Hepatitis E Virus: Identification and evaluation of the ...epubs.surrey.ac.uk/855396/1/U606696.pdf · Hepatitis E Virus: Identification and evaluation of the potential for zoonotic

Hepatitis E Virus: Identification and evaluation of the potential for zoonotic

transmission in the pork food chain

Animal Health and Veterinary Laboratories Agency (AHVLA), Virology

Department, Addlestone, Surrey, United Kingdom & Faculty of Health and Medical

Science, Microbial Sciences Division, University of Surrey, Guildford, Surrey,

United Kingdom & Central Veterinary Institute, Wageningen University and

Research Centre (CVI), Department of Virology, Lelystad, The Netherlands

A thesis submitted in accordance with the requirements of the degree of Doctor of

Philosophy in Microbial Sciences

August 2012

©Alessandra Berto

( T AHVLAAnimal Health and

Æ Veterinary Laboratories j Agency

U N I V E R S I T Y O FSURREY W A G E N I N G E N

ProQuest Number: U606696

All rights reserved

INFORMATION TO ALL USERS The qua lity of this reproduction is d e p e n d e n t upon the qua lity of the copy subm itted.

In the unlikely e ve n t that the au tho r did not send a co m p le te m anuscrip t and there are missing pages, these will be no ted . Also, if m ateria l had to be rem oved,

a no te will ind ica te the de le tion .

uestProQuest U606696

Published by ProQuest LLO (2019). C opyrigh t of the Dissertation is held by the Author.

All rights reserved.This work is protected aga inst unauthorized copying under Title 17, United States C o de

M icroform Edition © ProQuest LLO.

ProQuest LLO.789 East Eisenhower Parkway

P.Q. Box 1346 Ann Arbor, Ml 4 81 06 - 1346

STATEMENT OF ORIGINALITY

This thesis and the work to which it refers are the results of my own efforts. Any ideas, data, images or text resulting from the work of others (whether published or unpublished) are fully identified as such within the work and attributed to their originator in the text, bibliography or in footnotes. This thesis has not been submitted in whole or in part for any other academic degree or professional qualification. I agree that the University has the right to submit my work to the plagiarism detection service TurnitinUK for originality checks. Whether or not drafts have been so- assessed, the University reserves the right to require an electronic version of the final document (as submitted) for assessment as above.

Alessandra Berto (PhD Candidate)

Signature:............ Date:

Acknowledgments

No one walks alone on the journey of life. I would like to start to thank those that

joined me, walked beside me, and helped me along the way.

In fact a part of my big effort, the success of this project depends largely on the

encouragement and guidelines of many others.

First and foremost, I would like to thank to my supervisors, Dr. Malcolm Banks, Dr. Wim H.M. van der Poel, Dr. Francesca Martelli and Dr. Lisa Roberts for the valuable guidance and advice. They inspired me greatly to work in this project. Their willingness to motivate me contributed tremendously to my project and my scientific skills.

Besides, I would like to thank all my friends, mainly the VI5 PhD students at AHVLA, in particular Sosan Obulukola (Buki) that a part of feeding me with Nigerian food, she helped me to be stronger during these 3 years. Others two good friends are Victor Riitho my IT support and Sophie Morgan my English dictionary.

Sylvia Grierson not only helped me under the seientific aspect but she was/is my Scottish mentor.

An honorable mention goes to my parents and brother for their understandings and supports on me in completing this project.

Finally, I wish to express my love and gratitude to Ruben for his understanding & endless love through the duration of my studies.

Without the help of the particular that I mentioned above, I would have faced many difficulties while doing this.

Table of contentsABBREVIATION TABLE.............................................................................................. x

Abstract.............................................................................................................................. 1

CHAPTER 1 General Introduction..................................................................................3

.1 Hepatitis E virus aetiology......................................................................................... 4

.1.1 Hepatitis E in non-endemic regions........................................................................8

. 1.2 Hepatitis E in disease-endemic regions................................................................. 8

.2 Morphology and Genomic organization..................................................................10

.3 Viral proteins.............................................................................................................14

.3.1 Methyltransferase................................................................................................... 14

.3.2 Papain-like cysteine protease................................................................................ 15

.3.3 Helicase...................................................................................................................15

.3.4 RNA-dependent RNA polymerase (RdRp)......................................................... 15

.3.5 0RF2 and the major capsid protein......................................................................16

.3.6 ORF3 and its product.............................................................................................19

.4 The HEV replication cycle....................................................................................... 22

.4.1 Viral receptor and entry........................................................................................ 22

.4.2 Model of HEV replication.................................................................................... 22

.5 Potential targets for the development of antiviral drugs........................................ 25

.6 HEV inactivation studies......................................................................................... 26

.7 Taxonomy: Evolutionary History and Population Dynamics of Hepatitis E Virus

28

.8 Genotype classification.............................................................................................31

.9 Epidemiology of H EV ..............................................................................................34

.9.1 Epidemiology in humans...................................................................................... 34

.9.2 Epidemiology in pigs and other animals.............................................................. 43

.10 Pathogenesis, clinical signs and symptoms.......................................................... 44

.10.1 In humans............................................................................................................. 44

.10.2 In pigs....................................................................................................................48

.11 Diagnostic procedures.............................................................................................50

.11.1 ELISA...................................................................................................................50

.11.2 Conventional RT-PCR.........................................................................................51

. 11.3 Real time RT-PCR...............................................................................................51

IV

1.11.4 Negative strand detection.................................................................................... 52

1.11.5 Cell culture and new technology for in-vitro propagation of the virus............52

1.11.6 Microscopy.......................................................................................................... 56

1.11.6.1 Confocal microscopy....................................................................................... 56

1.11.6.2 Electron microscopy, transmission and scanning.......................................... 57

1.12 Vaccination............................................................................................................. 57

1.12.1 HEV vaccination modelling in pigs................................................................... 58

1.13 Aims of the VITAL PhD project...........................................................................61

CHAPTER 2 VITAL Ring Trial.................................................................................... 64

Introduction......................................................................................................................65

Materials and methods....................................................................................................66

2. 1 Virus concentration and nucleic acid extraction....................................................66

2.1.1 Sampling and virus concentration in pork liver tissue........................................ 66

2.1.2 Nucleic acid extraction from pork liver tissue.....................................................66

2.1.3 Sampling and virus concentration from soft fruit................................................67

2.1.4 Nucleic acid extraction from soft fruits............................................................... 68

2.2 Positive standards construction................................................................................ 69

2.3 Real time PCR protocols.......................................................................................... 70

2.3.1 Quantification of adenovirus by real-time PCR...................................................70

2.3.2 Detection and quantification of Murine Norovirus by real-time RT-PCR 71

2.3.3 The internal amplification controls (lACs)..........................................................71

2.4 Data interpretation:...................................................................................................77

Results..............................................................................................................................78

2.5 Detection of spiked Human Adenovirus in raspberries samples......................... 78

2.6 Detection of spiked Human Adenovirus in liver samples....................................81

2. 7 Discussion.................................................................................................................84

CHAPTER 3 Hepatitis E virus in the UK pork food chain......................................... 85

3.1 Introduction: VITAL Data gathering.......................................................................86

Materials and Methods.................................................................................................... 87

3.2 UK sampling scheme................................................................................................87

3.2.1 Sample collection................................................................................................... 87

3.2.1.1 Slaughterhouse.....................................................................................................87

3.2.1.2 Processing/cutting point:.................................................................................... 87

V

3.2.1.3 Point of sale:....................................................................................................... 88

3.3 Sample preparation and nucleic acid extraction:....................................................88

3.4 Real time PCR........................................................................................................... 89

3.4.1 HEV........................................................................................................................89

3.4.2 PAdV.......................................................................................................................90

3.4.3 MNoV.....................................................................................................................90

3.4.4 HAdV......................................................................................................................91

3.4.5 Internal assay controls........................................................................................... 91

3.4.6 Positive standards construction.............................................................................92

Results..............................................................................................................................96

3.5 HEV detection........................................................................................................... 96

3.5.1 PAdV detection......................................................................................................97

3.5.2 HAdV detection.....................................................................................................97

3.6 Discussion................................................................................................................. 99

CHAPTER 4 Replication of Hepatitis E virus in three-dimensional cell cultures system.......................................................................................................................103

4.1 Introduction............................................................................... ............................ 104

4.2 Use of the 3D Culture system to investigate the viability of HEV detected by RT-

PCR in UK pork sausage and French liver sausage (figatelli)..............................106

4.3 Propagation of HEV in cell cultures.................................................................107

4.3.1 Comparison of efficiency of the 3D and 2D cell culture for HEV replication

.........................................................................................................................................107

4.3.2 Inoculum preparation:.................................................................................... 108

4.3.3 Infection of the cells:........... 108

4.3.4 Comparison of 3D, 2D and 3D transferred to 2D cell cultures for HEV

replication.................................................................................................................109

4.3.5 RNA extraction from supernatant of 3D cell cultures, 2D cell cultures and 3D

cell transferred to 2D system infected with HEV..................................................110

4.3.6 Real Time RT-PCR.........................................................................................110

4.3.7 Positive strandard and copy number quantification..................................... 110

4.3.8 Definition of Ct values:.................................................................................. 112

4.4 Materials and Methods to investigate the viability of HEV in UK sausages and

figatelli samples................. 112

VI

4.4.1 Cell Preparation................................................................................................... 108

4.4.2 Inoculum preparation of figatelli sample and UK sausages:............................112

4.4.3 Cell inoculation....................................................... 113

4.4.4 Determination of infectivity of progeny virus...................................................113

4.4.5 RNA extraction and real time RT-PCR............................................................. 113

4.4.6 Electron microscopy............................................................................................113

Results............................................................................................................................ 115

4.5 Comparison of HEV replication in 3D cell and 2D cell culture systems........... 115

4.6 Evaluation of the infectivity of the viral progeny and comparison of HEV

replication in 3D and 2D culture systems and 3D cells transferred into 2D............. 115

4.7 Results of the use of the 3D cell culture system to investigate the viability of

HEV in UK sausages and French liver sausages (figatelli)....................................... 121

4.8 Discussion................................................................................................................125

4.8.1 HEV replication in the 3D cell culture system.................................................. 125

4.8.2 Discussion of the use of the 3D cell culture system to investigate the viability

of HEV in the UK sausages and French liver sausages (figatelli)............................. 129

CHAPTER 5 Inactivation studies................................................................................ 132

5.1 Heat inactivation..................................................................................................... 133

5.2 UV light and NaOCl HEV inactivation studies.................................................... 134

Materials and Methods.................................................................................................. 137

5.3 Cells preparation:.................................................................................................... 137

5.3.1 Heat inactivation experiment.............................................................................. 137

5.3.1.1 Inoculum preparation...................... 137

5.3.1.2 Infection of the 3D cells....................................................................................137

5.4. UV inactivation experiments................................................................................ 138

5.4.1 Preparation of the inoculum................................................................................ 138

5.4.2 HEV UV inactivation procedure......................................................................... 138

5.4.3 Inoculation of cultures and sample collection................................................... 139

5.4.4 Electron microscopye........................................................................................... 139

5.4.5 Sodium hypochlorite inactivation....................................................................... 140

5.4.5.1 Preparation.........................................................................................................140

5.4.5.2 Treatment...........................................................................................................140

5.4.6 RNA extraction and Real Time RT-PCR...................... 141

VII

Results............................................................................................................................ 142

5.5.1 Heat inactivation treatment................................................................................. 142

5.5.2 Homogenate of HEV positive liver exposed to UV light to test HEV

inactivation..................................................................................................................... 144

5.5.2.1 Homogenate of HEV positive liver treated for 30 min to UV light.............. 148

5.5.2.2 Electron microscopy result.............................................................................. 148

5.5.3 Inactivation of HEV positive supernatant with 5% of NaOCl........................152

5.6 Discussion............................................... 154

5.6.1 Homogenate of HEV positive liver heated at different temperatures.............. 154

5.6.2 Inactivation of HEV positive supernatant with UV light.................................. 156

5.6.3 Inactivation of HEV positive supernatant with 5% of NaOCl.......................... 159

CHAPTER 6 Prevalence and transmission of hepatitis E virus in domestic swine population in different European countries..................................................................162

6.1 Pig dynamics of transmission modeling study...................................................... 163

6.1.1 Introduction...........................................................................................................164

Materials and methods.................................................................................................. 167

6.2 Samplings.................................................................................................................167

6.3 RNA extraction and RT-PCR procedures..............................................................168

6.3.1 UK 2007 and 2008.............................................................................................. 168

6.3.2The Netherlands, Portugal, Italy, Spain and Czech Republic............................ 168

6.3.3 HEV transmission modelling.............................................................................. 169

Results.............................................................................................................................171

6.4 Discussion............................................................................................................. 175

CHAPTER 7 Overall discussion...................................................................................178

References...................................................................................................................... 187

Appendix........................................................................................................................200

Appendix A: Attempted construction of an interferon Knock-out cells line...........202

Appendix B: Multicenter collaborative trial evaluation of a method for detection of

human adenovirus in berry fruit................................................................................... 209

Appendix B.l: Transmission dynamics of hepatitis E virus in pigs: Estimation from

field data and effect of vaccination.............................................................................. 216

VIII

Appendix B.2: Prevalence and transmission of hepatitis E virus in domestic swine

populations in different European countries............................................................... 223

Appendix C.l: VITAL SOP 001: Sampling and virus concentration from faeces..236

Appendix C.2: VITAL SOP 002, sampling and virus concentration from harvester's

hands.............................................................................................................................. 240

Appendix C.3 VITAL SOP 005, sampling and virus concentration from soft fruit

.........................................................................................................................................244

Appendix C.4: VITAL SOP 009, sampling and virus concentration from pork meat

and liver tissue.............................................................................................................. 250

Appendix C.5: VITAL SOP 010, nucleic acids extraction from faeces.................. 253

Appendix C.6: VITAL SOP Oil, nucleic acids extraction from pork meat and liver

tissue.............................................................................................................................. 257

Appendix C.7: VITAL SOP 012, nucleic acids extraction from soft fruit..............260

Appendix C.8: VITAL SOP: 013, nucleic acids extraction from harvester's hands..

.........................................................................................................................................263

Appendix C.9: VITAL SOP 014: general protocol for the quantification of

adenovirus by real time PCR....................................................................................... 266

Appendix C.IO: VITAL SOP 015, detection and quantification of porcine

adenovirus by real time PCR....................................................................................... 271

Appendix C .ll: VITAL SOP 020, detection and quantification of hepatitis E virus

by real time RT-PC R ...................................................................................................277

Appendix C.12: VITAL SOP 021 detection and quantification of murine norivirus

by real time RT-PCR....................................................................... 283

Appendix C.13: virus detection by RT-PCR: details on quality controls, virus

detection and quantification..........................................................................................289

Appendix C.14: VITAL SOP 023, protocol for the establishment of lAC

incorporation..................................................................................................................294

List of publication, training courses and conferences.................................................297

IX

ABBREVIATION TABLE

Abbreviation DefinitionATCC American Type Culture CollectionALT Alanine aminotransferaseCLD Chronic liver diseaseCSF Cerebrospinal fluidCt Cycle thresholdDpi Day post infectionELISA Enzyme-linked immunosorbent assayET-NANBH Enterically non-A non-B HepatitisODD or GAD Glycine Aspartate-AspartateHACCP Hazard Analysis and Critical Control Point

HAY Hepatitis A virusHCV Hepatitis C virusHEV Hepatitis E virusHPA Health Protection AgencyHAdV Human AdenoviruslAC Internal assay controlMC Monte Carlo modelMoNV Murine NorovirusNa2S203 Sodium thiosulphateNaOCl Sodium hypochloriteNsp Nonstructural proteinNTC No template controlOIE Organisation for animal healthORE Open reading framePaDV Porcine AdenovirusPBS Phosphate Buffered SalinePEG Polyethylene glicolPLC/PRF/5 Hepatocarcinoma cell lineRdRp RNA-dependent RNA polymeraseRT-PCR Reverse transcriptase- PCRRWV Rotating Wall VesselSIR Susceptible, infectious, recover (model)SOP Standard operating procedureSPC Sample process controlSTATl Signal transducer and activator of transcription 1UNG Uracil N-glycosylaseUSDA United States Department of Agriculture

X

UTR Untranslated regionUV light Ultraviolet lightVITAL Integrated Monitoring and Control of Food borne

Viruses in European Food Supply Chain

XI

PageFigures /Tables description number

Figure 1.1: Geographical distribution of human HEV disease pattern and human HEV isolates Page 5

Table 1.2: Differences in epidemiological and clinical featuresassociated with hepatitis E in disease-endemic and non-endemic region Page 10

Figure 1.3: Genome organization and proteins of HEV Page 11

Figure 1.4: role of the ORE 3 protein in HEV pathogenesis Page 19

Figure 1. 5: Proposed replication cycle of HEV Page 22

Figurel.6: Phylogenetic tree based on complete genomic sequences of selected human and swine hepatitis E virus Page 30

Figure 1.7: A phylogenetic tree based on the complete genomicsequences of 30 human, swine, and avian HEV strains Page 33

Table 1.8 Risk factors for asymptomatic hepatitis E virus infection in a random sample of Mornay population, Darfur, Sudan, September 2004 Page 36

Figure 1.9: Epidemic region, Kashmir, 1978 Page 37

Figure 1.10: Rotating Wall Vessel motor Page 52

Table 2.1: Graphic representation of pFBV2 containing the sequence ofthe synthetic DNA Page 70

Table 2.2: Adenovirus oligonucleotides Page 71

Table 2.3: Mumine norovirus oligonucleotides Page 71

Table 2.4: lAC constructions Page 72

Table 2.5: Results of analysis of raspberry artificially contaminated with HIGH titre of Human Adenovirus Page 75

Table 2.6: Results of analysis of raspberry artificially contaminated with LOW titre of Human Adenovirus Page 75

Table 2.7: Results of analysis of raspberry non artificially contaminatedwith Human Adenovirus Page 76

Table 2.8: Percentage of concordance for raspberry sample Page 76

XII

Table 2.9: Results of analysis of liver artificially contaminated with Page 78HIGH titre of Human Adenovirus

Table 2.10: Results of analysis of liver artificially contaminated with LOW titre of Human Adenovirus Page 78

Table 2.11: Results of analysis of liver non artificially contaminated with Human Adenovirus Page 79

Table 2.12: Percentage of concordance for liver samples between results provided at AHVLA and by the ring trial leader Page 79

Table 3.1: Source of surface swab samples Page 90

Figure 3.2 Graphic representation of pCR2. ITOPO-rSTD Page 91

Table 3.3: Number of samples PAdV, HEV and HAdV positive Page 94

Table 4.1: GTSF-2 complex medium Page 110

Table 4.2: Copy numbers of HEV genome detected in the 3D culture and2D cells Page 114

Figure 4.3: Comparison of Ct values in the 3 cell culture systems Page 115

Figure 4.4: copy number per ml detected in the 3D cells culture systemof the serial dilution Page 116

Table 4.5: HEV RNA detected by real time RT-PCR in supernatant ofHEV positive cells infected with French figatelli Page 118

Figure 4.6: supernatant of cells infected with UK sausages tested by realtime RT-PCR Page 119

Figure 4.7: HEV-like particle in HEV positive supernatant in figatelli sample Page 120

Figure 5.1: Treatment of HEV infected liver at 100° C leads to inactivation of the virus Page 139

Figure 5.2: Analysis of the Variation overtime the UV light inactivation experiment in the supernatant of the 3D cell cultures Page 142

Figure 5.3: HEV decay measured in the inoculum by real time RT-PCRafter the UV light treatment Page 143

Figure 5.4: analysis of CT values of supernatant of 3D cells infectedwith inoculum treated with UV light for 30 min. Page 146

XIII

Figure 5.5: HEV-like particle Page 147

Figure 5.6: analysis of Ct values of HEV positive supernatant treatedwith NaOCl and untreated Page 149

Figure 6.1: HEV swine prevalence in six different EU countries. HEV prevalence plotted for six countries and 5 pig age groups Page 169

Table 6.2: Transmission rate parameter, average of infectious period and reproductive number. Page 170

XIV

Abstract

Hepatitis E is an acute hepatitis in humans, first recognised in 1980 and caused by

hepatitis E virus (HEV). The principal mode of spread of HEV is faecal-oral from

contaminated water supplies, almost exclusively in developing regions.

Accumulating evidence indicates that HEV transmission may be zoonotic in

developed regions from swine and perhaps other animal species serving as

reservoirs for the virus. The exact transmission routes are unclear, largely because

HEV is extremely difficult to propagate in vitro, but retail pig products have been

shown to contain HEV RNA.

This PhD project was part of the EU FP7 project VITAL (Integrated Monitoring

and Control of Food borne Viruses in European Food Supply Chains). The main

aim of this PhD project was to investigate the presence and residual infectivity of

HEV in the pork food chain. This helped to assess the potential importance of the

pig and its products in zoonotic transmission of HEV. A cell culture system for

HEV was further optimised for HEV detection in food samples.

A productive HEV infection was established in 3D cell culture (Alexander

hepatoma PLC/PRF/5) that was permissive for HEV replication. Furthermore, a

trial to compare the efficiency of 3D, 2D and 3D transferred to 2D cells culture

systems was performed indicating that replication in the 3D cell culture system was

the most efficient. In addition, these studies showed that cells grown in 3D and then

transferred to 2D for infection were able to support HEV replication. Further

refinements such as heat, UV light and sodium hypochlorite inactivation studies

were performed. These approaches should enable an assessment of the significance

of the pork food chain in transmission of HEV and facilitate the development of

control measures.

Within the VITAL project standard methods were developed to have common viral

detection and extraction methods between all laboratories, and ring trials were

organized between 15 EU laboratories to assess the efficacy of the Standard

Operating Procedures (SOPs) developed. Since all the laboratories involved were

able to detect the viruses with the common SOPs the ring trial was considered

successful and the second step of the project began, involving the screening by real

time RT-PCR for HEV throughout the pork food chain. One of 40 pig livers and 6

of 63 pork sausages were found to be HEV positive. Virus viability was tested using

the 3D cell culture system but no evidence of viral replication was detected. A

mathematical model suggested that the circulation of HEV in six European

countries is endemic. In addition, HEV prevalence in pig’s faeces was investigated

showing that pigs close to the slaughter age can still be HEV positive.

In conclusion, the work carried out in this PhD projected contributed to our

understanding of HEV replication in-vitro and provided useful information on the

prevalence of HEV in the pork food chain in the UK. In addition, progress was

made with possible inactivation methods and control strategies.

CHAPTER 1 General Introduction

1 Food-borne viruses

Foodborne viruses are a common and, probably, the most under-recognised cause of

outbreaks for example of gastroenteritis. Human infection can occur following

consumption of contaminated food, person-to-person body contact, or release of

aerosols. Food may be contaminated by infected food handlers or by contact with

water contaminated by treated or untreated sewage. Outbreaks of viral foodborne

illness have been associated with the consumption of shellfish that have been

harvested from sewage-polluted waters, for example. The greatest risk of foodborne

illness occurs with catering operations preparing ready to eat foods, although

foodborne spread is difficult to prove. The most common food borne vim ses are

Norovims and hepatitis A vims. Vimses require a host in order to multiply, and the

original source of all foodborne vimses is the human intestine. Usually, they cannot

grow in food. Contamination of food may occur either during preparation and

serving by infected food handlers or by contact with sewage or sewage-polluted

water.

Pathogenic vimses originate from two sources to contaminate the food chain:

humans and animals. To facilitate identification of whether contamination is of

human or zoonotic origin, monitoring the presence of human and animal vimses at

various points in the food supply chains is still necessary. Adenovimses infect both

humans and a wide variety of animal species, are shed in large numbers in the faeces

of infected individuals [4], and are capable of robust survival [5]. They have been

proposed as an index of viral contamination, and the specific detection of

adenovimses from human or animal origin should be a useful tool for tracing the

source of faecal viral contamination. Hundesa et al. (2006) stated that due to higher

prevalence in fecal and environmental samples of bovine adenoviruses, bovine

polyomaviruses are the best candidates for tracing a bovine source of viral

contamination [6]. As well as the index viruses, the presence of HEV in pork

production is necessary to be examined since that HEV is regarded as a model

zoonotic virus.

1.1 Hepatitis E virus aetiology

HEV is a hepatotropic virus and the causative agent of hepatitis E, an acute viral

hepatitis in humans. The infection may vary in severity from inapparent infection to

fulminant liver failure and death. Although considered an acute disease, chronic

infections have been observed in liver and kidney transplant and chronic liver

disease (CLD) patients. The mortality rate is between 1% and 4% [7], (higher than

hepatitis A virus - HAV, a Picomavirus) and in people with CLD and in pregnant

women it can reach 25-30%.

Hepatitis E is an important public health concern and a major contributor to

enterically transmitted hepatitis worldwide {Figure 1.1) [8]. Based on

seroprevalence data, an estimated one third of the world’s population has been

infected with HEV [7].

In endemic regions, hepatitis E occurs in epidemic forms meanwhile in developed

regions HEV occurs sporadically {Figure 1.1).

Hepatitis E is the second most important cause of acute clinical hepatitis in adults

throughout Asia, Africa and the Middle East where the infection is endemic. In

these countries, the infection mainly spreads through the contamination of water

supplies occasionally leading to large-scale outbreaks or epidemics. Hepatitis E is

rare in industrialized countries, where infection is historically mostly related to

travelling to endemic areas. However, more recently, significant numbers of

autochthonous cases have been documented in many developed countries [9].

A

•Q,

€'&

0ICL

I*0

I

o

in<N>oV3<Uc/)g

= > I XCQ # • 1Ic

ssss

IaO)

I

X

cdt15

Ig

L-io

oing>o73gV3o

<DsoXis

11OX) -2:2oo

a

o

Idcu

-§

gcao%

I

73ëo

I&o

cSs-X:15

£? i.S o

cS

1&c/23OCo-s€og

00co'-3o_c

o'g

cdo

uc5'

> s

SIN .a: I

■■5 :2.d

I§t)£g

X

oe ■'3

a -o X3k-(o(N

c/ 2

oc o

§f l<U 3 bJO O

g-

cdCQ

<uCL

oc(U

Zl ^OX) <u0) cc /3 o « 1

(N

o(N623X:X

I>>X3

dC

I U

I IQ “ .2= 1OX)

io

IIs-

c /2 S

! f ;& 1 ^

OX)

Ïi>

73g

O_ X39 OX)w I

1cjg--C

c3 .2U

s - l °C/]2

OX)

d0

1 Ud

•*5

IIODQ

1.1.1 Hepatitis E in non-endemic regions

In developed regions, the transmission of HEV is most likely mainly via a zoonotic

route. Evidence of this is given by the many autochthonous (indigenously acquired)

eases worldwide where swine isolates show a very high RNA sequence homology

to human HEV isolates [10]. Additional evidence is the experimental transmission

of human isolates to pigs and of swine HEV to primates [10]. Hepatitis E

autochthonous transmission has been recorded in most developed countries and

regions including USA, Europe (including UK, France, the Netherlands, Austria,

Spain, Greece and Italy), and developed countries of Asia-Pacific (Japan, Taiwan,

Hong Kong, Australia) [11].

In the UK, the disease appears to be more common among residents of coastal and

estuarine areas [11]. Zoonotic transmission has been proposed [11] and is now

widely accepted; in some developed regions transmission appears to be seasonal

with peaks in spring and summer [11].

Patients with unexplained hepatitis are tested by serological tests and these are the

cases where the disease is most often recognized. Generally, the symptoms are

similar to those in endemic regions. In developed areas, the majority of the cases

have been in middle aged or elderly men, where often another disease already

coexisted [12] {Table 1.2).

1.1.2 Hepatitis E in disease-endemic regions

Although the majority of hepatitis E eases in resource limited countries are

sporadic, local epidemic outbreaks occur frequently. They are usually separated by

a few years and they can affect several thousand individuals [13, 14]. Usually the

8

majority of the outbreaks are due to consumption of drinking water contaminated by

human faeces and the longevity varies from a few weeks to over a year [14]. The

outbreaks frequently follow heavy rainfall and floods [15], conflict leading to

concentrations of displaced persons in refugee camps [15], or are associated with

disposal of human excreta into rivers [15]. Food-borne transmissions have been

described in resource-limited areas, but due to a relatively long incubation period

(up to 9 weeks), establishing a correlation between consumption of pork food and

occurrence of disease is difficult.

In India HEV is hyper-endemie, the majority of the cases reported are sporadic and

40% of sewage specimens obtained throughout all seasons are HEV positive [2, 16-

19]. Interfamilial spread is not common but multiple cases in one family have been

reported [2, 16-19]. It is suggested that this is due to shared infected water rather

than person-to-person transmission as the time interval between cases is too short.

