers areconnected in groups of three by a complex formed with twocopies of VP23 and one copy of VP19c (47, 54, 68). The hexonsare composed of six molecules of the major capsid proteinVP5. Eleven of the 12 pentons are composed of five moleculesof VP5, while 1 of the 12, the so-called portal, is a cylindricalstructure of 12 molecules of UL6 (46). Also involved in capsidassembly, but not physical components of the capsids, are thescaffold polypeptides VP22a, VP21, and the serine protease,VP24, which is required for capsid maturation (9, 26, 38, 51).Six copies of VP26, a 12-kDa polypeptide encoded by theUL35 gene, occupy the tips of each hexon and thus decorate
the surface of the capsid (42, 69). Although not essential forvirus replication in tissue culture, VP26 was demonstrated tobe important for infectious virus production in trigeminal gan-glia (12). VP26 is a protein expressed later in the virus repli-cation cycle after the onset of DNA replication and has beendemonstrated to have multiple phosphorylated forms (43).VP26 has been shown to be recruited in an ATP-dependentmanner after pro-capsid formation (8). As it lacks a nuclearlocalization signal (NLS), it must form complexes with NLS-containing proteins, such as VP5 and VP22a, in order to spe-cifically accumulate in the nucleus (52, 60).
The virus capsid is surrounded by an amorphous layer, theso-called tegument. The tegument contains at least 15 virus-encoded proteins in various copy numbers which play impor-tant structural and functional roles during infection (32). Onemajor structural component of the tegument is VP16, a 54-kDaprotein encoded by the UL48 gene (63). Although VP16 is notessential for viral DNA replication, its structural role in thetegument is essential. Recombinants of HSV-1 that lack theUL48 gene show impaired replication, a defect in DNA pack-aging, and the absence of infectious virus progeny (63). VP16is responsible for transcriptional regulation of immediate-early(IE) genes and is also involved in the modulation of the activ-ities of early and late virus genes (7, 48, 49). VP16 has beenshown to coimmunoprecipitate with virion host shutoff protein(55), to cross-link into complexes with gB, gD, and gH (70),
* Corresponding author. Mailing address: Institute of Virology, Uni-versity of Zurich, Winterthurerstrasse 266a, CH-8057 Zurich, Switzer-land. Phone: 41 44 6358713. Fax: 41 44 6358911. E-mail: [email protected].
† Supplemental material for this article may be found at http://jvi.asm.org/.
‡ A.P.O. and D.L.G. contributed equally to the work reported in thisarticle.
� Published ahead of print on 12 March 2008.
4974
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
and to copurify with UL47 (67) and with VP22 (16). Due to itsinvolvement in linking capsid and future envelope-associatedtegument proteins during virion formation, VP16 is absolutelyrequired for assembly of infectious virus (63) and plays essen-tial roles in viral maturation and egress (24, 44).
The tegument is surrounded by the viral envelope, which isa lipid membrane of cellular origin that contains at least 11different viral glycoproteins. The glycoproteins are the majorantigenic determinants for the host-specific recognition, andthey are involved in cell entry, cell-to-cell spread, and immuneevasion. Glycoprotein H, the product of the UL22 gene, is a110-kDa protein which is essential for infectivity (14) andmembrane fusion, but not for receptor binding (22, 25). Gly-coprotein H must be coexpressed with gL in order for bothproteins to be properly processed, folded, and transported tothe virion envelope as well as the infected cell surface (33). ThegH/gL complex plays essential roles in viral penetration, cell-to-cell spread, and syncytium formation (53). Both glycopro-teins are conserved among the herpesviruses, although somedifferences regarding assembly, structure, and intracellulartransport of the heterocomplex exist between individual her-pesviruses (27, 33, 34, 50). Only very recently was it shown thatthe simultaneous deletion of gH and gB results in a severedeficit in nuclear egress leading to the accumulation of virionsin the perinuclear space, whereas the deletion of gH or gBalone did not lead to a significant defect (19). One strategy toinvestigate mechanisms of viral infection, replication, and as-sembly is the fusion of viral proteins with autofluorescent pro-teins (reviewed in reference 5). Many of the HSV-1 proteinshave been shown to maintain their functional activity whenfused with foreign polypeptides. Among these, a green fluo-rescent protein (GFP)-VP26 fusion was demonstrated to beincorporated into intranuclear capsids and mature virions,where it was capable of interacting with VP5 while retaining itsautofluorescence (13). GFP-VP26 retained its biological activ-ity during the replication cycle, as the recombinant virus rep-licated at a rate comparable to that of wild-type (wt) virus (13).A recombinant HSV-1 that expressed VP16 fused to GFP(VP16-GFP) also showed normal replication kinetics and in-corporation of the fusion protein into the virion (35). Similarly,fusion of enhanced yellow fluorescent protein (EYFP) with gHdid not markedly alter gH functions, as the recombinant viruswas replication competent and showed stable autofluorescence(39). The EYFP-gH fusion protein formed a stable heterocom-plex with gL and was incorporated into the virion envelope aswell as cellular membranes (39).
In this study, we have constructed a recombinant HSV-1 thatsimultaneously encodes the VP26 capsid protein fused withmonomeric red fluorescent protein (mRFP), the VP16 tegu-ment protein fused with enhanced cyan fluorescent protein(ECFP), and the gH envelope glycoprotein fused with EYFP.This triple-fluorescent recombinant HSV-1, rHSV-RYC, wasreplication competent and incorporated the autofluorescentfusion proteins into all three virion compartments. Confocallaser scanning microscopy (CLSM) of living infected cells re-vealed new insights into the organization and dynamics ofHSV-1 infection and into the interactions between HSV-1virion proteins. To our knowledge this is the first report of theconstruction and live analysis of a recombinant virus encodingthree different autofluorescent fusion proteins.
MATERIALS AND METHODS
Cell culture and virus. BHK, Vero, and Vero 2-2 cells (56) were maintainedin Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetalbovine serum (FBS). Penicillin G at 100 units/ml, 100 �g/ml streptomycin, and0.25 �g/ml amphotericin B were added to all cell culture media. For culturingVero 2-2 cells, 500 �g/ml G418 was included in addition.
HSV-1 strain F as well as the recombinant viruses were grown, and titers weredetermined in Vero cells.
Construction of recombinant viruses. Recombinant HSV-1 encoding one(rHSV-R or rHSV-48Y), two (rHSV-RYor rHSV-RC), or three (rHSV-RYC orrHSV-RYC/2) different virion proteins fused with autofluorescent proteins weregenerated by homologous recombination in Escherichia coli SW102 and galK
selection/counterselection (62) using a bacterial artificial chromosome (BAC)-cloned HSV-1 strain F genome (pYEbac102; kindly provided by Y. Kawaguchi,Tokyo Medical and Dental University, Japan) (59).
Electroporation and galK positive/negative selection. To prepare electrocom-petent bacteria, 500 �l of an overnight culture of E. coli SW102/YEbac102 wasdiluted in 25 ml LB medium containing 12.5 �g/ml chloramphenicol in a 50-mlconical flask and grown at 32°C. When the optical density at 600 nm reached 0.6,10 ml of the culture was transferred to another 50-ml conical flask and incubatedat 42°C in a shaking water bath. After exactly 15 min, the culture was brieflycooled on ice, transferred into two 15-ml tubes, and pelleted for 5 min at 5,000rpm and 0°C. The supernatant was removed, and the pellet was resuspended in1 ml ice-cold H2O by gently swirling the tube on ice. Then, 9 ml of ice-cold H2Owas added, and the cells were pelleted again; this step was repeated once more.After the second washing and centrifugation step, the supernatant was removed,and the pellet (approximately 50 �l) was kept on ice until electroporated withPCR product (targeting cassettes). In a first step (galK selection), a PCR product(see below) that contained the E. coli galK gene flanked by 50 nucleotides ofsequence homology to either side of the targeting locus on the virus genome(VP26, gH, and VP16) (Fig. 1) was electroporated into 25 �l of electrocompetentE. coli SW102/YEbac102 cells in a 0.1-cm cuvette (Bio-Rad, Hercules, CA) at 25�F, 1.75 kV, and 200 �. After electroporation, the bacteria were grown in 1 mlLB medium for 1 h at 32°C and then washed twice with 1� M9 salts (37 mMNa2HPO4, 22 mM KH2PO4, 19 mM NaCl) as follows: the culture was pelleted at13,000 rpm for 15 s, resuspended in 1� M9 salts, and pelleted again. The washingstep was repeated once more. After the second wash, the supernatant wasremoved and the pellet was resuspended in 1� M9 salts before 100-�l aliquotsof serial dilutions (1:10, 1:100, and 1:1,000) were plated on galactose minimalmedium plates (62) supplemented with 12.5 �g/ml chloramphenicol to selectGal� recombinant colonies. After 2 to 3 days of incubation at 32°C, colonieswere picked and streaked on MacConkey galactose indicator plates to obtainsingle bright pink/red Gal� colonies. One or two of these colonies were pickedto prepare electrocompetent bacteria for the second recombination step, thein-frame introduction of autofluorescent protein-coding sequences into VP26,gH, or VP16 sequences and galK counterselection. For this, electrocompetent E.
coli SW102 cells containing the galK-modified YEbac102 were prepared as de-scribed above and electroporated with PCR products (targeting cassettes; seebelow) containing coding sequences of autofluorescent proteins flanked by thesame 50 nucleotides present on the galK PCR product that target the DNA tohomologous sequences in the virus genome (VP26, gH, and VP16). After elec-troporation, the bacteria were recovered in 10 ml LB medium for 4.5 h at 32°Cand washed twice with 1� M9 salts, and serial dilutions were plated on minimalmedium plates containing glycerol as carbon source, leucine, biotin, and 2-deoxy-galactose (DOG; Acros Organics, Geel, Belgium) for selection against galK (62).After 3 days of incubation at 32°C, colonies were picked, and BAC DNA wasisolated and characterized by restriction endonuclease and Southern analysis.
PCR amplification and purification of targeting cassettes. Phusion polymer-ase (Finnzymes, Espoo, Finland) and the following primers were used to amplifythe targeting cassettes: (i) mRFP-VP26 fusion, galK selection, ul35-galK-fw, 5�-ACAGCCCTCCCGACCGACACCCCCATATCGCTTCCCGACCTCCGGTCCCG CCTGTTGACAATTAATCATCGGCA-3�, and ul35-galK-rev, 5�-CCAAGCGCCCGGACGCTATCGGTGGTAACGGTGCTGGGGCGGTGAAATTGTCA
GCACTGTCCTGCTCCTT-3�; mRFP-VP26 fusion, galK counterselection, ul35-rfp-fw, 5�-ACAGCCCTCCCGACCGACACCCCCATATCGCTTCCCGACCTCCGGTCCCGATGGCCTCCTCCGAGGACGTC-3�, and ul35-rfp-rev, 5�-CCAAGCGCCCGGACGCTATCGGTGGTAACGGTGCTGGGGCGGTGAAATTGGGC
GCCGGTGGAGTGGCGGCC-3�; (ii) EYFP-gH fusion, galK selection, UL22-galK-fw, 5�-GTTATTATTTTGGGCGCTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGCCTGTTGACAATTAATCATCGGCA-3�, and UL22-galK-rev,5�-CGTGTCGCGCCAGTACATGCGGTCCATGCCCAGGCCATCCAAAAACCATGGTCAGCACTGTCCTGCTCCTT-3�; EYFP-gH fusion, galK counterselec-
VOL. 82, 2008 MULTIFLUORESCENCE LIVE ANALYSIS OF HSV REPLICATION 4975
CGGCA-3�, and UL48-galK-rev, 5�-GGTGACGGGAGGGGAAAACCCAGACGGGGGATGCGGGTCCGGTCGCGCCCCTCAGCACTGTCCTGCTCCTT-3�; VP16-ECFP/EYFP fusion, galK counterselection, UL48-ECFP-fw, 5�-TTCGAGTTTGAGCAGATGTTTACCGATGCCCTTGGAATTGACGAGTACGGTGTGAGCA
AGGGCGAGGAGCTGTTC-3�, and UL48-ECFP-rev, 5�-GGTGACGGGAGGGGAAAACCCAGACGGGGGATGCGGGTCCGGTCGCGCCCCTTACTTG
TACAGCTCGTCCATGCC-3�. Sequence portions shown in italics are homolo-gous to the galK gene. The following plasmids (10 ng) were used as templates:pgalK for all galK selection/targeting cassettes (obtained from S. Warming,
National Cancer Institute, Frederick, MD) (62), pcDNA-mRFP-N1 (obtainedfrom U. F. Greber, University of Zurich, Zurich, Switzerland) for the VP26-mRFP targeting cassette, and pECFP-N1 and pEYFP-N1 for amplification ofVP16-ECFP/EYFP and gH-EYFP targeting cassettes, respectively. The PCRconditions were as follows: 94°C for 15 s, 60°C for 30 s, and 72°C for 1 min, for30 cycles. After completion of the reaction, DpnI (10 U; New England Biolabs,Allschwil, Switzerland) was added for digestion of the template for 2 h. TheDpnI-digested reaction mix was run on a 1% agarose gel, and the PCR productwas purified using a QIAQuick PCR purification kit (Qiagen, Hombrechtikon,Switzerland) followed by ethanol precipitation. The DNA was resuspended in 40�l H2O, and an aliquot of 2 to 5 �l (10 to 30 ng) was used for electroporation.
Excision of BAC sequences and isolation of recombinant HSV-1. To excise theBAC DNA backbone and isolate recombinant viruses, 1.2 � 106 Vero 2-2 cells(56) per 6-cm tissue culture plate were cotransfected with 0.2 �g of plasmid p116,which expresses Cre recombinase with an NLS (kindly provided by K. Tobler,University of Zurich, Zurich, Switzerland), and 2 �g of CsCl gradient-purifiedrecombinant HSV-1 BAC DNA using Lipofectamine (Invitrogen). After 2 to 3days of incubation at 37°C, the supernatant was harvested and plaque purifiedtwice, and the excision of the BAC sequences was verified by PCR.
Virus replication assays. For the determination of growth kinetics, Vero cellswere inoculated at a multiplicity of infection (MOI) of 0.1 or 5 PFU per cell.After 2 h of incubation at 37°C, 5% CO2, the cultures were washed three timeswith PBS and then incubated with DMEM containing 2% FBS. Samples (cellculture medium and cells) were removed after 0, 12, 24, 36, and 48 h. The cellculture medium was removed from the cells and serially diluted to determine thetiters on Vero cells. The titers of cell-associated virus were determined on Verocells inoculated with serial dilutions of supernatants of cells prepared by threecycles of freezing and thawing, followed by centrifugation at 1,900 � g.
Determination of particle/PFU ratios. To determine the particle counts, virusstocks with known titers (PFU/ml) were mixed with 204-nm-diameter latex beads(Agar Scientific, Essex, United Kingdom) of known concentration, adsorbedonto 300-mesh parlodion- and carbon-coated copper electron microscope gridsfor 5 min at room temperature (RT), briefly washed with H2O, and negativelystained with 2% sodium phosphotungstate, pH 7.4, for 1 min at RT. Sampleswere examined in a transmission electron microscope (CM12; Philips, Eind-hoven, The Netherlands), and the relative numbers of virus particles and latexbeads were determined, which allowed us to calculate the absolute numbers ofvirus particles in the virus stocks.
Purification of virions. Virions were purified from BHK or Vero cells infectedat an MOI of 0.1 PFU with either wt HSV-1, rHSV-RYC, or rHSV-RYC/2.When the cytopathic effect (CPE) was complete, the cultures were frozen andthawed three times, and cell debris was removed by centrifugation for 10 min at2,600 � g and 4°C. Virions were purified through 60%, 30%, and 10% sucrose (inPBS) gradients in Beckman Ultra-Clear 25- by 89-mm centrifuge tubes, whichwere centrifuged for 2 h at 28,000 rpm and 4°C using a Beckman SW28 rotor.The interface between the 30% and 60% sucrose layers was collected, diluted inPBS, and ultracentrifuged for 1 h at 25,000 rpm and 4°C. Following resuspensionof the pellet in Hanks’ buffered saline solution, the virion stocks were frozen ina dry ice-ethanol bath and stored at �80°C.