Studies in endemic regions show high seroprevalence rates ranging from 15% to

60% [16, 20-24]. Notably, the age-specifie seroprevalence profiles for HEV are

found to differ from those reported for antibody to HAV even though, in endemic

countries, the transmission routes for these two viruses are similar [16]. HAV

seroprevalence rates reach more than 95% in children by the age of 10 years

whereas HEV infection is rarely detected in children [16].

The peak incidence in sporadic cases of hepatitis E in endemic regions occurs in

15-35-year-olds [2, 16-19]. Additionally, HEV infections are predominantly

reported in men with a male-to-female ratio ranging from 1/1 to 3/1 [25]. This sex

bias is, however, not seen in children presenting with hepatitis E [26]. The reason

why men more commonly develop hepatitis E infection is not understood but males

outnumbering females may be due to a greater risk of exposure to HEV infection

[26]. Morbidity rates during hepatitis E epidemics have ranged from 1% to 15%

[27]. Higher mortality rates and fulminant liver disease have been described among

pregnant women during hepatitis E outbreaks [27]. Furthermore, HEV infection

during pregnancy is not only associated with severe disease or higher mortality, but

also with an increased risk of prenatal mortality and low birth weight. In developing

regions neonatal vertical transmission rates have been estimated at 78.9% [28] but it

is yet unclear whether the high morbidity and mortality rates during pregnancy are

also seen in developed regions {Table 1.2). The exact cause for this predilection to

severe disease in pregnant women still needs to be better studied, including the

suspicion that it is due to hormonal or immunological factors [29].

1.2 Morphology and Genomic organization

HEV was designated in 2004 as the sole member of the genus Hepevirus in the

family Hepeviridae [30]. The HEV genome was first cloned from cDNA libraries

prepared from the bile of macaques experimentally inoculated with stool

suspensions from human patients [31]. A similar PCR was later used to clone the

genomes of multiple geographically distinct isolates of HEV [32-34].

HEV is a small, non-enveloped, single-stranded, positive-sense RNA virus. The

genome size is approximately 7.2 Kb [35, 36] {Figure 1.3). The genome of HEV is

capped at the 5' end and polyadenylated at the 3' end (Figure 1.3.A). It contains

short stretches of untranslated regions (UTR) at both ends {Figure 1.3.B, red box).

The HEV genome has three open reading frames (ORFs), shown in Figure 1.3B.

ORFl encodes the non structural polyprotein (nsp) that contains various functional

units: methyltransferase (MeT), papain-like cysteine protease (PCP), RNA helicase

1 0

(Hel) and RNA dependent RNA polymerase (RdRp) [3]. 0RF2 encodes the viral

capsid protein, the N-terminal signal sequence and glycosylation loci. ORF3

encodes a small regulatory phosphoprotein. Details of the 0RF3 protein are shown

in Figure 1.3. The roles of the 0RF3 protein in HEV pathogenesis are promotion of

cell survival, modulation of the acute phase response and immunosuppression [3].

1 1

Featm^ Eitdeinic regions NcMii-eiuleimc regions

Geographical locations Underdeveloped countries mostly in Asia and A&ica

Developed countries in Europe North America, parts of Asia, Australia,

Epidemiologicalpatterns

Large epidemics, small outbreaks and ^oradic cases

Only sporadic cases with occasional small clusters

Water-bornetransmission

Well known ,most common route Unknown, but has been detected and may be contributory

Zoonotic transmission Not reported Yes

Animal reservoir No Yes

Vims genotype Almost entirely genotypes 1 and 2, a few cases of genotype 4 in China

Genotype 3; occasional cases of genotype 4 in Taiwan

Age group Young men most commonly affected

Usually dderly

Chronic infection Not known Reported in tran^lant recipients receiving immunosuppressive dmgs

Severity Variable severity, including fulminant hepatic 6ilure

Severity and p oor outcome is related to coexistent disease conditions

Relationship with pregnancy

Particularly high rates of symptomatic disease and of more severe disease in pregnant women than in men and non-pregpant women

No data on pregnant women, but eady evidence indicates 1 ower mortality/morbidity in developed regions

Table 1.2 Differences in epidemiological and clinical features associated with hepatitis E in disease-endemic and non-endemic regions. The first column describes the HEV features, the second and third column describe the features in endemic and non endemic regions. Table adapted from Aggarwal et al, 2010 [1].

1 2

i ?

I0§(5Û<g1

t/!

IaISg0

1!Io

g

S

^ = i fI t(D

IUiO

0Oh

a(N

1

;I

T3C(U

o a

IoB

o'gc/3o

23O

2c/5-3

"O

I >>

I'oOh T3gT)3 3

îna

3

i g3 ^

c.

3

X0

X

1C/313§rSo

X3

3O3

.3

33OO33

3

O =/) 3h 3c /5 3

c /5

332C/3

S'

3’3

3h

C /3

Ibû3

110

2 •S3

H

ê331033

33

"33o"1333a

3 mè0

331_33

3033

1oS'3D<

IC /3

g

%

o

3O

'S>c / 53

■33O3

3a

Io3.

<

§IK

.3<§UDh

3

3o

■l'S'o3

Tp 3g

O 33 3

Ifg3cr 3

% 2

I03.

1

8

X

ogbû_33_3"o3

3

0 X

c /5

1C /5

.S'3

3.3

èo.3

3

&

322CL3 c

3

"334 >

sQ

3223hO

X3-c /5O334

13bO2

aSc /5

3c /5

3O

g

3bû

1a

c /53X0

X33

c /530'bb3

3:3'Ch

3.B"o34

33•3§3

U0g333

c /53X0-33 [2

3 000

c /5 03 (N'3s a03 CL_3 2X 30 s

3-0 uVh3 B>> 0X C4—13 33 B•3 3hP 3

s %

13

1.3 Viral proteins

Open reading frame one (ORFl) is the largest (5079 nt) of the three ORFs and it

begins after the 5’ noncoding region (5'-NCR) of 27 to 35 nucleotides (nt). It

encodes a 1693 aminoacid polyprotein including viral non-structural proteins such

as methyltransferase, a papain-like cysteine protease, a helicase and an RNA-

dependent RNA Polymerase (RdRp) [37-41].

The region between the end of ORFl and start of ORF3/ORF2 appears to be

complex and contains regulatory elements [35] {see sections 1.3.5 and 1.3.6).

1.3.1 Methyltransferase

The Methyltransferase domain has been suggested by computer-assisted

assignments to encompass an amino terminal domain between 60 to 240

aminoacids. Downstream of the methyltransferase domain there is a Y domain of

200 aminoacids but at present no particular function is known. While the HEV

methyltransferase showed guanine-7-methyltransferase and guanyltransferase

activities [41, 42], the source of the RNA triphosphatase was not clear but it seems

that the RNA triphosphatases specifically cleave 5’-phosphate of the nascent

mRNAs, without attacking the P-phosphoryl group. The RNA triphosphatases from

RNA viruses are helicases or helicase-like proteins where the active site of the RNA

triphosphatase is shared or overlaps with the helicase/ NTPase catalytic site. This

suggested that the HEV helicase has RNA 5’-triphosphatase (RTPase) activity.

A recent report [43], suggested that when a purified recombinant HEV helicase

protein was incubated with either alpha-3 2p_ labelled RNA or gamma-3 2p_

labelled RNA, the HEV helicase had a gamma-phosphatase activity, which might

catalyze the first step in RNA cap formation. Two reports have shown the presence

14

of a 5’m 7G cap on the HEV genomic RNA. The HEV genomic RNA transcribed in

vitro from viral cDNA is infectious for primates only when it is capped [44]. A 5’

RNA ligase-mediated rapid amplification of cDNA ends (RACE) method designed

to select capped RNAs amplified the 5’ ends of the SAR-55 (genotype 1) and MEX-

14 (genotype 2) mRNA, confirming that the HEV genomic RNA is capped [44, 45].

1.3.2 Papain-like cysteine protease

A Papain-like protease domain follows the Y domain {Section 1.3.1) encompassing

440-610 aminoacids, and has been identified in other viruses such as alphavirus,

rubella virus and hepatitis C virus (HCV). It is postulated that this viral protease is

involved in either co- or post-translational viral polyprotein processing to yield

discrete non-structural protein products [42]. A conserved “X domain” of unknown

function flanks the papain-like protease domain, preceded by a proline-rich region

“P” that might constitute a flexible hinge between the X domain and the upstream

domains [37].

1.3.3 Helicase

The Helicase domain is similar to the typical Helicase superfamily and shows the

highest overall homology with the helicase of beet necrotic yellow vein virus

(>10%). It promotes unwinding of DNA, RNA or DNA duplexes required for

genome replication, recombination, repair and transcription [42].

1.3.4 RNA-dependent RNA polymerase (RdRp)

The RdRp domain, encompassing 1200-1700 aminoacids of the carboxy terminal

region of ORFl, shows a conserved amino acid motif recognised in all positive

strand RNA viruses as the canonical Glycine-Aspartate-Aspartate (GDD) motif. It

15

has been observed that mutations in this motif (GDD to GAD) generate replication-

deficient HEV viruses unable to replicate. The RdRp has a crucial role in binding to

the 3’UTR (untranslated region) of HEV RNA and directing the synthesis of the

complementary strand RNA [42]. Several linear B-cell epitopes have been

identified in the ORFl protein, and appear to be particularly concentrated in the

region of the RdRp [46].

1.3.5 ORF2 and the major capsid protein

Open reading frame 2 is about 1980 nt in length from nt 5147 to nt 7124,

downstream of ORFl. Translation of this region produces the HEV structural

polypeptide (pORF2) of 660/599 aminoacids [47] and this appears to be highly

conserved. The 5’ end of 0RF2 region presents an average of approximately 350-

450 nt most conserved among HEV isolates; recently it has been used for

classifying different subgenotypes of HEV [48].

In animal cells, the major capsid protein is expressed in a -74 KDa form (pORF2)

and a -88 KDa glycosylated form (gpORF2) that was immunoreactive with sera

from chimpanzees infected with HEV [49]. pORF2 is synthesized as an 82 KDa

precursor (ppORF2) that co-translationally translocates via the N-terminal signal

sequence to the endoplasmic reticulum (ER) membrane. The putative signal

peptides consist of three regions: an amino terminal region of 22 amino acids with

positively charged residues (Arg), a central hydrophobic core with 14 residues and a

third region containing a turn-inducing stretch of proline residues, followed by the

signal peptidase cleavage site. Processing of ppORF2 is by cleavage in the

endoplasmic reticulum into the mature polypeptide (pORF2), and then it is

glycosylated (gpORF2) at N-linked glycosylation sites “Asn-X-Ser/Thr” (N-X-S-T)

16

at residues 137, 310 (these appear to be the major sites of N-Glycan addition) and

561, attached as a core unit of oligosaccharides (Glc3Man9Glc-NAc2), while the

polypeptide chains are translocated across the ER membrane [50]. This process

occurs usually for the synthesis of envelope proteins. The glycosylation sites are

conserved in the 0RF2 sequences of all HEV isolates sequenced [32, 35, 51, 52].

Mutations in the pORF2 glycosylation sites prevented the formation of infectious

virus particles and resulted in low infectivity in macaques [53]. The 88 KDa

gpORF2 obtained is transported to the cell surface by a bulk flow mechanism in the

absence of any signal of retention in the endoplasmic reticulum. Final assembly

occurs at the cytoplasmic membrane with encapsidation of HEV positive-stranded

genomic RNA.

Expression of gpORF2 in mammalian cells (COS-1 and HepG2) showed that it is

expressed intracellularly, as well as on the cell surface, and has the potential to form

non-covalent homodimers [42, 49, 50, 54]. Recently, it has been suggested that

gpORF2 is an unstable form of the protein [55]. Although pORF2 is proposed to

take part in capsid assembly, the role of gpORF2 is not clear, being possibly

involved in apoptotic signalling [49].

ORF-2 has been expressed in vitro and characterized by heterologous expression

systems including Escherichia coli [56], mammalian cells using plasmids [49],

alphavirus vectors [55, 57], baculovirus expression systems [58], recombinant

vaccinia virus [59] and yeast [60]. The full length 0RF2 product expressed in insect

cells is insoluble, whereas the truncated products, mapping to aminoacids 112-660,

assemble into virus-like particles (VLP), indicating that cleavage and assembly of

the capsid protein occurs in the system [61-64]. The size of empty VLPs (23.7nm) is

17

smaller than the authentic native HEV virions (27nm) and similar virus particles

have not been found in the bile or stools from patients infected with hepatitis E or

from experimentally infected monkeys. Expressed VLPs were used as antigen for

enzyme-linked immunosorbent assay (ELISA) against antibodies to HEV,

appearing to be specific and sensitive enough to detect anti-HEV IgG as well as

IgM in human and experimentally infected monkey sera [65, 66]. Immunodominant

epitopes in ORF2 and 0RF3 have been included in commercially available

diagnostic ELIS As for HEV [67]. The 0RF2 epitopes are located at the extreme 3’

end of that reading frame [67]. The antibody response to pORF2 shows that it is

highly immunogenic and protective [7]. Currently, a single serotype has been

described, with extensive cross-reactivity among circulating human and swine and

chicken strains [47, 68].

To support the hypothesis that ORF2 is essential for the generation of infectious

virions, Parvez et al (2011) [69] constructed a recombinant baculovirus

(vBacORF2) that expressed the full-length 0RF2 capsid protein of a genotype (gt) 1

strain of HEV. Results showed that the baculovirus-expressed ORF2 protein was

able to transencapsidate the viral replicon and form a particle that could infect naïve

HepG2/C3A cells. Parvez et al (2011) [69] confirmed the results obtained by Xing

et al [70] that HEV virus-like particles formed in insect cells captured some of the

template 0RF2 RNA used to produce the particles. In conclusion it is strongly

considered that the 0RF2 protein transcomplements a replicon that is deficient in

capsid protein production and efficiently encapsidates the replicon viral RNA to

form stable HEV particles which are infectious for naïve hepatoma cells [69]. This

1 8

ex vivo RNA packaging-system could be further used to study many aspects of HEV

molecular biology [69].

1.3.6 ORF3 and its product

Open reading frame 3 (ORF3) partially overlaps with ORFl by 4 nt and shares most

of the remaining nucleotides of 0RF2 at the 5’ end [42]. 0RF3 encodes for a

123/122 amino acid immunogenic phosphoprotein of 13.5 KDa (pORF3) with yet, a

not fully defined function [35].

Recent studies using a HEV replicon with a deleted ORF3 in cell culture showed

normal RNA replication, suggesting that 0RF3 is not required for HEV replication,

virion assembly or infection of culture cells [71].

Yamada et al provided evidence that pORF3 is required for virion egress from

infected cells [72]. In addition, pORF3 is present on the surface of HEV particles

suggesting that the HEV particles released from infected cells are lipid-associated.

In its primary sequence, pORF3 contains two large hydrophobic domains in its N-

terminus that are rich in polycysteine [72]. Domain 1 may serve as a cytoskeleton

anchor at which pORF2 can assemble the viral nucleocapsid, although it was

reported that recombinant 0RF2 protein assembled into small but typical

icosahedrons in the total absence of ORF3 [73, 74] and also bound mitogen-

activated protein kinase phosphatase (MAPKP) [75]. Another smaller hydrophobic

domain (Domain 2) follows in the primary sequence, which has been shown to

homo-dimerize in a yeast cellular environment, and in human hepatoma cells it was

demonstrated to interact with another host protein endogenous hemopexin (Hpx), an

acute-phase plasma glycoprotein that plays important roles in inflammation. The

19

pORF3-Hpx interactions may have significant importance in viral pathogenesis

(Figure 1.4) [76].

Chandra et al [77] described studies that suggested that the 0RF3 blocks phospho-

STAT3 nuclear transport (Figure 1.4). A block in receptor mediated endocytosis

inhibits the nuclear transport of STAT3 [77]. It is known that STAT3 is involved in

the acute response and activation of acute phase proteins and it regulates the

transcription of a number of acute phase genes such as interleukin-6 (IL-6) [77].

The acute phase proteins (APPs) are expressed mainly by the liver and have a wide

range of activities that contribute to host defence. The main role of APPs is

neutralizing inflammatory agents and minimizing the extent of local tissue damage,

as well as participate in tissue repair and regeneration [77]. In conclusion, Chandra

at al. suggested that ORF3 could attenuate inflammatory responses and create an

environment for increased viral replication and survival mainly in the liver [77].

20

Receptor Tyrosine Kinase

Endocytosis

PSTAT3

(A)Promotion of cell survival m dm

I.KlWWlI

OIll-microglobulin

Numus

(B )Modulation of

acute phase response

ïicreasediil-microglobuBn secretion

(Cl knm unosuppreg ion

Figure 1.4 Role of the ORF3 protein in HEV pathogenesis. (A) Promotion o f cell survival. The ORF3 protein activates MAP kinase by binding and inactivating its cognate phosphatase (MKP). Additionally, it upregulates and promotes homo­oligomerization of the outer mitochondrial membrane porin, VDAC, and increases hexokinase levels, thus reducing mitochondrial depolarization and inhibiting intrinsic cell death. (B) Modulation o f the acute phase response. The ORF3 protein localizes to early and recycling endosomes, and inhibits the movement of activated growth factor receptors to late endosomes. This prolongs endomembrane growth factor signaling and contributes to cell survival. Through this mechanism, pORF3 also reduces the nuclear transport of pSTAT3, a critical transcription factor for the expression of acute phase response genes. (C) Immunosuppression. The ORF3 protein promotes the secretion of a 1-microglobulin, an immunosuppressive protein that could act in the immediate vicinity of the infected cell. Figure taken form Chandra et al 2008 [3].

21

1.4 The HEV replication cycle

1.4.1 Viral receptor and entry: The cell surface molecules that bind HEV or its

capsid proteins are not known yet. He et al (2008) described that a truncated peptide

of 0RF2 is involved in binding and entry of the following cell lines: HepG2, Huh-7,

PLC/PRF5 and A549 cells [78].

1.4.2 Model of HEV replication: The process by which HEV RNA enters the

target cells is still unknown (Figure 1.5:1-2). In the cytoplasm the genomic RNA is

translated into non-structural proteins (Figure 1.5: 3). The genome amplification

step involves replication of positive strand genomic RNA into negative strand RNA

intermediates (Figure 1.5: 4A). These are used as template for the synthesis of the

genomic positive strands (Figure 1.5: 4B). This is akin to alphaviruses and a region

homologous to alphavirus junction sequences is proposed to serve as the

subgenomic promoter. The subgenomic RNA can then be translated into the

structural protein(s) (Figure 1.5: 5). Based on in vitro expression and replicon

studies, some details have now begun to emerge. The genomic RNA is packaged

with the capsid protein to assemble new virions (Figure 1.5: 6). The mechanism by

which the virion is released from the cell has yet to be characterized [3].

It is unclear whether gut cells are infected following ingestion of the virus. It is

believed that the primary site of HEV replication is the liver, with hepatocytes being

the most likely cell type [79]. Results support infection and replication in non-

hepatic cell types such as A549 lung carcinoma cells and in Caco-2 colon

carcinoma cells. Although it is not efficient, viral replication has been demonstrated.

In pigs experimentally infected with swine HEV, positive-sense viral RNA was

detected in almost all tissues at some point during the infection, but negative-sense

22

RNA intermediates were detected primarily in the small intestine, lymph node,

colon and liver [79]. In a recent report, HEV RNA was detected in peripheral blood

mononuclear cells, but due to the lack of an efficient HEV in vitro cell culture

verifying the evidence of viral replication in this compartment in patients with HEV

infection was not possible [80].

23

>PJX

I(Uc§(U

(N

TD§

cd§

X3s s

i f

! !(U& .£

< z oc

<DbO

<uJ=,

BIJi CL

<g5 o c6 CD

Hl/5*V3(Uoo

u5“

I1■g!/5O2 kir>

I

X3#

I'ga

a<Zûi

ogW)

(U_u

g"

<§CJsoaW)Xi3

■g

1 :

■gbû<uc2c

oc(UbûT3C

OCLUJC

H

t 3g

I -9C

! lgo<

ZdCo

t 373<

- Ic3 73

a01o

LC

oCL

732

' g(U

o

S) S'l ë53 sb û vj

I Î22CL

c/:g -o(U

H

IT)

CL

cb

73(U

73a73

N

gacb-.

73(UN

'S

Ix :CJc3

gW)3O

(Uo<u

ao

73O

Id)

3L3

\ o

00

8(N

24

1.5 Potential targets for the development of antiviral drugs

Various steps in the HEV life cycle can be potential targets for the development of

antiviral drugs. The methyltransferase and guanyltransferase activities in the ORFl

protein {Section 1.3) are strictly virus-specific and thus good targets for antiviral

development [41]. The RNA helicase of HEV has been biochemically characterized

and it is essential for replication of the viral RNA genome [43], but it is not clear

how distinct it is from human helicases to be a potential drug target. The HEV

RdRp expressed in E. coli was shown to bind the 3’ end of the viral RNA genome

[81], but its biochemical activity has so far not been characterized. Since the RdRp

is unique to RNA viruses, it would again be a good drug target, and perhaps some

viral inhibitors can be explored against this target, for example the RdRp is used as

inhibitor of viral replication for HCV infections. Interference with HEV RNA

replication has been attempted using ribozymes and small interfering RNAs. Mono-

and di- hammerhead ribozymes designed against the 3‘ end of the HEV genomic

RNA were shown to inhibit expression from a reporter construct in HepG2 cells

[82]. In A549 cells infected with HEV, small interfering RNAs (siRNAs) against

the ORF2 region were also shown to offer protection [83]. While such approaches

are feasible in vitro, the delivery and targeting of such inhibitors in vivo would be

the real challenge. At least one study in immunocompromised transplant patients

with chronic HEV infection has also shown the efficacy of Ribavirin monotherapy

[84]. Again, the utility of this approach among the vast majority of HEV infections

that are acute remains questionable.

25

1.6 HEV inactivation studies

HEV has proven difficult to propagate in vitro [85], and despite some recent

improvements, there is no doubt that the failure to develop a repeatable and efficient

in-vitro propagation system for HEV has hindered attempts to understand the

environmental survival and other physical and pathobiological characteristics of

HEV. The determination of these qualities would potentially offer much valuable

information in understanding the epidemiology and control of HEV infections.

Feagins et al in 2008 [85] performed a HEV heat inactivation study in a pig animal

model. The objective of the study was to determine if traditional cooking methods

are effective in inactivating infectious HEV present in contaminated commercial pig

livers. The result obtained was that four of the five pigs inoculated with a pool of

two HEV-positive liver homogenates incubated at 56°C [86] for 1 h developed an

active HEV infection shedding virus in the faeces. The pigs inoculated with a

pooled homogenate of two HEV-positive livers stir-fried at 191°C [86] for 5

minutes and the group of pigs inoculated with a pooled homogenate of two HEV-

positive livers boiled in water for 5 minutes showed no evidence of infection as

there was no seroconversion, viraemia, or faecal virus shedding in any of the

inoculated pigs [87].

What is not clear is how effective the usual processing procedures for uncooked pig

products are in inactivating pathogens such as HEV. Moreover, the risk of HEV

infection via the consumption of HEV-contaminated pig tissues raises public health

concerns since it is not clear what cooking conditions will be effective in

inactivating the virus present in the contaminated pig tissues.

26

HEV can be found in the liver, blood, intestinal tract and skeletal muscle, all of

which are consumed in one form or another and often together, such as in sausages.

How safe are these products? The question is difficult to answer because HEV

grows poorly in cell culture, and testing HEV viability in vivo requires nonstandard

laboratory animals.

Other inactivation studies with HEV have not been performed thus far. Inactivation

studies with UV light were performed with other viruses such as HAV, calicivirus

or other enteric viruses, or with bacteria [88, 89]. Exposure to solar ultraviolet (UV)

radiation is a primary means of virus inactivation in the environment, and

germicidal (UVC) light is used to inactivate viruses in hospitals and other critical

public and military environments [90, 91]. Safety and security constraints have

hindered exposing highly virulent viruses to UV and gathering the data needed to

assess the risk of environments contaminated with high-consequence viruses [92].

UV sensitivity for some viruses has been extrapolated from data obtained with UVC

(254 nm) radiation by using a model based on the type, size and strandedness of the

nucleic acid genomes of the different virus families [93, 94]. Therefore, there was

little information to allow accurate modelling, confident extrapolation, and

prediction of the UV sensitivity of viruses deposited on contaminated surfaces,

conditions more likely to be relevant to public health or biodefence. One of the

goals of this study was to determine the inactivation kinetics produced by exposure

to UV light (UV, 254 nm radiation) of HEV since that is relevant to public health

(Section 5.2).

Other inactivation studies with disinfectants such as chlorine were not performed

until now with HEV. Sodium hypochlorite, a derivate of chlorine solution.

27

commonly known as bleach, is frequently used as a disinfectant or a bleaching

agent. US Government regulations (21 CFR Part 178) allow food processing

equipment and food contact surfaces to be sanitized with solutions containing

bleach, provided that the solutions do not exceed 200 parts per million (ppm)

available chlorine. A l-in-5 dilution of household bleach with water is effective

against many bacteria and viruses {Section 5.2).

1.7 Taxonomy: Evolutionary History and Population Dynamics of Hepatitis E

Virus

HEV segregates as four genotypes and the characterization is based on the genomic

sequence analysis of human and animal isolates [95, 96]. A genetically distinct

group has also been identified in avian samples, sharing 50% homology with

mammalian isolates [94].

Genotypes 1 and 2 appear to be anthroponotic whereas gts 3 and 4 are zoonotic

[97]. All four genotypes belong to a single serotype [30]. The recent discovery of

novel lineages of HEV in rabbits [98, 99], rats [100], and wild boar [101] has

expanded further the mammalian HEV diversity. It has been suggested that the

HEV sequences found in rabbits represent a novel genotype [102, 103]. However,

additional phylogenetic analysis indicated that rabbit HEV is closest to gt 3 [100,

104] and may have zoonotic potential. In addition, the discovery of a genetically

distinct avian HEV [105] indicates a very long evolutionary history for the HEV

group of viruses. Contrary to swine HEV (asymptomatic in pigs), avian HEV shows

hepatomegaly in poultry.

The first animal strain of HEV was detected in swine (swine HEV) in 1997 in the

USA [52]. Since then, swine HEV strains have been isolated from all over the world

2 8

and from several animal species (e.g. wild boar, mongoose and sika deer). In

developed regions the human and swine strains show a sympatric distribution [106].

Purdy et al [107] suggested that HEV can be segregated into two clades. One clade

is the enterically transmitted, epidemic form represented by gts 1 and 2, and the

other clade is the zoonotically transmitted, sporadic form exemplified by gts 3 and 4

[9, 97, 108].

Genotypes 1 and 2 have been identified only in humans, gts 3 and 4 have been

identified both in humans and in animals [42, 47, 52, 109]. Gt 1 HEV has been

identified from human cases in Asia and Africa [48] whilst gt 2 was firstly

identified in Mexico and subsequently in Africa. Gt 3 has been identified in humans

and animals in several developed countries, such as Europe, Japan, Australia and

New Zealand. Gt 4 has been identified in both animals and humans in China,

Taiwan, Japan and Vietnam and most recently in The Netherlands [110]. HEV

strains of gts 1 and 2 have less genomic variability than those of gt 3 and 4 [47].

This could be due to the differences in the transmission patterns between the

genotypes. In addition, the presence of an animal reservoir for gts 3 and 4 could

have caused an independent evolution of the virus in specific animal species [47].

That HEV has an animal origin [111] suggests that some ancestral HEV variants

could have subsequently developed the capacity to efficiently transmit to and

between humans. To prevent emergence of novel human diseases a better

understanding of epidemiological and evolutionary processes facilitating this

transition from enzootic to human-to-human transmission is necessary. The clear

division between HEV genotypes into two modes of transmission offers an

important opportunity for studying molecular evolutionary processes related to the

29

transition from one mode to another. Prudy et al [107] studied the evolutionary

history of HEV using several models estimating population dynamics, in terms of

time to the most recent common ancestor (TMRCA), and variation in selective

pressures acting on different HEV genotypes. Purdy et al [107] did not analyse

HEV gt 2 due to lack of available samples. ORF2 analysis suggests that the mean

time of emergence of the ancestor for modern HEV genotypes ranged from 536 to

1344 years ago. For gt 3, from 265 to 342 years ago; for gt 4, from 131 to 266 years

ago; and for gt 1, from 87 to 199 years ago. Thus, the anthroponotic gt 1 is the most

recent compared to the enzootic gts 3 and 4 [107].

Following Drummond et al [l\2 \, Purdy et al [107] decided to set up a model using

0RF2 sequences for gts 1, 3 and 4 to understand the genotype dynamics and to

study the demographic history of HEV genotypes. Gt 1 went through an increase in

population size between 25-35 years ago. Gt 3 population was stable since 1760,

but it had a dramatic shift in its size over the 20th century. The effective population

size of gt 4 remained constant until 20 years ago when it rapidly decreased over 10

years to the original level. [107].

Purdy et al [107] suggested that HEV has histories dating back tens of thousands to

millions of years but early members have been replaced by the modern variants

[107]. A more ancient TMRCA is suggested due to contacts between humans and

domesticated swine about 11.000 years ago [38] immediately after urbanization

started [39]. HEV gt 1 increased in the last 35 years. Gts 3 and 4 showed decreases

around 1990 [107] and this may be due to greater awareness of the HEV health

problem around the world and improved diagnostics rather than an actual expansion

of the HEV [107]. During the Second World War the increase of HEV cases was

30

probably related to the increasing population size rather than meat consumption

[111]. The country-specific HEV evolutionary history observed probably reflects

temporal variations in rates of transmission and/or exposure for HEV strains of the

same genotype circulating in different geographic regions [107].

1.8 Genotype classification

Extensive genomic diversity has been observed among HEV isolates, but a single

serotype is recognised [47, 113]. Genotype 1 was first identified and subjected to

sequencing in 1991 [35] from a sample that came from Myanmar (Burma strain)

showing more than 88% nucleotide identity with other gt 1 strains isolated in Asia

(China, India, Nepal and Pakistan) and Africa (Chad and Morocco) [47].

In 1992, a new strain which was completely different from the Burma strain was

sequenced from outbreaks in Mexico (1986) and classified as gt 2. Compared to gt

1, which is present in many geographic regions, gt 2 occurs in fewer countries [48].

Genotype 3 was identified in 1997 in the USA from an autochthonous infection in a

patient without history of travel abroad; it was sequenced and became the first strain

belonging to gt 3 [114]. Later on, gt 3 HEV was shown to be distributed in many

countries worldwide including Asia, Europe, Oceania, North and South America

[106, 115-117].

Currently, the four genotypes are classified into different subtypes, based on

approximately 300-450 nucleotides of sequence in the 5’ end of the ORF2 region

which are most conserved among all HEV isolates. The phylogenetic analysis

demonstrated that HEV can be divided into total 24 subtypes. Gt 1 was divided in 5

subtypes (la, lb, Ic, Id, le), gt 2 in two subtypes (2a, 2b), gts 3 segregate in 10

31

subtypes (3a, 3b, 3c, 3d, 3e, 3f, 3g, 3h, 3i, 3j) and gt 4 in 7 subtypes (4a, 4b, 4c, 4d,

4e, 4f and 4g) [48] (Figure 1.6) [118].

32

\

%

II

t/3

aIc

11Ia

Ii§O'0X)

i ^bûc

CJ id

00

3

3

3

3O

II3

O33

IIÎi■s3.Q

Î

cruCA

§a

X

§

I®

Sso

f a .22

2

So

(N~o§

Ü

IX)3*3

1303

1CJ

-3

1_o'33

1CX)34

bû

O3

O

11 a c3 ^CJ 3CJ J-i X "O

VD3 3

CJ

s3O" '+H

I B

CS -0 4>U 00

I‘S

b£

!

X

3

3CJ

T3§

'S

3

OX

Ic/Tga3

X3

3O

•XoCJc

a&

1 1cdc:<

IX§C/Χ a3

X

I I£

I% 3

ECJ

Ic/3XCJ

IT “U u

2§

X3

Xc /3

IOc / 3

> ffi3- ”3§ cnbû Oc /3 CJ 3 CJ

Ioc / 3

c / 3

X

Ic / 3

X

3

Ü

a

"3uc /33

§C/3£g3

X

II

--1 Ic OJ .o x: CD

bû3

■?O

XV:

(Uc/DCJ

CI43IX3O

oc /3

<Ow

33

1.9 Epidemiology of HEV

1.9.1 Epidemiology in humans

The epidemiology of HEV differs significantly in industrialized and non­

industrialized countries. In resource-limited countries, the infection is endemic and

spreads mainly through contamination of water supplies.

Data from sero-surveys forced re-evaluation of the epidemiology of hepatitis E and

gave an indirect indication to vocationally acquired HEV infections in industrialized

countries [2].

In industrialized countries, Hepatitis E occurs sporadically and affects mainly

visitors returning from endemic areas. Some of the cases in industrialized countries

however, are non-travel-related and are considered as being autochthonous.

Autochthonous cases have been reported in N and S America, many European

countries and industrialized countries of the Asia-Pacific area, including Japan,

Taiwan, Hong Kong and Australia.

Zoonotic spread of the virus was first suspected when genomic sequences of HEV

isolates from two autochthonous cases in the USA were found to be closely related

to swine HEV [114].

In 2001 [119] HEV swine strains were identified in The Netherlands, showing close

genetic similarity to European human strains. In 2002 field isolates of swine HEV

were identified from different geographic areas [120] demonstrating nucleotide

identity between swine (88-100%) and human strains (89-98%). In 2004 in the

United Kingdom two UK swine HEV strains were identified with 100% amino acid

34

sequence identity over a partial sequence amplified by PCR, to one autochthonous

human case of HEV in the UK (Figure 1.7) [121].

In Spain, 2006, de Deus et al [122] identified swine affected by HEV with

nucleotide identity (85.7%-100%) between swine and human strains.

Recently, a hepatitis E outbreak on board in a UK cruise ship returning from an 80

night world cruise was investigated. The UK Health Protection Agency (HPA) was

informed of four cases of jaundice on board a cruise ship which departed from

Southampton on 7 January and returned on 28 March 2008. An epidemiological

investigation was launched by HP A to identify any additional cases of hepatitis E

and potential risk factor for infection. The investigation was a cohort study to

include all 2850 UK passengers who were on the cruise at any point. A total of 851

of the 2850 eligible passengers took part in the investigation. Finally, 33 (4%)

individuals were identified with recent acute HEV infection, although only 11 of

these were symptomatic cases. A common source outbreak was shellfish eaten on

board the cruise ship. The causative agent was identified as HEV gt 3 which was

closely related to the other gt 3 strains isolated in Europe [113, 123, 124].

The route of transmission has not been determined in most of these cases, although

zoonotic spread has been proposed [125]. To investigate the possible presence of

animal reservoirs, several animal species have been tested for anti-HEV antibodies.

HEV antibodies have been detected in different animal species, monkeys, pigs,

rodents, chickens, dogs, cats, cattle and sheep, both in resource-limited and

industrialized countries, suggesting that these animals could be infected by HEV

[113, 123, 124].

35

9996

92

95

92—E

f i

ri

AF503512 UKSW AY362357 UK Hu AF503511 UK Sw10Q----- AB073911 JAP Sw

L- AB093535 JAP Hu AF336292NLSW

A F 3 3 2 ^ 0 N L S w- AF336296 NL Sw— AF195063 SP Sw sew age API 95062 SP Hu AF336294 NL Sw

1 0 0cAF336295 NL Sw

AY032759NLSW- AF195061 SP Hu AY032758 NL Sw

AY032757 NL Sw

Figure 1.7 Phylogenetic tree. Human United Kingdom isolate (AY362357) is shown in bold and compared with closely related swine and human hepatitis E virus isolates. Bootstrap values greater than 70% are considered significant and are indicated. Figure taken from Banks et al, 2004, [121].

36

Water-borne (effectively faecal-oral) and food-borne transmissions, as well as

transfusion of infected blood products and vertical (maternal-foetal) transmission

[1], are now established routes of HEV transmission.

Aggarwal et al have reported an example of materno-fetal transmission of HEV

infection [126]. HEV-RNA or immunoglobulin (Ig) M anti-HEV antibodies have

been detected in seven of eight babies born to mothers with acute hepatitis E in the

third trimester of pregnancy [127].

Blood transfusion HEV infection has been described by Kriittgen et al in 2011

[128]. The study reported the youngest ever case of a five-month-old Caucasian girl

presenting with diarrhoea, emesis, and elevated ALT. Surprisingly, acute infection

with Hepatitis E virus (HEV) gt 3 was laboratory-confirmed by reverse transcriptase

polymerase chain reaction (RT-PCR) and sequencing [128]. In HEV endemic and

non-endemic areas, the presence of HEV viremia among healthy blood donors and

transmission of this infection to transfusion recipients has been documented [129].

Faecal-oral transmission of HEV occurs primarily through contaminated water in

endemic-regions where it is responsible for both sporadic and epidemic outbreaks

[130]. In epidemic form, the disease may involve tens of thousands of cases and is

the cause of considerable morbidity and mortality, posing a major public health

problem in endemic regions. In India alone, over 2.2 million cases of hepatitis E are

thought to occur annually. Hepatitis E in resource-limited countries has different

epidemiological and clinical features and investigation is patchy. Disruption of

water supplies in conflict zones has been shown to have caused major outbreaks of

hepatitis E amongst disrupted persons [131, 132]. During the conflict in Darfur,

Sudan, over 6 months in 2004, 2621 hepatitis E cases were recorded (incidence

37

3.3%), with a case-fatality rate of 1.7% (45 deaths, 19 of which involved were

pregnant women). Interestingly in this outbreak, as well as age, a risk factor for

infection was drinking chlorinated surface water (odds ratio, 2.49; 95% confidence

interval, 1.22-5.08) [132] {Tablel.8 [132]).

Although, supported by phylogenetic data, it is assumed the disease was around for

many years, hepatitis E was first recognised during an epidemic of hepatitis, which

occurred in Kashmir Valley in 1978. The epidemic involved an estimated 52,000

cases of icteric hepatitis with 1700 deaths (Figure 1.9) [1].

Based on these data, the possibility of another human hepatitis virus distinct from

post-transfusion non-A, non-B hepatitis was postulated. Balayan et al (1983) [130]

successfully transmitted the disease to himself by oral administration of pooled

stool extracts of 9 patients from a non-A, non-B hepatitis outbreak which had

occurred in a Soviet military camp located in Afghanistan. Over the years, hepatitis

E was identified as a major health problem in resource-limited countries with unsafe

water supplies and poor sanitary disposal.

38

Exposure

No. of individuals

Asymptomatic All HEV infection

in = 104) in = 491

Risk of asymptomatic

HEV infection, % RR (95% Cl)

Age group, years>45 17 5 29.4 Reference15-45 51 22 43.1 1.47 (0.48-4.47)0-14 36 22 61.1 2.08 (0.67-6.43)

SexFemale 73 35 47.9 ReferenceMale 31 14 45.2 0.94 (0.45-1.99)

Size of the family« 6 persons 65 29 44.6 Reference>6 persons 39 20 513 1.15 (0.57-2.30)

Presence of animals in the houseNo 54 23 42.6 ReferenceYes 50 26 52.0 1.22 (0.62-2.41)

Ever collected water from riverNever 76 35 46.1 ReferenceYes 28 14 50.0 1.09 (0.51-2.31)

No. of water reservoirs in house1 19 6 31.6 Reference2 37 16 432 1.37 (0.46^.07)>2 48 27 56.3 1.78 (0.63-5.00)

Source of drinking waterBorehole, unchlorinated 42 17 40.5 ReferenceSurface water, chlorinated 55 28 50.9 1.26 (0.61-2.59)Other 7 4 57.1 1.41 (0.37-5.45)

Use latrines.At least sometimes 81 37 45.7 ReferenceNever 23 12 52.2 1.14 (0.51-2.54)

Wash hands before eatingAt least sometimes 80 35 43.8 ReferenceNever 24 14 58.3 1.33 (0.62-2.88)

Wash hands after defecatingAt least sometimes 83 38 45.8 ReferenceNever 21 11 52.4 1.14 (0.50-2.61)

NOTE. RR, risk ratio.

Table 1.8 Risk factors for asymptomatic hepatitis E virus infection in a random

sample of Mornay population, Darfur, Sudan, September 2004. Figure taken

from Guthamann et al, 2006, [132].

39

MATERIAL REDACTED AT REQUEST OF UNIVERSITY

40

Food-borne transmission of HEV was first demonstrated in clusters of Japanese

patients that had eaten raw or undercooked meat of pig, wild boar or sika deer. The

genomic sequences of HEV identified from these patients were identical to those

recovered from the frozen leftover meat [133].

In addition, Colson et al [134] reported HEV evidence based on epidemiological

findings that 5 cases of autochthonous acute hepatitis E were linked to ingestion of

raw figatelli [134]. Figatelli are traditional sausages from Corsica, they are made

with pig liver and are commonly eaten uncooked, and they can be considered as a

possible source of HEV infection in France [134].

Legrand-Abravanel et al [135], studied 38 patients in south-western France with

HEV gt 3 infection. The patients were compared with matched control participants

in south-western France who had no evidence of HEV infection. According to the

results of a questionnaire, consumption of game meat, consumption of processed

pork and consumption of mussels were all statistically significantly more common

among case patients than among control participants. Eating undercooked pork and

pork products is quite common in Europe. Although the study by Legrand-

Abravanel et al [135] did not address the consumption of undercooked meat, other

studies have explored it’s association with hepatitis E. A case-control study by

Wichmann et al [136] in Germany, found that consumption of raw or undercooked

wild boar meat, and offal (liver, kidney, and intestine) was statistically significantly

associated with autochthonous HEV infection.

Other direct evidence of zoonotic transmission was recently reported by Kim et al

[137]. A sporadic case of acute hepatitis E was confirmed as gt 4 HEV in a 51 year

old Korean female. The case was reported as the first case of presumably zoonotic

41

transmission of HEV identified as gt 4 in a patient with acute hepatitis E after

ingestion of raw bile juice from a wild boar living on a mountain in South Korea.

Although drinking of raw bile juice is not a common practice in Korea, like other

parts of the world, some believe that bile juice could increase their energy or

stamina as a folk remedy.

Furthermore, it has been shown that commercial pig livers purchased from local

grocery stores as food in Japan, the United States (11%) and Europe [87, 138] are

contaminated by HEV and that some of the HEV-contaminated commercial pig

livers still contain infectious virus [87].

A study performed in an UK hospital tested 500 blood donors, 336 individuals over

the age of 60 years and 126 patients with chronic liver disease were tested for HEV

IgG. At the end of the study 40 cases of autochthonous hepatitis E (gt 3) were

identified [9]. These patients did not have a recent travel history and the major

probability was autochthonous hepatitis [9]. Autochthonous hepatitis E in developed

regions is frequently misdiagnosed as drug-induced liver injury, a common problem

that occurs with increased frequency in elderly people. The outcome can be poor in

those individuals with underlying chronic liver disease, with mortality approaching

70% [9].

Seroprevalence data from industrialised countries suggests that subelinical or

unrecognised infection is common. However, the real incidence of clinical

autochthonous hepatitis E in the UK is not known [139] but increased and improved

surveillance for hepatitis E has shown it may be more common than hepatitis A. [9,

140]. Data from France and Japan show similar trends [141, 142]. The literature

42

contains relatively few reports from the USA regarding autochthonous hepatitis E

[143]. It is known that the HEV human seroprevalence is around 21% in blood

donors, it is strongly possible that the majority of the patients with unexplained

hepatitis are “missed” since hepatitis E infection is often not considered a diagnostic

possibility in the USA [143].

1.9.2 Epidemiology in pigs and other animals

It is now accepted that autochthonous hepatitis E in developed regions has a largely

zoonotic source.

Evidence of this statement is described in many reports where HEV sequences

derived from pigs are closely related to HEV sequences from humans. Many

animals, for example domestic pigs, wild boar, deer, mongoose, trout and bivalves

are found to be HEV positive [144, 145]. In addition, HEV antibodies are detected

in domestic and feral animals. Gts 3 and 4 are the most commonly detected in this

wide range of animals. Data obtained from animal experiments suggest that

genotype 3 (zoonotic) is the most attenuated relative to genotype 1 and 2 (human to

human) where they cause more severe pathology [146-148]. Although genotype 3 is

considered by some to be the most attenuated for human beings, differences in

genotype virulence is still not well understood [149]. It is also suggested that gt 4 in

India differed relative to gt 4 subtypes found in China, Japan, and Taiwan. Data

show that Indian gt 4 is apparently not able to infect humans and it has been

suggested that this is probably due to the substitution of 26 amino acids, 16 in ORF-

1, 8 in ORF-2 and 2 in ORF-3 [150]. Autochthonous hepatitis E gt 3 was first

observed in the USA from comparing human sequences with pig sequences [52].

HEV seroprevalence in pig farms is high worldwide and it can be as high as 100%

43

in some pig herds [130]. Furthermore, in some studies it is demonstrated that

slaughterhouse workers, farmers, veterinarians and people that work in close contact

with pigs may be exposed to a greater risk of HEV infection. The evidence is based

on reports where this category of workers presents a higher HEV IgG

seroprevalence relative to non-pig workers [151]. More than 20% of pigs close to

the slaughter age are excreting HEV in faeces [152]. Watercourses may be HEV

contaminated due to run-off of pig faeces from outdoor pig units. In addition HEV

has been detected in slurry lagoons on pig farms, from urban sewage works, and

from pig slaughterhouses [153]. The risks of spreading untreated slurry on farmland

still need to be characterized but it should be remembered that rhesus monkeys have

been infected with HEV recovered from sewage and slurry [154].

1.10 Pathogenesis, clinical signs and symptoms

1.10.1 In humans

Studies on HEV have facilitated the understanding of elements of its replication,

host immune response, and liver pathology in HEV infected patients and primates

[39, 130]. It has been estimated that the infectivity titre of HEV for macaques is

10000-fold higher when inoculated intravenously compared with when it is ingested

[8]. Clinical signs of hepatitis E are dose-dependent in these animal models and

production of disease may require challenge doses 1000 times or more greater than

that required for infection [113].

After ingestion, the virus probably replicates in the intestinal tract (the primary site

of replication has not been identified yet) and reaehes the liver, presumably via the

portal vein [42]. It replicates in the cytoplasm of hepatocytes [155] and is released

into the bile and bloodstream, by mechanisms that are still poorly understood, and

44

excreted in the faeces [113]. The incubation period is 4-5 weeks based on an oral

infection study in human volunteers [130, 156]. Viral excretion in faeces begins

approximately 1 week prior to the onset of illness and typically persists for 2-4

weeks, in some cases RT-PCR has yielded positive results until 52 days after onset

[157]. The viremia can be detected in the first 2 weeks after the onset of illness

[156, 158, 159]. Viral excretion and viremia has been detected by RT-PCR also

prior to liver abnormalities, which normally appear with an elevation of

aminotransferase levels, and reach a peak by the end of the first week from the

clinical symptoms. Simultaneously the humoral immune responses appear. Anti-

HEV IgM or IgG levels are detected by enzyme immunoassay [160, 161]. Anti-

HEV IgM appears during clinical illness and then gradually disappears over a few

months (4-5 months). Some days later than IgM, anti-HEV IgG appears and persists

for few years [162, 163]. The persistence of HEV antibody in the sera is still

unclear. One study observed that 14 years after acute HEV infection anti-HEV

antibodies were still circulating in 47% of patients [164]. To diagnose acute HEV

infection, anti-HEV IgM is a useful tool, whereas IgG anti-HEV does not

necessarily indieate recent HEV infection [40].

Hepatitis E symptoms are typical of acute icteric viral hepatitis; the most common

recognizable symptom is an initial prodromal phase (preicteric phase) lasting a few

days, with a variable combination of flu-like symptoms, fever, mild chills,

abdominal pain, anorexia, nausea, aversion to smoking, vomiting, clay-coloured

stools, dark or tea coloured urine, diarrhoea, arthralgia, asthenia and a transient

macular skin rash [40]. These symptoms are followed in a few days by lightening of

the stool colour and jaundice appearance. Itching may also occur. With the onset of

45

jaundice, fever and other prodromal symptoms tend to diminish rapidly and then

disappear entirely. Laboratory test abnormalities include bilirubinuria, a variable

degree of rise in serum bilirubin (predominantly conjugated), marked elevation in

serum alanine aminotransferase (ALT), aspartate aminotransferase,

gammaglutamyltransferase activities and a mild rise activity in serum alkaline

phosphatase. The magnitude of transaminase rise does not always correlate well

with the severity of liver injury. The illness is usually self-limiting and typically

lasts 1-4 weeks [40]. Recent reports described evidence of chronie HEV infection

in transplant patients [165, 166]. A small number of patients with aeute HEV

infection have a prolonged elinical illness with marked eholestasis (cholestatic

hepatitis), including persistent jaundice and prominent itching. In these cases,

laboratories observed a rise in alkaline phosphatase and a persistent bilirubin rise

even after transaminase levels returned to normal [40]. The prognosis is good as

jaundice finally resolves spontaneously after 2-6 months. Within the past few years,

HEV has been demonstrated to be responsible for chronic hepatitis, which can

rapidly evolve to cirrhosis in immunocompromised patients [167-169]. However,

little data regarding HEV-related extrahepatie manifestations has been published,

although an association between neurologic manifestations (e.g., Guillain-Barré

syndrome, neuralgic amyotrophy, acute transverse myelitis) and acute HEV

infection has been suggested [170-174]. Previously, the association between

neurologic signs and symptoms and HEV infection has been based on detection of

anti-HEV immunoglobulin (Ig) M in serum. However, Rianthavorn et al [175]

reported a case of HEV gt 3-induced neurological amyotrophic in which HEV RNA

was detected in the serum of patients with neurologic signs and symptoms [176].

Recently, Kamar et al [176] detected HEV RNA in the cerebrospinal fluid (CSF) of

46

a kidney-transplant recipient with chronic HEV infection and neurological signs and

symptoms [177]. In addition, Kamar et al reported 7 chronic HEV gt 3 infections,

with development of neurological complications, from January 2004 until April

2009 [84] and the disappearance of the neurological symptoms were correlated with

a decreasing HEV titre.

Other infected individuals have a milder clinical course and develop only non­

specific symptoms that resemble those of an acute viral febrile illness without

jaundice (anicterie hepatitis) [161]. Histological features of hepatitis E may differ

from other forms of aeute viral hepatitis. Nearly half of hepatitis E patients have a

cholestatic hepatitis, which is characterized by eanalicular bile stasis and gland-like

transformation of parenchymal cells. In these patients, degenerative changes in

hepatocytes are less marked [40, 178]. The Kupffer cells appear prominent. Portal

tracts are enlarged and contain an inflammatory infiltrate consisting of lymphocytes,

a few polymorphonuclear leucocytes and eosinophils. Polymorphonuclear cell

volume is particularly increased in the cholestatic type of lesion [40, 178]. In cases

with severe liver injury, a large proportion of the hepatocytes are affected, leading

to sub-massive or massive necrosis with collapse of liver parenchyma [40]. At the

beginning, HEV infection is entirely inapparent and asymptomatic. A small

percentage of patients have more severe symptoms with fulminant or subacute (or

late-onset) hepatic failure. The exact frequencies of asymptomatie infection and of

anicteric hepatitis are not known but a large proportion of individuals test positive

for anti-HEV IgG [40]. In resource-limited regions hepatitis E is common in young

adult and adults (15-40 years of age). Hepatitis E appears to cause more-severe

disease in pregnant women, particularly during the second and third trimesters [40].

47

HEV commonly causes intrauterine infeetion as well as substantial prenatal

morbidity and mortality [127], suggesting that the placenta may be the viral

replication site as Lassa fever [179, 180]. Death is usually due to encephalopathy,

haemorrhagic diathesis or renal failure. In a preliminary report [181] cynomolgus

monkeys infected intravenously with HEV developed acute tubular necrosis with

focal haemorrhages suggesting that HEV may replicate in monkey kidneys. In

pregnant monkeys, however, no increased mortality has been observed [182]. In

endemic countries such as India, the mortality rate of women with acute gt 1

hepatitis E in the third trimester of pregnancy is usually fairly high (26-64%) [183].

Why acute HEV infection in pregnant women causes severe liver dysfunetion is not

known.

Experimentally, HEV transmission has occurred from infected to uninfected in­

contact pigs confirming that the virus is contagious [184].

Many reports described that [167, 176, 177] in immunosuppressed transplant

patients chronie HEV infection progress rapidly in cirrhosis [165]. Established

cirrhosis has been shown in two HIV-infected patients, in 2009, in UK and France

[185]. HEV and HIV coinfection still need to be better studied. [176] What it is

known to date is that that it seems that there was no difference in anti-HEV

seroprevalence between patients with HIV infection and control group [185].

1.10.2 In pigs

The mechanisms of HEV pathogenesis and replication are poorly understood due to

the lack of a practical animal model and an efficient in vitro cell culture system for

HEV. HEV might replicate in tissues and organs other than the liver [186].

48

Williams et al [72] confirmed clinical and pathological findings of HEV infection in

pigs previously reported by Halbur et al [149]. It is unclear how the virus reaches

the liver and extra-hepatic site(s), but it is presumably that HEV is transmitted by

the faecal-oral route. Primary the hepatocytes are the only known sites of HEV

replication [79]. It has been hypothesized that liver damage induced by HEV

infection may be due to the immune response to the invading virus and may not be a

direet eause of viral replication in hepatocytes [79, 187]. Several studies with

naturally infected pigs described HEV RNA detectable in different organs and

tissues, even after viremia was cleared [188]. For swine HEV-infected pigs, viral

RNA was detected in small intestines, colons, lymphnodes, and livers [79, 188].

Other extrahepatie tissues such as kidney, tonsil, and salivary gland had detectable

HEV RNA for only 1 or 2 weeks [79]. It appears that lymphonodes and the

intestinal tract are the main extra-hepatic sites of replication. The significance of

identifying extra-hepatic sites of HEV replication is unclear at this time.

Experimentally infected pigs do not present any clinical signs, histological analysis

shows signs of mild, focal liver necrosis but no fever or other signs (as for example

lack of appetite) are observed.

49

1.11 Diagnostic procedures

Enzyme-linked immunosorbent assays (ELISA), conventional reverse transcriptase

PCR (RT-PCR) and real time RT-PCR, cell culture, confoeal microseopy and

electron microscopy have been used for detection or confirmation of HEV infection.

These methods differ significantly in their sensitivity and specificity. The

eommonly used methods for HEV detection are described below in more detail.

1.11.1 ELISA

HEV recombinant proteins and synthetie peptides, corresponding to

immunodominant epitopes of the 0RF2 and ORF3 structural proteins of the virus,

have been sourced as the capturing antigen [113]. Subunits of ORF2 have been

expressed in different systems such as prokaryotic, insect, animal and plant cells in

order to obtain pure antigen for ELISA [189]. Recombinant antigens derived from

ORF2 generally have a superior sensitivity and specificity. In common with all

serological tests, ELISA can only be applied once antibody has developed, in most

cases at least 2 weeks after infection. However, serological tests are able to

discriminate between IgM and IgG, thus enabling distinction of the acute phase

from the convalescent phase of infection. HEV antibody prevalence has been

reported in several studies in industrialized countries [125, 189]. Commercially

available ELIS As have improved in recent years, but it is suspected some of the

earlier prevalence data reflected subelinical infections and serological cross­

reactivity that may have contributed to this high seroprevalence in the non-endemic

areas [38, 113].

50

1.11.2 Conventional RT-PCR

Conventional RT-PCR assays are currently utilized in direct diagnosis of HEV. The

samples collected may be faeces, serum (from animal or human), cultures of

infected cells cultivated in 2D and 3D configurations, or post mortem tissue highly

positive as bile and liver [42, 190]. HEV is an RNA virus and the RNA needs to be

extracted before being subjected to the reverse-transcription reaction phase to

cDNA. This is a limiting step, because cDNA is easily degradable, if in the samples

the viral load is so low at initial state, may give rise at the end to false negativity.

Various sets of sense and antisense synthetic oligonucleotide primers may be used

for the detection of the HEV genome, differing based on conservative region targets

in the genome against the central or terminal part of ORFl or C terminal of ORF2

[42]. There are reports which indicate broad-spectrum degenerate primers, for

identifying positives samples from all genotypes. For example A l/S l and 3156/7

primers [191] are used to amplify the ORF2 region. Often the first product of PCR

amplification it is of insufficient quantity to be visualized by electrophoresis.

However, if the first product of PCR has been amplified by nested RT-PCR with the

internal primers A2S2 [192] and 3158/9 [191], respectively, the PCR product

became clearly visible on the eleetrophoresis gel through ethidium bromide

staining.

1.11.3 Real time RT-PCR

Real-time RT-PCR is becoming the most popular method for direct detection of

HEV in clinical samples. The technique enables both detection and confirmation of

specificity genotyping. In addition, real time RT-PCR is a sensitive tool in

epidemiological investigations since that this technique is fast and reliable. The full

51

viral genome of HEV was cloned in 1991 [35]. Since then several pairs of primers

have been designed to amplify various segments of the genome. The primers are

mainly designed to the conserved regions (heliease, polymerase and the terminal

fragment of ORF2) of the HEV genome [42]. The development of real time RT-

PCR, whereby the accumulation of the PCR amplicon can be deteeted in real-time,

has allowed for the quantification of HEV.