Immunoprecipitation, SDS-PAGE, Western analysis, and silver staining.
Vero cells (4 � 105 cells per well in a 12-well plate) were mock infected orinfected with either wt HSV-1, rHSV-RY, rHSV-RYC, or rHSV-RYC/2 at anMOI of 1 PFU. When CPE was almost complete (between 24 and 48 h postin-fection [p.i.]), the cells were washed with cold PBS and prepared for immuno-precipitation or directly lysed with sodium dodecyl sulfate (SDS) loading buffer,boiled for 5 min, and analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting using the antibodies listed below. For immuno-precipitation, the cells were lysed with 200 �l of EBC170 lysis buffer (50 mM TrispH 8.0, 170 mM NaCl, 0.5% NP-40) supplemented with one tablet of proteaseinhibitor cocktail (Complete, mini, EDTA-free; Roche Diagnostics, Rotkreuz,Switzerland) per 10 ml. The cell extract was collected and immunoprecipitatedwith the gH-specific monoclonal antibody (MAb) LP11 (kindly provided by A.Minson and H. Browne, University of Cambridge, United Kingdom) (6) diluted1:30 in EBC170. After 1 h at 4°C, complexes were allowed to attach to proteinA-Sepharose beads. After washing the beads four times with EBC170 buffer, theLP11 MAb complexes were eluted from the beads by adding SDS loading buffer.The samples were boiled for 5 min, and proteins were separated by SDS-PAGEand transferred onto nylon membranes (Protran; Whatman, Bottmingen, Swit-zerland). Nonspecific reactions were blocked by incubating the membranes for1 h with PBS containing 5% skimmed milk and 0.3% Tween 20. Membranes werethen incubated for 1 h with antibodies against VP26 (rabbit polyclonal antibody[PAb] diluted 1:1,000 in PBS, 0.3% Tween 20 [PBS-T]; kindly provided by A.Helenius, ETH Zurich, Switzerland), VP16 (MAb LP1, diluted 1:500 in PBS-T;
FIG. 1. Construction of rHSV-RYC. (A) Representation of theHSV-1 BAC (YEbac102) genome structure, showing the region con-taining the UL35 gene. The galK expression cassette was inserted intothe UL35 gene through homologous recombination (HR) and selec-tion for Gal� recombinants (rHSVBAC35galK). GalK was then re-placed by mRFP coding sequences by HR and counterselected forGal� recombinants (rHSVBAC35R). The same procedure was usedfor the fusion of EYFP with the UL22 gene on the rHSVBAC35Rgenome (B) and for the fusion of ECFP with the UL48 gene on rHSVBAC35R22Y (C). The BAC sequences were removed by the Cre/loxPrecombination system (Cre), resulting in the recombinants HSV-1rHSV-R, rHSV-RY, and rHSV-RYC. TRL, terminal repeat of thelong segment; UL, unique long segment; IRL, internal repeat of thelong segment; IRS, internal repeat of the short segment; US, uniqueshort segment; TRS, terminal repeat of the short segment.
4976 DE OLIVEIRA ET AL. J. VIROL.
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
kindly provided by A. Minson and H. Browne, University of Cambridge, UnitedKingdom) (41), GFP (MAb JL-8BD, diluted 1:8,000 in PBS-T; Clontech, Saint-Germain-en-Laye, France), ICP4 (MAb, diluted 1:10,000 in PBS-T; AdvancedBiotechnologies, Columbia, MD), ICP8 (MAb clone 10A3, diluted 1:10,000 inPBS-T; Abcam, Cambridge, United Kingdom), and VP22 (rabbit PAb AGV031,diluted 1:10,000 in PBS-T; kindly provided by G. Elliott, Marie Curie ResearchInstitute, Oxted, United Kingdom). After washing, the membranes were incu-bated with rabbit anti-mouse immunoglobulin G (IgG)–horseradish peroxidase(HRP) (1:10,000 in PBS-T; Sigma-Aldrich, Buchs, Switzerland) or goat anti-rabbit IgG–HRP (1:10,000 in PBS-T; Sigma-Aldrich, Buchs, Switzerland). Targetproteins were visualized by enhanced chemiluminescence (ECL Western blottinganalysis system; GE Healthcare, Zurich, Switzerland) and autoradiography(Lumi-film chemiluminescent detection film; Roche Diagnostics, Rotkreuz, Swit-zerland). A molecular weight standard (BenchMark prestained ladder; GIBCO,Invitrogen, Basel, Switzerland) was used to determine the sizes of the proteinbands. Silver staining of gels was performed using the Bio-Rad silver stain kit(Bio-Rad, Hercules, CA) according to the manufacturer’s manual.
CLSM. CLSM was performed on a Leica TCS SP2 AOBS confocal laserscanning microscope (Leica Microsystems, Wetzlar, Germany) equipped with anincubation chamber (THE BOX; Live Imaging Services, Reinach, Switzerland),a temperature control device (THE CUBE; Live Imaging Services, Reinach,Switzerland), and a gas mixer (THE BRICK; Live Imaging Services, Reinach,Switzerland). The settings for the individual fluorophores were as follows: 4�,6-diamidine-2�-phenylindole (DAPI), excitation at 405 nm and recording at 415 to480 nm; ECFP, excitation at 458 nm and recording at 468 to 510 nm; fluoresceinisothiocyanate (FITC), excitation at 488 nm and recording at 498 to 570 nm;EYFP, excitation at 514 nm and recording at 520 to 550 nm; mRFP/Atto590/Alexa Fluor 594 (AF594), excitation at 594 nm and recording at 604 to 700 nm.In order to avoid channel overlap, blue and red channels were recorded simul-taneously while the yellow/green channels were recorded separately. The imagesshown in Fig. 7 and 8, below, were deconvolved with a blind deconvolutionalgorithm using the Huygens Essential 2.6.0p1 software (Scientific Volume Im-aging, Hilversum, The Netherlands). Image processing was done with Imaris5.0.1 (Bitplane AG, Zurich, Switzerland) and Adobe Photoshop CS 8.0.1 soft-ware. The detailed procedures were as follows.
(i) High-resolution CLSM of live or fixed, infected cells. Vero cells wereseeded on Lab-Tek four-well chambered coverglasses (Nalge Nunc Interna-tional, Rochester, NY) at 105 cells/well. On the following day, the cells werewashed once with cold (4°C) DMEM and incubated for 15 min at 4°C, and theDMEM was replaced with cold (4°C) virus inoculum at the MOIs described inthe figure legends. The viruses were then allowed to adsorb to the cells for 1 hat 4°C with gentle shaking. Subsequently, the virus inoculum was replaced withwarm (37°C) Iscove’s modified Dulbecco’s medium (GIBCO, Invitrogen, Basel,Switzerland) supplemented with 25 mM HEPES and 2% FBS, and the cells wereincubated at 37°C, 5% CO2. At the indicated times after infection (temperatureshift), live cells were observed by CLSM in a humidified atmosphere at 37°C,5%CO2. Where mentioned in the text below, the cells were fixed with 3.7%formaldehyde in PBS for 15 min at RT prior to microscopy.
(ii) Time-lapse CLSM of live, infected cells. Vero cells were seeded into35-mm glass-bottom dishes (MatTek, Ashland, MA) at 5 � 105 cells/dish. On thefollowing day, the cells were infected with rHSV-RY or rHSV-RYC diluted inDMEM at the MOIs described in the text below. The viruses were allowed toadsorb for 2 h at 37°C, 5% CO2. The cells were then washed with PBS, overlaidwith Iscove’s modified Dulbecco’s medium supplemented with 25 mM HEPESand 2% FBS, and incubated at 37°C, 5% CO2. At the indicated time, live cellswere observed by CLSM in a humid atmosphere at 37°C, 5% CO2. Images wererecorded at intervals of 15 to 25 min.
Immunofluorescence. Vero cells were seeded on round 12-mm coverglasses in24-well plates at 105 cells/well. On the following day, the cells were washed withPBS and infected with wt HSV-1 or rHSV-RY diluted in DMEM at the MOIsdescribed in the figure legends. The viruses were allowed to adsorb for 1 to 2 hat 37°C, 5% CO2. The cells were then washed with PBS, overlaid with DMEMsupplemented with 2% FBS, and incubated at 37°C, 5% CO2. At the indicatedtime points, the cells were washed once with cold PBS and fixed with 3.7%formaldehyde in PBS for 15 min at RT, and the fixation was stopped with 0.1 Mglycine in PBS for 5 min at RT. Immunofluorescence staining, DAPI staining,and embedding of cells were performed as described previously (29) except thatthe cells were permeabilized with 0.2% Triton X-100 in PBS for 15 min at RTand that 0.2 mg/ml human IgG (Sigma-Aldrich, Buchs, Switzerland) was in-cluded in the blocking solution when cells were stained with antibodies of rabbitorigin. Primary antibodies were used at the following dilutions: anti-HSV-1 ICP8MAb 7381 (kindly provided by R. D. Everett, MRC Virology Unit, Glasgow,United Kingdom), 1:500 (see Fig. 6C, below) or 1:1,000 (see Fig. 6D, below);
anti-HSV-1 gH MAb LP11, 1:3; anti-HSV-1 VP16 MAb LP1, 1:3 (see Fig. 8A,below) or 1:200 (see Fig. 8D, below); rabbit anti-HSV-1 VP26 PAb VP26/C(kindly provided by P. Desai, Johns Hopkins University, Baltimore, MD) (12),1:400. Secondary antibodies were used as follows: F(ab�)2 fragment of goatanti-rabbit IgG(H�L)–AF594 (Molecular Probes, Invitrogen, Basel, Switzer-land), 1:200; goat anti-rabbit IgG(H�L)–FITC (Southern Biotechnology, Bir-mingham, AL), 1:100; goat anti-mouse IgG(H�L)–AF594 (Molecular Probes,Invitrogen, Basel, Switzerland), 1:200; Fab fragment of goat anti-mouseIgG(H�L)–FITC (Jackson ImmunoResearch, West Grove, PA), 1:100.
FISH. Infection with wt HSV-1 and immunofluorescence staining for VP26were performed as described above. Fluorescent in situ hybridization (FISH) wasperformed as described previously (18) with the following modifications: (i) cellswere fixed with precooled methanol for 10 min at �20°C; (ii) immunofluores-cence staining was performed before the hybridization step; (iii) fluorescentlabeling of BAC-cloned HSV-1 DNA (YEbac102) was performed with anAtto590 nick translation labeling kit according to the manufacturer’s manual(Jena Bioscience, Jena, Germany).
Electron microscopy. Vero cells were grown on sapphire disks for 2 days priorto infection with rHSV-RYC. After 24 h, cells were fixed with 0.25% glutaral-dehyde for 30 min and then frozen in a high-pressure freezer (HPM010; BAL-TEC Inc., Balzers, Liechtenstein) as previously described (37). The sapphiredisks carrying the frozen cells were transferred into a freeze-substitution unit (FS7500; Boeckeler Instruments, Tucson, AZ) precooled to �88°C for substitutionwith acetone and subsequent fixation with 0.25% glutaraldehyde and 0.5%osmium tetroxide at temperatures between �30°C and �2°C as previously de-scribed in detail (64) and embedded in Epon at 4°C. Sections of 50 to 60 nm wereanalyzed in a transmission electron microscope (CM12; Philips, Eindhoven, TheNetherlands) equipped with a slow-scan charge-coupled-device camera (Gatan,Pleasanton, CA) at an acceleration voltage of 100 kV.
RESULTS
Construction of a recombinant HSV-1 encoding mRFP-
VP26, VP16-ECFP, and EYFP-gH fusion proteins. The goal ofthis study was to construct and characterize a recombinantHSV-1 that simultaneously encodes selected structural pro-teins from all three virion compartments fused with autofluo-rescent proteins, in particular, capsid protein VP26 fused withmRFP, tegument protein VP16 fused with ECFP, and enve-lope glycoprotein H fused with EYFP. This triple-fluorescentrecombinant HSV-1 was constructed via homologous recom-bination in E. coli using a BAC-cloned HSV-1 strain F genome(pYEbac102) (59) and the galK positive/negative selectionmethod (62) as described in Materials and Methods. Briefly, ina first step, a DNA fragment containing the galK expressioncassette flanked by homology arms that target the cassettebetween codons 1 and 5 of the VP26 coding sequences waselectroporated into E. coli SW102 cells that contained thepYEbac102 HSV-1 BAC DNA. Gal-positive recombinant bac-teria were selected on galactose minimal medium plates. BACDNA prepared from these clones was characterized by restric-tion endonuclease analysis (not shown), and one clone(rHSVBAC35galK) was selected for the second recombinationstep. For the second step, the galK expression cassette wasreplaced by electroporating a DNA fragment containing themRFP expression cassette, again flanked by the homologyarms that facilitate the in-frame insertion of mRFP codingsequences between codons 1 and 5 of the VP26 coding se-quences, into E. coli SW102/rHSVBAC35galK. After galK
counterselection with DOG, Gal-negative colonies werepicked, BAC DNA was prepared and characterized by restric-tion endonuclease analysis (not shown), and one clone (rHSVBAC35R; Fig. 1A) was selected for further manipulation. Thesubsequent fusion of gH with EYFP (rHSVBAC35R22Y; Fig.1B) and VP16 with ECFP (rHSVBAC35R22Y48C; Fig. 1C)
VOL. 82, 2008 MULTIFLUORESCENCE LIVE ANALYSIS OF HSV REPLICATION 4977
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
was performed using the same galK positive/negative selectionprocedure described above and in Materials and Methods. Thefinal recombinant, rHSVBAC35R22Y48C, contained codons 1to 225 of mRFP fused to codons 5 to 108 of VP26, codons 2 to239 of EYFP inserted between codons 6 and 9 of gH, andcodons 1 to 489 of VP16 fused to codons 2 to 239 of ECFP.Two additional recombinant HSV-1 BACs were constructedthat contained either codons 1 to 489 of VP16 fused to codons2 to 239 of EYFP (rHSVBAC48Y) or codons 1 to 225 ofmRFP fused to codons 5 to 108 of VP26 and codons 1 to 489of VP16 fused to codons 2 to 239 of ECFP (rHSVBAC35R48C). A second triple-fluorescent recombinant HSV BAC,rHSVBAC35R22Y48C/2, was created by introducing codons 2to 239 of EYFP between codons 6 and 9 of gH in rHSVBAC35R48C. The two triple-fluorescent HSV BACs, rHSVBAC35R22Y48C and rHSVBAC35R22Y48C/2, encode the samefusion proteins, but these were inserted in different orders. Toconfirm that the recombinations had occurred as expected,BAC DNA was analyzed by restriction endonuclease digestionand Southern blot analysis (not shown). Finally, to rescue re-combinant viruses and release the virus genome from the BACbackbone, recombinant HSV-1 BAC DNA was cotransfectedwith a Cre recombinase-expressing plasmid, p116, into mam-malian cells (Fig. 1). Progeny virus was harvested after 2 to 3days and plaque purified twice, and the excision of the BAC
sequences was confirmed by PCR analysis (not shown). Therecombinant viruses constructed and used in this study weredesignated as follows: rHSV-R (mRFP-VP26), rHSV-48Y(VP16-EYFP), rHSV-RY (mRFP-VP26 and EYFP-gH),rHSV-RC (mRFP-VP26 and VP16-ECFP), rHSV-RYC (mRFP-VP26, EYFP-gH, and VP16-ECFP), and rHSV-RYC/2 (mRFP-VP26, EYFP-gH, and VP16-ECFP). The two triple-fluorescentrecombinants, rHSV-RYC and rHSV-RYC/2, produced compa-rable titers and showed identical patterns of fluorescence in in-fected cells (not shown).
Synthesis of autofluorescent fusion proteins in infected
cells. To verify that the recombinant viruses expressed the fluo-rescent fusion proteins, Vero cells were mock infected or infectedwith either wt HSV-1, rHSV-RY, or rHSV-RYC at an MOI of 1PFU per cell. When the CPE was approximately 90%, cells wereharvested and analyzed. The 90% CPE was reached approxi-mately 24 h p.i. for the wt virus and 48 h p.i. for the recombinantvirus, consistent with delayed replication kinetics of the recombi-nant viruses (see Fig. 3, below). Western blotting with a rabbitanti-VP26 PAb (kindly provided by A. Helenius, ETH, Zurich,Switzerland) detected the 12-kDa VP26 protein from wt HSV-1-infected cell lysates. In the lysates of rHSV-RY- or rHSV-RYC-infected cells, the 12-kDa VP26 was not detected but was re-placed with a band of approximately 50 kDa, which correspondsto the size expected for the mRFP-VP26 fusion protein (Fig. 2A).
FIG. 2. Expression of fluorescent fusion proteins in infected cells. Vero cells were mock infected (m) or infected with either wt HSV-1 (wt),rHSV-RY (RY), rHSV-RYC (RYC), or rHSV-RYC/2 (RYC/2) at an MOI of 1 PFU and harvested when the CPE was approximately 90%. Celllysates were analyzed by SDS-PAGE followed by Western blotting with antibodies against VP26 (A), VP16 (B), GFP (C), ICP4 (F), and ICP8 (G).For detection of gH and EYFP-gH, cell lysates were immunoprecipitated with a gH-specific antibody followed by SDS-PAGE and silver staining(D) or Western blotting with a GFP-specific antibody (E). Arrows indicate the mRFP-VP26, VP16-ECFP, and EYFP-gH fusion proteins, as wellas the wt VP26, VP16, gH, ICP4, and ICP8 proteins. The arrowheads in panels D and E point to a band that likely represents the EYFP-gHprecursor. Sizes of molecular weight standards are indicated.
4978 DE OLIVEIRA ET AL. J. VIROL.
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
The band intensity of the wt 12-kDa VP26 protein was consis-tently weaker than that of the 50-kDa mRFP-VP26 fusion pro-tein. The reason for this might be that the relatively small VP26protein adsorbed less well to the nitrocellulose membrane thanthe larger fusion protein.
Western blotting with the anti-VP16 MAb LP1 (41) detectedthe VP16 protein in lysates of cells infected with either wtHSV-1 or rHSV-RY. In rHSV-RYC-infected cell lysates, how-ever, the native VP16 was replaced by a band of approximately100 kDa, which was also detected by the GFP-specific MAbJL-8BD (Fig. 2B and C). As the GFP-specific antibody reactsnot only with GFP and ECFP but also with EYFP, a band ofapproximately 140 kDa was visible in both rHSV-RY- andrHSV-RYC-infected cell lysates which represented theEYFP-gH fusion protein (Fig. 2C, left panel). Of note is thatthe levels of the EYFP-gH fusion protein appeared to behigher in rHSV-RY- than in rHSV-RYC-infected cells. Wetherefore compared the EYFP-gH expression level of rHSV-RYC to that of the independently constructed triple-labeledvirus, rHSV-RYC/2, as well as to rHSV-RY. As shown in Fig.2C (right panel), the ratios between EYFP-gH and VP16-ECFP were comparable for both triple-labeled viruses. In ad-dition, in this experiment, the total amounts of EYFP-gH ap-peared similar for the double- and triple-labeled viruses. Thereason for the fairly low levels of EYFP-gH detected in someexperiments therefore appears to be due to variations in theefficiency of infection between different experiments, ratherthan due to an inherent inability of the triple-colored viruses toexpress normal amounts of EYFP-gH.
To compare the expression levels of gH from wt HSV-1 andthose of EYFP-gH from the recombinant viruses, cell lysateswere immunoprecipitated with the gH-specific MAb LP11 (6),which binds to a conformational epitope of gH, followed bySDS-PAGE and silver staining of the gel (Fig. 2D). A bandcorresponding to the molecular mass of gH (110 kDa) wasvisible for wt HSV-1 but was replaced with bands correspond-ing to the molecular mass of EYFP-gH (140 kDa) in thesamples of the recombinant viruses. The levels of gH appearedto be higher for wt HSV-1 and for rHSV-RY than for rHSV-RYC. To confirm expression of the EYFP-gH fusion protein,lysates were first immunoprecipitated with the gH-specificMAb LP11 and then analyzed by SDS-PAGE and Westernblotting. The GFP-specific antibody detected the approxi-mately 140-kDa EYFP-gH fusion protein in both rHSV-RY-and rHSV-RYC-infected cell lysates (Fig. 2E). Of note is thatthe levels of EYFP-gH were similar in this setting. Interest-ingly, in rHSV-RY-infected cell lysates but not in rHSV-RYC-infected cell lysates, a slightly smaller band was also visible,which likely represents the EYFP-gH precursor (30) (Fig. 2E).The accumulation of the EYFP-gH precursor might be a con-sequence of the higher total levels of EYFP-gH of rHSV-RYresulting in incomplete processing of the precursor, while thelower EYFP-gH levels expressed by rHSV-RYC may be com-pletely processed into the mature form. The GFP-specific an-tibody also detected the VP16-ECFP fusion protein in rHSV-RYC-infected and LP11-immunoprecipitated cell lysates (Fig.2E), which is consistent with an earlier finding that gH cancoimmunoprecipitate with VP16 (31). An alternative explana-tion, however, could be that VP16-ECFP and EYFP-gH coim-
munoprecipitate because GFP-derived proteins can undergoweak dimerization (57, 65, 66).
We also compared the accumulation of the HSV-1 IE pro-tein ICP4 and the early protein ICP8 among wt HSV-1 and therecombinants. While ICP4 (Fig. 2F) accumulated to compara-ble levels in cells infected with either wt HSV-1, rHSV-RY, orrHSV-RYC, the levels of ICP8 (Fig. 2G) were reduced in cellsinfected with the recombinant viruses. In conclusion, theseresults demonstrated that the fusion proteins mRFP-VP26,VP16-ECFP, and EYFP-gH were expressed in infected cellswith ongoing compromised levels of gene expression.
Growth kinetics of autofluorescent recombinant HSV-1. Weassessed the growth properties of recombinants that expressedthe mRFP-VP26 fusion alone or coexpressed two or three ofthe fusion proteins. In the first set of experiments, Vero cellswere infected at a low MOI (0.1 PFU) with either wt HSV-1,rHSV-R, rHSV-48Y, rHSV-RY, rHSV-RC, or rHSV-RYC,and cultures were harvested at 12, 24, 36, and 48 h p.i. asdescribed in Materials and Methods. Virus yields in both cellculture supernatant (Fig. 3A) and cells (Fig. 3B) were titratedseparately (PFU/ml). The growth properties of the recombi-nant viruses compared to wt HSV-1 can be summarized asfollows: (i) the kinetics of virus release was delayed for recom-binants rHSV-RY and rHSV-RYC, while all the other recom-binants showed kinetics similar to that of wt HSV-1 (Fig. 3A);(ii) in the supernatant, the final titers of the recombinantviruses were reduced 2.6-fold (rHSV48Y) to 40-fold (rHSV-RYC) at 48 h p.i; (iii) in the cell pellet, the final titers of therecombinant viruses were reduced 7.7-fold (rHSV-RY) to 62-fold (rHSV-RC) at 48 h p.i. While it appeared that the fusionof EYFP to gH contributed to the delayed kinetics of virionrelease of rHSV-RY and rHSV-RYC (Fig. 3A), the contribu-tion of the individual fusions to the reduced final titers was lessobvious; specifically, the fusion of EYFP to VP16 alone(rHSV-48Y) had the weakest effect on the final titers, and allother recombinants, whether single, double, or triple labeled,showed similar final titers in the supernatants (Fig. 3A).
In a second set of experiments, we compared the growthproperties of rHSV-RYC and wt HSV-1 at a high MOI (5PFU) (Fig. 3C and D). Under these conditions, the growthdeficit of the triple-labeled recombinant was less pronounced.Although the delayed kinetics of virus production was stillobserved, the final titers at 48 h p.i. differed only by a factor of5.8 in the supernatant and a factor of 5.6 in the pellet. Thesefindings suggest that the growth deficit of rHSV-RYC can bepartially overcome by infection at high MOI, which obviatesthe need for efficient cell-to-cell spread.
To further characterize the growth properties of the recom-binant viruses, we determined the particle/PFU ratios of tworecombinants, rHSV-RY and rHSV-RYC, as well as wtHSV-1. We observed particle/PFU ratios of 68 � 49 (mean �
standard deviation) for rHSV-RY, 26 � 19 for rHSV-RYC,and 1.3 � 0.9 for wt HSV-1, indicating that the recombinantviruses were on average 20- to 50-fold less infectious than thewt virus, a finding which at least partially explains the reducedtiters in the recombinant virus stocks.
In summary, the recombinant viruses showed reduced titersboth in the supernatant as well as in the pellet, with morepronounced reductions at low than at high MOI. While thefusion of EYFP to gH seemed to contribute to a delay in the
VOL. 82, 2008 MULTIFLUORESCENCE LIVE ANALYSIS OF HSV REPLICATION 4979
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
kinetics of virion release, there was no clear correlation be-tween the number of tagged virion proteins and the reductionin titer. Finally, the recombinant viruses did not seem to havea specific deficit at the level of virion egress, since the differ-ences between the wt virus and the recombinants were com-parable in the supernatant and the pellet. The data rathersuggest that the kinetics of recombinant virus replication wasdelayed.
Incorporation of autofluorescent fusion proteins into the
virion. To confirm that all three fusion proteins were incorpo-rated into the virion, wt HSV-1 virions and rHSV-RYC virionswere prepared by sucrose gradient centrifugation and analyzedfor the presence of the recombinant proteins. Western blottingwith the VP26-specific PAb revealed the 12-kDa VP26 in wtHSV-1 virions and the 50-kDa mRFP-VP26 fusion protein inrHSV-RYC virons (Fig. 4A). Similar to the observations madein Fig. 2A, the band intensity of the wt VP26 protein wasweaker than that of the mRFP-VP26 fusion protein. As pre-viously mentioned, this difference might be due to differentefficiencies of adsorption to the nitrocellulose membrane, sinceit is unlikely that the fusion protein is incorporated more effi-ciently into the virions than the wt protein. Similar observa-tions were also made in a previous report (45). In order toobtain a visible band for wt VP26, a doubled amount of wtvirions was loaded for the blot shown in Fig. 4A. Westernblotting with the VP16-specific MAb revealed the presence ofVP16 in the wt virions and VP16-ECFP in the rHSV-RYC
virions, the amounts of which appeared comparable (Fig. 4B).The VP16-ECFP fusion protein, but not wt VP16, could alsobe detected with the GFP-specific MAb (Fig. 4C). As expected,the anti-GFP MAb also detected the EYFP-gH fusion protein(Fig. 4C). As noted in Fig. 2, the ratio of EYFP-gH to VP16-ECFP was quite variable between individual experiments (Fig.2C, compare left and right panels). To detect gH from wtHSV-1 and EYFP-gH from rHSV-RYC, virion proteins wereimmunoprecipitated with the gH-specific MAb LP11 followedby SDS-PAGE and silver staining. The results shown in Fig. 4Ddemonstrate the presence of gH in wt virions and EYFP-gH inrHSV-RYC virions. Again, it appeared that the level of gH washigher in the wt virus than in with the recombinant. As ex-pected, immunoprecipitation of virion lysates with LP11 fol-lowed by Western blotting with the anti-GFP MAb detectedthe EYFP-gH fusion protein but not the wt gH (Fig. 4E). Aspreviously noted (Fig. 2E), VP16-ECFP coimmunoprecipi-tated with EYFP-gH (Fig. 4E). Staining for the VP22 tegu-ment protein confirmed that comparable amounts of virionswere loaded on the gels (Fig. 4F). Taken together, these resultsdemonstrate that all three fusion proteins, mRFP-VP26,VP16-ECFP, and EYFP-gH, are indeed incorporated into thevirus particle, although the amounts of incorporated EYFP-gHwere lower than those of wt gH.
Dynamics of compartmentalization of mRFP-VP26, VP16-
ECFP, and EYFP-gH in infected cells. Next, we monitored thelocalization of mRFP-VP26, VP16-ECFP, and EYFP-gH in
FIG. 3. Growth kinetics of recombinant HSV-1 and wt HSV-1. Vero cells were infected with MOIs of 0.1 (A and B) or 5 (C and D) PFU ofeither a recombinant HSV-1 (rHSV-R, rHSV-RY rHSV-RYC, rHSV-RC, or rHSV-48Y) or wt HSV-1, and progeny virus was harvested from thecell culture medium (A and C) or from the cells (B and D) at 0, 12, 24, 36, and 48 h p.i. Titers are expressed as PFU per ml. The titers representmeans from three experiments. Error bars represent standard deviations.
4980 DE OLIVEIRA ET AL. J. VIROL.
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
infected cells. For this, Vero cells were plated onto chamberedcoverglasses and infected with rHSV-RYC, and live cells wereexamined by CLSM at various times after infection. In the firsthours postinfection, small fluorescent foci were detected onthe surface of the cells and within the cytoplasm (Fig. 5a to d).Some foci show colocalizations of ECFP, EYFP, and mRFPsignals, suggesting that they represent intact virions from thevirus inoculum (Fig. 5a to d, insets). De novo protein synthesiswas first observed at 6 h p.i. for VP16-ECFP, which was founddiffusely in the nucleus with accumulation in very early viralreplication compartments (RCs) (Fig. 5e and h). At 8 h p.i.,VP16-ECFP was present in mature nuclear RCs as well as inthe cytoplasm, where it was found in a diffuse pattern withaccumulation in some small perinuclear foci (Fig. 5i and l). Atthis time, expression of EYFP-gH and mRFP-VP26 also be-came apparent. In particular, EYFP-gH was found diffusely inthe cytoplasm with some accumulation in a vesicular patternaround the nucleus (Fig. 5j and l), while mRFP-VP26 wasfound in small microfoci which were distributed throughoutthe nucleus with accumulation in viral RCs (Fig. 5k and l).
These small microfoci displayed a high mobility within thenucleus (not shown), reflecting active movement of nuclearcapsids (21). The localization of the VP26 and VP16 fusionproteins to RCs was confirmed by staining rHSV-R- andrHSV-48Y-infected cells for ICP8, a marker for RCs (Fig. 6Cand D). Between 10 and 16 h p.i., VP16-ECFP was predomi-nantly found in the viral RCs as well as in small foci in theirperiphery. In addition, the cytoplasmic VP16-ECFP accumu-lation became more intense, with a pronounced recruitment ofVP16-ECFP to the plasma membrane, where it was found in adot-like pattern (Fig. 5m and p). At this stage, EYFP-gH wasstill prominent in the cytoplasm but now strongly accumulatedin the nuclear membrane (Fig. 5n and p). Microfoci of mRFP-VP26 were still observed in the nucleus, but in addition,mRFP-VP26 was also observed in much larger foci which pref-erentially formed in the periphery of the RCs, but it did notcolocalize with the small VP16-ECFP foci (Fig. 5o and p).These large foci have previously been suggested to correspondto sites of capsid assembly, so-called assemblons (13). Between18 and 24 h p.i., two additional patterns became apparent.