1.11.4 Negative strand detection

Since HEV is a positive strand RNA virus that putatively codes for a RNA-

dependent RNA-polymerase, HEV should replicate through a negative-strand RNA

intermediate [35]. Nanda et al [193] already showed HEV negative-strand RNA in

the liver tissue of infected rhesus monkeys, providing support for the putative

mechanism of HEV replication.

Varma et al [194] described viral HEV replication in transfected PLC/PRF/5 cells

and observed negative strand replication until 24h after the cells were transfected

with ORF2, with a maximum RNA negative strand peak after 8h post transfection

[194].

1.11.5 Cell culture and new technology for in-vitro propagation of the virus

Several cell lines for in vitro replication of HEV have been tested in the 2D

monolayer culture system [32, 195, 196]. These cell lines were hepatocytes from

non-human primates, human embryonic lung diploid cells (2BS), human carcinoma

alveolar basal epithelial cells (A549), hepatocarcinoma cells (PLC/PRF/5),

hepatocellular human carcinoma (HepG2) and primary hepatocytes from non­

human primates. However, the majority of the cell lines did not support replication

52

of HEV or the virus growth was limited, i.e. low titre virus. The lack of an efficient

and reliable cell culture system and a practical animal model for HEV have

hindered studies on mechanisms of HEV replication, transmission, pathogenesis and

environmental survival.

In a recent study, Tanaka et al have tested 21 cell lines including PLC/PRF/5 cells

using a faecal suspension with high HEV load as inoculum [197]. A high load of

HEV was detected in the eulture supernatant of cultivated PLC/PRF/5 cells from

day 12 post inoculation. At AHVLA laboratory, several attempts were made to

reproduce Tanaka’s work using field swine HEV PCR positive faecal materials as

inoculum, but without success. Okamoto in 2011 described for the first time, a cell

culture system capable of secreting infectious HEV in high titres into culture media

[198]. The success with the original JE03-1760F strain has been extended to other

strains that can support the replication of HEV with an even higher efficiency, and

can be passaged through many generations [198]. Okamoto was able to infect

PLC/PRF/5 cells with both sera and faeces of patients and observe high HEV titre in

the cell culture system [198]. Furthermore Okamoto has engineered infectious HEV

cDNA clones, in addition he affirmed that this system, reinforced by reverse

genetics, will solve many mysteries and answer numerous questions surrounding the

epidemiology, viral absorption/entry, packaging and delivery of viral particles,

toward illuminating the life cycle of HEV. No other authors after Okamoto have

been able to reproduce those experiments [198].

Hence, an efficient in vitro propagation system for HEV is crucial for HEV research

in general, and to the VITAL project in particular. There are several reports in the

literature demonstrating the potential of a new 3D culture system Rotating Wall

53

Vessel (RWV) (Figure 1.10) [199], for the growth of fastidious viruses. The RWV

is a cylindrical bioreactor which is rotated on an axis parallel with the ground.

Subsequently, a solid body mass rotation of the culture medium is obtained, creating

a low-fluid-shear environment [200]. The RWV culture method has been shown to

be applicable for fluid shear stress-related studies in suspension. The cells are

maintained in suspension by the resolution of the centrifugal, gravitational and

Coriolis forces, so cells placed in the RWV bioreactor experience minimal

mechanical stresses and high mass transport (of nutrients, oxygen etc.) and are thus

able to assemble into tissue-like aggregates. This 3D culture system has been used

to grow fastidious Norovirus from faecal materials [201]. The system offers a

potential for in vitro cultivation of HEV. The RWV technology is used to simulate

the low shear environment inherent to microgravity [202].

54

B CFilling port Gas-pem cable membranî

\ \ A

/f Sampling ports

' f A '#

yDocking point

FRONT b a c k

Figure 1.10 Rotating Wall Vessel motor (RWV) or Rotary cell culture system.

A: The RCCS (RCCS-4DQ, Synthecon) is available as a one, two, four or eight

station rotator base. The system depicted consists of a four Station Rotator Base,

along with a power Supply with Tachometer. Each station is capable of rotation at

independent speeds, enabling four experimental conditions and/or experiments to be

run simultaneously. The system is supplied with four Rotary wall vessels (RWV).

(B): The cylindrical RWV is completely filled with culture medium, cells and micro

carrier beads through the filling port on the face of the vessel. All bubbles are

removed from the RWV through the sampling ports to reduce shear. The vessel is

attached to the rotator base by docking point and rotated on its axis that is parallel to

the ground creating a solid body rotation. Cell-beads aggregates in the RWV are

maintained in a gentle fluid orbit and do not collide with the walls or any others

parts of the vessel (i.e., suspension culture). As 3D tissues grow in size, the rotation

speed is adjusted to compensate for the increased settling rates of the larger

particles. The cells and/or tissue particles join to form larger tissue particles that

continue the differentiation process. Oxygen supply and Carbon dioxide removal

are achieved through a gas-permeable silicone rubber membrane that covers the

back of the RWV bioreactors. Schematic representation on how the system, works

(section c). Figure taken from Nickerson et al, 2001; [199].

55

1.11.6 Microscopy

Microscopy is the teehnical field of using microscopes to view samples or objects.

There are three well-known branches of microscopy, optical, electron and scanning

microscopy. Optical and electron microscopy involve the diffraction, reflection, or

refraction of electromagnetic radiation/ electron beam interacting with the subject of

study, and the subsequent collection of this scattered radiation in order to build up

an image. This process may be carried out by wide-field irradiation of the sample

(e.g. standard light microscopy and transmission electron microscopy) or by

scanning of a fine beam over the sample (e.g. confoeal laser scanning microscopy)

and scanning electron microscopy.

1.11.6.1 Confoeal microscopy

There has been a tremendous increase in the popularity of eonfocal microscopy in

recent years. The technique of laser scanning confoeal microscopy has become an

invaluable tool for a wide range of investigations in the biological and medical

sciences for imaging of optical section in living and fixed specimens ranging in

thickness up to 100 micrometers [203]. The basic key to the confoeal approach is

the use of spatial filtering techniques to eliminate out of focus light or glare in

specimens whose thickness exceeds the immediate plane of focus. Confoeal

Microscopy offers several advantages over conventional wide field optical

microscopy, including the ability to control depth of field, elimination or reduction

of background information away from the focal plane (that leads to image

degradation), and the capability to collect serial optical section. The choice of

fluorescent probes for confoeal microscopy must address the specific capabilities of

56

the instrument to excite and detect fluorescence emission in the wavelength regions

made available by the laser system and detectors.

1.11.6.2 Electron microscopy, transmission and scanning

The transmission electron microscopy (TEM) technique is specific, labour intensive

and expensive, but was a critical precursor for understanding the natural history of

HEV, being the tool used to detect the viral particle causing non-A non-B non C

hepatitis in 1975 [204]. The virus particle of 27-34 nm appeared non-enveloped,

was detected in stool samples collected during preicteric and early icterie phases

and to determine antibody titres in the sera [186]. In general, the TEM technique

does not serve as a diagnostic tool since it usually requires large amounts of antigen

and high antibody titre and further, virions are shed in degraded form in faeces [42].

The scanning electron microscope (SEM) produces very high-resolution of a sample

surface, revealing details about 1 to 5 nm in size. Due to the way these images are

created, SEM micrographs have a large depth of field yielding a characteristics

three-dimensional appearance useful for understanding the surface strueture sample

composition.

1.12 Vaccination

Due to lack of a reliable cell culture system for HEV, vaccine development has been

difficult. Two candidate vaccines have successfully completed phase 3 clinical trials

in humans. Baculovirus-expressed ORF-2 protein from a Pakistani strain of HEV

has been licensed by Smith Kline-Beecham [205]. In the Royal Nepalese Army, a

vaccination trial to prevent HEV clinical disease was conducted and it showed

95.5% efficacy (95% Cl). Also in China, another trial was conducted. The vaccine

57

was prepared with a recombinant protein from the HEV ORF-2 viral capsid

expressed in Escherichia coli (HEV 239) [83]. Vaccine efficacy after three doses

was 100% (95% Cl 72.1-100.0). It was considered that these two vaccines could

prevent HEV morbidity and mortality in pregnant women, patients with chronic

liver disease in endemie areas, patients with organ transplants and other

immunocompromised subjects who may contract HEV gt 3 in industrialized

countries.

As far as we know these two vaccines cover gt 1 but nothing is known about

prevention of gt 3 and it is quite unthinkable to set up a vaceination plan for the

entire worldwide population against HEV gt 3, mostly because in non-endemic

areas HEV is sporadic and incidence is generally still very low. The production of a

HEV vaccine for pigs would be more feasible and cheaper, but it is acknowledged

that in the absence of any disease in pigs, it might not be justified or practicable to

vaccinate pigs. However, in considering the options for control of autochthonous

acquired gt 3 and gt 4 HEV in humans, it is important to have some data on the

estimated impact and optional timing of HEV vaccination of pigs. This would be

useful feasibility data in case of changes in the incidence of human gt 3 infections in

developed regions or other events that may require the vaccination of pigs.

1.12.1 HEV vaccination modelling in pigs

Only a few studies regarding the dynamics of HEV transmission have been done but

no vaccination modelling in pigs has been performed to date. Bouwknegt et al 2008

[86] described HEV transmission among pigs from chains of one-to-one

transmission. The model describes HEV transmission in pigs and it can be used both

with animal contact exposure experiments and in the field. Each age group or

58

contact-exposure animal is subdivided into three distinct compartments that consist

of pigs that are susceptible (S), infectious (I) or recovered (R). The system

described by this SIR model is assumed to be in an endemic equilibrium. This

endemic equilibrium can only exist when the virus is suffieiently transmissible. The

transmissibility is expressed by the reproduction number (Rq) and it is the number

of infections by an infectious individual during its entire infectious period (in an

infinite susceptible population). The endemic equilibrium assumes that Rq > 1. This

SIR model means that the infected animals reach immunity after infection. The

latent period between infection and excretion of infectious virus, is observed to be 3

days in intravenously inoculated pigs [86].

The model is analysed by Monte Carlo (MC) sampling. This means that three

random numbers of infectious animals are drawn from the distribution depending on

the observed number of positive. Each Monte Carlo (MC) sample consists of three

numbers of animals that signify the numbers of infectious weaners, growers and

fatteners.

Bouwknegt et al 2008 [86] observed that Rq for contact-exposure was estimated to

be 8.8 (Cl 95%,) showing the potentia] of HEV to cause epidemics in populations of

pigs.

Casas et al reported a longitudinal survey study on swine HEV infeetion dynamics

conducted in different herds [206], but the dynamics of HEV transmission was

analysed using SPSS 15.1 software (SPSS Inc., Chicago, IL, USA) and not a

mathematical model such as the SIR model.

59

Only a couple of studies have applied mathematical model such as the SIR model in

field samples to better understand HEV dynamics of transmission [207]. This

mathematical model can better help in a theoretical way by mimicking the in vivo

system to understand of how HEV is circulating between pigs in the same farms and

between different age groups. Furthermore this model can also try to mimic how a

vaccination model can help to eradicate an endemic virus such as HEV and it can

help to understand at which age, during an early or later stage, it is more effective to

vaccinate the animals [86].

60

1.13 Aims of the VITAL PhD project

This PhD project was part of the European project VITAL (Integrated Monitoring

and Control of Foodbome Viruses in European Food Supply Chains). This project

included 15 laboratories in Europe and this PhD was developed to spend the first

year in the UK, one year in The Netherlands and the last year in the UK. The main

aims of the VITAL project were to:

i: Acquire data on virus contamination of food and environmental sources.

ii: Assess food borne viral risks for determining high-risk situations and efficacy of

interventions.

iii: Develop new measures to prevent virus contamination of food and the

environment.

iv: Develop and assess measures of reduction and control in case of virus

contamination.

The specific aims of this PhD project were to investigate HEV presence and

residual infectivity in the pork food chain in order to facilitate any future control

measures. During this PhD project samples across the UK pork food chain were

tested for HEV contamination. Furthermore, a cell culture system was optimised to

demonstrate the infectivity of the virus in the food samples tested and HEV

inactivation strategies were investigated. This will aid understanding of the

mechanisms of HEV replication, pathogenesis and environmental (including within

food matrices) survival. The knowledge derived from this study is going to be used

to develop codes of practice aimed at reducing or eliminating zoonotic transmission

of HEV via the food-borne route.

61

The 3 objectives of the PhD project were:

1) a) To evaluate a new 3D cell culture system to assess HEV infectivity. This was

set up to verify that the HEV virus content detected by PCR in pig products and

environmental samples is infectious.

b) To compare the efficiency of the 3D system to the conventional 2D cell culture

system. In addition, cells grown in the 3D system were transferred to a 2D system

and infected. This aimed to produce the best tool with which to examine large

numbers of samples being investigated for potential transmission routes.

c) The risk of HEV infection via the consumption or manipulation of HEV-

contaminated pig livers raises further public health concern since it is not clear

which conditions will be effective in inactivating the virus present in the

contaminated pig livers. Inactivation studies were performed to better understand

which is the best method to inactivate HEV in various matrices and environments.

The inactivation studies performed were heat, UV light and sodium hypochlorite

HEV inactivation. The heat inactivation was performed to better understand at

which temperature the virus is inactivated to produce guidelines for consumers,

particularly in relation to cooking conditions. The other two studies were set up to

provide information that could be incorporated in guidelines for pork chain workers.

2) To assess methods for HEV detection within the VITAL project, particularly

from sampling in the UK pork food chain. The first step of the VITAL project was

to optimise the Standard Operating Procedures (SOPs). It was requested that the

sample collection laboratories involved in the project tested the SOPs. This was to

be accomplished by means of blind ring trials. Samples were spiked with Human

62

Adenovirus (HAdV) and the results obtained were evaluated by the ring trial leader.

The second step was testing samples collected at the slaughterhouse (40 pig liver

sample and 40 pig faeces), processing point (40 pork muscles) and point of sale (63

pork sausages). The aim was to gain an insight into the frequency of HEV in the UK

pork foodchain.

3) HEV dynamics of transmission study: Since HEV is a zoonosis that is

widespread in the pig population in Europe, there might be an interest to produce a

pig vaccine to reduce the impact of HEV infection in the human population. Prior to

any vaccine development, modelling work is necessary to assess the impact of

vaccination in the reduction of HEV excretion by the pigs. I participated in the

collection of HEV prevalence data in European countries, and in the construction of

the dynamics of transmission model.

63

CHAPTER 2 VITAL Ring Trial

64

Introduction

This PhD project was part of the European project VITAL (Integrated Monitoring

and Control of Foodborne Viruses in European Food Supply Chains). This project

included 15 laboratories in Europe and one of the main aims was to assess methods

for the detection of Human Adenovirus (HAdV) and Norovirus in the soft fruit and

salad and detection of HEV in the pork products and shellfish. This PhD project was

focused on the pork foodchain and its initial phase was the validation of the

extraction and detection methods for two sample matrices (soft fruit and pork

products). These methods were developed as standard operating procedures (SOPs)

and assessed by means of a blind ring trial between all data gathering laboratories in

the VITAL consortium. Samples were spiked with HAdV, the target virus and with

Murine Norovirus (MNoV) the extraction control. All samples were tested by all the

laboratories involved in the ring trial and the results were sent to the ring trial leader

for evaluation.

Ring trial: In each data-gathering laboratory the first task was evaluating common

SOPs, developed for the project, to test the robustness of all methodologies from

virus extraction to detection methods (real time PCR).

65

Materials and methods

Liver tissue and raspberries were the matrices selected for the ring trial. HAdV and

MNoV, supplied from the Istituto Superiore della Sanita’, Rome (ISS), were used as

the target virus and extraction control virus (called sample process control SPC),

respectively. Each target virus suspension (HAdV) was tested blind and coded; the

concentrations were known only by the ring trial leader. Fifty pi of each target virus

suspension and 10 pi of SPC virus suspension were used to spike each sample. The

MNoV was used as control to monitor the success of the extraction process.

2.1 Virus concentration and nucleic acid extraction

2.1.1 Sampling and virus concentration in pork liver tissue

Two hundred and fifty mg of liver tissue, obtained from a local UK supermarket,

was cut from three different inner portions of a liver. Fifty pi of the coded sample

virus was spiked into the sample and incubated for 2 h. The liver was then

homogenized manually using surgical blades and mortar. The homogenized liver

tissue was transferred into 1 ml lysis buffer (containing 0.14 M D-mercaptoethanol).

Ten pi of the positive process control virus was added to the sample. The tubes were

centrifuged for 20 min at 10.000 x g. Eight hundred pi of the aqueous phase was

transferred to a new 2 ml microtube and the suspension used immediately for RNA

extraction (VITAL SOP 009, Appendix C.4).

2.1.2 Nucleic acid extraction from pork liver tissue

Trizol (Invitrogen) (0.75 ml) and 0.2 ml of chloroform were added to the

supernatant obtained in section 2.1.1. The samples were incubated for 5 min at room

temperature and the tubes centrifuged for 15 minutes at 12.000 x g. One ml from

66

the aqueous phase was transferred to a clean 2 ml microtube. An equal volume of

Phenol : Chloroform: Isoamyl alcohol (25:24:1) solution was added and the solution

was centrifuged for 15 minutes at 10.000 x g. Eight hundred pi from the upper

aqueous phase was transferred to a clean 2 ml tube. LiCl (0.1 ml, 5 M) solution was

added into the solution and mixed by vortexing. The tubes were incubated at -20°C

for at least 4 hours. The supernatant after centrifugation (10 minutes at 10.000 x g)

was removed and the pellet was washed with 70% ethanol, dried and resuspended in

50 pi of nuclease-free deionised-distilled-water. The extracted RNA was stored at -

80”C. (VITAL SOP Oil, Appendix C.6).

2.1.3 Sampling and virus concentration from soft fruit

Twenty five g of raspberries, obtained from a local UK supermarket, was weighed

and transferred to a sterile beaker and 50 pi of Adenovirus (yielding stock titres of

approximately 4x10^ plaque-forming units (PEU) ml“ ) was spiked into the sample

and incubated for 2 hours. Ten pi of the SPC and 40 ml of Tris Glycine 1% Beef

Extract (TGBE) Buffer Including 6500 U of pectinase (250 pi of Pectinex Ultra

SPL solutions) were added to the sample. The sample was agitated at room

temperature for 20 min by rocking at 60 rpm. The supernatant was decanted from

the beaker through a strainer into one 50 ml tube. The sample was centrifuged at

10.000 X g for 30 min at 4°C. The supernatant was decanted into a single clean

tube/bottle. The pH of the sample was adjusted to 7.2 with Hydrochloric acid (1 N).

5X electrolyte-polyethylene glycol / Sodium chloride (0.25 ml of solution) was

added to the sample and incubated with gentle rocking at 4°C for 60 min. The

solution was centrifuged at 10.000 x g for 30 min at 4°C and the supernatant

decanted and discarded. The pellet was resuspended in 500 pi of PBS. Five hundred

67

pi chloroform:butanol solution (1:1) was added to the solution and centrifuged at

10.000 X g for 15 min at 4°C. The aqueous phase was transferred to a clean tube and

stored at -20°C. (VITAL SOP 005, Appendix C.3).

2.1.4 Nucleic acid extraction from soft fruits

Nucleic acid extraction from the samples processed in step 2.1.3 was performed

according to the NucliSENSE lysis protocol (BioMérieux). Briefly 500 pi of the

concentrated solution obtained from the soft fruit {section 2.1.3) were transferred

into a clean centrifuge tube. Four and a half ml of NUCLISENSE lysis buffer were

added to the tube, and mixed by vortexing briefly. The samples were centrifuged for

2 min at 1.500 x g to ensure that the entire sample was brought down into the tube.

Fifty pi of well-mixed magnetic silica solution (BioMérieux) was added to the tube

and mixed by vortexing briefly. The supernatant was discarded after centrifuge for 2

min at 1.500 x g. Wash buffer 1 (400pl) was added and the pellet resuspended by

pipetting/vortexing. The suspension was transferred to a 1.5 ml screw-cap tube.

Another 2 washes (400 |il each time with washing buffer 2 and 3) were made, after

every wash the pellet attached to the silica beads was resuspened. The final step

consisted in adding 50 pi of elution buffer and transferring the tubes to a

thermoshaker for 5 min at 60°C at 1.400 rpm. The tubes were placed in a magnetic

rack to allow the silica to settle and the eluate was transferred to a clean tube. The

RNA was retained at 4°C for a maximum of 24 hrs or at -80°C for up to one week

(VITAL SOP 012, Appendix C.T).

68

2.2 Positive standards construction

Within the VITAL project synthetic multiple-target DNA oligonucleotides were

constructed for use as quantification standards for nucleic acid amplification assays

for Human Adenovirus, Porcine Adenovirus and Bovine Polyomavirus [208]. For the

DNA standard a synthetic DNA molecule was designed to contain target sequences

for real time PCR assays for BPyV [209], HAdV [210] and PAdV [211]. The

oligonucleotides were synthesised (Eurofins MWG Operon, Ebersberg, Germany)

and cloned into a pCR 2.1-TOPO plasmid (Invitrogen, Breda, The Netherlands)

{Figure 2.1) [208].

The DNA concentration was determined by UV spectrophotometry in a Nanodrop

ND-1000 spectrophotometer (ThermoScientific, Wilmington, NC, USA). The

measurement was performed in duplicate and concentration in grammes was

converted to molecule number using the following formula:

DNA molecules x pi *— [(g/pl)/(plasmid length in base pairs x 660)]

X 6.022 X 10“

The standards used for the quantification of the target viruses were designed by

Martinez-Martinez et al [208] and subsequently sent to all VITAL laboratories

involved in the VITAL ring trial.

69

2.3 Real time PCR protocols

2.3.1 Quantification of adenovirus by real-time PCR

This protocol was based on the SOP “General protocol for the quantification of

Adenovirus by Real Time PCR” {see SOP 14 VITAL, AppendixC.9). Briefly, this

assay was a duplex real time PCR using the primers and conditions described by

Hernroth et al (2002) [210], with the inclusion of an internal amplification control

(LAC) [212] to verify if PCR inhibitions occurred. The reaction contained

IxTaqMan Universal PCR Master Mix (Applied Biosystems). The primers were

used at a final concentration of 0.9 pM, Table 2.2. These primers targeted the

HAdV hexon gene. The reaction mix was prepared following the manufacturer

instructions (ABI PRISM HID 7000 SDA from Applied Biosystems) and consisted

of 0.225 pM adenovirus TaqMan probe (labelled with F AM), 50 nM lAC probe (0.1

pM, labelled with VIC), 100 copies of adenovirus lAC (Yorkshire Bioscience Ltd,

UK) and enzyme mix (12.5 pi). Ten p.1 of the diluted nucleic acid extract was added

to make a final reaction volume of 25 pi.

The total volume for one reaction after addition of target was 25 pi (15 pi mix plus

10 pi sample or standard). Ten pi of nuclease-free deionised-distilled-water was

added to the NTC samples (no template control). Two PCR replicates were

performed for each sample. In each PCR run, positive (Synthetic multiple-target

DNA oligonucleotides described in section 2.3) and negative (water) amplification

controls were included to exclude possible contaminations. Following activation of

the UNG (uracil Nglycosylase) (2 min, 50°C) and activation of the AmpliTaq Gold

for 10 min at 95°C, 45 cycles (15 sec at 95°C and 1 min at 60°C) were performed.

The data were analysed using the MX3000 software.

70

2.3.2 Detection and quantification of Murine Norovirus by real-time RT-PCR

This protocol was based on the methods described by da Silva et al, Svraka et al,

Loisy et al and Kageyama et al [201, 213-215]. The oligonucleodites used are

described in Table 2.3. The MNoV PCR was performed using RNA UltraSense™

One-Step Quantitative RT-PCR System (Invitrogen) and primers and probe were

designed by Baert et al in the ORFl/2 junction region: Fw-0RF1/0RF2 (5’- CAC

GCC ACC GAT CTG TTC TG-3’) (location 4972-4991), Rv-0RF1/0RF2 (5’-

GCG CTG CGC CAT CAC TC-3’) (location 5064-5080), MGB-ORF1/ORF2 (5’-

FAM-CGC TTT GGA ACA ATG-MBG-NFQ-3’) (location 5001-5015) [216].

Ten pi of RNA extracted from the samples was added into each reaction, including

the negative control (NTC) and 0.6 pi of lAC [213]. The total volume for one

reaction after addition of target was 20 pi (10 pi mix plus 10 pi sample or standard).

Ten pi of nuclease-free deionised-distilled-water was added in the NTC samples. The

Real Time RT-PCR was performed in a real-time PCR platform (MX 3000,

Stratagene): reverse transcription 50°C for 15 min, 2 min at 95°C followed by 40

cycles of 15 s at 95°C and 1 min at 60°C. The data were analysed using the MX3000

software.

2.3.3 The internal amplification controls (lACs)

Internal amplification controls (lACs) were constructed for incorporation into real­

time nucleic acid amplification assays for Hepatitis E virus. Human Adenovirus

Murine Norovirus and Porcine Adenovirus. The addition of lAC into the assays was

to provide a robust PCR control that can be routinely applied in the analysis of foods

for viruses.

71

The lAC was a chimeric DNA molecule containing non-target sequences flanked by

target sequences complementary to the virus-specific primers [212]. This molecule

was then cloned into a plasmid {Figure 2.4) [212]. The plasmid or the RNA

transcript was the chimeric lAC which was co-amplified with the virus primers and

detected using a fluorescent probe complementaiy to the internal non-target

sequence [212]. When using a real-time PCR-based assay, the virus target

amplicons were detected with specific hydrolysis probes, labelled with one

fluorophore (e.g. FAM), and the LAC amplicons were detected with the specific

lAC probe, labelled with a different fluorophore (e.g. VIC). Each lAC was designed

by Diez.Valcarce [212] for the VITAL project as a DNA or RNA molecule

containing sequences from the prfA gene from Listeria monocytogenes (nucleotide

positions 2281-2348, AN AY512499) flanked by the sequences complementary to

the primers used in the specific assays [212]. The chimeric DNA molecules were

generated by PCR using as template 5 ng of L. monocytogenes strain CECT 935

DNA [212]. The PCR products were excised from a 2% Ix TBE agarose gel and

purified using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), then

cloned into the pCR 2.1-TOPO Vector (Invitrogen) in the case of lACs for the HEV

assays or into the pGEM-T Easy Vector (Promega, Madison, WI, USA) in the case

of lACs for the Human Adenovirus (HAdV), Porcine Adenovirus (PAdV) and

Murine Norovirus (MNoV) assays. lACP probe construction was also conducted by

Diez- Valcarce et al [212]. The probe was targeting portion of the target virus and

portion of the plasmid [212].

The lAC construction was performed by Diez-Valcarce et al [212], it was

subsequently sent to Yorkshire Bioscience for manufacturing and finally bought

from the VITAL members involved in the ring trial and data gathering.

72

73

00GCCCCTAGATCCTACCCTCAACGGAATTCTAGACAAAGATGGTGTGTATCCTGTTGAGTGTTGGTGTCCAGATCCAAGTAAC7r^C4r0C/lCm’ GCCGGGC4GG4CGK-CTCGGAG7ACCTGAGCCCaGGCCTGGrGC4G7TCGCCCGrGAACt3<3CCaCTACTGCAAOTTCCACATCCAGOTOCCiX:AAAAGTTCTTTGCÇÇTÇAAGAGCCTGCTOCTGCGGCCOC

pFBV2 4159 bp

Figure 2.1 Graphie representation of pFBV2 containing the sequence of the synthetic DNA. The length of the plasmid is 4,159 bp. The viral insert was flanked by Apal and Notl sites. The sequences of the qPCR assays are shown (BPyV—bold, HAdV-2—italics and PAdV— underlined. The sequences corresponding to the TOPO vector are in normal type. Figure taken from Martinez-Martinez et al [208].

74

Primers Sequences

Forward primer: AdP 5 ’- CWT ACA TGC ACA TCK CSG G-3’

Reverse primer: AdR 5 ’- CRC GGG CRA AYT GCA CCA G -3’

Adenovirus TaqMan Probe

5 ’- FAM- CCG GGC TCA GGT ACT CCG AGG CGT CCT-BHQ-3’

TaqMan probe: lACP 5 -VIC- CCA TAC ACA TAG GTC AGG -M GBNFQ- 3 ’

Table 2.2 Adenovirus oligonucleotides. The table describes primer sequences used

for the Adenovirus PCR detection method. Figure adapted from Diez- Valcarce et al

[212].