FIG. 4. Incorporation of fluorescent proteins into virions. Purified wt HSV-1 (wt), rHSV-RY (RY), rHSV-RYC (RYC), and rHSV-RYC/2(RYC/2) were analyzed by SDS-PAGE followed by Western blot analysis with antibodies specific for VP26 (A), VP16 (B), GFP (C), and VP22(F). For detection of gH and EYFP-gH, virion proteins were immunoprecipitated with a gH-specific antibody and analyzed by SDS-PAGEfollowed by silver staining (D) or Western blotting with a GFP-specific antibody (E). The corresponding fusion proteins mRFP-VP26, VP16-ECFP,and EYFP-gH, as well as the wt VP26, VP16, gH, and VP22 proteins are indicated. Unspecific bands are marked by asterisks. Sizes of molecularweight markers are shown.
VOL. 82, 2008 MULTIFLUORESCENCE LIVE ANALYSIS OF HSV REPLICATION 4981
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
FIG. 5. High-resolution CLSM of living rHSV-RYC-infected cells. Vero cells were infected with an MOI of 18 PFU, and live cells wereobserved by CLSM with settings specific for ECFP (VP16-ECFP fusion protein), EYFP (EYFP-gH fusion protein), and mRFP (mRFP-VP26fusion protein). The thin gray lines in panels a to d mark the contours of the nucleus. The insets in panels a to d show a magnification of the sectordenoted by the white square. The filled arrowheads within the insets point to colocalizations of ECFP, EYFP, and mRFP signals. Arrows, earlyRCs; filled triangle, VP16-ECFP foci in periphery of RCs; open triangles, large mRFP-VP26 and VP16-ECFP foci in periphery of nuclei; filleddiamonds, asymmetric, perinuclear accumulation of VP16-ECFP and mRFP-VP26. Images represent single z stacks of the cells.
4982
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
First, the majority of the VP16-ECFP was consistently re-cruited out of the nucleus into the cytoplasm. Specifically, itwas found accumulating in an asymmetric, perinuclear patternreminiscent of the Golgi complex, where it often colocalized
with mRFP-VP26 and associated with EYFP-gH (Fig. 5q to t).Second, in a subset of cells, VP16-ECFP was recruited into thelarge mRFP-VP26 foci in the periphery of the nucleus, whileEYFP-gH remained in a pronounced perinuclear pattern (Fig.
FIG. 6. High-resolution CLSM of rHSV-RYC-infected cells and rHSV-R- and rHSV-48Y-infected cells stained for ICP8. (A) Vero cells wereinfected with rHSV-RYC, and living cells were observed by CLSM as described for Fig. 5. The images show a high magnification of a protrusionof the plasma membrane (top of picture). The arrows point to foci in which all three fusion proteins colocalize. The insets show magnificationsof these foci. (B) Vero cells were infected with rHSV-RYC, and fixed cells were observed by CLSM as described for panel A. (C) Vero cells wereinfected with rHSV-R at an MOI of 10 PFU, fixed at 12 h p.i., and stained with the anti-ICP8 MAb 7381 and a FITC-conjugated secondaryantibody, as well as DAPI. The cells were observed by CLSM with settings specific for DAPI, FITC (ICP8), and mRFP (mRFP-VP26 fusionprotein). (D) Vero cells were infected with rHSV-48Y at an MOI of 10 PFU and stained as described for panel C, except that an AF594-conjugatedsecondary antibody was used. The cells were observed by CLSM with settings specific for DAPI, EYFP (VP16-EYFP fusion protein), and AF594(ICP8). Images in panels A to D represent single z stacks of the cells.
VOL. 82, 2008 MULTIFLUORESCENCE LIVE ANALYSIS OF HSV REPLICATION 4983
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
5u to x). Finally, at these late time points, the dot-like accu-mulations of VP16-ECFP at the plasma membrane consis-tently colocalized with EYFP-gH and mRFP-VP26 (Fig. 5q tot), suggesting that they reflect the accumulation of progenyvirus at the plasma membrane. This possibility was furtherinvestigated by high-magnification CLSM of the plasma mem-brane, which, as previously described, often formed pro-nounced plasma membrane protrusions (35) (Fig. 6A and B).On such plasma membrane protrusions, we observed a verystrong association of VP16-ECFP and mRFP-VP26 (Fig. 6A,panel d) as well as a somewhat looser association of EYFP-gHwith mRFP-VP26 and VP16-ECFP (Fig. 6A, panels e and f).The looser association of EYFP-gH with mRFP-VP26 andVP16-ECFP is probably due to the fact that we observed living
cells and that while the ECFP and the mRFP channels wererecorded simultaneously, the EYFP channel was recorded sep-arately, thus explaining the observed differences in the degreeof colocalization. Indeed, the association between the threesignals was more pronounced in fixed cells (Fig. 6B). Theseobservations, together with the fact that the number of dotsincreased in the course of infection, support the hypothesisthat the dot-like accumulation of virion proteins of three dif-ferent compartments at the plasma membrane might corre-spond to accumulating virion progeny. Nevertheless, it cannotbe excluded that at least a subset of these foci also representvirions from the inoculum which did not successfully enter thecell and thus remained bound to the plasma membrane.
In order to obtain a more detailed picture of the subnuclear
FIG. 7. High-resolution CLSM of large VP26 foci. (A) Vero cells were infected with rHSV-RY at an MOI of 0.3 PFU, fixed at the indicatedtimes postinfection, stained with DAPI, and observed by CLSM with settings specific for DAPI, EYFP (EYFP-gH fusion protein), and mRFP(mRFP-VP26 fusion protein). Images represent single z stacks of the cells. (B) Panels a and c show magnifications of the mRFP-VP26 foci markedwith the numbered arrows shown in panel A, while panels b and d show surpass views of three-dimensional reconstructions of the same foci.(C) Vero cells were infected with wt HSV-1 at an MOI of 10 PFU, fixed at 12 h p.i., and stained with the rabbit anti-VP26 PAb VP26/C and aFITC-conjugated secondary antibody. HSV-1 DNA was detected by FISH using an Atto590-labeled probe. Cells were observed by CLSM withsettings specific for DAPI, FITC (VP26), and Atto590 (HSV-1 DNA). Images represent single z stacks of the cells.
4984 DE OLIVEIRA ET AL. J. VIROL.
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
distribution of the large mRFP-VP26 foci, we infected cellswith rHSV-RY, fixed them at 16 or 20 h p.i., and stained thenuclei with DAPI. CLSM analysis revealed that, at such latetime points, the large mRFP-VP26 foci were often located atthe very periphery of the nuclei (Fig. 7A) and that the densityof mRFP-VP26 within these large foci was not homogenous(Fig. 7B). Rather, mRFP-VP26 accumulated strongly at therim and displayed only a weak accumulation in the interior,suggesting a hollow structure of these foci (Fig. 7B). In addi-tion, we observed that while some of the VP26 structures werestill separated from the nuclear membrane by a thin layer ofcondensed chromatin (Fig. 7B, panels a and b), others dis-placed the chromatin to such an extent that they virtuallygained access to the nuclear membrane, which was visible byvirtue of EYFP-gH fluorescence (Fig. 7B, panels c and d). Inorder to test if these large VP26 foci corresponded to anaccumulation of DNA-filled capsids, we codetected VP26 andHSV-1 DNA in wt HSV-1-infected cells (Fig. 7C). While VP26and HSV-1 DNA colocalized within the RCs, the large VP26foci did not contain HSV-1 DNA. Assuming that DNA withinvirions is accessible for FISH, these data suggest that the largeVP26 foci do not correspond to accumulations of DNA-filledcapsids.
To ascertain that the distribution of the fluorescent virionproteins corresponded to that of the respective wt proteins, weperformed infections with wt HSV-1 and detected VP16, gH,and VP26 by immunofluorescence. CLSM analysis of stainedcells revealed that the patterns for all three wt virion proteinswere very similar to those observed with the recombinant vi-ruses (Fig. 8A to C). However, it has to be noted that theaccumulation of VP16 in large foci at the nuclear peripheryand their colocalization with VP26 was not observed in wtHSV-1-infected cells stained with VP26- and VP16-specificantibodies (Fig. 8D). This analysis also demonstrated that thestructure of the large VP26 foci was identical to that observedwith the mRFP-VP26 fusion protein (Fig. 8C, panel h). Inter-estingly, the proportion of cells displaying such large VP26 fociappeared to be somewhat smaller in wt HSV-1-infected cellsthan in cells infected with the recombinant viruses.
Time-lapse CLSM of cells infected with either rHSV-RYCor rHSV-RY allowed us to obtain a dynamic view of the in-teraction between VP16, gH, and VP26 in the infected cells(Fig. 9; see also movies S1 to S3 in the supplemental material).Specifically, the image series demonstrated a very dynamiccompartmentalization of VP16-ECFP in the course of infec-tion. While VP16-ECFP initially steadily accumulated in thenuclear RCs and later in the small foci in the periphery of theRCs, there was a very rapid and pronounced recruitment ofVP16-ECFP out of the nucleus into the cytoplasm and, in somecells, into the large mRFP-VP26 foci at the periphery of thenucleus in a late stage of infection. This redistribution wasfairly rapid and generally occurred within 1 to 2 h (Fig. 9A). Inaddition, the time-lapse series revealed the progressive accu-mulation of EYFP-gH at the nuclear membrane and in theperinuclear cytoplasmic pattern (Fig. 9A and B). Finally, theanalysis demonstrated that the initially small foci of mRFP-VP26 expanded and coalesced to form much larger foci, whichwere pushed toward the periphery of the nucleus as infectionprogressed (Fig. 9A and B).
Ultrastructural analysis of rHSV-RYC-infected cells. Elec-tron microscopy revealed clear indications for normal matura-tion of the triple-fluorescent recombinant HSV-1, rHSV-RYC,with identical phenotypes to wt HSV-1 (Fig. 10). These phe-notypes include formation of capsids with occasional crystal-line-like accumulation within the nucleus (Fig. 10C), buddingof capsids at the inner nuclear membrane (Fig. 10B), buddingof capsids at Golgi membranes (Fig. 10D), virions withinvacuoles (Fig. 10E), and virions in the extracellular space(Fig. 10F).
DISCUSSION
Autofluorescent proteins have been used extensively tostudy many different biological processes, including the repli-cation cycle of viruses (reviewed in reference 5). Recombinantherpesviruses encoding individual virus proteins fused withautofluorescent proteins have previously been constructed tostudy several different aspects of the herpesvirus life cycle,including trafficking, assembly, and maturation (11, 13, 15, 17,20, 35, 39). Here, we report for the first time the constructionand time-lapse analysis of a recombinant HSV-1 that simulta-neously encodes virus proteins from three different virion com-partments, capsid (VP26), tegument (VP16), and envelope(gH), fused with different autofluorescent proteins (mRFP,ECFP, and EYFP, respectively).
Crucial to the construction of the triple-fluorescent recom-binant HSV-1 was the availability of a BAC-cloned HSV-1genome (59), which facilitated the easy manipulation of thevirus genome in bacteria. The combination of the HSV-1 BACwith the possibility for both positive and negative selection inbacteria provided by the galK system (62) allowed the serialintroduction of the three fusion genes into the virus genome.The reconstitution of recombinant virus progeny and theelimination of the BAC backbone were accomplished fol-lowing cotransfection of the recombinant HSV-1 BAC DNAwith a Cre recombinase-expressing plasmid in mammaliancells (Fig. 1).
Western analysis of infected cells demonstrated that allthree fusion proteins were synthesized (Fig. 2). Interestingly,the triple-fluorescent recombinant HSV-1, rHSV-RYC, wasreplication competent, although with delayed kinetics, and in-corporated all three fusion proteins into the different virioncompartments. It appeared that the fusion of EYFP to gH wasresponsible for a delay in the kinetics of virus release (Fig. 3).This is consistent with a previous report describing the fusionof EYFP to the N terminus of gH (39). Although the authorsof that study contended that the recombinant virus replicatedto titers comparable to those of wt HSV-1, it has to be notedthat the wt virus used in their study (strain 17 syn�) reachedonly a titer of 5.25 � 106 PFU/ml, which is rather low for a wtvirus. The fusion of autofluorescent proteins to VP16 andVP26 also seemed to affect virus titers, although there were noindications that fusion to the essential VP16 would have agreater impact on viral replication fitness than fusion to thenonessential VP26. In addition, the analysis did not supportthe notion that the effects of the individual fusions were addi-tive. Rather it appeared that the addition of at least oneautofluorescent fusion protein to a virus protein resulted in asomewhat delayed kinetics of virus production (gH) or reduced
VOL. 82, 2008 MULTIFLUORESCENCE LIVE ANALYSIS OF HSV REPLICATION 4985
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
final titers (VP16 or VP26). Electron microscopy analysis re-vealed that the triple-fluorescent recombinant HSV-1 wascomparable to wt HSV-1 also at the ultrastructural level (Fig.10). Moreover, CLSM of infected cells demonstrated that the
distribution and compartmentalization of the three autofluo-rescent fusion proteins encoded by rHSV-RYC were compa-rable to those observed with either wt HSV-1 or recombinantsof HSV-1 that encode autofluorescent proteins fused with
FIG. 8. Immunofluorescence staining for VP16, gH, and VP26 in wt HSV-1-infected cells. (A) Immunofluorescence staining for VP16. Vero cellswere infected with wt HSV-1 at an MOI of 10 PFU. At the indicated times postinfection, the cells were fixed and stained with the anti-VP16 MAb LP1and an AF594-conjugated secondary antibody, as well as DAPI. The cells were then observed by CLSM with settings specific for DAPI and AF594. Filledarrowhead, VP16 foci in the periphery of RCs. (B) Immunofluorescence staining for gH. Vero cells were infected and stained as described for panel A,except that the anti-gH MAb LP11 was used. (C) Immunofluorescence staining for VP26. Vero cells were infected and stained as described for panelA, except that the rabbit anti-VP26 PAb VP26/C was used. Panel h shows a magnification of the VP26 focus marked with an arrow. (D) Vero cells wereinfected as described for panel A, fixed at 16 h p.i., and stained with DAPI, the anti-VP16 MAb LP1 (detected with an AF594-conjugated secondaryantibody), and the rabbit anti-VP26 PAb VP26/C (detected with a FITC-conjugated secondary antibody). The cells were then observed by CLSM withsettings specific for DAPI, AF594 (VP16, shown in green), and FITC (VP26, shown in red). Images in panels A to D represent single z stacks of the cells.
4986 DE OLIVEIRA ET AL. J. VIROL.
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
VP26, gH, or VP16 individually (Fig. 5 to 8) (13, 35, 39).Finally, the strong dot-like association of autofluorescent fu-sion proteins of three different virion compartments, VP16-ECFP, mRFP-VP26, and EYFP-gH, at plasma membrane pro-trusions (Fig. 6A and B) supports the hypothesis that thesedots indeed are mature virions and that progeny virions incor-porate sufficient amounts of the fluorescent fusion proteins toallow their visualization, although this has to be confirmed onthe ultrastructural level. Nevertheless, it would be less convinc-ing to draw such a conclusion with a recombinant HSV-1 thatencodes only one or two autofluorescent virion proteins.
The major advantage of our approach is the possibility forsimultaneously visualizing the distributions and interactionsbetween different virus proteins and virion compartments onthe single cell level. Moreover, our strategy allows study of thedynamics of these events in live cells. For example, mRFP-VP26 and VP16-ECFP colocalized within RCs in the nucleusbut, in addition, they both also formed foci in the periphery ofthe RCs that did not colocalize (Fig. 5). In a previous report itwas hypothesized that the VP16 foci in the periphery of theRCs may correspond to sites where capsids acquire VP16 (35).Our experiments, however, suggest that this hypothesis is un-
likely. In the course of the infection, the mRFP-VP26 fociexpanded and coalesced to form larger foci that relocated tothe periphery of the nucleus. In the majority of the cells,VP16-ECFP was redistributed from the nucleus to the cyto-plasm late in infection, in a process that occurred very rapidly(generally within 1 to 2 h). Of note is that in a subset of cells,VP16-ECFP was, in addition, recruited into the large mRFP-VP26 foci at the periphery of the nucleus (Fig. 5 and 9; see alsomovies S1 to S3 in the supplemental material). This phenom-enon was, however, not observed in wt HSV-1-infected cellsstained with VP16- and VP26-specific antibodies, in whichVP26, but not VP16, was consistently observed in the large fociat the nuclear periphery (Fig. 8). In contrast, the colocalizationof VP26 and VP16 in the cytoplasm late in infection wasreadily observed in both rHSV-RYC- and wt HSV-1-infectedcells (Fig. 5 and 8). There are two possible explanations for thisdiscrepancy: first, the fusion of ECFP to VP16 may have al-tered some of its biological properties, leading to its recruit-ment into the large mRFP-VP26 foci at the nuclear periphery.Second, it is conceivable that VP16 and VP26 similarly colo-calized in wt HSV-1-infected cells but that the VP16-specificantibody employed did not detect VP16 when present in the
FIG. 9. Time-lapse CLSM of rHSV-RYC- and rHSV-RY-infected cells. Vero cells were infected with rHSV-RYC (A) or rHSV-RY (B) atMOIs of 2 and 0.3, respectively. Cells that just started to accumulate fluorescent proteins were monitored by CLSM with settings specific for ECFP(VP16-ECFP), EYFP (EYFP-gH), and mRFP (mRFP-VP26). Selected frames at the indicated intervals are shown. Images were processed withImaris software in the surpass view mode. Arrowheads denote the cells described in the text.
VOL. 82, 2008 MULTIFLUORESCENCE LIVE ANALYSIS OF HSV REPLICATION 4987
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
large VP26 foci at the periphery of the nucleus, possibly be-cause of an altered conformation of VP16 in these structures.However, the very late appearance of this colocalization (18 to24 h p.i.) suggests that it likely does not represent a crucial step
in the assembly and egress of progeny virus, since infectiousprogeny are produced already at earlier time points (i.e., 12 hp.i.) (Fig. 3). The accumulation of VP26 in large nuclear fociwas previously documented in cells infected with wt HSV-1
FIG. 10. Electron micrographs of Vero cells infected with rHSV-RYC after prefixation at 24 h p.i. followed by freezing and freeze-substitution.(A) Low-power micrograph showing Golgi membranes, virions within a vacuole (arrow), and capsids (arrowheads) within the cytoplasm andbudding at Golgi membranes, respectively. (B) Virion within the perinuclear space of the nuclear envelope. (C) Accumulation of capsids in acrystalline manner within the nucleus. (D) Budding capsid at Golgi membranes. (E) Virion within a concentric vacuole. (F) Virions in theextracellular space. Bars, 500 nm (A and C) and 100 nm (B, D, and E).
4988 DE OLIVEIRA ET AL. J. VIROL.
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
and stained with VP26-specific antibodies, as well as by expres-sion of VP26 fused to GFP. The formation of nuclear VP26foci was demonstrated to depend on the presence of VP5 andVP22a and to occur in an ATP-dependent manner (8, 11, 13,52). These VP26 foci were hypothesized to correspond to thesites of capsid assembly, similar to the assemblons described byWard and coworkers, which contained the capsid proteinsICP35, VP5, and VP19c and formed very late in infection atthe periphery of the nuclear RCs (13, 61). Interestingly, Wardet al. (61) detected a partial colocalization between assemblonsand VP16 by staining with VP19c- and VP16-specific antibod-ies. However, this partial colocalization clearly differs from thealmost perfect colocalization of VP16-ECFP and mRFP-VP26in large foci at the nuclear periphery observed in our study(Fig. 5). The ultrastructural correlate of this colocalizationremains to be determined. It is possible that the VP26 foci atthe nuclear periphery may represent the accumulation of dead-end products, as previously suggested for assemblons (10, 36),to which VP16 is recruited late in infection. This hypothesis isfurther supported by the finding that these structures do notcontain HSV-1 DNA, indicating that they do not correspond toaccumulations of DNA-filled capsids (Fig. 7).
In summary, this study demonstrates the feasibility of theconstruction of a recombinant HSV-1 simultaneously express-ing autofluorescent proteins fused to VP16, VP26, and gH.This study sheds light on the spatial and temporal organizationof HSV-1 infection at the single-cell level. Specifically, thesimultaneous fluorescence labeling of several virion compo-nents allowed assessment of the interactions of the differentviral proteins in the course of the infection. This approach maybe used to address several open questions in HSV-1 biology,for example, the spatial organization of capsid assembly andmaturation by fluorescent labeling of several components ofthe pro-capsid and those of mature capsids. In addition, fluo-rescently labeled virus proteins may be combined with systemsfor the live visualization of viral DNA, as previously describedfor several viruses, such as HSV-1, Epstein-Barr virus, andadeno-associated virus (1, 23, 28, 29, 58), to specifically assessthe dynamics of the association of viral proteins with viralDNA. Finally, the simultaneous fluorescent labeling of capsid,tegument, and envelope components may prove useful for thestudy of virus trafficking, for example, to assess and comparethe composition of virions transported in an anterograde ver-sus retrograde direction within axons (2–4, 20, 40).
ACKNOWLEDGMENTS
We kindly thank U. F. Greber, H. Browne, A. Minson, A. Helenius,P. Desai, Y. Kawaguchi, S. Warming, R. D. Everett, G. Elliott, and K.Tobler for providing reagents and I. Heid for technical assistance.
This work was supported by the Swiss National Science Foundation(grants 3100A0-100195 and 3100AO-112462 to C.F.), the NovartisFoundation for Biomedical Research (grant 06C77 to C.F.), and theNational Institutes of Health (grant CA69246 to X.O.B. and C.F.).
REFERENCES
1. Amon, W., R. E. White, and P. J. Farrell. 2006. Epstein-Barr virus origin oflytic replication mediates association of replicating episomes with promyelo-cytic leukaemia protein nuclear bodies and replication compartments.J. Gen. Virol. 87:1133–1137.
2. Antinone, S. E., G. T. Shubeita, K. E. Coller, J. I. Lee, S. Haverlock-Moyns,
S. P. Gross, and G. A. Smith. 2006. The herpesvirus capsid surface protein,VP26, and the majority of the tegument proteins are dispensable for capsidtransport toward the nucleus. J. Virol. 80:5494–5498.
3. Antinone, S. E., and G. A. Smith. 2006. Two modes of herpesvirus traffickingin neurons: membrane acquisition directs motion. J. Virol. 80:11235–11240.
4. Bearer, E. L., X. O. Breakefield, D. Schuback, T. S. Reese, and J. H. LaVail.
2000. Retrograde axonal transport of herpes simplex virus: evidence for asingle mechanism and a role for tegument. Proc. Natl. Acad. Sci. USA97:8146–8150.
6. Buckmaster, E. A., U. Gompels, and A. Minson. 1984. Characterisation andphysical mapping of an HSV-1 glycoprotein of approximately 115 � 103
molecular weight. Virology 139:408–413.7. Campbell, M. E., J. W. Palfreyman, and C. M. Preston. 1984. Identification
of herpes simplex virus DNA sequences which encode a trans-actingpolypeptide responsible for stimulation of immediate early transcription. J.Mol. Biol. 180:1–19.
8. Chi, J. H., and D. W. Wilson. 2000. ATP-dependent localization of theherpes simplex virus capsid protein VP26 to sites of procapsid maturation.J. Virol. 74:1468–1476.
9. Davison, M. D., F. J. Rixon, and A. J. Davison. 1992. Identification of genesencoding two capsid proteins (VP24 and VP26) of herpes simplex virus type1. J. Gen. Virol. 73:2709–2713.
10. de Bruyn Kops, A., S. L. Uprichard, M. Chen, and D. M. Knipe. 1998.Comparison of the intranuclear distributions of herpes simplex virus proteinsinvolved in various viral functions. Virology 252:162–178.
11. Desai, P., J. C. Akpa, and S. Person. 2003. Residues of VP26 of herpessimplex virus type 1 that are required for its interaction with capsids. J. Virol.77:391–404.
12. Desai, P., N. A. DeLuca, and S. Person. 1998. Herpes simplex virus type 1VP26 is not essential for replication in cell culture but influences productionof infectious virus in the nervous system of infected mice. Virology 247:115–124.
13. Desai, P., and S. Person. 1998. Incorporation of the green fluorescent pro-tein into the herpes simplex virus type 1 capsid. J. Virol. 72:7563–7568.
14. Desai, P. J., P. A. Schaffer, and A. C. Minson. 1988. Excretion of non-infectious virus particles lacking glycoprotein H by a temperature-sensitivemutant of herpes simplex virus type 1: evidence that gH is essential for virioninfectivity. J. Gen. Virol. 69:1147–1156.
15. Dohner, K., K. Radtke, S. Schmidt, and B. Sodeik. 2006. Eclipse phase ofherpes simplex virus type 1 infection: efficient dynein-mediated capsid trans-port without the small capsid protein VP26. J. Virol. 80:8211–8224.
16. Elliott, G., G. Mouzakitis, and P. O’Hare. 1995. VP16 interacts via itsactivation domain with VP22, a tegument protein of herpes simplex virus,and is relocated to a novel macromolecular assembly in coexpressing cells.J. Virol. 69:7932–7941.
17. Elliott, G., and P. O’Hare. 1999. Live-cell analysis of a green fluorescentprotein-tagged herpes simplex virus infection. J. Virol. 73:4110–4119.
18. Everett, R. D., and J. Murray. 2005. ND10 components relocate to sitesassociated with herpes simplex virus type 1 nucleoprotein complexes duringvirus infection. J. Virol. 79:5078–5089.
19. Farnsworth, A., T. W. Wisner, M. Webb, R. Roller, G. Cohen, R. Eisenberg,
and D. C. Johnson. 2007. Herpes simplex virus glycoproteins gB and gHfunction in fusion between the virion envelope and the outer nuclear mem-brane. Proc. Natl. Acad. Sci. USA 104:10187–10192.
20. Feierbach, B., M. Bisher, J. Goodhouse, and L. W. Enquist. 2007. In vitroanalysis of transneuronal spread of an alphaherpesvirus infection in periph-eral nervous system neurons. J. Virol. 81:6846–6857.
21. Forest, T., S. Barnard, and J. D. Baines. 2005. Active intranuclear movementof herpesvirus capsids. Nat. Cell Biol. 7:429–431.
22. Forrester, A., H. Farrell, G. Wilkinson, J. Kaye, N. Davis-Poynter, and T.
Minson. 1992. Construction and properties of a mutant of herpes simplexvirus type 1 with glycoprotein H coding sequences deleted. J. Virol. 66:341–348.
23. Fraefel, C., A. G. Bittermann, H. Bueler, I. Heid, T. Bachi, and M. Ackermann.
2004. Spatial and temporal organization of adeno-associated virus DNAreplication in live cells. J. Virol. 78:389–398.
24. Fuchs, W., H. Granzow, B. G. Klupp, M. Kopp, and T. C. Mettenleiter. 2002.The UL48 tegument protein of pseudorabies virus is critical for intracyto-plasmic assembly of infectious virions. J. Virol. 76:6729–6742.
25. Fuller, A. O., R. E. Santos, and P. G. Spear. 1989. Neutralizing antibodiesspecific for glycoprotein H of herpes simplex virus permit viral attachment tocells but prevent penetration. J. Virol. 63:3435–3443.
26. Gibson, W., A. I. Marcy, J. C. Comolli, and J. Lee. 1990. Identification ofprecursor to cytomegalovirus capsid assembly protein and evidence thatprocessing results in loss of its carboxy-terminal end. J. Virol. 64:1241–1249.
27. Gillet, L., J. S. May, S. Colaco, and P. G. Stevenson. 2007. Glycoprotein Ldisruption reveals two functional forms of the murine gammaherpesvirus 68glycoprotein H. J. Virol. 81:280–291.
28. Glauser, D. L., O. Saydam, N. A. Balsiger, I. Heid, R. M. Linden, M.
Ackermann, and C. Fraefel. 2005. Four-dimensional visualization of thesimultaneous activity of alternative adeno-associated virus replication ori-gins. J. Virol. 79:12218–12230.
29. Glauser, D. L., R. Strasser, A. S. Laimbacher, O. Saydam, N. Clement, R. M.
VOL. 82, 2008 MULTIFLUORESCENCE LIVE ANALYSIS OF HSV REPLICATION 4989
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
Linden, M. Ackermann, and C. Fraefel. 2007. Live covisualization of com-peting adeno-associated virus and herpes simplex virus type 1 DNA replica-tion: molecular mechanisms of interaction. J. Virol. 81:4732–4743.
30. Gompels, U. A., and A. C. Minson. 1989. Antigenic properties and cellularlocalization of herpes simplex virus glycoprotein H synthesized in a mam-malian cell expression system. J. Virol. 63:4744–4755.
31. Gross, S. T., C. A. Harley, and D. W. Wilson. 2003. The cytoplasmic tail ofherpes simplex virus glycoprotein H binds to the tegument protein VP16 invitro and in vivo. Virology 317:1–12.
32. Haarr, L., and S. Skulstad. 1994. The herpes simplex virus type 1 particle:structure and molecular functions. APMIS 102:321–346.
33. Hutchinson, L., H. Browne, V. Wargent, N. Davis-Poynter, S. Primorac, K.
Goldsmith, A. C. Minson, and D. C. Johnson. 1992. A novel herpes simplexvirus glycoprotein, gL, forms a complex with glycoprotein H (gH) and affectsnormal folding and surface expression of gH. J. Virol. 66:2240–2250.
34. Kinzler, E. R., and T. Compton. 2005. Characterization of human cytomeg-alovirus glycoprotein-induced cell-cell fusion. J. Virol. 79:7827–7837.
35. La Boissiere, S., A. Izeta, S. Malcomber, and P. O’Hare. 2004. Compart-mentalization of VP16 in cells infected with recombinant herpes simplexvirus expressing VP16-green fluorescent protein fusion proteins. J. Virol.78:8002–8014.
36. Lamberti, C., and S. K. Weller. 1998. The herpes simplex virus type 1cleavage/packaging protein, UL32, is involved in efficient localization ofcapsids to replication compartments. J. Virol. 72:2463–2473.
37. Leuzinger, H., U. Ziegler, E. M. Schraner, C. Fraefel, D. L. Glauser, I. Heid,
M. Ackermann, M. Mueller, and P. Wild. 2005. Herpes simplex virus 1envelopment follows two diverse pathways. J. Virol. 79:13047–13059.
38. Liu, F. Y., and B. Roizman. 1991. The herpes simplex virus 1 gene encodinga protease also contains within its coding domain the gene encoding themore abundant substrate. J. Virol. 65:5149–5156.
39. Lorentzen, E. U., B. R. Eing, W. Hafezi, R. Manservigi, and J. E. Kuhn. 2001.Replication-competent herpes simplex virus type 1 mutant expressing anautofluorescent glycoprotein H fusion protein. Intervirology 44:232–242.
40. Luxton, G. W., S. Haverlock, K. E. Coller, S. E. Antinone, A. Pincetic, and
G. A. Smith. 2005. Targeting of herpesvirus capsid transport in axons iscoupled to association with specific sets of tegument proteins. Proc. Natl.Acad. Sci. USA 102:5832–5837.
41. McLean, C., A. Buckmaster, D. Hancock, A. Buchan, A. Fuller, and A.
Minson. 1982. Monoclonal antibodies to three non-glycosylated antigens ofherpes simplex virus type 2. J. Gen. Virol. 63:297–305.
42. McNabb, D. S., and R. J. Courtney. 1992. Identification and characterizationof the herpes simplex virus type 1 virion protein encoded by the UL35 openreading frame. J. Virol. 66:2653–2663.
43. McNabb, D. S., and R. J. Courtney. 1992. Posttranslational modification andsubcellular localization of the p12 capsid protein of herpes simplex virus type1. J. Virol. 66:4839–4847.
44. Mossman, K. L., R. Sherburne, C. Lavery, J. Duncan, and J. R. Smiley. 2000.Evidence that herpes simplex virus VP16 is required for viral egress down-stream of the initial envelopment event. J. Virol. 74:6287–6299.