Primers Oligonucleodites

Forward primer FW -0RF1/0RF2 (5 ’- CAC GCC ACC GAT CTG TTC TG3’)

Reverse primer RV-0RF1/0RF2 (5 ’- GCG CTG CGC CAT CAC TC-3’)

Probe (Taqman MGB probe)

MGB-ORF1/ORF2 (5’-FAM- CGC TTT GGA ACA ATG -M G B ­N F Q -3 ’)

lACP lACP (5’-VIC- CCA TAC ACA TAG GTC AGG -M G B - NFQ- 3 ’

Table 2.3 Murine norovius oligonucleotides. The table describes primer

sequences used for the MNoV detection method. Figure adapted from Diez-

Valcarce et al [212].

Detection targetVims DNA/RNA

lAC targetL. monocytogenes DNA

Primer L.monoF # # # #

# * # #Primer L.monoR

Primer lACF # • • •

1st PCR

2nd PCR• • • •

Primer lACR

lACChimeric DNA

T7 RNA pol + DNase

DNA RNA

Duplex real-time PCR Duplex RT-real-time PCR

Figure 2.4 lAC constructions. PCR amplification of non-target DNA is performed using hybrid oligonucleotide primers. This produces a chimeric DNA molecule containing non-target sequences flanked by target sequences complementary to the virus-specific primers. This molecule is then cloned into a plasmid. If the lAC is for RNA virus detection, the plasmid should contain a T7 RNA polymerase promoter, and lAC RNA transcripts are subsequently produced by T7 RNA polymerase. The plasmid or the RNA transcript is the chimeric lAC which is co-amplified with the virus primers and detected using a fluorescent probe complementary to the internal non-target sequence. Figure taken from Diez- Valcarce et al [212].

76

2.4 Data interpretation: Results and data interpretation were described by

D’Agostino et al 2011 [217, 218]. Briefly, each participant sent to the trial leader

their data [217, 218]. When an assay showed a quantification cycle (Ct) value lower

or equal to 40 or 45 for Murine Norovirus or adenovirus, respectively,

independently of the corresponding lAC Ct value, the result was interpreted as

positive [217, 218]. When an assay showed a Ct value more than or equal to 40 or

45 for Murine Norovirus or Adenovirus, respectively, and the LAC Ct value lower

or equal to 40, the result was interpreted as negative [217, 218]. When an assay

showed both the target and its corresponding lAC Ct values > 40 or 45 respectively,

the reaction was considered to have failed. When a participant reported that at least

one of the HAdV replicates was positive, they were considered to have identified

the sample as being Adenovirus contaminated [217, 218]. When a participant

reported that both HAdV replicates were negative, but at least one replicate MNoV

assay was positive, they were considered to have identified the sample as being

Adenovirus uncontaminated [217, 218]. When a participant reported that both

replicate HAdV assays were negative and both replicate MNoV assays were

negative, they were considered to have reported that the analysis of that sample had

failed. Interpretation of the results followed the principles outlined by D’Agostino et

(2011) [219].

77

Results

2.5 Detection of spiked Human Adenovirus in raspberries samples

Nine batches of raspberry samples were spiked with an equivalent number of blind

coded samples, some of them known to contain human adenovirus (HAdV). Murine

Norovirus (MNoV) was used as internal extraction control. At the end of the ring

trial, the ring trial leader sent a feedback to each participant. The nine blind coded

samples were revealed to be divided into three groups: three positive with high viral

titre (5x lO" PFU) three positive with low viral titre (5x 10 PFU) and three

negative for HAdV. On three samples tested in duplicate for each category (high,

low level and blank) for HAdV all the samples tested by AHVLA showed the

expected Ct values (high HAdV contamination Ct values of 26, low HAdV

contamination 33, blank HAdV contamination no Ct values).

Table 2.5 shows the results from the analysis of raspberry samples artificially

contaminated with 5x 10 PFU of HAdV. The Ct values detected by real time PCR

for these samples had an average of 26 Ct. All samples were correctly reported as

contaminated with the target virus (HAdV) by real time PCR. Table 2.6 shows the

results, obtained by real time PCR, from the analysis of raspberry samples

artificially contaminated with 5x10^ PFU HAdV, in this case the Ct detected by real

time PCR were around 33 Ct. Table 2.7 shows the results from the analysis of the

non-artificially contaminated raspberry samples where no Ct values were detected

by real time PCR.

Sixteen out of 18 duplicates tested were positive for MNoV. Percentages of

concordance of the results provided at AHVLA by the ring trial leader are shown in

table 2.8.

78

Laboratoiy Sample A Sample B Sample C

HAdV MNoV HAd\^ MNoV HAdV MNoV

Rep. 1 Rep. 2 Rep. 1 Rep. 2 Int. Rq>. 1 Rqp. 2 Rep. 1 Rq>. 2 Int. Rep. 1 Rep. 2 Rep. 1 Rep. 2 In t

Table 2.5 Results of analysis of raspberry sample artificially contaminated with 5x10 PFU human adenovirus (HIGH). Twenty five g of raspberry was artificially contaminated with 50 p.1 of HAdV and with 10 jil of extraction control (MNoV). Samples A, B, C represent the samples run in duplicate of raspberries contaminated with HIGH level of HAdV (Human Adenovirus), and spiked with MNoV (Murine Norovirus). Rep. - replicate; + target signal present by real time RT-PCR, lAC signal present or absent by real time PCR; - target signal absent by real time PCR, LAC signal present; C-sample contaminated; Int -Interpretation. Figure adapted from D’Agostino et al, 2011 [217,218].

Laboratory Sample A Sample B Sample C

HAdV MNoV HAdV MNoV HAdV MNoV

Rep. 1 Rep. 2 Rep. 1 Rep. 2 Int. Rep. 1 Rep. 2 Rep. 1 Rep. 2 Int. Rep. 1 Rep. 2 Rep. 1 Rep. 2 Int.

Table 2.6 Results of analysis of raspberry sample artifîcially contaminated with 5x10 PFU human adenovirus (LOW). Twenty five g of raspberry was artificially contaminated with 50 jil of HAdV and with 10 |il of extraction control (MNoV). Samples A, B, C represent the samples run in duplicate of raspberries contaminated with LOW level of HAdV (human adenovirus), and spiked with MNoV (Murine Norovirus). Rep. - replicate; + target signal present by real time PCR, LAC signal present or absent by real time PCR; - target signal absent by real time PCR, LAC signal present; C- contaminated; Int - Interpretation. Figure adapted from D’Agostino erfl/,2011[217,218].

79

Laboratory’ Sample A Sample B Sample C

HAdV MNoV HAdV MNoV HAdV iViNoV

RqrJ Rqi. 2 R ep .! Rep. 2 Int. R ep .! Rep, 2 Rep. 1 Rqr. 2 bit. Rep. I Rep. 2 Rep. 1 Rep, 2 bit.

TIC nr nr.

Table 2.7 Results of analysis of the non-artifîcial contaminated raspberry sample.Twenty five g of raspberry was artificially contaminated with 50 |il of HAdV and with 10 jll of extraction control (MNoV). Samples A, B, C represent the samples run in duplicate of raspberries contaminated with no HAdV human adenovirus, and spiked with MNoV murine norovirus. Rep. - mean replicate PCR; + target signal present by real time PCR, LAC signal present or absent by real time PCR; - target signal absent, LAC signal present; UC - uncontaminated; Int - Interpretation. Figure adapted from D’Agostino et al, 2011 [217, 218].

HAdV MnoV

High level: 100% concordance 88.88% concordance

Low level: 100% concordance

Blank: 100% concordance

Table 2.8 Percentage of concordance for raspberry samples of the results provided at AHVLA by the ring trial leader. The first column describes that all 3 samples tested were reported as contaminated/uncontaminated with the High/ Low /Blank of HAdV. The second column represents the total MNoV concordance.

80

2.6 Detection of spiked Human Adenovirus in liver samples

Nine batches of liver samples were spiked with an equivalent number of blind

coded samples, some of them known to contain HAdV. MNoV was used as internal

extraction control. At the end of the ring trial, the ring trial leader sent a feedback to

each participant. The nine blind coded samples were revealed to be divided into

three groups: three positive with high viral titre (5x lO' PFU), three positive with

low viral titre (5x 10 PFU) and three negative for HAdV.

From the Collaborative Trial Table 2.9 shows the results from the analysis of liver

samples artificially contaminated with 5x 10 PFU of HAdV obtained by real time

PCR with an average of 29 Ct values. All samples were correctly reported as

contaminated but one was detected at a higher Ct than expected (40). Table 2.10

shows the results from the analysis of liver samples artificially contaminated with

5x10^ PFU HAdV, in these samples the average of Ct values detected was 34. All

samples were correctly reported as contaminated as judged by the ring trial leader.

Table 2.11 shows the results from the analysis of the non-artificially contaminated

liver samples and all samples were reported as negative where no Ct values were

detected by real time PCR in all samples.

Percentages of concordance of the results provided at AHVLA and those disclosed

by the ring trial leader are shown in Table 2.12. Of three samples tested in duplicate

for each category (high, low level and blank) for HAdV all but one sample gave the

expected Ct values. One replicate of sample contaminated with High HAdV level

gave a Ct over 40, and was considered by the ring trial leader as negative. Thirteen

out of 18 duplicates tested were positive for MNoV.

81

Laboratory Sample A Sample B Sample C

HAdV MNoV HAdV MNoV HAdV MNoV

Rep. 1 Rep. 2 Rep. 1 Rep. 2 In t Rep. I Rep. 2 Rep. 1 Rep. 2 Int. Rep. 1 Rep. 2 Rep. 1 Rep. 2 In t

Table 2.9 Results of analysis of liver artificially contaminated vrith 5x10^ PFU human adenovirus (HIGH). Two hundred and fifty mg of liver tissue was artificially contaminated with 50 jitl of HAdV and with 10 [il of MNoV (the extraction control).Samples A, B, C represent the samples run in duplicate of raspberries contaminated with HIGH level of HAdV (Human Adenovirus), and spiked with MNoV (Murine Norovirus). Rep. - replicate R; + target signal present by real time PCR, lAC signal present or absent; - target signal absent by real time PCR, LAC signal present; C - sample contaminated; Int - interpretation.

Laboratory Sample A Sample B Sançle C

HAdV MNoV HAdV MNoV HAdV MNoV

Rep. 1 Rep. 2 Rep. 1 Rep. 2 InL Rep. 1 Rep. 2 Rep. 1 Rep. 2 Int. Rep. 1 Rep. 2 Rep. 1 Rep. 2 In t

Table 2.10 Results of analysis of liver artificially contaminated with 5x10^ PFU human adenovirus (LOW). Two hundred and fifty mg of liver tissue was artificially contaminated with 50 |il of HAdV and with 10 jitl of MNoV (the extraction control). Samples A, B, C represent the samples run in duplicate of raspberries contaminated with LOW level of HAdV (Human Adenovirus), and spiked with MNoV (Murine Norovirus). Rep. - replicate; + target signal present by real time PCR, lAC signal present or absent; - target signal absent by real time PCR, LAC signal present; C - sample contaminated; Int - interpretation.

82

laboatarj* Sample A Sample B Sample C

RAdV MNoV HAdV MNoV HAdV MNoV

RepJ Rep. 2 Rep. I Rep. 2 bit. Rqi. 1 Rep. 2 Rep. 1 Rep. 2 bit. Rep, 1 Rep. 2 Rep. I Rep. 2 b it

Tir - no nr.

Table 2.11 Results of analysis of the non-artificial contaminated liver sample. Twohundred and fifty mg of liver tissue was artificially contaminated with 50 jil of HAdV and with 10 |Lil of MNoV (the extraction control).Samples A, B, C represent the samples mn in duplicate of raspberries contaminated with HIGH level of HAdV (Human Adenovirus), and spiked with MNoV (Murine Norovirus). Rep.- replicate; + target signal present by real time PCR, lAC signal present or absent; - target signal absent by real time PCR, lAC signal present, UC uncontaminated; Int - interpretation.

HAdV MNoV

High level: 83.33% concordance 72.22% concordance

Low level: 100% concordance

Blank: 100% concordance

Table 2.12 Percentage of concordance for liver samples of the results provided at AHVLA by the ring trial leader. The first column describes that all 3 samples tested were reported as contaminated/uncontaminated with the High/ Low /Blank of HAdV. Second column represents the total MNoV concordance.

83

2.7 Discussion

In general, the results obtained at AHVLA proved capability of detecting the target

virus (Human Adenovirus).

The method under trial proved capable of detecting Human Adenoviruses in berry

fruit at a level of at least 10 PFU per 25 g in artificially contaminated samples.

Concordance of 100% was obtained for detection of HAdV in raspberries, and

83.3% of concordance was obtained for detection of HAdV in pork liver, this is due

to one duplicate of the sample with high titre found to be negative. However, a

lower percentage of concordance (88.8%) for the raspberries (16 of 18 duplicates

tested were positive) and 72.2% for the pork liver (13 of 18 duplicates tested were

positive) for the process control virus (Murine Norovirus) (Tables 2.8 and 2.12)

indicated that the protocol was in need of some refinement. Template inhibition (too

much template in the reaction), pipetting error and some problems related to the

extraction methods of the pork liver SOP (such as presence of fat in the samples)

could have contributed to these differences. The SOPs of the EU VITAL project

were assessed with overall good results.

The ring trial assessed the efficacy of the SOPs developed during the first year of

the project and assessed the capability of the different data gathering laboratories in

their implementation, thereby providing a system for integrating the monitoring and

control of viruses in food supply chains.

84

CHAPTER 3

Hepatitis E virus in the UK pork food chain

85

3.1 Introduction: VITAL Data gathering

After optimisation of the SOPs during the VITAL Ring Trial, this project assessed

hepatitis E virus (HEV) contamination of the pork food chain from production to

point of sale.

Current systems for the monitoring and control of foodborne contaminations are

largely based on measuring contamination with bacterial and fungal pathogens, with

significantly lower emphasis on viral pathogens. As a consequence, the risks of viral

contamination of food at various points in production chains are largely unknown,

rendering construction of control measures and codes of practice very difficult.

HEV has been implicated in zoonotic foodborne acute hepatitis from contaminated

pig products [134] (see chapter 1). This study investigated the various stages of the

pork production foodchain from farm to retail outlet, to identify HEV contamination

levels. The knowledge derived from these studies will be used to develop codes of

practice aimed at reducing or eliminating transmission of HEV via the foodborne

route.

This chapter reports the findings obtained within the VITAL project in the pork

food chain in the United Kingdom.

86

Materials and Methods

3.2 UK sampling scheme

Samples were collected in a UK pig slaughterhouse (livers and individual faecal

samples), in a UK meat processing point (muscle samples), and in a UK

supermarket and a local butcher’s shop (sausages). In addition, surface swabs were

collected at the premises, in areas where viral contamination was considered more

likely. These included work surfaces (e.g. chopping boards, scales), utensils (e.g.

knives, points) and workers’ hands {Table 3.1). All samples collected were tested

for the presence of HEV (target virus). In addition they were tested for porcine-

adenovirus (PAdV) and HAdV, indicators of pig and human faecal contamination,

respectively. Nucleic acid extraction and real-time PCR were performed according

to standardised VITAL protocols. All samples were spiked with a control virus.

Murine Norovirus (MNoV) during nucleic acid extraction, to demonstrate the

extraction of amplifiable nucleic acid.

3.2.1 Sample collection:

3.2.1.1 Slaughterhouse: 40 carcasses were selected after slaughter. Ten carcasses

were randomly selected from each of 4 batches of pigs slaughtered on that day

(corresponding to 4 different farms). From each carcass the visceral pack was

removed during the slaughter process and 2 to 3 grams of liver and 8 to 10 grams of

faeces were collected. Ten surface swab samples were also collected at this point

{Table 3.1).

3.2.1.2 Processing/cutting point: 40 carcasses were selected. Ten carcasses were

randomly selected from each of 4 batches of pigs slaughtered (corresponding to 4

87

different farms, all slaughtered in the abattoir visited within the study). From each

carcass five grams of muscle were collected. Ten surface swab samples were also

collected at this point {Table 3.1).

3.2.1.3 Point of sale: 63 sausages were collected in 11 batches from 2 different

types of retail outlet (2 UK supermarkets and 1 butcher). Sausages were collected

on different days to ensure that they were from different batches of pigs. Eight

surface swab samples were collected at this point of the pork food chain {Table 3.1).

3.3 Sample preparation and nucleic acid extraction:

3.3.1 Faeces: Two hundred and fifty mg of soft faecal contents was suspended in

2.25 ml of gentamycin-containing PBS solution and centrifuged at 3.000g x 15 min.

Nucleic acid was extracted from 140 \i\ of the supernatant using the QIAamp® viral

RNA mini kit (QIAGEN), according to the manufacturer’s instructions. (VITAL

SOP 001, Appendix C.l, VITAL SOP 010, Appendix C.5).

3.3.2 Liver, meat, sausages: The samples were prepared according to the protocol

described by Bouwknegt et al, 2007 [151]. Briefly, two hundred and fifty mg of

pork meat or liver tissue taken from 3 different meat locations were disrupted in

lysis buffer and microcarrier beads (BlOspec products, cat. no. 110791 lOzx) using a

mechanical disruptor (3.000 rpm x 50 sec). Nucleic acid was extracted from the

supernatant using the RNeasy Midi kit (QIAGEN), according to the manufacturer’s

instructions. (VITAL SOP 009, Appendix C.4, VITAL SOP Oil, Appendix C.6).

3.3.3 Swabs: A sterile gauze square was swabbed five times in the operative’s hand

and transferred to a plastic bag containing 20 ml of gentamycin- PBS solution (see

recipe in Appendix C.2 and C.8). The gauze swab was squeezed to release the

88

contents of the swab, the contents were vortexed and the eluate was centrifuged at

3.000g X 5 min and stored at -20°C.

Nucleic acid was extracted using the NucliSENSminiMAGO kit (bioMérieux),

according to the manufacturer’s instructions. (VITAL SOP 002 and VITAL SOP

013 Appendix C.2 and C.8).

3.3.4 Extraction control: Each sample was spiked with 10 pi of a culture of MNoV

(titre: 4.7x10^ PEU) before the lysis step of the extraction. Detection of MNoV

RNA by PCR was used to demonstrate extraction of amplifiable nucleic acid.

3.4 Real time PCR: all real time PCR and real time RT-PCR were duplex PCRs

containing probe of the target virus and probe for the specific lAC.

3.4.1 HEV: PCR to detect HEV in the collected samples was performed using the

RNA Ultrasense™ One-Step Quantitative RT-PCR System (Invitrogen) and the

primers and probe.

Jothikumar’s primers [220] and probes were used and they were designed on a

multiple sequence alignment of HEV genome sequences in the ORF3 region

available in GenBank [220].

- JHEV-F (5’- GGT GGT TTC TGG GGT GAC -3’) (10 pM);

-JVHEV-R (5’- AGG GGT TGG TTG GAT GAA -3’) (10 pM);

- JHEV-P (Taqman probe) (5’-FAM- TGA TTC TCA GCC CTT CGC -BG Q l-3’)

(10 pM), [220].

89

Ten pi of RNA were added to a mix containing buffer RNA Ultrasense reaction mix

(5X), lAC probe (IpM), ROX reference dye (50x), RNA Ultrasense enzyme mix

and 0.6 pi of lAC to a total volume of 20 pi.

The real time RT-PCR reaction was carried out at 50°C for 15 min, 95°C for 2 min,

and 45 cycles at 95°C for 10 sec, 55°C for 20 sec and 72°C for 15 sec {VITAL SOP

020, Appendix C .l2).

3.4.2 PAdV: PAdV PCR was performed using TaqMan Universal PCR Master Mix

(Applied Biosystems). Hundesa et al (2009) [211] primers and probe were used:

PAdV-F (5’-AAC GGC CGC TAC TGC AAG-3’), PAdV-R (5’ AGC AGC AGG

CTC TTG AGG-3’), PAdV-P (5’- FAM-CAC ATC GAG GTG CCG C-BHQl-3’)

at a final concentration of 0.225 pM. Location of oligonucleotides refers to PAdV -3

hexon (GenBank accession number AJ237815).

Ten pi of RNA were added to a mix containing buffer reaction mix (2X) ,IAC-P and

0.5 pi of lAC (0.1 pM) to a total volume of 25 pi. The PCR reaction was performed

for 2 min at 50° C, 10 min at 95° C, and 45 cycles of 15 s at 95° C, 20 s at 55° C and

20 s at 60° C [221]. (VITAL SOP 015, Appendix C.IO).

3.4.3 MNoV: Real time RT-PCR was performed as described in section 2.3.2.

Briefly the MNoV PCR was performed using RNA UltraSense^^ One-Step

Quantitative RT-PCR System (Invitrogen) and primers and probe were designed by

Baert et al in the ORFl/2 junction region: Fw-ORFl/ORF2 (5’- CAC GCC ACC

GAT CTG TTC TG-3’) (location 4972-4991), Rv-0RF1/0RF2 (5’- GCG CTG

CGC CAT CAC TC-3’) (location 5064-5080), MGB-ORF1/ORF2 ( 5 -FAM-CGC

TTT GGA ACA ATG-MBG-NFQ-3’) (location 5001-5015) [216].

90

Ten pi of RNA were added to a mix containing buffer RNA Ultrasense reaction mix

(5X), lAC probe (IpM), ROX reference dye (50X), RNA Ultrasense enzyme mix

and 0.6 pi of lAC with a total volume mix of 20 pi. The RT-PCR reaction was

carried out at 50°C for 15 min, 95°C for 2 min, and 40 cycles at 95°C for 15 s and

60°C for 1 min (VITAL SOP 21, Appendix C .l3).

3.4.4 HAdV: Real time RT-PCR was performed as described in section 2.3.1 [210].

Briefly the HAdV PCR was performed using TaqMan Universal PCR Master Mix

(Applied Biosystems). Hernroth et al (2002) [210] primers and probe were used.

Primers have been selected from the conserved region of the first part of the

Adenovirus hexon gene. AdF (5’- CWT ACA TGC ACA TCK CSG G-3’). AdR

(5’- CRC GGG CRA AYT GCA CCA G-3’), AdPl (5’- FAM- CCG GGC TCA

GGT ACT CCG AGG CGT CCT-BHQ-3’) [210] at a final concentration of 0.225

pM. Ten pi of RNA was added to a mix containing buffer reaction mix (2X), lAC-P

(0.1 uM) and 0.6 pi of lAC to a total volume of 25 pi. The RT-PCR reaction was

performed at 2 min at 50°C, 10 min at 95°C, and 45 cycles of 15 s at 95°C and 1 min

at 60°C [210]. (VITAL SOP 015, Appendix C.9). Only swabs samples were tested

for HAdV.

3.4.5 Internal assay controls: All real time RT-PCRs and real time PCRs were

performed with an internal assay control (lAC). lAC construction was explained in

section 2.3.3. Briefly the lACs (lAC RNA or DNA depending on which virus was

going to be tested) were added in each reaction to test for inhibitors of PCR

amplification and to control for contamination of any of the real time RT- PCR

reagents [212].

91

The lAC was detected by a probe that targeted a different sequence to that of the

target virus probe, and was distinguished from the target probe by using a different

fluorescent label. A MGB TaqMan probe was used for each lACP assay, at a final

concentration of 0.1 pM {VITAL SOP 22 and 23, Appendix C.14 and C.75).

The constmction of lACs was performed by Diez-Valcarce et al [212] with PCR

amplification of non-target DNA using hybrid oligonucleotide primers containing

sequences from the prfA gene from Listeria monocytogenes (nucleotide positions

2281-2348, AN AY512499). This produces a chimeric DNA molecule containing

non-target sequences flanked by target sequences complementary to the virus-

specific primers [212]. The probes, labelled with one fluorophore (e.g. FAM), and

the lAC amplicons are detected with the specific lAC probe, labelled with a

different fluorophore (e.g. VIC) detected by real time RT-PCR with specific

hydrolysis [212].

The number of lAC copies was calculated by dividing the amount of lAC in each

stock solution by the weight of one lAC molecule [212].

3.4.6 Positive standards construction: Synthetic multiple-target RNA

oligonucleotides were constructed for use as quantification standards for nucleic acid

amplification assays for Human Norovirus genogroup I and II, Hepatitis E virus.

Murine Norovirus [208]. Briefly, a synthetic DNA molecule was designed to contain

target sequences for reverse transcription real-time PCR (RT-PCR) assays for HEV

[220], hNoV GI [214] and hNoV GII [222]. The oligonucleotide was synthesised

(Burofins MWG Operon, Ebersberg, Germany) and cloned into a pCR 2.1- TOPO

plasmid (Invitrogen, Breda, The Netherlands) [208], {Figure 3.2). The RNA

concentration was determined by UV spectrophotometry in a Nanodrop ND-1000

92

spectrophotometer (ThermoScientific, Wilmington, NC, USA). The measurement

was performed in duplicate and concentration in grammes was converted to molecule

number using the following formula:

RNA molecules x— [(g/|.il)/(transcript length in nucleotides x 340)]

X 6.022 X 1(P

The standards used for the quantification of the targets viruses were designed by

Martinez-Martinez et al [208] and subsequently sent to all VITAL data gathering

laboratories.

93

Slai^italioiBe Pl’ocesidng^ cutting po in t Point of sole

Bar under qp etator insp ecting livers B ench on v ^ c h meat is sold Chopping board

Floor under carcasses in dean area Box in which cuts collected Cold-room

Doorhandle

Hand 1 Doorhandle Hands

Hand 2

Hand 3

Hand 4

Hand 1

Hand 2

Hook

Kni fe us ed immediately after scrapin g Kni fe

Knife used on livers immediately after Point

Evisceration Saw

FI oor under v^iich livers are hung Scale

Boxes in which livers are collected prior to freezing and sale

Knives

Sausage maker

Sink

Sheer

Toilet

Table 3.1 Source of surface swab samples. The first column describes all the swabs samples collected at the slaughterhouse. The second column describes all the swabs samples collected at the processing point. The third and last column represents all the swabs collected at the point of sale.

94

OCGOCCOdTCOACGCCATCTTCATTCACAAAACTGOGAGCCAGATT<3CGATCOCCCTO:CACOTGCTCAGATCTOAGAATCTCATCCATCTOAACATfc-C7X4GMCGCCA7CA7CATTrACaKM7CQQQCAQQÂQA77QCQATCTCTaTCCA7AATCCGAG<n-CATOQMGCGCA7CCAGCQKQQOGTlGCllG<iMGWXMKG(i(i(iKXTGCGAAGGGCTGACAATCAACCCGGTCACCCCAGAAACCACCOCOGCCOCAATAAGGOCOAATTCTOCAOATATCCATCACACTOOCGOCCGCTCGAOa

GCOTGGGGCCC

pCR2.1TOPO-rSTD 4295 bp

Figure 3.2 Graphie representation of pCR2.1TOPO-rSTD containing the sequence of the synthetic rFBVl RNA. The length of the plasmid pCR2.1TOPO- rSTD is 4295 bp. The viral insert was flanked by Notl and Apal sites. The sequences of the RT-qPCR assays are shown (hNoV GII— within box, hNoV GI—italics, HEV—bold and MNV-1— underlined. The sequences corresponding to the TOPO vector are in normal type. Figure taken from Martinez-Martinez et al [208].

95

Results

UK pork products (livers, muscles and sausages) and faeces collected in the various

stages of the pork food chain (slaughterhouse, processing point and point of sale)

were tested for HEV to identify the possible HEV contamination levels.

The samples that tested positive for the different PCRs are listed in Table3.3. The

table describes the 3 points of the food chain where the pork samples were

collected.

3.5 HEV detection

HEV RNA was detected at all three sites of the pork food supply chain as evidenced

by real time RT-PCR. Table 3.3 shows the number of samples where HEV RNA

was detected. In the production point (slaughterhouse) we detected 5 HEV positive

faeces in a total of 40 samples collected (13%). One of the 40 livers (2.5 %) and 1

of 10 (10%) surface swabs, a hand swab of a worker along the chain, were HEV

positive.

In the processing plant none of the 40 pig muscle samples were HEV positive,

whilst 1 of 10 (10%) surface swabs from a metal point used to hook the carcasses

were HEV positive.

At the point of sale 6/63 (9.5 %) sausages and 2/8 (25%) surface samples (knife and

slicer swabs) were HEV positive. Five of the 6 positive sausages were in 1 of the 11

batches collected. All control results showed no evidence of cross contamination.

96

3.5.1 PAdV detection

The indicator of pig faecal contamination, PAdV, was detected at 2 of 3 sites.