45. Nagel, C. H., K. Dohner, M. Fathollahy, T. Strive, E. M. Borst, M. Messerle,
and B. Sodeik. 2008. Nuclear egress and envelopment of herpes simplex viruscapsids analyzed with dual-color fluorescence HSV1(17�). J. Virol. 82:3109–3124.
46. Newcomb, W. W., R. M. Juhas, D. R. Thomsen, F. L. Homa, A. D. Burch,
S. K. Weller, and J. C. Brown. 2001. The UL6 gene product forms the portalfor entry of DNA into the herpes simplex virus capsid. J. Virol. 75:10923–10932.
47. Newcomb, W. W., B. L. Trus, F. P. Booy, A. C. Steven, J. S. Wall, and J. C.
Brown. 1993. Structure of the herpes simplex virus capsid. Molecular com-position of the pentons and the triplexes. J. Mol. Biol. 232:499–511.
48. O’Hare, P., and C. R. Goding. 1988. Herpes simplex virus regulatory ele-ments and the immunoglobulin octamer domain bind a common factor andare both targets for virion transactivation. Cell 52:435–445.
49. O’Hare, P., C. R. Goding, and A. Haigh. 1988. Direct combinatorial inter-action between a herpes simplex virus regulatory protein and a cellular
octamer-binding factor mediates specific induction of virus immediate-earlygene expression. EMBO J. 7:4231–4238.
50. Omerovic, J., L. Lev, and R. Longnecker. 2005. The amino terminus ofEpstein-Barr virus glycoprotein gH is important for fusion with epithelialand B cells. J. Virol. 79:12408–12415.
51. Person, S., S. Laquerre, P. Desai, and J. Hempel. 1993. Herpes simplex virustype 1 capsid protein, VP21, originates within the UL26 open reading frame.J. Gen. Virol. 74:2269–2273.
52. Rixon, F. J., C. Addison, A. McGregor, S. J. Macnab, P. Nicholson, V. G.
Preston, and J. D. Tatman. 1996. Multiple interactions control the intracel-lular localization of the herpes simplex virus type 1 capsid proteins. J. Gen.Virol. 77:2251–2260.
53. Roop, C., L. Hutchinson, and D. C. Johnson. 1993. A mutant herpes simplexvirus type 1 unable to express glycoprotein L cannot enter cells, and itsparticles lack glycoprotein H. J. Virol. 67:2285–2297.
54. Saad, A., Z. H. Zhou, J. Jakana, W. Chiu, and F. J. Rixon. 1999. Roles oftriplex and scaffolding proteins in herpes simplex virus type 1 capsid forma-tion suggested by structures of recombinant particles. J. Virol. 73:6821–6830.
55. Smibert, C. A., B. Popova, P. Xiao, J. P. Capone, and J. R. Smiley. 1994.Herpes simplex virus VP16 forms a complex with the virion host shutoffprotein vhs. J. Virol. 68:2339–2346.
56. Smith, I. L., M. A. Hardwicke, and R. M. Sandri-Goldin. 1992. Evidence thatthe herpes simplex virus immediate early protein ICP27 acts post-transcrip-tionally during infection to regulate gene expression. Virology 186:74–86.
57. Snapp, E. L., R. S. Hegde, M. Francolini, F. Lombardo, S. Colombo, E.
Pedrazzini, N. Borgese, and J. Lippincott-Schwartz. 2003. Formation ofstacked ER cisternae by low affinity protein interactions. J. Cell Biol. 163:
257–269.58. Sourvinos, G., and R. D. Everett. 2002. Visualization of parental HSV-1
genomes and replication compartments in association with ND10 in liveinfected cells. EMBO J. 21:4989–4997.
59. Tanaka, M., H. Kagawa, Y. Yamanashi, T. Sata, and Y. Kawaguchi. 2003.Construction of an excisable bacterial artificial chromosome containing afull-length infectious clone of herpes simplex virus type 1: viruses reconsti-tuted from the clone exhibit wild-type properties in vitro and in vivo. J. Virol.77:1382–1391.
60. Taylor, T. J., M. A. Brockman, E. E. McNamee, and D. M. Knipe. 2002.Herpes simplex virus. Front. Biosci. 7:d752–d764.
61. Ward, P. L., W. O. Ogle, and B. Roizman. 1996. Assemblons: nuclear struc-tures defined by aggregation of immature capsids and some tegument pro-teins of herpes simplex virus 1. J. Virol. 70:4623–4631.
62. Warming, S., N. Costantino, D. L. Court, N. A. Jenkins, and N. G. Copeland.
2005. Simple and highly efficient BAC recombineering using galK selection.Nucleic Acids Res. 33:e36.
63. Weinheimer, S. P., B. A. Boyd, S. K. Durham, J. L. Resnick, and D. R.
O’Boyle II. 1992. Deletion of the VP16 open reading frame of herpes simplexvirus type 1. J. Virol. 66:258–269.
64. Wild, P., E. M. Schraner, H. Adler, and B. M. Humbel. 2001. Enhancedresolution of membranes in cultured cells by cryoimmobilization and freeze-substitution. Microsc. Res. Tech. 53:313–321.
65. Yang, F., L. G. Moss, and G. N. Phillips, Jr. 1996. The molecular structureof green fluorescent protein. Nat. Biotechnol. 14:1246–1251.
66. Zacharias, D. A., J. D. Violin, A. C. Newton, and R. Y. Tsien. 2002. Parti-tioning of lipid-modified monomeric GFPs into membrane microdomains oflive cells. Science 296:913–916.
67. Zhang, Y., D. A. Sirko, and J. L. McKnight. 1991. Role of herpes simplexvirus type 1 UL46 and UL47 in alpha TIF-mediated transcriptional induc-tion: characterization of three viral deletion mutants. J. Virol. 65:829–841.
68. Zhou, Z. H., M. Dougherty, J. Jakana, J. He, F. J. Rixon, and W. Chiu. 2000.Seeing the herpesvirus capsid at 8.5 Å. Science 288:877–880.
69. Zhou, Z. H., J. He, J. Jakana, J. D. Tatman, F. J. Rixon, and W. Chiu. 1995.Assembly of VP26 in herpes simplex virus-1 inferred from structures ofwild-type and recombinant capsids. Nat. Struct. Biol. 2:1026–1030.
70. Zhu, Q., and R. J. Courtney. 1994. Chemical cross-linking of virion envelopeand tegument proteins of herpes simplex virus type 1. Virology 204:590–599.
4990 DE OLIVEIRA ET AL. J. VIROL.
by o
n O
cto
ber 5
, 2009
jvi.a
sm
.org
Dow
nlo
aded fro
m
The Open Virology Journal, 2010, 4, 109-122 109
1874-3579/10 2010 Bentham Open
Open Access
Herpes Simplex Virus Type 1/Adeno-Associated Virus Hybrid Vectors
Anna Paula de Oliveira and Cornel Fraefel*
Institute of Virology, University of Zurich, Zurich, Switzerland
Abstract: Herpes simplex virus type 1 (HSV-1) amplicons can accommodate foreign DNA of any size up to 150 kbp and,
therefore, allow extensive combinations of genetic elements. Genomic sequences as well as cDNA, large transcriptional
regulatory sequences for cell type-specific expression, multiple transgenes, and genetic elements from other viruses to
create hybrid vectors may be inserted in a modular fashion. Hybrid amplicons use genetic elements from HSV-1 that
allow replication and packaging of the vector DNA into HSV-1 virions, and genetic elements from other viruses that
either direct integration of transgene sequences into the host genome or allow episomal maintenance of the vector. Thus,
the advantages of the HSV-1 amplicon system, including large transgene capacity, broad host range, strong nuclear
localization, and availability of helper virus-free packaging systems are retained and combined with those of heterologous
viral elements that confer genetic stability to the vector DNA. Adeno-associated virus (AAV) has the unique capability of
integrating its genome into a specific site, designated AAVS1, on human chromosome 19. The AAV rep gene and the
inverted terminal repeats (ITRs) that flank the AAV genome are sufficient for this process. HSV-1 amplicons have thus
been designed that contain the rep gene and a transgene cassette flanked by AAV ITRs. These HSV/AAV hybrid vectors
direct site-specific integration of transgene sequences into AAVS1 and support long-term transgene expression.
HERPES SIMPLEX VIRUS TYPE 1 - BIOLOGICAL PROPERTIES
Herpes simplex virus type 1 (HSV-1) is a member of the family Herpesviridae, subfamily Alphaherpesvirinae, genus Simplexvirus. It is a common human pathogen that causes infections of the orofacial mucosal surfaces and may rarely cause acute hepatitis, kerato-conjunctivitis or meningo-encephalitis.
The HSV-1 particle is composed of three different compartments, capsid, tegument, and envelope. The capsid proteins are involved in the formation and maturation of the icosahedral capsid [1] and packaging of the viral genome [2-6]. The tegument, which is located between capsid and envelope, is composed of viral proteins involved in transport of capsids to nuclear pores, attachment to the nuclear pore complex [7], release of the virus genome from the capsid into the nucleus [8], and remodeling the host cell environment to optimize replication [9-14]. The viral envelope is a lipid bilayer of host origin that contains 11 viral glycoproteins. These play important roles in viral attachment, entry, cell to cell spread, and egress [15, 16]. HSV-1 can enter the cells by receptor-mediated fusion between virus and cell membrane [17-20]. However, depending on the cell type and virus strain, HSV-1 can penetrate the host cell also by endocytosis [20-22] and phagocytosis [23]. In the cytoplasm, the capsid is transported to the nucleus via interactions with the minus-end-directed microtubule motor protein dynein [24-26] Capsids bind to the nuclear pore complex and release the DNA genome into the nucleus [7, 27, 28].
*Address correspondence to this author at the Institute of Virology,
University of Zurich, 8057 Zurich, Switzerland; Tel: +41 44 635 8713, Fax:
The HSV-1 genome is a double-stranded DNA (dsDNA) of 152 kbp. It is organized in two segments, unique long (UL) and unique short (US), both of which are flanked by inverted repeats (see Fig. 1). The essential cis elements for viral DNA replication and encapsidation include the origins of DNA replication, located in the UL (oriL) and TRs, (oriS) regions [29, 30], and the packaging/cleavage signals (pac) that reside in the a sequences located at both termini of the genome as well as at the junction between the long and the short segments [31]. The viral genome circularizes after it reaches the nucleus [32] and serves as a template for DNA replication. However, there is also evidence that circularization is not required for replication [33]. The majority of the replicative intermediates are long concatemers that are thought to have been synthesized by a rolling-circle mechanism [34-36]. The concatemers are cleaved into unit-length genomes at the pac signals after filling pre-formed capsids [36, 37].
HSV-1 encodes approximately 89 genes [38], which are expressed in a cascade of three temporal phases: immediate-early, early, and late. The late genes can be subdivided in leaky-late (expression is not dependent on viral DNA synthesis) and true-late (expression depends on viral DNA synthesis) [31, 39, 40].
There are several hypotheses on the mechanisms of envelopment of the nucleocapsid. The generally accepted view suggests a two-step envelopment process in which the capsid acquires a primary envelope by budding at the inner nuclear membrane and then is de-enveloped by fusion with the outer nuclear membrane [41, 42]. The secondary envelope is acquired when the capsid buds into the Golgi or cytoplasmic vesicles [43-49]. The alternative pathways described include (i) budding at the inner nuclear membrane followed by intraluminal transport via ER and Golgi and (ii)
110 The Open Virology Journal, 2010, Volume 4 de Oliveira and Fraefel
exit via impaired nuclear pores and envelopment at the outer nuclear membrane or ER membrane [50-52]. Regardless of the mechanism of envelopment, mature virions seem to exit the cell by exocytosis via intraluminal transport to Golgi cisternae and formation of transport vacuoles [53-55].
An important aspect of HSV-1 biology is the capability of this virus to establish latent infections in sensory neurons of the trigeminal ganglia [56]. The latent HSV-1 genome is a circular, condensed episome, and viral gene expression is limited to the non-coding, latency-associated transcripts (LATs) [57]. Expression of LATs was demonstrated to increase the number of neurons in which latency is established [58] and to affect the efficiency of reactivation [59, 60]. Recent findings that LAT encodes several micro RNAs (miRNA) in HSV-1 infected cells corroborates with the proposed hypothesis that the exonic regions of LAT might function as primary miRNA precursors [61]. At least two of the identified miRNA precursors in latently infected neurons may facilitate the establishment and maintenance of viral latency by post-transcriptionally regulating viral gene expression [62-65].
Latent HSV-1 can periodically reactivate in response to a variety of stimuli, including fever, UV light, hormonal imbalance, malignancy or immune suppression, and enter a new lytic cycle, usually at the site of the primary infection. Recently, the requirement of ICP0 for viral DNA replication [66-68] and for exit from latency has been reconsidered, as in vivo studies showed that reactivation of HSV-1 genomes does not depend on viral DNA amplification [69] nor functional ICP0 [70]. Upon stress conditions, and in the absence of other viral proteins, VP16 was demonstrated to be activated [71], supporting the hypothesis that de novo expression of VP16 regulates entry into the lytic program in neurons. Repeated reactivation does not appear to kill the neurons, indicating that the extent of virus replication must be limited.
The understanding of the biological properties of HSV-1 and the molecular mechanisms of virus replication have allowed the design of specialized vector systems for somatic gene therapy, oncolytic virotherapy, and vaccination.
HSV-1 BASED VECTOR SYSTEMS
HSV-1 is an attractive vector for gene therapy due to its (i) large transgene capacity, (ii) high transduction efficiency and broad cell tropism that includes both dividing and non-dividing cells, and (iii) ability to establish latency while maintaining at least some transcriptional activity. However,
as HSV-1 is a human pathogen, its use as a vector can result in host immune responses and cytopathogenic effects in patients, and possibly reactivation of and recombination with latent wild-type HSV-1. Taking these aspects into consideration, two different HSV-1-based vector systems, recombinant and amplicon, have been developed.
Initially, recombinant herpesviruses were constructed for functional studies of viral genes and development of vaccines. However, advances in site-specific modification of the viral genome facilitated the use of HSV-1 as a gene transfer vehicle [72]. Different approaches for the construction of recombinant HSV-1 vectors are based on the target tissue and purpose of gene delivery e.g. replication-conditional recombinant HSV-1 vectors are suitable for therapeutic treatment of tumors; replication-defective recombinant HSV-1 vectors are applied for gene replacement therapy [73]. Although some preclinical studies show promising results, several obstacles have to be overcome: (i) replication-defective mutants of HSV-1 can cause cytopathic effects in primary cultures of neuronal cells and inflammatory responses in neural tissue in vivo; (ii) most viral and nonviral promoters are silenced after injection into the brain. Therefore, the main focus in the development of new HSV-1-based vectors has been directed at achieving nontoxic, long-term gene expression in neurons.
The second type of HSV-1-based vector system, the HSV-1 amplicon vector, originated about three decades ago. Spaete and Frenkel analyzed the nature of defective virus genomes generated during the passage of standard HSV-1 stocks at high multiplicity of infection [74, 75]. Their investigations revealed that an ori and a pac signal were the only two cis-acting sequences required for the replication and packaging of defective virus genomes in the presence of trans-acting HSV-1 helpervirus (Fig. 2A). The word amplicon was used to delineate the fact that multiple copies of a DNA sequence of interest can be amplified in a head-to-tail arrangement in concatemeric defective virus genomes and packaged into HSV virions [76]. HSV-1 amplicon vectors share similar structural and immunological properties with the wild type HSV-1 particle, which can trigger cell signaling and cellular responses that may have a transient impact on cell homeostasis or gene expression. However, the lack of virus genes and protein synthesis reduces the risk of reactivation, complementation and recombination with latent or resident HSV-1 genomes.
HSV-1 amplicon vectors have been used to infect efficiently a number of different cell types, including
Fig. (1). Schematic representation of the HSV-1 genome. The HSV-1 genome is a linear double stranded DNA of approximately 152 kb in
size, composed of two unique segments, UL and US, which are flanked by inverted repeats, TRL /IRL and IRS/TRS. The minimal cis elements
required for HSV-1 DNA replication and packaging include the origin of DNA replication, ori, and the cleavage/packaging, pac, signals.
oriL oriSoriSpac pacpac
UL IRL USIRSTRL TRS
HSV/AAV Hybrid Vectors The Open Virology Journal, 2010, Volume 4 111
epidermal cells and dendritic cells in the skin [77, 78], some cell types in the cochlea [79, 80], hepatocytes [81], skeletal muscle [82], neurons [83], glioblastoma, and other tumor cells [84-86]. Despite the promising features of the HSV-1 amplicon vector as a gene delivery system, further developments concerning vector production, stability of transgene expression, and interaction with target cells are essential. Recently, the presence of bacterial sequences in the amplicon genome was shown to be responsible for the formation of inactive chromatin, leading to a rapid transgene silencing [87]. Strategies to increase the stability of transgene expression included the use of: (i) cell type-specific promoters [88, 89] and (ii) genetic elements from other viruses that confer genetic stability, such as integration of the transgene into host chromosomes [90, 91] or conversion of the amplicon genome into a replication-competent extrachromosomal element [92-95].
One of these strategies, the combination of genetic elements from HSV-1 amplicons and adeno-associated virus (AAV) to achieve site-specific integration of the transgene
into the host genome and long-term transgene expression is described in detail below, after a short introduction into AAV biology.
ADENO-ASSOCIATED VIRUS – BIOLOGICAL PROP- ERTIES
Adeno-associated virus (AAV) belongs to the genus Dependovirus within the subfamily Parvovirinae, family Parvoviridae [96]. Different AAV serotypes have been identified that can infect a broad range of species; about 11 serotypes and more than 100 variants of AAV infect primates. Based on serological studies, AAV serotypes 2, 3, and 5 most probably have a human origin [97, 98], while AAV4 appears to have originated in monkeys [99]. AAV6 shares some genomic similarities with AAV2 and AAV1, raising the hypothesis that a recombination event could have occurred in vivo or in cell culture [100, 101]. The AAV serotypes 1 to 6 were isolated as contaminants in laboratory adenovirus stocks, while AAV 7, 8, 9, 10, and 11 were isolated as DNA molecules using a “signature PCR”, a
Fig. (2). Viral vectors. A) HSV-1 amplicon. The HSV-1 amplicon contains three types of genetic elements: i) sequences from bacteria
(colE1 and ampR) that allow plasmid propagation in E. coli; ii) sequences from HSV-1, in particular an origin of DNA replication (ori) and a
DNA packaging/cleavage signal (pac), which allow replication and packaging of the amplicon DNA into HSV-1 particles in the presence of
HSV-1 helper functions in mammalian cells; and iii) a transgene cassette with the gene of interest. B) Recombinant AAV vector.
Recombinant AAV vectors are bacterial plasmids that contain the AAV ITRs flanking a transgene of interest. Replication of the ITR cassette
and packaging into AAV particles is achieved by supplying helpervirus functions and the rep and cap genes in cis or trans but outside the
ITR cassette. C) HSV/AAV hybrid amplicon. In addition to the HSV-1 amplicon elements, HSV/AAV hybrid amplicon vectors contain the
AAV rep gene and a transgene of interest flanked by AAV ITRs. D) HSV/EBV hybrid amplicon. In addition to the HSV-1 amplicon
elements, HSV/EBV hybrid amplicon vectors contain the EBV origin of DNA replication (oriP) and the gene encoding EBNA-1 which
together can support episomal retention and segregation of the vector in dividing cells. E) HSV/RV hybrid amplicon. In addition to the
HSV-1 amplicon elements, HSV/RV hybrid amplicon vectors contain the retrovirus (MoMLV) gag, pol, and env genes, and the RV LTRs
flanking a transgene of interest.
A B CampR
HSV-1 oriS AAVrep
colE1
HSV-1 pac
AAV
AAVITR
D E
transgeneAAV ITR
RVEBV RVgag, pol, env
RV LTR
EBVebna1
EBVoriP
RV LTR
LTRoriP
112 The Open Virology Journal, 2010, Volume 4 de Oliveira and Fraefel
screening-based strategy [102]. Despite being widespread among species and infecting different tissues, AAV infections have not been associated with any pathology. Primate AAV serotypes share significant sequence similarities, and the occurrence of cross-reaction of neutralizing antibodies may be species specific or depend on tissue type or route of administration [101, 103, 104].
The genome of AAV is a linear single stranded DNA of 4.7 kb, and either the positive or negative strand can be packaged with equal efficiency. The genome is flanked by inverted terminal repeats (ITR) of 145 bp, containing a palindromic sequence that forms a hairpin as a T-shaped secondary structure. The Rep binding site (RBS) and the terminal resolution site (TRS) are regions within the ITRs that play important roles in the replication and packaging of the AAV genome [105] (Fig. 3A). Two open reading frames (ORFs), Rep and Cap, are responsible for encoding overlapping proteins through alternative splicing (Fig. 3B). The Rep proteins, Rep78/68, and Rep52/40 are transcribed from two different promoters, p5 and p19, respectively, and are involved in DNA replication, transcription, and chromosomal integration. The p5 promoter contains a TATA box, a RBS, a TRS, the Yin Yang 1 (YY1) binding site, and a downstream sequence that can form a hairpin structure. The RBS is involved in Rep-mediated promoter regulation activity [106, 107], thus in the absence of helper functions small amounts of Rep are expressed that bind to the p5 promoter inhibiting transcription [108, 109]. The regulatory activity of Rep seems to be involved in the maintenance of a constant ratio of Rep and Cap proteins during infection in order to keep the balance between AAV genome replication and packaging. The Cap ORF encodes three overlapping proteins, VP1, VP2 and VP3, from a single promoter, p40. These structural proteins compose the AAV icosahedral capsid whose diameter ranges from 18 to 26 nm [110].
Fig. (3). Schematic map of the wild type AAV genome. A)
Secondary structure formed by the inverted terminal repeat, ITR.
Depicted are the Rep binding sites, RBEs, and the terminal
resolution site, TRS. B) The AAV genome expresses two clusters
of genes, rep and cap, from three different promoters, p5, p19, p40,
by alternative splicing.
The replication of the AAV genome is based on a “rolling hairpin model”. The hairpin structure at the ITR acts as a primer that converts the DNA into a double-stranded template, and together with the essential cis-acting elements RBS and TRS, and helpervirus functions, the replication and transcription of the AAV genome is initiated [111-113]. The Rep78/68 proteins play major roles in the replication process due to DNA-binding, endonuclease, and helicase activities. After binding to the RBS, Rep induces a site- and strand-specific nick at the TRS, creating a new genome end allowing the reinitiation of the synthesis and formation of a monomer extended form that can be packaged [114]. If the hairpin structure in the monomer turnaround form is not resolved before reinitiation on the other genome end, continued synthesis leads to double stranded dimer molecules, in which two genomes in the inverted orientations (head-to-head or tail-to-tail) are covalently joined by a single ITR [115]. Interestingly, the RBS and TRS signals located within the p5 promoter sequence have been demonstrated to act together as an alternative origin of DNA replication in the presence of adenovirus [116, 117] or HSV-1 helpervirus functions [108]. Replication from a plasmid cloned p5 replication origin led to the accumulation of large, head-to-tail linked concatameric replication products, which could readily be packaged into HSV-1 virions if the HSV-1 packaging/cleavage signal was included on the plasmid [108]. These findings indicate that the AAV p5 replication origin could substitute for the HSV-1 origin of DNA replication on HSV/AAV hybrid vectors (see below). AAV is a replication defective virus as it depends on a helper virus, such as adenoviruses [118], a herpesvirus [119-121], or vaccinia virus [122] for productive replication (Fig. 4). Helper viruses are also responsible for inducing a cell cycle arrest in late S or G2 phase, as in the case of adenoviruses [123] or for down regulating host cell functions as in the case of HSV-1 as the helpervirus [124, 125].
Many studies have assessed the different elements from the helperviruses required for AAV replication. A model has been proposed where the HSV-1 helicase/primase proteins constitute a scaffold that recruits ICP8, Rep and cellular replication (RPA) proteins to the self-primed AAV DNA into replication compartments [126-129]. The HSV-1 polymerase complex is preferentially used for AAV replication instead of the cellular machinery [113, 130]. Interestingly, an inhibitory effect of Rep78/68 proteins has been described on HSV-1 replication [131, 132], suggesting a regulatory effect of AAV over HSV-1, thereby limiting expression of HSV-1 early genes [113, 129].
In the absence of helpervirus, the AAV genome can integrate into a specific site termed AAVS1, on chromosome 19q13.3-qter of human cells [133-136] (Fig. 4). The integration is mediated by Rep78/68 and ITRs through a nonhomologous deletion/insertion recombination event [134, 136-143]. Also, an integration efficiency element (IEE) has been identified within the p5 promoter of AAV [144], and more specifically a 16-bp RBE was shown to be sufficient for AAV genome integration [145]. Rescue of the integrated AAV genome is possible by superinfection with helper virus [130]. Although HSV-1 ICP0 seems to contribute to the activation of the rep gene from latent AAV genomes [146],
A RBE‘
RBE TRSRBEITR TRS
B p5 p19 p40 poly A
Rep78
rep cap
ITRITR Rep78
Rep68
Rep52
Rep40
VP1
VP2/3
HSV/AAV Hybrid Vectors The Open Virology Journal, 2010, Volume 4 113
Fig. (4). The life cycle of AAV. Co-infection of AAV and
helpervirus, adenovirus or HSV-1, leads to viral gene expression,
viral DNA replication, and production of progeny virus. In the
absence of helpervirus, the genome of AAV can integrate into a
specific site on human chromosome 19. In the presence of
helpervirus, integrated AAV genomes are rescued and enter the
lytic replication cycle.
it is not sufficient to induce rep synthesis [130]. Some studies have demonstrated the autonomous replication of AAV under special conditions [147-149], however, the efficiency of replication is significantly lower than in presence of helpervirus functions.
AAV can infect different tissues and bind to unique cellular receptors, which can account for a serotype-specific tissue tropism. Several cellular receptors used by AAV for cell entry have been identified, including heparan sulfate [150], fibroblast growth factor receptor [151], and integrin alphaVbeta5 [152]. The initial steps of AAV infection, attachment to cellular glycosaminoglycan receptors and interactions with coreceptors seem to define the intracellular trafficking pathway of the capsid. Upon entry, AAV capsids are endocytosed via clathrin-coated pits [153], a process that requires dynamitin [154], and transported through both late and recycling endosomes. Trafficking in recycling endosomes appears to be favorable for efficient transgene expression [155]. The process of uncoating is still not well characterized [153, 156], however, AAV appears to enter the nucleus through a mechanism independent of the nuclear pore complex [157].
AAV BASED VECTORS
The broad cell tropism, lack of pathogenicity, and stable long-term gene expression make AAV an attractive vector for gene therapy [158]. AAV2 was the first AAV isolate to be developed into a recombinant vector for transgene delivery as it has been shown to infect a broad range of cell types in animal models [159], showing high efficiency in most of the tumor cells tested [160]. Recombinant AAV
vectors are constructed by replacing the Rep and Cap ORFs with a transgene of interest flanked by the ITRs. Rep, Cap and helper functions can be supplied in trans in order to allow replication of the transgene in the host cell [135] (Fig. 2B). Different methods of delivering helper functions have evolved, from co-infection with Ad or HSV-1 [161, 162], to plasmid-based protocols [163], and stable-expression by cell lines [164-166]. The development of a baculovirus based vector production method in insect (SF9) cells has also shown promising results [167, 168].
Recombinant AAV vectors have been tested in preclinical studies for a variety of diseases such as hemophilia, -1 anti-trypsin deficiency, cystic fibrosis, Duchenne muscular dystrophy, rheumatoid arthritis, prostate and melanoma cancer, Canavan disease [169], Alzheimer’s, and Parkinson’s [170].
Recombinant AAV have shown efficient transduction of different regions of the brain, and are currently used in several clinical trials for neurological disorders [171-173]. Increased interest in designing AAV vectors for the treatment of neurodegenerative diseases that require gene delivery to broad areas or very local and specific areas of the brain are now the focus of many studies [174]. AAV2 has been the most widely used AAV serotype for gene delivery to the CNS, transducing almost exclusively neurons in different brain structures [175-178], and supporting long-term transgene expression in the CNS [179-181] as well as in the dorsal root ganglia [182]. AAV2 has shown higher transduction efficiency in glioblastoma in vitro and in vivo when compared to serotypes 4 and 5 [183]. However, other studies have demonstrated a higher distribution and transduction in the CNS when using rAAV serotypes 1 and 5 [175, 184, 185]. The different AAV serotypes have been exploited on their ability to efficiently transduce distinct regions of the brain due to different cellular tropisms [174, 183, 186].
Immune Response to rAAV Vectors
The brain has been thought to be an immune privileged, compartmentalized organ that lacks an adaptive immune response. Some studies have suggested that viral vectors induce little immunogenicity, especially when injected once in the parenchyma of naïve animals [104, 187, 188], or that the presence of antibodies to both capsid proteins and transgene products seems not to correlate with reduction in transgene expression [187, 188]. Further studies with pre-immunized animals, however, established that circulating neutralizing antibodies can affect intracerebral rAAV-mediated transduction, and even suggested that the adaptive arm of the immune system can be primed by intracerebral rAAV2 administration [104].
Immune responses in the absence of expression of AAV genes have also been observed in naïve animals in a dose-dependent manner [104]. This has been suggested to occur due to the slow process of AAV capsid uncoating, thus allowing antigen presentation of processed capsid peptides by MHC-I, or by an immune reaction specific to the transgene [189, 190].
Improvements on rAAV Vectors
Despite the explicit advantages of rAAV as a vector for gene therapy, improvements in the regulation of transgene expression need to be achieved in order to confer safety.
– helpervirus+ helpervirus
Replication Integration
Chr.
19
+ helpervirus
Rescue
P k iPackaging & Egress
nucleus
114 The Open Virology Journal, 2010, Volume 4 de Oliveira and Fraefel
Much research is focused on efforts to limit vector spread, in order to achieve specific tissue or organ delivery, or to enable the transduction of tissues that are refractory to naturally occurring AAV vectors. Engineering of AAV vectors for altered tropism, enhanced transduction efficiency, and evasion of antibody neutralization includes manipulation of the AAV capsid by insertion of peptide ligands, conjugate-based targeting, and presentation of large protein ligands on the AAV capsid [191]. The diversity of AAV serotypes brings the possibility to evade preexisting immunity by engineering hybrid or pseudotyped AAV vectors derived from different serotypes [192-194].
Another strategy that focuses on the transduction efficiency is the improvement on the second-strand synthesis step during AAV replication (Fig. 5). The development of self-complementary AAV (scAAV) vectors relies on the packaging of an inverted repeat genome that can fold into dsDNA without the requirement for DNA synthesis or base-pairing between multiple vector genomes, thereby bypassing the rate-limiting second-strand DNA synthesis [195]. The scAAV vectors displayed enhanced transduction in comparison with conventional AAV vectors in some tissues and cancer cells but their efficiency still depends on tissue, cell type, and route of administration [196, 197].
Fig. (5). Comparison between self-complementary AAV
(scAAV) and rAAV vectors. scAAV delivers a dimeric inverted
repeated DNA molecule thereby bypassing the rate-limiting second-
strand DNA synthesis of rAAV.
Modifications on purification protocols using chromatography techniques have also contributed to increased yields of rAAV and to considerable elimination of contaminating infectious helper viruses [198-201].