Thirty-nine out of 40 (98%) faeces samples were PAdV positive in the production

point as were 6 of the 40 livers (15%) and 4 of 10 (25%) surface swabs (knife swab

immediately after evisceration, 2 hand swabs and floor swab from under which pigs

are hung). At the processing point PAdV was not detected in any of the pig muscle

samples (n=40) or swab samples (n=10) tested. At point of sale PAdV was not

detected in any of the sausages (n=63) tested but 1 of 8 swab samples (12.5 %) from

the door handle of the cold room was PAdV positive (Table 3. 3).

The highest number of PAdV positive swabs was observed in the production point

(4/ 10) whilst no PAdV was detected in any swab at the processing point (Table

3.5.2 HAdV detection

Swabs collected in the three points of the pork food chain were tested for HAdV,

but presence of virus was not detected in any of the swabs collected, as shown by

real time PCR. (Table 3.3).

97

Point in chain Sample type PAdVDNA + /n(% ) HEVRNA + /n(% )HAdV+/n

Production point (slaughterhouse)

Faeces 3 9 /4 0 (98) 5 /4 0 (12.5) -

Liver 6 /4 0 (15) 1 /40 (2 .5 ) -

Surface swab 4 /1 0 (40) 1 /1 0 (10) 0 /1 0

Processing point Muscle 0 /4 0 0 /4 0 -

Surface swab 0 /1 0 1 /1 0 (10) 0 /1 0

Point o f sale Sausage 0 /6 3 6 / 63 (9.5) -

Surface swab 1 /8 (1 3 ) 2 /8 (2 5 ) 0 / 8

Table 3.3 Number of samples PAdV, HEV and HAdV positive. The first column

represents the point of the chain: production point (sloughterhouse), processing

point and point of sale. The second column describes the sample type: faeces, liver,

surface swabs of the slaughterhouse. In addition it describes muscle and surface

swabs of the processing point and sausages and surface swabs of the point of sale.

The third columns describes the number and percentage of sample tested PAdV +

(positive)/-(negative) as assessed by real time RT-PCR. The fourth column

represents the number and percentage of samples tested HEV + (positive)/-

(negative). The last column describes the number and percentage of samples tested

HAdV +(positive)/-(negative).

98

3.6 Discussion

The presence of HEV and/or faecal contamination was investigated at three points

in the pork food supply chain in the UK, in the slaughterhouse, in the processing

plant and at the point of retail sale. Samples of pig liver and faeces were collected at

slaughter, samples of pig muscle (meat) during processing, and pork sausages at the

point of sale. In addition, swab samples were collected from various surfaces

considered likely sources of HEV and/or faecal contamination. All samples were

tested by real time RT-PCR for HEV and real time PCR for PAdV, and for HAdV

(swab samples only).

HEV has a high seroprevalence in the UK pig herds [121]. In this study HEV was

detected in the faeces of 12.5% of pigs at slaughter-weight. In a previous study

conducted in the UK [223] a similar percentage (13%) [121] of faeces collected at

slaughter weight was positive for HEV. The presence of HEV in pig liver at

slaughter has not been investigated in the UK prior to this study, but at 12.5%

indicates that a high percentage of HEV faeces-positive slaughter pigs may have

HEV present in the liver.

The failure to detect HEV in pig meat in the cutting (processing) plant compared to

the detection in 9.5% of pork sausages at the point of sale is interesting. Liver is not

permitted as a constituent of pork sausages in the EU (Commission Directive

2001/101/EC), but it is possible that the samples of muscle tissue scanned for HEV

at the processing point were not as representative as those for sausage meat, where

mixing and mincing of meat occurs prior to sausage production. The sausages were

collected on different days to ensure they originated from different batches of pigs.

99

The choice of sausages as the type of point of sale pork product investigated for

HEV was made because this product is consumed widely across the UK, unlike pig

liver for instance, and a 9.5% HEV detection rate in pork sausages at point of sale

could be a cause for concern.

In terms of viral transmission potential, the surface swabs provided evidence that

both PAdV and HEV contamination does occur in the slaughterhouse and

interestingly at the point of sale. In the processing point HEV was detected in just 1

surface swab. The 98% positive rate recorded for pig faeces with the PAdV indicator

provides validation of this approach for detection of faecal contamination of porcine

origin. The detection of PAdV on a door handle swab is interesting. This may have

been the result of transfer from a contaminated pig carcass, but the in-test controls

and method of sampling exclude this contamination as a source of the HEV in the

sausage meat.

No evidence of human faecal contamination was detected in any sample at any

point in the chain, indicating that personal hygiene standards were high, and that the

HEV detected was unlikely to have come from human contamination of the

samples.

In industrialized regions, although the incidence of clinical hepatitis E in humans is

low, the seroprevalence is relatively high, indicating a high proportion of subclinical

disease and/or underdiagnosis. Whilst it is likely that a small proportion of this

exposure to HEV results from travel to or migration from, endemic regions [117,

142], this still leaves a substantial level of exposure to HEV that appears to have an

indigenous source.

1 0 0

Pork food products have been shown to contain HEV in several industrialized

regions, including the UK and recently a cluster of cases in Southern France

associated with the consumption of raw figatelli, a pig liver sausage mainly eaten

raw [134]. However, these pork foodborne reports have to date involved pig liver,

and although in other studies pig muscle tissue was shown to carry HEV [224], this

current study shows that in the UK, a proportion of a point of sale pork product with

a high volume, nationwide consumption (>193,000 tonnes of pork sausages

consumed in GB in the year to February 2012, BPEX, UK), may be contaminated

with HEV.

In efforts to determine the transmission routes of autochthonous hepatitis E, this

data does indicate that the potential for exposure to HEV via consumption of

undercooked pork sausages does exist in the UK.

It has to be remembered that the numbers of samples tested for viral contamination

were relatively small in this study, so these results should be taken as indicators

only, and for greater confidence in the results, a greater number of samples would

have to be tested.

A corollary question to ask from these observations is in relation to the viability of

the HEV detected in the pork sausages. Feagins et al [85, 138] have modelled the

survival of HEV under various times and temperatures of cooking [85] observing

that HEV is not completely inactivated when heated at 56 ° C for 1 hour. So from

this evidence, adequate cooking of pork sausage should at least remove the threat of

infection. Whilst the findings reported here do not provide any indications regarding

the viability of the detected HEV, viability of HEV in the positive samples from this

1 0 1

study was determined using a 3D cell culture system which we have shown is more

sensitive than monolayer culture for in-vitro propagation of HEV {Chapter 4).

1 0 2

CHAPTER 4

Replication of Hepatitis E virus in three-

dimensional cell cultures system

103

4.1 Introduction

In addition to the data gathering on the presence of HEV in the food chain, this

project also aimed to develop a 3D cell culture system able to support the

replication of HEV and investigate if HEV detected by real time RT-PCR in pork

products corresponds to the presence of viable virus.

To date attempts to confirm the routes of transmission in epidemiological

investigations of cases of autochthonous hepatitis E in developed regions have

failed [113] but it is suggested that there may be several routes of zoonotic

transmission, contributing to exposure to HEV and disease in humans [125]

{Chapter 1).

A major impediment to the investigation of potential HEV routes of transmission

from pigs to humans is the limited knowledge relating to the survival of the virus in

pig tissues and faeces and in the environment. To a large extent this is due to the

difficulty in propagating HEV in-vitro. A method using hepatocellular carcinoma

HepG2/C3A has been reported by Emerson et al [225]. However, the infection of

HepG2/C3A with HEV was not able to be repeated at AHVLA (data provided by

Malcolm Banks). Tanaka et al [197] reported that PLC/PRF5 cells were able to

support replication of HEV. Moreover, Tanaka et al [197] reported that the virus

progeny was infectious, as demonstrated by passage in the PLC/PRF/5 cells [197].

Infection of PLC/PRF/5 using as inoculum swine faeces, instead of human faeces,

was attempted at AHVLA without success. There are several reports in the literature

demonstrating the potential of a 3D culture system utilising a Rotating Wall Vessel

(RWV), for the growth of fastidious viruses [201, 226-228]. This RWV low-shear,

suspension culture system was introduced as a novel method to cultivate cell lines

104

able to support bacterial replication in varying shear conditions [200]. The RWV is

a cylindrical bioreactor that is rotated on an axis parallel with the ground.

Subsequently, a solid body mass rotation of the culture medium is obtained, creating

a low-fluid-shear environment {Figure 1.10, chapter 1) [200, 229, 230]. The cells

are maintained in suspension by the resolution of the centrifugal, gravitational and

Coriolis effects, so cells placed in the RWV bioreactor experience minimal

mechanical stresses and high mass transport (of nutrients, oxygen etc). It has been

shown that several 3D lines changed molecular mechanisms in the transduction of

mechanical culture conditions into cellular effects [231]. Possible changes of the 3D

cells could be in cell cycle and cell death pathways or upstream regulation of

secondary messengers [231]. The cells are attached to porous, collagen-coated

microcarrier beads and this allow the cells to assemble into tissue-like aggregates

with a functionality similar to tissues in the human body [231]. The system offers a

potential for in vitro cultivation of HEV, therefore, we investigated the use of 3D

cultures as a means of improving the efficiency of HEV propagation.

Since that literature reported that the 3D cell culture system is an efficient and

reliable cell culture system able to support the propagation of viruses, during my

PhD project I aimed to:

1) Evaluate a new 3D culture system to assess HEV infectivity. Homogenate of

HEV positive pig liver obtained from an animal experiment was used as inoculum

to evaluate the 3D cell culture system. This was needed to verify if the HEV

detected by PCR in pig and environmental samples was infectious.

2) Compare the efficiency of the 3D system to the conventional 2D cell culture

system (PLC/PRF/5 cells grew in monolayer). In addition, cells grown in the 3D

105

system were transferred to a 2D system and infected. Since that the 3D cell culture is

difficult for a number of reasons (i.e limited number of samples for each experiment)

the testing of 3D transferred to 2D was an attempt to exploit these cell

receptor/differentiation advantages in a format i.e. microplate, that would allow for

larger numbers of samples to be tested.

4.2 Use of the 3D Culture system to investigate the viability of HEV detected by

RT-PCR in UK pork sausage and French liver sausage (figatelli)

The detection of HEV RNA by real time RT-PCR in six of 63 pork sausages

collected at UK retail outlets {Section 3.5.1) needed further investigation to clarify

the risks of foodborne transmission of HEV. The concern was: is the virus viable or

is it present but inactivated?

This section describes the work undertaken to use the 3D culture system as a means

of determining the infectivity of the HEV real time RT-PCR positive UK sausages.

Pork liver sausages, known as figatelli, which are often eaten raw after cold

smoking, have been linked to cases of clinical hepatitis E in France. A collaboration

was made with the French ANSES Institute in Paris. A contact was made with Dr

Nicole Pavio of ANSES, with the suggestion that by using the 3D system, the

viability of HEV detected in the figatelli could be confirmed. The figatelli saiisages

were then sent to AHVLA for further investigations.

The main aim of this section was testing via the 3D cell culture system if the UK

sausages collected during the VITAL data gathering {chapter 3) and French figatelli

contains viable virus, for this reason the UK and French sausages were used as

inoculum to infect 3D cell cultures and evaluate the infectivity of those samples.

106

Materials and Methods

4.3 Propagation of HEV in cell cultures: The Alexander hepatocarcinoma cell line

(PLC/PRF/5) from the American Type Culture Collection (ATCC 8024) was used

in the experiments. The cells were initially grown as 2D monolayers inside

conventional cell culture flasks (BD Bioscience, USA) in the complete growth

medium GTSF-2 [228] {Table 4.1) in preparation for seeding into the Rotating Wall

Vessel (RWV, Synthecon, Inc, Houston TX, USA), at 3TC in a 5% CO2

environment. Cells were trypsinised at 95% confluence and resuspended in fresh

medium at a density of 2x10^ cells/ml, the cell density required before being

transferred in the vessel. PLC/PRF/5 cells were introduced into a RWV cell culture

vessel with 10 mg/ml of porous Cytodex-3 microcarrier beads (collagen type-I-

coated porous microspheres, average size 175 \xm in diameter - Cat number C0646,

Sigma). Cells were cultured in the RWV in GTSF-2 at 37°C and 5% C02, with a

rotation speed appropriate to maintain the cell aggregates in suspension during the

entire culture duration (approximately 17-25 rotations/min initially with subsequent

increase to 27-35 rotations/min after the infection) [232]. The cells were grown for

at least 28 days before being infected to allow differentiation as described by

Navran [232]. For the 2D system experiments the cells were seeded in 48-well

plates, each well containing 2x10" cells.

4.3.1 Comparison of efficiency of the 3D and 2D cell culture for HEV

replication: The first experiment aimed to compare the efficiency of the 3D and 2D

cell culture systems when infected with the same HEV PCR positive inoculum.

Details of the protocol used are listed below.

107

4.3.2 Inoculum preparation: The positive HEV pig liver sample obtained from an

animal experiment was provided by Central Veterinary Institute, Wageningen

University and Research Centre [86]. A sample of the liver (0.3g) was homogenized

manually using a pestle and mortar in 2.7 ml of GTSF-2 media. The homogenate

was centrifuged at 8.000 x g for 3 minutes and the supernatant was filtered through

a sterile spin-X centrifuge tube filter (0.22pm; Costar) at 10.000 x g at 4°C for 15-

25 min. Two and half ml of inoculum was used to inoculate the cells.

4.3.3 Infection of the cells:

3D: the medium was removed from the vessels and 2.5 ml of viral inoculum was

added to the cells in the vessel. One vessel was inoculated with the virus and one

was used as a negative control (2.5 ml GTSF-2 non-infected media). Cells were

incubated for two hours at 35.5°C and inserted into the Rotating Wall Vessel. After

two hours the vessel was filled with 47.5 ml of fresh medium. Subsamples of

medium (140 pi) were collected in duplicate and added to 560 pi of lysis buffer

(Viral RNA, Qiagen), and stored at -20°C (0 days post infection, dpi). Samples were

collected as described above at the following dpi: 3, 6, 9, 12, 15, 18, 24, 27, 30, 32,

36, 39, 42,46,49, 58, 62, 67, 70, 85, 107, 126, 134, 155 and 175.

2D: the medium was removed from the cells and 200 pi of virus inoculum was

added to each well of a 48 well plate. One column of the plate was used as negative

control (200 pi of GTSF-2 non-infected media). The plate was incubated at 35.5°C

for two hours and each well was replenished with fresh medium (300 pi) without

removing the inoculum. A subsample (140 pi) of medium was collected in duplicate

and added to 560 pi of Lysis buffer and stored at -20°C (0 dpi). Fresh medium (280

1 0 8

pi) was added to replace the medium that was removed. Samples were collected

twice a week for 27 days.

4.3.4 Comparison of 3D, 2D and 3D transferred to 2D cell cultures for HEV

replication: In a further experiment, the 3D cells from a 3D vessel were transferred

to a plate to be infected simultaneously with the 3D cell culture and the

conventional 2D cell culture.

3D cells transferred to 2D: Each well of the plate contained 50 pi of cells and media

from one vessel (33 days of differentiation in the 3D system) plus 450 pi of GTSF-2

media. The plate was left in the incubator for 6 hours at 37°C to allow cell adhesion.

The preparation of the 3D and 2D cell culture was performed as described in section

4..?..?.

The inoculum was the supernatant (real time RT-PCR positive for HEV) of the cells

of the first experiment at 58 dpi {section 4.3.1).

The virus was used neat and diluted from 10' to 10' in the 2D and 3D transferred

to 2D systems. In the 3D system only four vessels were available and they were

infected with the virus undiluted, diluted 10 times (10'^), diluted 100 times (10'^)

and a non-infected control.

The infection of the three systems for HEV replication was performed following the

protocol described in section 4.3.3. The experiment was carried out for 40 days and

subsamples (140 pi) were collected at the following dpi: 0, 5, 8, 12, 15, 19, 22, 26,

29, 33, 36 and 40, for both 2D cells and 3D cells transferred to 2D, while for the 3D

cells the experiment lasted 96 days and samples were collected once a week.

109

4.3.5 RNA extraction from supernatant of 3D cell cultures, 2D cell cultures and

3D cell transferred to 2D system infected with HEV: Nucleic acid extraction was

performed according the Qiagen viral RNA kit (Qiagen) protocol. A subsample

(140 pi) of medium was collected in duplicate, added to 560 pi of Lysis buffer and

stored at -20°C (0 dpi).

4.3.6 Real Time RT-PCR: The real time RT-PCR reaction was set up according to

the protocol of Jothikumar et al 2006 [220] using the Superscript III Platinum one-

step quantitative RT-PCR kit (Invitrogen). The RT-PCR reaction was set up and

performed according to the manufacturer’s instructions. Jothikumar’s primers and

probes were used and they were designed on a multiple sequence alignment of HEV

genome sequences in the ORF3 region available in GenBank [220].

-JHEV-F (5’- GGT GGT TTC TGG GGT GAC -3’)

-JVHEV-R (5’- AGG GGT TGG TTG GAT GAA -3’)

- JHEV-P (Taqman probe) (5’-FAM- TGA TTC TCA GCC CTT CGC -BG Q l-3’).

The 20 pi reaction contained 10 pi of 2x RT-PCR kit Master Mix (Qiagen), 0.2pl of

enzyme, 2pl of RNA, and primers and probe at concentrations of 250 and 100 nM,

respectively. The real time RT-PCR reaction was carried out at 50°C for 15 min,

95°C for 2 min, and 45 cycles at 95°C for 10 sec, 55°C for 20 sec and 72°C for 15

sec.

Negative (water) and positive (synthetic RNA constructed by Martinez-Martinez et

al [208]) controls were included in each run.

4.3.7 Positive standard and copy number quantification: The standard used for

the quantification of the HEV nucleic was constructed by Martinez-Martinez et al

1 1 0

[208]. The plasmid construction was described in section 3.4.6. Briefly the

construction of a plasmid for transcription of synthetic RNA was performed. A

synthetic DNA molecule was designed to contain target sequences for real-time RT

PCR assays for HEV [220], hNoV GI [214] and hNoV GII [222] [208]. The

oligonucleotide was synthesised (Eurofins MWG Operon, Ebersberg, Germany) and

cloned into a pCR 2.1- TOPO plasmid (Invitrogen, Breda, The Netherlands).

The RNA concentration was determined by UV spectrophotometry in a Nanodrop

ND-1000 spectrophotometer (ThermoScientific, Wilmington, NC, USA). The

measurement was performed in duplicate and concentration in grammes was

converted to molecule number using the following formula:

RNA molecules x |il ^= [(g/|il)/(transcript lengtii in nucleotides x 340)]

>< 6 .02:2 >( 1()23

The 20 gl reaction contained 10 gl of 2x RT-PCR kit Master Mix (Qiagen), 0.2ml of

enzyme, 2gl of standard, and primers and probe at concentrations of 250 and 100

nM, respectively. The real time RT-PCR reaction was carried out at 50°C for 15 min,

95°C for 2 min, and 45 cycles at 95°C for 10 sec, 55°C for 20 sec and 12°C for 15

sec.

This synthetic plasmid, as previously mentioned, was designed by Martinez-

Martinez et al [208] as part of the VITAL project.

The copy number of the samples was extrapolated from a standard curve produced

from logio titrations of cloned amplicon. Copy number (HEV RNA copies per ml

sample) was calculated as follows:

1 1 1

copy number per 2 gl template RNA

X 30 (per 60 gl extraction elute = 140 gl sample, HEV positive supernatant)

X 7.14 (1000 gl/140 gl)

4.3.8 Definition of Ct values: Cycle threshold (Ct) is a measure of the number of

PCR cycles (in Real-time RT-PCRs) needed to observe a fluorescent signal. Our Ct

+/- cut off value was fixed at 40 to avoid false positive and non-specific signal; this

means that only sample with Ct < or equal to 40 were considered positive. The Ct

values were determined fixing the threshold just above the non-specific background

fluorescence.

4.4 Materials and Methods to investigate the viability of HEV in UK sausages

and figatelli samples

4.4.1 Cell Preparation: cell culture preparation was performed as described in

section 4.3.

4.4.2 Inoculum preparation of figatelli sample and UK sausages: After one year

from the first HEV RNA detection only three of the six sausages (section 3.1) were

still HEV RNA positive by real time RT-PCR, possibly due the degradation of the

HEV RNA after prolonged storage. The HEV real time RT-PCR-positive figatelli

samples were obtained from a French processing point (Dr Nicole Pavio, ANSES,

France). Two and half g of each of the four figatelli samples (four different subtypes

of genotype 3) and the three UK sausages were homogenized manually using a

pestle and mortar in 5ml of GTSF-2 media. The homogenate was centrifuged at

1 1 2

8.000 X g for 3 minutes and the supernatant was filtered through 1.2 gm, 0.45 \im

and 0.2 gm filters to reduce the risk of bacterial contamination.

4.4.3 Cell inoculation: cell inoculation was set up as described in section 4.3.3.

4.4.4 Determination of infectivity of progeny virus: To evaluate the infectivity of

progeny virus from the primary inoculations, HEV real time RT-PCR positive

supernatant from dpi 16, of one sample named as figatelli 84, was used to infect

fresh 3D PLC/PRF5 cultures. Two and half ml of HEV positive supernatant was

used as inoculum to infect the 3D cell cultures. The cell inoculation was performed

as described in sections 4.3.3.

4.4.5 RNA extraction and real time RT-PCR: HEV RNA extraction and real time

RT-PCR was performed as described in section 4.3.5 and 4.3.6.

4.4.6 Electron microscopy: In order to provide further confirmation of the validity

of the real time RT-PCR results, a sample was sent to Reimar Johne and Jhone

Reetz at the Bundesinstitut fur Risikobewertung (BfR) in Germany and submitted to

electron microscopy examination. Supernatant of the cell cultures collected at 33

dpi was exposed to polioformcarbon-coated, 400-mesh copper grids (Plano GmbH,

Wetzlar, Germany) for 10 min, fixed with 2,5% aqueous glutaraldehyde (Electron

Microscopy Science Company , Germany) solution for 1 min and stained with 2%

aqueous uranyl acetate solution (Electron Microscopy Science Company,

Germany) for 1 min. The specimens were examined by transmission electron

microscopy using a JEM-1010 (JEOL, Tokyo, Japan) at 80 kV accelerated voltage.

113

ComponentConcentration or volume ^

Source/order number of designation

MEM -0 1 supplemented with 2.25 g/liter of L-Gln 400 ml (40%) Sigma

L-15 600 ml (60%) GIBCO

NaHC03 1.35gperL Sigma/S-5761

HEPES 3.0g Research Organic s/6003H-2

Folic Acid 67 /ig/ml lOOul SIGMA/F-8758

0.5% Nicotinic Acid 0.66 ul Sigma/N-4126

Bactopeptone 0.6g Difco/0118-01

I-inositol 0.024g Sigma/I-5125

Fructose 0.13g Sigma/F-3510

Galactose 0.25g Sigma/ G-5388

D-Glucose 0.33g Sigma/G-5250

200mML-Gln [2Mm] 18.3ml Sigma/G-5763

Gentamycin 1ml Gibco/600-5750AD

Fungizone 1ml Sigma A 2942

Ins ulin - Trans ferrin- S o dium-S e lenite (ITS S) 5ml Sigma/1-1884

Fetal bovine serum (FBS)

6% during differentation 2% after infection Autogenbioclear

Table 4.1 GTSF-2 complex medium with relative supplements \

Concentrations are provided for the preparation of approximate by 1 L volume of

medium.

114

Results

4.5 Comparison of HEV replication in 3D cell and 2D cell culture systems

This experiment was set up in order to assess the efficiency of HEV replication in

the 3D cells culture system and to compare it to the conventional 2D cell culture

system.

After the inoculation with homogenate of HEV positive liver obtained from an

animal experiment, in the 3D culture system, HEV nucleic acid was detected in the

supernatant of the infected cells at all collection points (Figure 4.2 A). In contrast,

no HEV nucleic acid was detected at any collection points in the 2D culture system

(Figure 4.2 E), for this reason the 2D experiment was terminated at 27 dpi. In the

3D culture system, the virus copy number showed a significant increase between 24

to 39 dpi, peaking at 1.5 xlO^ viral RNA copies/ml of supernatant, followed by a

second increase between 100 dpi to 155 dpi, peaking at 2.0 xlO^ viral RNA

copies/ml of supernatant (Figure 4.2 A). HEV nucleic acid was still detectable at

175 dpi. In both culture systems, the non-infected control cells remained HEV

negative throughout the experiment. The real time RT-PCR controls (synthetic

plasmid and water) performed as expected, with the positive control being positive

while no Ct values were detected for the water samples (real time RT-PCR negative

control).

4.6 Evaluation of the infectivity of the viral progeny and comparison of HEV

replication in 3D and 2D culture systems and 3D cells transferred into 2D

During the secondary infection, where the inoculum was the supernatant collected at

58 dpi from a vessel of the previous experiment (section 4.5), viral RNA was

detected by real time RT-PCR at all dpi in the 3D cell culture system (Figure 4.3 A),

115

and at all dilutions of inoculum {Figure 4.3 A, shows the Ct values and Figure 4.4 A

shows the copy number/ml). In the supernatant of the cells infected with undiluted

inoculum the viral RNA copies/ml was low and constant throughout all the

experiment. In this experiment no trend was observed, the expectation was that in

the non diluted inoculum the copy number detected by real time RT-PCR would be

the highest followed by the sample infected with inoculum diluted 1 in 10 (10'^) and

the lowest copy number should have been detected in the sample infected with

inoculum diluted 1 in 100 (10'^).

In the supernatant of 3D cells infected with inoculum diluted one in ten, the number

of viral RNA copies/ml increased sharply between 61 and 82 dpi, peaking at 3.5

xlO \ After 82 dpi the number of genome copies in this sample remained constant

{Figure 4.3 and Figure 4.4 A). The number of copies in the supernatant of the

inoculum diluted one in 100 (10'^) was higher compared to the other 2 inocula

during almost all the follow up of the experiment. Several other peaks were

observed throughout the incubation period suggesting HEV replication.

In the 3D cells transferred to 2D system the trend was similar for the undiluted and

10' dilution of inoculum and Ct values indicative of a positive signal were detected

at all dpi. In the supernatant of the 3D cells transferred to 2D infected with

inoculum diluted 100 times, Ct values were detected at all dpi but 12 dpi. However,

all the other dilutions (from 10" to 10' dilutions) were considered negative as Ct

values were above 40 for almost all dpi (Figure 4.3 C).

In the 2D system, the Ct values (Ct values range 25-35) for undiluted and 10'

dilution of inoculum remained almost unchanged, throughout the experiment whilst

116

the values for the 10' were negative at 26 dpi. All the other dilutions were equal to

or above 40 and for this reason considered as being negative (Figure 4.3 B).

117

2 50E+08

150E+08

OL 1 OOE+08

OOE+07

0 O O E + 0 0 I # I # I # i 0 1 # 1 — I— I— — r— I— r —i— i— i— i— i— i— i— r

3D cells

2 0 cells

days post infection

ICXG COPY number/ml 0 3 6 9 12 15 18 24 273D cells 0 0000 00033 0 0046 00033 0 0240 0 0480 36000 822% 11312D cells 000 000 000 000 0 00 000 0.00 000 000

Figure 4.2 Cq)v niiinbeis of HEV genome ml detected by real time RT-PCR in

the 3D culture system. 3D and ZD PLC/PRF/5 cell cultures were infected with

homogenate of HEV positive liver and supernatant was tested by real time RT-PCR.

A ------ represents the copy number/ml of supernatant of the 3D PLC/PRF/5,

represents the copy number/ml of the supernatant of 2D cells. Both samples

were infected with homogenate of HEV pork liver obtained from an experimentally

infected animal.

B Copy numbers per ml detected in the supernatant of 3D cells and 2D cells.

The table shows 10 viral copy numbers per ml detected by real time RT-PCR. It

details the viral copy number displayed in Figure 4.2 A to better describe that the

copy number/ml observed in the first 27 days were not zero.

118

20

2 5 -

3D cells» 3 0 - u n d i l u t e d

10''-!10''-2Ic 3 5 -

4 0 -

4 57 14 21 27 34 4 0 4 7 5 4 61 68 75 82 8 9 960

days p o s t in fe c tio n

T ’ W ' W A \ ,

3D cells transferred to 2D

■ u n d i l u t e d

- 1 0 ''- 1

■ 1 0 ''-2

■ 1 0 ''-3■ 10 ''-4

■ 10 ''-5

- 10''-6

12 15 19 22days p o s t in fe c tio n

2 0 -r -

2 5 -

3 0 -

Ô 3 5 -

4 0 -

3 60 5 8 12 1 5 19 22 26 2 9 33 40

2D cells

- u n d i l u t e d

- 1 0 » -1

. 10''-2 - 10 ''-3 . 10 ''-4 . 1 0 ''-5 . 1 0 ''-6

days p o s t in fe c tio n

Figure 4.3 Comparison of Ct values detected in the supernatant of the 3 different systems infected with different dilutions of inoculum. The 3 different cell cultures were infected with HEV positive supernatant diluted serial times obtained in the previous experiment. The supernatant collected at different days post infection (X axis) was tested by real time RT-PCR. The graphs represent the Ct values during the course of the experiment. A Ct values in the 3 cell cultures system black dashed line represent the cut off, B Ct values in the 3D cells transferred into 2D, black dashed line represents the cut o ff; C Ct values in the 2D cells cultures, black dashed line represent the cut off.

119

I 2.50E-K)7 - SI 2.00E+07 -

I 1.50E+07 -

l.OOE+O'

OOOE+OO

0 7 14 21 34 40 47 54 61 68 75 82 89 96

■ undiluted

10-1 • 10-2

c b \- s p o s t i n f e c t i o n

10^6 copy number/ml 0 dpi 7 14 21 27 34 40 47 54 61 68 75 82 89 96 dpi

Undiluted 0.34 0.99 0.19 0.42 0.45 0.39 0.27 0.18 0.20 0 26 0.79 1.55 1.83 1.64 0.47

0 38 0.11 1.04 1.47 083 0.14 0 06 0.00 0.55 0 99 19.97 36.21 0.29 0.92 0.01

iO'^-2 8.21 1,38 11.36 17.18 8.29 0.48 12.23 22.28 28.69 31.03 13.11 1.08 9.77 12 64 3.42

Figiire 4.4 copy num bers m l detected in th e supernntnnt o f the 3D cell cu ltures infected w iüi m i diluted m oculm n progeny, inoculm n diluted 10' or inocu lum diluted ICr .

A Co])y num bers/m l of H E V genom e detected b y R T-PC R in the 3D culture system (W hile figure 4.3 A describes the Ct values figure 4.4 A describes the copy num ber/m l observed in th e 3D cell culture during the course o f th e experim ent).

The 3D cells w ere infected w ith HEV positive supernatant undiluted, diluted 10

tim es (10'^) and diluted 100 tim es (10"^). The supernatant w as tested by real tim e

R T -P C R . represents supernatant of PLC/PRP/5 infected w ith hom ogenate o fH EV pork liver obtained from the supernatant o f the first experim ent (inoculum

undiluted). ------ represents supernatant o f cells infected w ith inoculum diluted 10

tim es and describes supernatant o f cells infected w ith inoculum diluted 100

times.

B Co%)y m im bers per m l detected iir the serial d ilution exi>erimeiit. T he table

shows 10^ viral copy num bers per m l detected by real tim e RT-PCR. I t details the

viral copy num ber displayed in F igure 4 .4 A.

1 2 0

4.7 Results of the use of the 3D cell culture system to investigate the viability of

HEV in UK sausages and French liver sausages (figatelli)

Homogenates of 3 UK sausages and 4 French figatelli were used as inoculum to

infect PLC/PRF/5 cells in the 3D cells culture system.

HEV RNA was detected by real time RT-PCR only in the supernatant of the 3D

cells infected with 1 of 3 French figatelli samples (figatelli 84). HEV RNA was

detected at all dpi in the cells inoculated with the figatelli homogenate (Figure 4.5

A). At 0 dpi the viral RNA copies were 6 . 4 x 1 /ml, the HEV viral RNA copy

number fell to 3.35x10^ /ml on 5 dpi, and then began to increase on dpi 26 to a peak

of 1.75x10^ /ml, at dpi 49. At the last sampling point on dpi 55, the copy number

was 8.9x10"^/ml. No further collections were performed due to mould contamination

in the vessels.

The cells infected with progeny virus from the original figatelli homogenate

cultures had detectable HEV RNA on all dpi tested. The copy numbers remained

fairly constant from just after inoculation (0 dpi) to the final reading at dpi 35, and

varied from 4.14x10^ to 1.71x10^ copies per ml suggesting viral replication (a slight

increase of HEV RNA copy numbers/ml was observed).

HEV RNA was detected in the supernatant of 3D cells infected with the UK

sausages until five dpi only in two out of three sausages used as inoculum to infect

the 3D cells (Figure 4.6).

4.7.1 HEV viral particles observed by electron microscopy: In the EM picture

(Figure 4.7) four HEV viral particles were detected by EM. The sample tested by

EM was supernatant of figatelli 84 collected at 33 dpi.

1 2 1

«o ïo iXj o

LU LU LUO O Oo CO (Oc\i ^ T-

LU LU LU LU LU LU LU0 0 0 0 0 0 0r ^ j O O O O o

T T » 1 30 O D C s l

|uj,üequjnu Ados

So

<C

i Bg §

&R g

g

8 B

? 8 8< 0

% 8<=>

80

5 gP i

P J 85

R kT#i B

rC fN

s i

R sC3

8

(N gi

çy?8 8

C 3 i

8C3

s0

S 2i

C fd

RC 3 S

80

80

c g

C380

gC> i

3sc ü

ÇOi C 3

0 *—

8 f

g ;

CO

11

S

aa>sCLoo

T5

HpqS

&

CL

• 5PPh

&1a

a3

aS

3L-iO

§

-g

I

CL

00

gtJOÈs<j3txO

.a

CA

1 2 2

w<D3

IÜ

40 ■’

5 8 12 16

•UK 44

UK 46 UK47

■ figatelli 87

• figatelli 100

■figatelli 116

days post infection

Figure 4.6 Supernatant of cells infected with UK sausages and French sausages tested hy real time RT PCR. Ct values detected by real time RT-PCR in the supernatant of PLC/PRF/5 cells infected with UK and French sausages (samples UK sausages 44, 46, 47, and French sausages 87, 100, 116)

123

'4'5

'4 ^

(

i-

. A~C

Figure 4.7 HEV-like particles in HEV positive supernatant obtained from the

3D cell culture system infected with homogenate of Hgatelli 84. Four HEV like

particles were observed by electron microscopy in the supernatant of 3D cells

infected with homogenate of HEV positive figatelli and collected at 33 dpi. The

arrows show four different HEV-like viral particles.

1 2 4

4.8 Discussion

4.8.1 HEV replication in the 3D cell culture system

The aims of this work were to investigate an in vitro 3D culture system to facilitate

studies into the viability of HEV detected by real time RT-PCR in pig products, and

to compare the system with the conventional 2D system.

In a study by Tanaka et al [III, 197] the potential of in vitro replication of HEV in

2D cultures of 21 cell lines, including PLC/PRF/5 (human hepatocarcinoma cell

line) [233] was investigated. The PLC/PRF/5 cell line was able to support in vitro

replication of HEV, yielding a high titre of HEV from 14 dpi to the end of the

observation period at 88 dpi [197]. However, the methodology described by Tanaka

et al [111] proved difficult to reproduce in our laboratory, prompting the

investigation of 3D culture system for more efficient virus propagation as described

by Straub [231].

The real-time RT-PCR results obtained in the 3D cultures, inoculated with

homogenised liver samples from an experimentally infected pig, showed detectable

HEV RNA at all dpi. In contrast, in the 2D system infected in parallel with the same

sample, HEV RNA was not detectable at any dpi.

In the primary inoculation there was evidence of virus replication by the

maintenance of the HEV RNA copy number close to the 0 dpi titre up to 24 dpi,

followed by a burst of replication peaking at 36 dpi with a decline back to the level

observed at 0 dpi at 42 dpi. This decline may have been due to synchronized

infection of uninfected cells and subsequent internalization of virus. Thereafter the

copy number gradually increased to reach a peak at 136 dpi (2 x 10 viral RNA

125

copies number per ml) followed by a gradual decline back to below the level

detected at 0 dpi by the end of the experiment at 175 dpi, when probably cell and

virus damage caused the rate of viral RNA production to be exceeded by that of

degradation.

By setting up a secondary inoculation {Figure 4.3 A), using progeny virus from the

first replication round, the viability of the virus detected by real time RT-PCR was

demonstrated. This data illustrates that in our hands, the 3D system was more

efficient in terms of demonstration of infectivity compared to the 2D system, since

the virus was able to replicate up to five months in the 3D cell culture system with

higher copy number/ml detectable by real time RT-PCR. Other studies have also

demonstrated that the 3D cell culture system is a useful tool in the cultivation of

fastidious bacterial and viral pathogens [199, 231, 234].

In the secondary passage titration experiment, the efficiency of propagation

appeared to be indirectly proportional to the concentration of the inoculum. Walker

et al [235] described that, depending on the cell line and the concentration of the

cells, a lower multiplicity of infection (MOI) can ultimately result in a higher peak

titre during the incubation period, and this phenomenon was also demonstrated by

others using suspension cultures [235]. The inoculum with the highest dilution

showed a phasic pattern of viral RNA copies number/ml not dissimilar to that of the

primary inoculation, whilst the intermediate dilution maintained the RNA copy

numbers/ml until a late single peak between 61 and 82 dpi. The undiluted inoculum

maintained the HEV copy at or around that of the TO level for the duration of the

experiment. Higher MOI represented by high copy number in real time RT-PCR

could be attributable to the same phenomenon explained by Walker et al [235].

126

The inverse relationship between inoculum concentration and efficiency of

replication, as measured by HEV copy number in the cultures, may indicate the

presence of a high proportion of non-viable HEV particles in the inoculum. These

could have a direct interfering effect by physical competition for receptor sites

[236], or an indirect effect by induction of the interferon response [236]. Dilution of

the inoculum would have the effect of reducing this interference. Since the cell line,

PLC/PRF5 appears not to produce IFN as measured by CAT ELISA (see Appendix

A), then the former interpretation is more likely to be correct.

In the serial dilution experiment, a small titration range was introduced to give some

impression of the relative sensitivity of 3D, 3D transferred to 2D, and 2D alone. The

virus was detectable by real time RT-PCR in all three systems until the end of the

experiment {Figure 4.3). In both the 2D and the 3D transferred to 2D systems the

virus was detectable at several dilutions at most dpi {Figure 4.3). The Ct values

among the dilutions were very similar and did not follow a regular trend (the

expected reduction would be three Ct of difference between each ten fold dilution).

The global examination of the data indicated a similar sensitivity of the 3D

transferred to 2D compared to the conventional 2D system in detecting HEV RNA.

A possible explanation for the inconsistency in detection of HEV RNA observed

with the 3D transferred to 2D system could be that not all the cells adhered to the

2D wells when transferred. Consequently, every time that the supernatant was

collected an undefined amount of cells was also removed. This would cause a

gradual reduction of the cells in the wells which consequently might have limited

the availability of cells for virus replication.

127

An end point of the serial dilutions was not achieved but it was observed that with

the increase of dilution, the Ct values progressively became higher in all systems

except the 3D system. Since there was no true trend in the Ct values detected, the

results obtained in the serial dilutions experiment were insufficiently consistent to

draw any measurable conclusion in relation to the relative sensitivity of the 3D cells

transferred to 2D and 2D system.

Regarding the results obtained from the serial dilutions of the virus in the 3D

system, no conclusion can be made since the virus was able to infect the cells in all

the dilutions. No trend was observed between the different dilutions, in terms of

higher virus concentration higher copy number. In fact, higher HEV RNA copy

number was detected in the cells infected with the inoculum diluted 100 times (10'

). This may be because the cells better tolerated a lower concentration of virus

allowing more efficient replication.

In conclusion, we demonstrated that the PLC/PRF/5 cells grown in the 3D culture

system offers an efficient tool for HEV propagation. The same cell type grown in

monolayer did not show significant evidence of supporting HEV replication. The

described system, including the diagnostic procedures, is useful tools to investigate

the biology of HEV virus and the viability of HEV in pork samples.

Research to optimise the described cell culture systems for the assessment of the

infectivity of the HEV in food samples should be planned. This may contribute

towards understanding the mechanisms of HEV replication, pathogenesis and

environmental (including within food matrices) survival.

128

4.8.2 Discussion of the use of the 3D cell culture system to investigate the

viability of HEV in the UK sausages and French liver sausages (figatelli)

Figatelli sample 84 was shown to contain viable HEV that was able to replicate in

the 3D cell culture system. There was an increase in the RNA copy numbers

between 29 and 44 dpi. The relatively low copy number in the inoculum used did

not affect the onset of viral replication in the 3D cell culture system {Section 4.8.1).

It is possible that the virus needs a specific threshold for optimal, sustained,

productive replication of HEV, and a low copy number in the inoculum would

influence the time taken for this threshold to be reached [197]. The observation that

at least one of the figatelli samples contained viable HEV provides a very good

corroboration of the reports from France implicating consumption of these products

as a cause of hepatitis E [134].

Regarding the culture of progeny HEV, RNA was detected at all dpi, but no

significant increase in copy number was observed at the time of last sampling (dpi

34). This result may indicate that to observe higher viral titre the virus probably

needs more time. Tanaka et al [197] observed that HEV appears to require a high

titre (between 10 and 10 ) to be able to infect 2D PLC/PRF/5 and HEV RNA was

first detectable in the progeny at 36 days by real time RT-PCR [197]. In this

experiment the viral copies number/ml was relatively low in comparison with the

Tanaka’s experiment and probably for this reason the figatelli progeny could not

replicate rapidly in the 3D system, giving a constant low copy number throughout

the experiment (34 dpi). Unfortunately, the experiment had to be terminated due to

mould contamination in the vessel. Due to this contamination we could not

determine if the HEV copy number would have increased in the same way as that of

129

figatelli 84, where the copy number began to increase around 36 dpi. Unfortunately

due to time limit and the economical restraints of the project the experiment could

not be repeated.

To provide further confirmation of the HEV real time RT-PCR results figatelli 84,

samples of culture supernatant from dpi 33 were examined by EM. Several entire

viral particles were observed in the sample showing that cell-free virus was present

in the supernatant after replication and release from cells.

Three other figatelli samples (87, 100 and 116) and the 3 UK HEV real time RT-

PCR positive sausages were tested using the 3D cell culture system, but other than 0

and 5 dpi for the UK sausages and 8 dpi for the 2 figatelli samples number 87 and

116, HEV RNA was not detected at any other time point. It may be that viral titre in

the inoculum was not high enough to obtain viral replication in the cells, as

previously reported by Tanaka et al [197] or because the virus contained in the

figatelli and UK sausage samples was not viable. A consideration that should be

taken into account is that in the two figatelli samples HEV RNA was detected until

8 dpi and for the UK sausages HEV RNA was detected until 5 dpi, these results

could be due to the fact that no viable virus in the UK sausages (due to bad

conservation of the samples) and that for the other two figatelli sample the viral titre

was not enough to support an in vitro infection. This would require further testing

using greater numbers of field samples such as sausages.

In conclusion, these results showed a significant finding outside the normal range of

experimental error. It is possible that in different homogenates or supernatants there

will be variable proportions of intact, viable virus, defective interfering particles,

free viral genomic RNA and degraded but still PCR reactive RNA. The differing

130

proportions will be manifested by a different relationship between apparent copy

number and kinetics of replication in-vitro. In theory, if all the RNA detected in the

real time RT-PCR is inactivated/degraded but still PCR reactive there should be a

decreasing in detection HEV RNA by real time RT-PCR.

131

CHAPTER 5

Inactivation studies

132

Introduction: After having evaluated the new 3D cell culture system the next step

was to carry out inactivation studies to better understand how and if HEV can be

inactivated.

In addition, to harmonise the VITAL project, three post-graduate students were

focused on inactivation studies of three different viruses: Norovirus, HEV, and

Adenovirus. In my case, the survival of HEV in pork products under various

inactivation conditions was investigated.

This chapter is subdivided into the following sections 1) heat inactivation 2) UV

light and NaOCl inactivation.

5.1 Heat inactivation

The risk of HEV infection via the consumption of HEV-contaminated pig livers

raises public health concerns, since it is not clear whether cooking conditions will

be effective in inactivating the virus. Feagins et al (2008) [85, 87] performed a HEV

heat inactivation study in an animal model. The objective of this study was to

determine if traditional cooking methods are effective in inactivating infectious

HEV present in contaminated commercial pig livers. Four of the five pigs

inoculated with a pool of two HEV-positive liver homogenates incubated at 56°C

for 1 h developed an active HEV infection. The pigs inoculated with a homogenate

of two HEV-positive livers stir-fried at 19UC for 5 min and the group of pigs

inoculated with a homogenate of two HEV-positive livers boiled in water for 5 min

showed no evidence of infection since there was no seroconversion, viremia, or

faecal virus shedding in any of the inoculated pigs.

133

HEV can be found in the liver, blood, and intestinal tract, which are all consumed in

one form or another and often together, such as in sausages. How safe are these

products? The question is difficult to answer because until recently it was difficult

to propagate HEV in cell cultures and testing HEV viability in vivo requires the use

of experimental animals, usually primates or pigs.

The in vitro 3D cell culture system described in the previous chapter was used to

propagate HEV for a heat inactivation experiment based on Feagins’s work but

replacing the use of pigs with 3D cell culture system.

5.2 UV light and NaOCl HEV inactivation studies

After having optimised the in vitro 3D cell culture system at AHVLA, as part of the

PhD project, I moved for one year to the Central veterinary Institute (CVI, The

Netherlands) transferring the 3D technology to continue the HEV in vitro studies

and subsequently perform virus inactivation experiments.

The following inactivation strategies were selected in this project: UV light

inactivation; NaOCl inactivation.

1) UV inactivation was investigated to clarify whether it could be a useful tool to

inactivate HEV on tools such as knives used to process the pork meat, on surfaces

and equipment such as found in farms, slaughterhouses, processing plants and

points of sale.

In this study the effect of UV light on HEV was evaluated. A homogenate of HEV

positive liver was exposed for 20, 30 and 50 minutes to UV light and the inoculum

was used to infect 3D cell cultures. This experiment was set up because exposure to

solar ultraviolet (UV) radiations is a primary means of virus inactivation in the

134

environment, and germicidal (UVC) light is used to inactivate viruses in hospitals

and other critical public and military environments [90, 91]. Safety and security

constraints have hindered exposing highly virulent viruses to UV and gathering the

data needed to assess the risk of environments contaminated with viruses that can

cause high consequence in humans [92]. UV sensitivity of some viruses has been

extrapolated from data obtained with UVC (254 nm) radiation by using a model

based on the type, size and strandedness of the nucleic acid genomes of the different

virus families [93, 94]. These predictions were based on viruses suspended in liquid

solutions, instead of a dry state. Therefore, there was little information to allow

accurate modelling, confident extrapolation, and prediction of the UV sensitivity of

viruses deposited on contaminated surfaces, conditions more likely to be relevant to

public health.

2) HEV inactivation by sodium hypochlorite (NaOCl) was also performed. Sodium

hypochlorite solution, commonly known as bleach, is frequently used as a

disinfectant. This disinfectant is one of the most common used in farms, in high

containment level laboratories, in water and or surfaces to kill bacteria and viruses.

US Government regulations (21 CFR Part 178) and the CDC: Guideline for

Disinfection and Sterilization in Healthcare Facilities (2008), allow food processing

equipment and food contact surfaces to be sanitized with solutions containing

bleach, provided that the solution is allowed to drain adequately before contact with

food, and that the solutions do not exceed 200 parts per million (ppm) available

chlorine. Furthermore Zand et al (2012) [237] observed that different concentrations

of NaOCl from 0.5% to 5.25% were able to inactivate E. Faecali growth [237].

135

Only a few studies have been deseribed with sodium bypocblorite inactivation of

viruses. Sabbab et al in 2010 [238] described that 5 minutes with peracetic acid or

with chlorine dioxide are sufficient to reduce the level of bacteria in environmental

surfaces as indicated in the disinfectant criteria standard guideline submitted by U.S

Protection agency (EPA) Guidance manual showing that this disinfectant is a good

tool to inactivate pathogens. Furthermore, this statement was also confirmed by

Tburston-Enriquez et al in 2003 demonstrating that viruses like FCV, adenovirus

and poliovirus type 1 are inactivated by chlorine [239].

Since NaOCl appears to be commonly used in the field we decided to set up an

inactivation study with NaOCl. HEV positive supernatant was treated with NaOCl

to a final concentration of 5% and the effect of the NaOCl was neutralised after 5

minutes with 10% of sodium tbiosulpbate (NazSiOg). This approach for neutralising

the cytotoxic effects of NaOCl was adopted from Sabbab et al, Benarde et al and

Tburston-Enriquez et al [238, 240, 241] who performed studies to verify if bacteria

and viruses were killed by the disinfectant.

136

Materials and Methods

5.3 Cells preparation; The cells were propagated in the 3D cell culture system as

deseribed in section 4.3.

5.3.1 Heat inactivation experiment

5.3.1.1 Inoculum preparation: The positive HEV sample was provided by the

Central Veterinary Institute, Wageningen University and Research Centre - CVI.

The sample was a liver tissue from an experimentally HEV infected pig [86]. The

liver tissue (Ig) was homogenized with a mechanical disruptor in 1 ml of GSTF-2

media and subsequently 8 ml of GTSF-2 media was added. The bomogenate was

centrifuged at 8.000 x g for 3 minutes and the supernatant was filtered through a

sterile spin-X centrifuge tube filter (0.22pm; Costar) at 10.000 x g at 4°C for 15-25

min. [87].

The human bepatocareinoma cell line was infected with inoculum untreated, heated

at 56‘ C for Ibour or heated at 100°C for 15 minutes. In addition one vessel was

used as non infected control.

5.3.1.2 Infection of the 3D cells: The medium was removed from the vessels and

2.5 ml of inoculum was added. The vessels were incubated for 2 hours at 35.5°C,

and gently agitated every 20 minutes. After two hours, 47.5 ml of fresh medium was

added to each vessel (the inoculum was not removed).

The whole experiment lasted 69 days. The collection of the sample was performed

on day: 0, 7, 13, 22, 33, 40, 48, 55, 62 and 69. On each collection day the following

aliquots were collected: 140 jil in duplicate for each vessel added to Lysis buffer

137

(Qiagen Viral RNA kit, Qiagen), to be stored at -20°C before RNA extraction. Fresb

medium (47.5 ml) was added to eaeb vessel to restore tbe full volume (50ml).

5.4. UV inactivation experiments

5.4.1 Preparation of the inoculum: Tbe preparation of inoculum was performed as

described in section 5.3.1.1.

5.4.2 HEV UV inactivation procedure: A 30 W UV lamp, 91 cm long (TUV

30WAT, 254nm, UVC, Philips) was warmed up for ca 20 min before starting tbe

experiments and tbe UV lamp was previously used for 30 hours (an UV light lamp

can be used for ca. 8000 hours). This represented tbe range of time recommended to

ensure that tbe light was 100% efficient. Tbe lamp was positioned above tbe sample

Petri dish to allow a distance from tbe UV source to tbe sample surface of 20 cm,

with tbe agitation set at 100 rpm.

Seven and half ml of liver bomogenate, prepared as previously described {Section

5.4.1) was exposed for 20, 30 and 50 minutes respectively under UV light. Tbe UV

irradiation dose that tbe inoculum received was: Dose UV light for 20 min= 99.6m

(W*s)/cm^; 30 min= 149.4m (W*s)/em^; or 50 min= 256.6m (W*s)/cm^. These data

were obtained from Philips website (bttp://www.pbilips.co.uk/) and they were

calculated as if tbe sample was Im from tbe centre of tbe lamp. Tbe Intensity was

83uW/cm^. Tbe depth of tbe inoculum in tbe Petri dish was 4mm. Tbe temperature

of tbe inoculum exposed under UV light was tested and it did not change during tbe

UV light treatment (ca 18°C).

A second experiment was performed as above but decreasing tbe depth of tbe

inoculum (from 4 mm to <1 mm) whilst exposed to tbe UV light for 30 minutes.

138

The duration of the first experiment where the inoculum was exposed under UV

light for different length of time was 60 days, whilst the second experiment where

the inoculum was exposed under UV light for 30 min and the depth of the inoculum

in the Petri dish was less than 4mm was terminated after 36 days due to

mycoplasma contamination. Each experiment was run with a positive control

(bomogenate of HEV positive liver and a non infected control).

5.4.3 Inoculation of cultures and sample collection: tbe infection was performed

as already deseribed in section 4.3.3. Briefly tbe medium was removed from tbe

vessels and 2.5 ml of infected supernatant (bomogenate of liver) (previously UV

inactivated) was added to tbe cells. Tbe vessels were incubated for 2 hours at

35.5°C, and inserted in tbe Rotating Wall Vessel (RWV). After two hours 47.5 ml

of fresb medium was added to each vessel (tbe inoculum was not removed). On

each collection day (tbe samples were collected once a week for two months) tbe

following aliquots were collected: 140 pi in duplicate for eaeb vessel was added to

Lysis buffer, to be stored at -20°C before extraction and an aliquot of media (20 ml

ca. from tbe infected vessels) was collected and stored at -80°C. After each

collection tbe vessels’ volumes were restored to 50 ml by addition of fresb GTSF-2

medium {Table 4.1).

5.4.4 Electron microscopy: Tbe electron microscopy procedure was performed as

described in section 4.4.6. Briefly, R. Jobne and J. Reetz at BfR in Germany

performed tbe EM examination, to provide more evidence of HEV replication.

Supernatants of tbe cell cultures that received tbe inoculum treated for 20 min under

UV light and collected at 21 dpi were applied to polioformcarbon-eoated, 400-mesb

copper grids (Plano GmbH, Wetzlar, Germany) for 10 min, fixed with 2,5%

139

aqueous glutaraldehyde (Electron Microscopy Sciences Company, Germany)

solution for 1 min and stained with 2% aqueous uranyl acetate solution (Electron

Microscopy Sciences Company, Germany) for 1 min. The specimens were

examined by transmission electron microscopy using a JEM-1010 (JEOL, Tokyo,

Japan) at 80 kV accelerated voltage.

5.4.5 Sodium hypochlorite inactivation

5.4.5.1 Preparation: In this experiment HEV positive supernatant was used as a

surrogate to better simulate environmental surface disinfection in premises where

pork and pork products are bandied. Five ml of a HEV positive supernatant

collected at 13 dpi exposed under UV light for 20 min in tbe previous UV

inactivation experiment and shown to be viable, was chosen to be treated with 5%

Sodium hypochlorite for 5 minutes. Tbe Sodium bypocblorite was neutralized with

10% of sodium tbiosulpbate [238, 240, 241].

Four vessels were used for this experiment. One vessel was used as positive control

(positive supernatant). Tbe second vessel was infected with 2.5 ml of HEV positive

supernatant treated with 5% NaOCl for 5 min. Tbe third vessel was tbe HEV

negative supernatant treated with 5% of NaOCl. Tbe last vessel was tbe non

infected control.

5.4.5.2 Treatment: Before tbe inoculum was added to tbe cells, to remove possible

bacteria contaminant, tbe inoculum (HEV positive supernatant treated or non­

treated with NaOCl) was filtered with 0.45 pim filter. Infection was performed as

described in section 5.4.3. Briefly, 2.5ml of HEV positive supernatant (previously

tested by real time RT-PCR) was collected from tbe total 5 ml previously exposed

to 5% NaOCl for 5 minutes and used as inoculum to infect tbe 3D cell cultures.

140

Sample collection was performed once a week as described in section 5.4.3 for 36

days before termination due to mycoplasma contamination.

5.4.6 RNA extraction and Real Time RT-PCR: RNA extraction and PCR of tbe

supernatant collected from tbe vessels was performed as described in section 4.3.5

and 4.3.6. Briefly nucleic acid extraction from 140|il of eaeb sample was performed

using tbe Qiagen viral RNA kit (Qiagen) following tbe protocol deseribed by tbe

manufacturer’s guidelines.

Real time RT-PCR testing was performed according to tbe protocol described by

Jotbikumar et al (2006) [220] using tbe Superscript III Platinum one-step

quantitative RT-PCR kit (Invitrogen). Tbe real time RT-PCR reaction was set up

and performed according to tbe manufacturer’s instructions as described in section

141

Results

5.5.1 Heat inactivation treatment

Three aliquots of bomogenate of HEV positive liver were non treated, heated for lb

at 56°C or heated for 15 min at 100°C and subsequently used as inoculum to infect

tbe 3D cell culture system to better understand tbe optimal temperature to inactivate

tbe virus.

HEV RNA was detected at all dpi except for 22 dpi in tbe cells infected with tbe

untreated inoculum {Figure 5.1). At 33 dpi tbe Ct values decreased and remained

almost constant until tbe end of tbe experiment (69 dpi). HEV RNA was also

detected in tbe 3D system infected with tbe inoculum heated at 56^C for one hour, at

0, 7, dpi with Ct values ranging between 43 and 40 and from 48 dpi until 62 dpi (Ct

values between 35 and 40) {Figure 5.1).