HSV/AAV HYBRID VECTORS
Rationale on the Construction of Hybrid Vectors
Hybrid gene transfer vectors are designed to combine advantageous properties of different viruses to enhance efficiency of transgene delivery, vector stability and long-term transgene expression, while maintaining high safety standards [133, 202]. For example, the instability of HSV-1 amplicon vector delivered transgene DNA and transient transgene expression can be overcome by introducing genetic elements that allow the amplicon DNA to be maintained as an episome or to integrate into the host cell genome [203]. The maintenance of the DNA as a replicating episome with chromosome-segregating capability can be achieved by using oriP and the EBNA-1 gene from Epstein-Barr virus (EBV) [204]. Alternatively, viral elements such as AAV ITR and rep [91, 178], or retrovirus components [205] can be used to allow HSV-1 amplicon vector delivered transgenes to integrate into the cell genome. HSV-1 based hybrid vectors have also been constructed to facilitate the production of rAAV vectors.
Hybrid Vectors for the Production of rAAV Vectors
The efficiency of rAAV production for routine clinical use is a major concern, as most of the systems used for rAAV production rely on transfection protocols, thereby limiting scale-up procedures [206-209]. Replication defective rHSV-1 vectors lacking specific genes (e.g. ICP4, ICP27), which have been developed in order to reduce pathogenicity and cytotoxic effects in vector infected cells, can also be used as helper viruses for the production of rAAV vectors. Specifically, the ability of rHSV-1 that lack the ICP27 gene to efficiently act as a helper virus for rAAV production has been demonstrated [210] ; rAAV production in the absence of ICP27 appeared to be even enhanced. This may be due to the role of ICP27 in regulating transcription and translation of viral and cellular genes, for instance in the inhibition of splicing of host and AAV transcripts, which reduces synthesis of Rep and Cap proteins. The use of replication defective rHSV-1 to deliver AAV rep and cap has also been explored and is a very promising approach as it generates higher yields of rAAV with no detectable helpervirus contamination. Moreover, when allied to infection of a cell line that provides the rAAV template to be packaged, transfection steps can be avoided entirely for the production of rAAV [161, 211]. A protocol with a single infection step can also be accomplished by inserting an AAV ITR-flanked transgene (rAAV genome) cassette into the genome of the rHSV-1 helpervirus [210].
HSV/AAV Hybrid Vectors for Site-Specific Integration into AAVS1
Over the past 2 decades, the development of improved HSV-1 amplicon packaging systems, in particular the development of helper virus-free packaging systems, has greatly reduced toxicity and immunogenicity, but has had little effect on the stability of amplicon-mediated transgene expression [81, 212-214]. On the other hand, classical rAAV vectors have a small transgene capacity (~4.6 kb) and, due to the replacement of the rep and cap genes by transgenic sequences, do not conserve the potential of the parent virus for site-specific integration.
scAAVrAAV
gene expression
nucleus
HSV/AAV Hybrid Vectors The Open Virology Journal, 2010, Volume 4 115
HSV/AAV hybrid amplicon vectors have been developed to overcome these limitations. In addition to the standard HSV-1 amplicon elements, HSV/AAV hybrid vectors incorporate the AAV rep gene and a transgene cassette that is flanked by AAV ITRs (Fig. 2C). By placing the rep gene outside of the ITR cassette, it is not expected to integrate into the host genome. Loss of rep after integration of the ITR cassette eliminates a potential source of toxicity and the risk of rescue/excision of integrated ITR cassettes if the cell is infected by a helpervirus. Because HSV/AAV hybrid vectors can be packaged into HSV-1 virions, they conserve the high efficiency of gene transfer, the large transgene capacity, and the availability of helper virus-free packaging systems. However, after delivery into the host cell nucleus, the vector has the potential to act like AAV with rep-mediated site-specific integration of the ITR-flanked transgene cassette into the AAVS1 sequence of human chromosome 19 [91].
The initial study on HSV/AAV hybrid vectors demonstrated that these vectors can be packaged into HSV-1 virions by using either helper virus-dependent or helper virus-free packaging systems [81, 215]. Hybrid vectors supported transgene retention and expression significantly longer than standard amplicons [215]. Although the possibility of transgene integration had not been specifically addressed in that study, the percentage of cells expressing the transgene was consistently higher with hybrid vectors that contained the rep gene than with those without rep, or with standard amplicons.
Two other studies have specifically addressed the question whether HSV/AAV hybrid vectors mediate genomic integration, both randomly or site-specifically at the AAVS1 site on human chromosome 19 [91, 178]. Heister and colleagues constructed HSV/AAV hybrid vectors that contained enhanced green fluorescent protein (EGFP) reporter gene flanked by the AAV ITRs and AAV rep. Replication assays demonstrated that both the AAV elements and the HSV-1 elements were functional in the context of the hybrid vector, as shown by the presence of replication intermediates of the ITR-flanked transgene cassette and high molecular-weight concatemeric products of replication from the HSV-1 origin of DNA replication. Such hybrid vectors could be packaged into HSV-1 virions, although the rep sequences incurred a drastic (20 to 2,000-fold) reduction in titers. Site-specific integration at AAVS1 was directly demonstrated by PCR and sequence analysis of ITR-AAVS1 junctions in transduced human 293 cells. The junctions were similar to those that had been identified in cells infected with wt AAV [133, 134, 138, 139, 216-218]. Similar results were obtained by Wang and colleagues who have used also 293 cells and extended the study to other cell lines, including glioma cells (gli36) and primary myoblasts [178]. These investigators used HSV/AAV hybrid vectors that contained rep68 and rep78, or no rep, and an ITR-flanked transgene cassette that consisted of an EGFP reporter gene and a neomycin resistance gene. In order to overcome the low-titer packaging problem inherent to the rep gene, they worked on position/orientation effects and found that a decent amplicon vector titer is achieved when the rep genes are placed downstream of the ITR cassette in the forward orientation. Rep mediated a significantly improved efficiency of stable tranduction in all human cells tested, including 293 cells, glioma cells and primary myoblasts. Although neomycin
selection was employed for cell cloning, a high proportion of the stably transduced cells had the transgene sequences correctly integrated at the AAVS1 site. In summary, inserting the AAV ITRs and rep genes into an HSV-1 amplicon considerably improved the frequency of stable transgene expression in various proliferating human cell types. Integration events of 4-5 kb ITR-flanked transgene cassettes occurred at a rate of approximately 10-30 % of the HSV/AAV hybrid vector infected cells, and about 50% of those events occurred specifically at the AAVS1 locus [91, 178]. The potential for AAVS1-specific integration and expression of an entire gene under control of its endogenous promoter using the HSV/AAV vector has also been evaluated. Large functional inserts (approximately 100 kb) could be integrated at the AAVS1 site but with a reduced efficiency [219, 220].
While the expression of rep78/68 has been demonstrated to be essential for the ability of HSV/AAV hybrid vectors to mediate site-specific integration, Rep proteins have a strong inhibitory effect on the HSV-1 replication machinery [91, 132, 178, 221]. As a consequence, the titers of HSV/AAV hybrid vectors are up to 2000-fold lower than those of standard amplicon vectors [91]. This could be due to (i) the toxicity of Rep, resulting in compromised cell metabolism [222], (ii) the ability of Rep to inhibit HSV-1 replication [131, 132], or (iii) the excision of ITR-flanked sequences from the amplicon DNA during packaging.
Potential improvements of the HSV/AAV amplicon vectors may rely on the appropriate use of the p5 promoter sequence. Indeed, the p5 promoter driving the expression of rep78/68 in the afore described HSV/AAV hybrid vectors [91, 178] may promote vector-backbone integration [144, 223] owing to its location outside of the therapeutic transgene cassette. In addition, it may also interfere with site-specific integration of the p5-free ITR-flanked transgenes. Transferring the p5 promoter sequence from the rep expression cassette to the transgene cassette may not only solve the problem of inadvertent integration of vector backbone sequences but also increase the efficiency of site-specific integration of the ITR cassette [144, 223].
Liu et al. developed a strategy to overcome the negative effect of AAV Rep on hybrid vector replication and packaging [224]. These investigators designed an HSV/AAV hybrid vector in such a way that little or no rep was expressed during packaging. However, rep was expressed in transduced cells if Cre-recombinase was provided; following site-specific integration, rep was suppressed again. These vectors mediated stable expression in 22% of transduced Cre-expressing 293 cells. Of those cells, approximately 70% transduction efficiency was achieved by Rep-mediated site-specific integration.
The finding that concatameric plasmid replication products from the AAV p5 replication origin can be packaged into HSV-1 virions if HSV-1 pac is included on the plasmid [108] could lead to the construction of a novel generation of HSV/AAV hybrid amplicon vectors which replicate from a heterologous origin of DNA replication. Such a vector system would have several advantages: first, as described by Philpott and coworkers, the AAV p5 element can efficiently mediate site-specific vector integration into AAVS1 on human chromosome 19 and support long term
116 The Open Virology Journal, 2010, Volume 4 de Oliveira and Fraefel
transgene expression [144, 225]. Second, the AAV p5 replication origin is not inhibited by rep expression, but instead depends on the presence of AAV Rep protein in the replication/packaging process [108, 116, 117].
The HSV-1 virion contains three proteinaceous compartments for delivery - envelope, tegument, and capsid – which could all be used to deliver functional foreign proteins by fusion with virion components [226]. For example, AAV Rep could be fused with VP16, an abundant HSV-1 tegument protein that enters the cell nucleus along with the virus genome. This would allow eliminating the rep gene from the HSV/AAV hybrid vector genome, as Rep protein could enter the cell nucleus as a fusion with VP16 and there may mediate efficient site-specific integration of the transgene sequences via p5 or ITRs.
The full potential of HSV/AAV hybrid vectors still needs to be evaluated for site-specific integration in vivo, for example in transgenic mice that carry the human-specific AAVS1 genomic element [227]. As murine [228] and simian [229] AAVS1 orthologs have been found, AAV2 likely can mediate site-specific integration in other species as well.
Future perspective and clinical use of HSV/AAV hybrid vectors are closely linked to standard HSV-1 amplicon vectors as both vector systems depend on the same packaging procedure. Helper virus-free packaging systems require transient transfection of vector DNA and packaging-defective HSV-1 helper DNA, which limits scale up potential. The use of amplicon vectors for clinical trials depends, therefore, on the design of novel packaging procedures that allow the production of large amounts of vector stocks with high titers. Strategies to overcome the adverse effects of the AAV rep gene on the titers of HSV/AAV hybrid vectors have been discussed above. The presence of the genetic elements from AAV on HSV-1 amplicon vectors should not add additional safety concerns to the amplicon system, as AAV is not known to be pathogenic in humans and AAV vectors are already being used in clinical trials.
OTHER HYBRID AMPLICON VECTORS
HSV/EBV Hybrid Vectors
Epstein-Barr virus, a human Gammaherpesvirus, has also been used as a hybrid partner with HSV-1 amplicons, due to its potential to persist as an extrachromosomal element in B-lymphocytes [230]. The EBV nuclear antigen (EBNA-1) and the origin of DNA replication (oriP) are the sole elements necessary for the long-term episomal retention and are therefore incorporated into the HSV-1 amplicon backbone to support replication and mitotic segregation of the amplicon concatenate in the host cell nucleus [231, 232] (Fig. 2D). HSV/EBV hybrid amplicon vectors have been demonstrated to efficiently transduce various human cells in culture and to support retention of vector sequences in dividing human cells [205]. Stable expression from large transgenes has also been demonstrated [233, 234]. Maintenance of transgene DNA in an episomal state as opposed to genomic integration reduces adverse effects in the host cell. However, long-term expression by these vectors depends on selective pressure and expression of EBNA-1 [95, 235]. In order to circumvent
the potential immunogenic and oncogenic properties of EBNA-1 [236], the use of a human episomal retention element (scaffold/matrix attachment region (S/MAR) from the human -interferon gene to generate a novel HSV-1 amplicon-based episomal vector has shown great potential even in the absence of selection pressure [93].
HSV/RV Hybrid Vectors
Elements from retroviruses (RV) have been combined with HSV-1 amplicons in order to achieve prolonged transduction of transgenes. Retroviruses, such as Moloney murine leukaemia virus (MoMLV), integrate randomly into the genome of dividing cells, and produce viral progeny without killing the host cell [237]. Due to the low efficiency of gene transfer, MoMLV –based vectors have been mostly used for ex vivo gene therapy protocols [238, 239]. Although this strategy has shown some therapeutic success in experimental brain tumors [240, 241] it is not effective when used in human trials [242-245]. HSV/RV hybrid amplicon vectors containing genetic elements from MoMLV have been developed in order to transduce genes required for the de novo synthesis of small defective retrovirus vectors. These hybrid vectors contain the long terminal repeat sequences (LTRs) flanking a transgene cassette, and the gag, pol, and env genes in a separate cassette (Fig. 2E). The LTRs and psi sequence comprise the signals necessary for packaging of virion RNA, reverse transcription, and integration into host cell genome. HSV/MoMLV hybrid vectors have indeed been demonstrated to support the packaging of genomic retrovirus RNA expressed from the amplicon vector into MoMLV particles and accomplish integration and transgenic expression in infected naïve cells [246]. One point of caution, however, is the danger of endogenous retroviruses complementing retroviral elements in hybrid vectors. The possibility that endogenous integrases can act on LTRs in hybrid amplicon vectors has indeed been demonstrated [247]. In order to enhance the transduction efficiency of a therapeutic gene in vivo and increase its expression stability, hybrid vectors containing elements from more than 2 viruses have been developed as well. These tribid vectors are based on HSV-1 amplicon vectors and contain elements from MoMLV and either EBV or AAV [205, 248].
REFERENCES
[1] Davison MD, Rixon FJ, Davison AJ. Identification of genes
encoding two capsid proteins (VP24 and VP26) of herpes simplex virus type 1. J Gen Virol 1992; 73 (Pt 10): 2709-13.
[2] Beard PM, Taus NS, Baines JD. DNA cleavage and packaging proteins encoded by genes U(L)28, U(L)15, and U(L)33 of herpes
simplex virus type 1 form a complex in infected cells. J Virol 2002; 76: 4785-91.
[3] Jacobson JG, Yang K, Baines JD, Homa FL. Linker insertion mutations in the herpes simplex virus type 1 UL28 gene: effects on
UL28 interaction with UL15 and UL33 and identification of a second-site mutation in the UL15 gene that suppresses a lethal
This is an open access article licensed under the terms of the Creative Commons Attribution Non-Commercial License (http: //creativecommons.org/licenses/by-nc/
3.0/) which permits unrestricted, non-commercial use, distribution and reproduction in any medium, provided the work is properly cited.
5. Acknowledgements
I would like to thank
F. A. M., Rijsewijk for his inspiring ideas
M. Ackerman for opening the door, and for the always interesting discussions
C. Fraefel for accepting into his group, and giving the possibility for my PhD
C. Fraefel, L. Enquist, and U. Greber for their great contribution during my work
A. Hehl, E. M. Schraner, U. Ziegler, and P. Wild for teaching and advising on microscopy techniques
B. de Andrade Pereira, C. Dresch, D. Glauser, A. Laimbacher, M. Seyffert, R. Vogel, M. Wickert, C. E.
Lange, A. D’Antuono, F. Caccuri, C. Palacios, for all the discussions and moments that made us grow
as scientists and human beings
R. Castro, R. Labhart, E. Loepfe, B. Salathe, K. Tobler, and B. Vogt, for advices, and all sort of help
C. Eichwald, M. Engels, A. Metzler, and M. Schwyzer, for the interesting discussions
S. Andersen, K. Dietze, and T. Baumann for helping on burocratic matters
To all for their relevant advices and friendship
Special thanks to
my family, Fabio and his family for always supporting my decisions
my previous bosses A. G. Fett-Neto, J. P. Fett, P. M. Roehe, A. Simonetti
all my friends
CURRICULUM VITAE
April/2011
1. Personal data and address
Name: Anna Paula de Oliveira
Parents: Mauro Pereira de Oliveira and Anna Maria de Oliveira