No viral RNA was detected at any dpi in tbe 3D cells infected with tbe inoculum

that was heated at 100°C for 15 minutes {Figure 5.1). In this experiment we set tbe

cut-off at 40 Ct to exclude non specific signal meaning that all samples detected

above 40 Ct were considered negative.

142

•3 • -

23 -<ü

>o

3 12

■2D unt'=3t5d ■ 2D % : C ■2D 133= D

days post infection

Figure 5.1 Tientment of HEV infected liver nt 100 "C lends to irrnctiv atiair of

the vims. 3D PLC/PRF/5 were infected with bomogenate of HEV positive liver and

the inoculum previous the infection was untreated, heated for Ih at 56°C and heated

for 15 min at 100 °C. Supernatant of the 3D cells was tested by real time RT-PCR.

— ♦ supernatant tested by real time RT-PCR of the cells infected with non heated

bomogenate of HEV positive liver. — supernatant of cells infected with

bomogenate of HEV positive liver heated for Ih at 56°C . — supernatant of 3D

cells infected with bomogenate of HEV positive liver heated for 15 min at 100°C.

■ represents +/- cut off at 40 Ct. Samples above this line are considered

positive for HEV.

143

5.5.2 Homogenate of HEV positive liver exposed to UV light to test HEV

inactivation

A homogenate of a HEV positive liver previously shown to contain viable virus was

exposed to UV light for 20, 30 and 50 min and aliquots of 2.5 ml were used to infect

3D cell cultures and HEV infectivity was evaluated by real time RT-PCR. The

experiment was repeated, decreasing the depth of the inoculum in the Petri dish

during the 30 min of UV light exposure.

The real time RT-PCR analysis showed that Ct values were detected at almost all

dpi in the supernatant of 3D cells infected with inoculum exposed to UV at different

times.

In the 3D cells infected with non-treated inoculum, HEV RNA was detected at all

except two dpi, 7 and 35 dpi. Ct values increased significantly at 13 dpi, indicating

lower viral titre (Ct values during the experiment ranged from 25 to 40). From 13 to

28 dpi, there was a difference of 8 Ct values (Ct values were between 30 and 38).

HEV RNA was detected in the 3D system infected with inoculum treated with UV

light for 20, 30 and 50 minutes at 0 ,7 , 13, 21, 28 and 42 dpi {Figure 5.2). At 35 dpi

no Ct values were detected in the supernatant of all samples by real time RT-PCR in

all the different treatments, suggesting that possibly the virus was replicating inside

the cells or due to a problem with the RNA extraction on that particular dpi.

Figure 5.3 describes the decay of HEV in terms of Ct values observed by real time

RT-PCR immediately after the UV light treatment. The non UV light treated (NT)

inoculum showed higher Ct values in comparison with the Ct values observed in

vessels receiving inoculum exposed to the UV light treatment during the 20, 30 and

50 min, indicating no inactivation. It should be noted that the UV dose calculation

144

provided by the UV light producer was made considering the UV lamp Im distant

from the sample while in this case the samples were 20 cm distant from the UV

lamp. Although the UV dose calculations are approximate, figure 5.3 shows there

was a partial increase in Ct in parallel with increase of the UV dose.

145

tu

13>Ô

21G 7 1 2 28 31 42 ec

“ ♦ “ untreated

UV

UV

- # “ 50 UV

days post infection

Figure 5.2 Analysis of the variation of Ct values overtime iir the UV light irractivatioir experiment irr tire supernatarrt of tire 31) cell cultures. 3D cells were infected with homogenate of HEV positive liver not treated, treated for 20 min under UV light, treated for 30 mm under UV light and treated for 50 min under UV light Supernatant o f the 3D cells cultures was tested by real time RT-PCR.— represents the supernatant of cells infected with the homogenate of liver not treated under UV light, represents the supernatant of cells mfected with homogenate of liver treated for 20 minutes under UV light. — represents the supernatant of cells infected with homogenate of liver treated under UV light for 30 min. — represents the supernatant of cells mfected with homogenate of liver treated for 50 mmutes under UV light

IS the cut off at 40 Ct values.

146

0.045i

0.040“

u

0.035“

0.030

r300

-200 0

“100

20 30 50

Treatment time (min)

Figure 5.3 HEV decay measured in the inoculum by real time RT-PCR after the UV light treatment. The graph describes the variation of the Ct values observed in association with the UV light dose that the inoculum (homogenate of HEV positive liver not exposed and exposed under UV light for 20, 30 and 50) received previous the 3D cell cultures infection. The UV dose was calculated considering the light at 1 m of distance from the centre of the lamp. The UV dose showed in this graph is an approximation of the UV dose during the time of the experiment. Black columns represent the increasing of UV light dose during the time. W hite column represent the Ct values detected after the UV light treatment.

1 4 7

5.5.2.1 Homogenate of HEV positive liver treated for 30 min to UV light

An homogenate of HEV positive liver was exposed to UV light for 30 min and 2.5

ml of the inoculum was used to infect 3D cell cultures; the HEV infectivity was

evaluated by real time RT-PCR. This UV light experiment was repeated, decreasing

the depth of the inoculum in the Petri dish.

HEV RNA was detected by real time RT-PCR during the entire experiment in the

supernatant of cells infected with an untreated homogenate of HEV positive liver

{Figure 5.4). Ct values increased from 0 dpi to 14 dpi from 20 to 30 Ct, at 18 dpi

there was a modest decrease in Ct and then an increase again to 26. From 29 dpi

until 36 dpi Ct values remained stable around 30, suggesting a stable replication.

The supernatant of 3D cells infected with the homogenate of HEV positive liver

where the inoculum prior to infection was exposed for 30 minutes to UV light, was

HEV positive by real time RT-PCR at all dpi but 3 dpi (10, 18, 29). The Ct values

were slightly higher (around 5 Ct higher) compared to the non treated inoculum

suggesting that viral particles may have been partially inactivated by the UV light.

From 0 until 10 dpi, Ct values increased gradually then decreased at 14 dpi,

increased again at 18 dpi and decreased at 26 dpi. At 29 dpi no RNA was detected

by real time RT-PCR but lower Ct values were detected at 33 dpi, followed by a

modest decrease of Ct at 36 dpi, suggesting that the virus was replicating.

5.5.2.2 Electron microscopy result

Following negative staining with uranyl acetate HEV-like particles were detected in

the supernatant of cells infected with homogenate of HEV positive liver that had

148

been exposed under UV light for 20 min and collected at 21 dpi. However, HEV

viral particles were very sparse and only as single particles {Figure 5.5).

149

20 -

25 -

>

35 -

40 -

0 3 7 10 14 18 22 26 29 33 36

■ liver

•liver 30'UV

days post infection

Figiire 5.4 Ann lysis of the Ct values observed in the supernatant of 3D cells infected with inoculiun treated with XJ\' light for 30 min 3D cells were infected with homogenate of HEV positive liver not exposed under UV light and exposed under UV light for 30 min. The supernatant collected at different days post infection (X axis) was tested by real time RT -PCR. The inocula were untreated homogenate of liver (— ) or homogenate of liver exposed for 30 minutes under UV light (— ).The IS the cut off at 40 Ct.

1 5 0

3 ^ j*

M.: ' 'S<'

Figure 5.5 HEV-like particles. The figure shows two HEV-like particles (arrow)

obtained by negative staining with uranyl acetate. The two particles were detected

in the HEV positive supernatant of 3D cell culture collected at 21 days post

infection and infected with the inoculum exposed for 20 min under UV light and

tested by electron microscopy.

151

5.5.3 Inactivation of HEV positive supernatant with 5% of NaOCl

Figure 5.6 describes the results obtained in the NaOCl inactivation study. The

supernatant (the inoculum was supernatant of 3D cells infected with HEV positive

supernatant, exposed for 20 minutes under UV and collected at 13 days post

infection) of cells not treated with NaOCl was positive at all time points except for

supernatant collected at 26 and 36 dpi. Ct values after a peak at 3 dpi with a Ct of 20

ranged between 32 and 40 during the course of the experiment. At 3 dpi, Ct values

decreased then increased slowly until 26 dpi and then HEV RNA was detected

again at 29 and 33 dpi, suggesting viral replication. Supernatant of the 3D cells

infected with inoculum treated with 5% NaOCl was positive by real time RT-PCR

at 0, 3 and 7 dpi.

In all experiments, to exclude a non specific signal, a cut off of 40 Ct was selected.

152

2 0

25 -

30 -

o35 -

40 -

450 3 7 10 14 18 22 26 29 33 36

• sup progeny •NaOCL

day s p o s t in fe c t io n

Figure 5.6 Analysis of the Ct va hies of HEV positive supernatant treated with NaOCl and untreated. PLC/PRF/5 cells were infected with HEV positive supernatant obtained form the UV light experiment. The cells received inoculum not treated with NaOCl and treated with 5% of NaOCl for 5 min. — represents the Ct values detected by real time RT-PCR of 3D cells infected with HEV positive supernatant exposed for 20 min under UV light and collected at 13 dpi but nottreated with NaOCl. represent the Ct values detected by real time RT-PCR of3D cells infected with HEV positive supematant exposed for 20 min under UV lightand collected at 13 dpi then treated for 5 minutes with 5% of NaOCl. is the cutoff at 40 Ct.

153

5.6 Discussion

5.6.1 Homogenate of HEV positive liver heated at different temperatures

A homogenate of pig liver known to contain infectious HEV was subjected to

heating, simulating some normal cooking conditions, and was applied to 3D cell

cultures to determine the effect of the virus inactivation as measured by HEV RNA

copy numbers in cell supernatants.

Differences in the Ct values were observed between the supernatant of the cells

infected with non- heated liver and supernatant of cells infected with HEV positive

liver heated at 56°C for one hour. As we can see in figure 5.1 the Ct values were

lower (ranging between 40 and 29) in the sample infected with the homogenate of

non-heated liver compared to the supernatant of cells that received as inoculum the

homogenate of liver heated at 56°C for one hour. The Ct values in the supematant of

cells infected with HEV positive liver heated at 56°C for one hour were higher,

probably reflecting partial virus inactivation. Full HEV inactivation was observed in

the inoculum heated at 100°C since no HEV RNA was detected by real time RT-

PCR at any point of the experiment. The results are similar to those of Feagins et al

[85, 87] where the pigs infected with HEV positive liver heated at 56°C were

shedding virus in the faeces, showing that the treatment was not sufficient to

inactivate HEV. Furthermore, the similarity of the results of in vivo and in vitro

experiments of this study underline the potential of the 3D cell culture system in

replacing the traditional in vivo infectivity studies.

HEV transmission in industrialized regions is not fully understood. It has been

suggested and is now widely accepted that HEV transmission is zoonotic [138,

154

242]. Tel et al [133] reported direct evidence of zoonotic HEV transmission via the

consumption of grilled or undercooked commercial pig liver purchased from local

grocery stores in Japan [133]. The majority of the patients in that study had a history

of consuming undercooked pig livers prior to the onset of the disease, indicating

that consumption of pig livers is a risk factor for hepatitis E [133]. Eleven percent of

livers purchased from local grocery stores in the United States, 6% in The

Netherlands [243] and 9.5% in the United Kingdom were found to be contaminated

by HEV (Chapters, section 3.5.1).

HEV inactivation and environmental resistance is not a well-covered topic and little

information is available. As an orally transmitted virus, HEV is most likely resistant

to inactivation by the acidic conditions of the stomach. The ability of HEV to

survive harsh or extreme environmental conditions can be attributed at least in part

to its non-enveloped viral structure [85, 87].

In Europe most pork meat is cooked prior to consumption, but there are some

exceptions where pork meat is eaten raw, as for example liver sausages in France.

The United States Department of Agriculture (USDA) and the United States

National Pork Board (NPB) recommend a cooking method for fresh pork that will

result in a minimum internal cooking temperature of 71 °C (http://

www.fsis.usda.gov/is_it_done_yet/, accessed on March 15, 2007). A time

stipulation is suggested based on the level of heat but many of the recipes do not

specify a minimum cooking temperature. Stir-frying and boiling are the two most

widely used and accepted methods for cooking pig livers for consumption. Feagins

at al evaluated that stir-frying and boiling of HEV-contaminated pig livers can

effectively inactivate the virus by using a swine bioassay to determine the virus

155

infectivity [85, 87]. By using an in vitro system, Emerson et al [225] reported that

HEV is approximately 50% inactivated when heated at 56°C for 1 h. In this study

we demonstrated that incubation of homogenate of contaminated pig livers at 56°C

for 1 h (temperature that produced an internal cooking temperature slightly below

the recommended 71°C without burning the tissue) did not fully inactivate the virus,

as HEV RNA was detected during the course of the experiment. Our results support

the in vitro results of Emerson et al [225] and the in vivo results of Feagins et al

[87] confirming that adequate cooking of HEV-contaminated commercial pig livers

will inactivate HEV in the tissue, thereby decreasing the risk of food-borne HEV

transmission. Importantly these results confirm that partial inactivation of HEV

(heat at 56°C for 1 h) may allow the virus to initiate an active infection in vitro

while the treatment of the liver at 100°C appears to be efficient to inactivate the

virus completely.

5.6.2 Inactivation of HEV positive supernatant with UV light

UV light inactivation studies are mostly performed with bacteria such as

Sphingopyxisalaskensisa marine bacteria. Salmonella and E. Coli [244, 245]. Only a

few UV light inactivation studies have been performed with viruses such as

Hepatitis A virus (HAV), Feline Calicivirus (FCV) and two Picornaviruses [246,

247] but never with HEV. This study was performed to find out if UV light would

inactivate HEV under the conditions described. From the results obtained in this

study the UV light applied was insufficient to completely inactivate the virus and

the same results were also obtained in other studies. In fact it has been observed a

decrease of 2 log in samples (lettuce, strawberry and onion) artificially

contaminated with HAV and Feline Calicivirus [246, 247]. Using relative Ct as a

156

crude measure of viral copy number, the amount of viral RNA detected did not vary

significantly between cells infected with UV light treated and non UV light treated

inoculum. HEV RNA was detectable in the 3D system by real time RT-PCR in the

cells that received the UV light treated inoculum. The data showed that the Ct

values for the 3D cells were not significantly different for all the different UV light

treatments. This could be due to the fact that the UV light treatment is not effective

in inactivating HEV or that the inactivation was partial and remaining viable

particles were able to infect the cells.

When the experiment was repeated, reducing the depth of the inoculum during

exposure, viral RNA was detected throughout the experiment, suggesting that viable

virus was present and inactivation had been incomplete although an increase of

almost 7 Ct values was observed during all the experiment in the supernatant of the

cells infected with inoclulm exposed for 30 min under UV light suggesting partial

inactivation of HEV. The depth of the inoculum in the Petri dish was reduced

because in the first experiment the depth of the inoculum in the Petri dish was 4 mm

and the literature advises to have less then 3mm of depth during the UV inactivation

[246, 247]. Also in this second experiment, where the inoculum was previously

exposed for 30 min under UV light, we detected RNA by real time RT-PCR at

almost all dpi, confirming that under the conditions employed, UV light did not

inactivate all the viral particles allowing some HEV replication in the cells.

The temperature of the inoculum exposed under UV light was tested and remained

constant during the inactivation treatment, avoiding any chance that the temperature

was affecting the experiment.

157

A possible explanation of this UV inactivation result can be that the RT-PCR and

3D sampling system is insufficiently sensitive to detect small variations in viral

particles once the cells are infected with the virus under different treatments, in

other words the 3D cells are able to pick up infectious virus also when it is present

in small quantities. As we already observed similar results were obtained in another

experiment where serial dilutions of the inoculum were performed {Chapter 4). In

the HEV serial dilution experiment, as obtained in the UV inactivation study, no

dose-related trend was observed after the cells were infected with HEV treated with

UV light or with serially diluted inoculum {Chapter 4).

Fino et al in 2008 [248] showed that HAV and other viruses are partially inactivated

in lettuce and that bacteria as for example E. Coli is inactivated by 99% with the

same treatment. Our results confirm partially those of Fino et al [248] where viruses

were partially inactivated by UV light.

In this study, we have shown that HEV, albeit partially inactivated by UV light

(higher Ct values at 0 dpi compared to the non-treated inoculum), is able during the

course of the incubation to replicate reaching the same Ct values or higher than the

inoculum without UV light treatment.

Electron microscopy was performed on HEV positive supernatant exposed to UV

light for 20 min and collected at 21 dpi. Only a few viral particles were detected,

probably because the viral replication was inhibited by mycoplasma contamination

in the 3D cell culture system and since the cells were supporting double replication

from the bacteria and from the virus [249]. Clearly, the demonstration of HEV

particles by EM is not easy since this is only the third electron micrograph since

1983 to show a hepatitis E virion [130, 250]. These results show that hepatitis E

158

virus is replicating in the 3D cells, since intact viral HEV particles have been

detected in the supernatant of the 3D cell culture system after several days from the

infection. In addition it is highly unlikely that the particles detected were from the

residual inoculum because at every collection point almost half of the media (23 ml)

content in the vessel was refreshed once a week. In conclusion, UV light under the

conditions employed appeared to be insufficient to fully inactivate HEV.

5.6.3 Inactivation of HEV positive supernatant with 5% of NaOCl

In this experiment a sample of HEV positive supernatant (HEV infectious progeny

virus obtained from a previous experiment) was treated with NaOCl at the final

concentration of 5% and the effect of the chemical was neutralised after 5 minutes

with 10% of sodium thiosulphate (Na2S203).

HEV RNA was detected only until 7 days post infection and Ct values detected by

real time RT-PCR were increasing each successive day post infection, indicating

that the virus was possibly inactivated by the NaOCl and the high Ct values detected

were residuum of inoculum.

The lack of detection of HEV RNA by real time RT-PCR in further collection

points could be also due to the fact that live virus was still present but the cells were

damaged by the chemical and could not support viral replication. To minimize the

cell damage 10% of sodium thiosulphate was used [237] to neutralize the effect of

the NaOCl. Despite this, visual confirmation of partial cell damage was observed

also in the negative control vessel (cells in contact with non-infected media treated

with 5% NaOCl and 10% Na2S203). The cytotoxic effect of the NaOCl and

thiosulphate should have been tested in this particular cell-system scenario before

the experiment in the cells or the virus removed from the inactivation mixture by

159

pelleting and washing in PBS, despite the literature describing the neutralisation of

the chemical (NaOCl) with 10% of sodium thiosulphate [237].

Alternatively, the inactivation might have worked, the treated inoculum was not

cytotoxic and the RNA detected at 7 dpi was just residual inoculum as is shown in

section 5.5.3 {Figure 5.6). Although definitive conclusions cannot be made, the

consideration that NaOCl was efficient enough to inactivate the virus should be

taken in consideration.

Guthmann et al [132] in 2006 reported a large outbreak of hepatitis E in the region of

Darfur of Sudan in 2004. In 6 months, 2621 cases of hepatitis were recorded where

contaminated water seemed to be the cause of this outbreak. Although the water

before being distributed was chlorinated with standard level (0.3/0.6 mg/L) of

chlorine, the drinking of chlorinated water was assessed as a risk factor for

contracting hepatitis E [132]. So it appeared that during that outbreak the water

disinfection was not effective to inactivate HEV. This highlights a need and it would

be useful to set up another disinfectant study to better prove which chlorine or other

chlorine derivate dose/time is effectively able to eliminate the virus from surfaces

and HEV contaminated water [132].

In conclusion, we determined that probably the NaOCl could be a good tool to

disinfect surfaces been in contact with pork products since that after the first week

no HEV RNA was detected in the HEV positive supematant derived from 20 min

UV light experiment and collected at 13 dpi treated for 5 minutes with 5% of

NaOCl [238, 240, 241]. Furthermore, we also showed that the HEV progeny vims

was able to infect other 3D cells providing once again that progeny is infectious and

is able to infect 3D cells {Figure 4.4, chapter 4) until 33 days post infection.

160

HEV can be identified at different points of the pork food chain and zoonotic

transmission through consumption of contaminated pork meat has been

demonstrated. There is still the need to understand which chemical and physical

conditions can be utilized to inactivate viable HEV particles that could be present

along the chain and in the final products.

In these studies we exposed viable HEV to heat, UV light and NaOCl. The

effectiveness of these selected inactivation strategies was evaluated in a 3D in vitro

system, previously shown to be able to support HEV replication.

Between the 3 methods used, the only one that gave indications of a consistent

successful inactivation was the heat treatment. These data confirm results obtained

by other authors in previous in vitro and in vivo models. Thoroughly cooking pork

meat is an effective means of inactivating HEV, and should therefore be

recommended.

161

CHAPTER 6Prevalence and transmission of hepatitis E virus

in domestic swine population in different European countries

1 6 2

The final goal of this PhD project was estimating HEV prevalence in 6 different

European countries and applied a mathematical model (SIR, described below)

developed by Backer et al [251] to determine the HEV dynamics of transmission.

Below is a brief explanation about the mathematical model that Backer et al [251]

applied to study HEV dynamics of transmission follow by the description of HEV

prevalence in 6 European countries.

6.1 Pig dynamics of transmission modeling study

Field studies, both cross-sectional [192, 252] and longitudinal [206, 253] have

shown a peak prevalence of HEV RNA in grower pigs, and a non-zero prevalence

in finishing pigs at slaughter age. A mathematical model determined the prevalence

pattern by how fast a susceptible animal can be infected (expressed by the

transmission rate parameter) and how long an infectious animal excretes virus

(expressed by the average infectious period). The product of these two parameters is

the reproduction number Rq that represents the number of infections one infectious

animal can cause in a fully susceptible population. However, the proportion of

infectious animals at slaughter age depends on all transmission parameters and these

have been determined in an experimental setting only [86]. Backer et al [251]

estimated all parameters that determine the transmission dynamics of HEV between

pigs, from field data confirming that HEV in pigs is endemic.

Briefly, each age group is subdivided in three distinct compartments that consist of

pigs that are susceptible (S), infectious (I) or recovered (R) [254]. The SIR model

assumed an endemic equilibrium. The virus is assumed not to be introduced by

infected weaners or other external sources but the disease can sustain itself in the

163

regenerating pig population. This endemic equilibrium can only exist when the virus

is sufficiently transmissible. The transmissibility is expressed by the reproduction

number Rq that represents the number of secondary infections caused by one

infectious animal during its entire infectious period in a fully susceptible and

infinite population [254]. When this number is smaller than one, the outbreak

cannot sustain itself and will die out. Therefore, the endemic equilibrium

assumption also contains the assumption that Ro > 1. This SIR model choice means

that the latent period was ignored and the infected animals reach immunity after

infection.

The same model described above was used to study HEV circulation in 6 different

EU countries (Following section).

6.1.1 Introduction

In 2008, Di Bartolo et al [192] investigated the prevalence of swine HEV in 274

pigs from six different swine farms of Northern Italy. Viral RNA was tested in

faeces and HEV RNA was detected in 42% of the samples. All farms tested positive

for HEV, with a prevalence ranging between 12.8% and 72.5%. All age groups

tested HEV-positive, although infection was more prevalent in weaners than in the

fatteners (42.2% vs. 27.0%).

Fernandez-Barredo et al [252] in 2006, tested 146 faecal samples of pigs from 21

farms. HEV RNA was detected in faecal samples from 34 pigs (23.29%). Pigs in the

first month of feeding (60%) and weaners presented the higher HEV prevalence

(41.7%).

164

De Deus et al [253] conducted a prospective study, where 19 sows and 45 piglets

were tested for antibodies to HEV. HEV IgG and IgM antibody was detected in

76.9% and 15.4% of sows, respectively. HEV RNA was detected in serum at all

ages analysed with the highest prevalence at 15 weeks of age. HEV was detected in

faeces and lymph nodes for the first time at 9 weeks of age and peaked at 12 and 15

weeks of age [253]. This peak coincided with the occurrence of mild to moderate

focal hepatitis as well as with HEV detection in bile, liver, mesenteric lymph nodes

and faeces, and with highest IgG and IgM at 15 weeks [253].

Few HEV transmission dynamics studies have been performed so far in pigs. The

common aim of those studies was evaluating the Rq that represents the number of

infections that one infectious animal can cause in a fully susceptible population.

Backer et al [251] estimated transmission parameters to explain the prevalence

pattern between pigs of different age groups. Briefly, the model describes how soon

after exposure a susceptible animal can be infected (expressed by the transmission

rate parameter) and how long an infectious animal excretes virus (expressed by the

average infectious period). The product of these two parameters is the reproductive

number Rq that represents the number of infections once that one infectious animal

can cause in a fully susceptible population.

Satou et al [207], using serology, tried to clarify the mechanisms of transmission

within farms in order to facilitate an understanding of the age-specific patterns of

infection, especially just prior to slaughter, estimating that more than 95% of pigs

are infected before the age of 150 days at which pigs are ready to be slaughtered.

The objective of this study was to evaluate HEV prevalence and HEV transmission

rates in different pig age groups in different countries. For this work, results from

165

pig samples obtained from farms in United Kingdom, Portugal, The Netherlands,

Italy, Spain and Czech Republic were used. For comparison of HEV transmission

rates and HEV infectious periods the model developed by Backer et al was used

[251].

166

Materials and methods

6.2 Samplings

The UK data sets (UK2007 and UK2008) consisted of 10 herds sampled by age

class: weaners (6-9 weeks of age), growers (10-12 weeks of age), fatteners (13-26

weeks of age) and sows. Pig faecal samples were collected from 10 different pig

farms in 2007 and 10 pig farms in 2008. Five faecal samples were obtained from

each age group.

In the Portugal data set, each herd was tested at entering (weaning age of 3 weeks),

growing (7 weeks) and at departure (slaughtering age of 21 weeks). A total of 200

pig faeces samples were collected from 5 commercial pig farms (40 samples per

farm) between December 2010 and February 2011. From each farm a total of 10

stool samples were obtained from each age group.

The data sets of Italy and The Netherlands comprised of test results of one fattening

group (21 weeks) of one single farm for The Netherlands (60 samples tested) and 3

farms for Italy (100 pigs faeces tested, age of the pigs 150 days), whereas the data

set obtained from Spain comprised of one group of sows in one single farm, and 23

boars in 5 different farms where faeces were tested for HEV RNA.

Ten pig farms were selected in Czech Republic, faecal samples from 200 pigs of

different age groups, weaners, growers, fatteners, sows and boars were tested for

HEV.

In all farms, samples of a minimum of 1 g of faeces were collected aseptically in a

sterile plastic container and maintained at 4°C (max. 24 h) or frozen at -20°C until

processing.

167

6.3 RNA extraction and RT-PCR procedures

6.3.1 UK 2007 and 2008

RNA extraction and PCR was performed as described by McCreary et al 2008

[223]. Briefly, 0.2 g of faeces was suspended in 1.8 ml phosphate-buffered saline,

140 pi of the supernatant was used to extract RNA, using the QIAamp Viral RNA

mini kit (Qiagen) according to the manufacturer’s instructions. The first round of

the PCR used 2 pi of RNA. The reaction conditions were 96°C for five minutes,

then 35 cycles of 96°C for five seconds, 55°C for five seconds and 75°C for 30

seconds, followed by 72°C for one minute. A second round was carried out with a

nested PCR, using a fast cycling PCR kit (Qiagen). The primers targeted the ORF-2

region; 3158N (forward): 5’ GTT(A)ATGCTT(C)TGCATA(T)CATGGCT-3’ and

3159N (reverse): 5 -AGCCGACGAAATCAATTCTCTC-3’ (Huang et al 2002).

The products of the amplification process were separated by gel electrophoresis, and

visualised with UV light [223].

6.3.2 The Netherlands, Portugal, Italy, Spain and Czech Republic

Two hundred and fifty mg of soft faecal contents was suspended in 2.25 ml of

gentamycin-containing PBS solution and centrifuged at 3.000g for 15 min. Nucleic

acid was extracted from 140 pi of the supernatant using the QIAamp® viral RNA

mini kit (QIAGEN), according to manufacturer’s instructions.

The real time RT-PCR was performed using RNA Ultrasense"^^ One-Step

Quantitative RT-PCR System (Invitrogen) and primers and probe: JHEV-F (5’-

GGT GGT TTC TGG GGT GAC -3’); JVHEV-R (5’- AGG GGT TGG TTG GAT

GAA -3’); JHEV-P (Taqman probe) ( 5 -FAM- TGA TTC TCA GCC CTT CGC -

BHQl-3’). Ten pi of RNA were added to a mix containing buffer RNA Ultrasense

168

(Invitrogen) reaction mix (5X), ROX reference dye (50X) and RNA Ultrasense

enzyme mix.

The real time RT-PCR was carried out at 50°C for 15 min, 95°C for 2 min, and 45

cycles at 95°C for 10 sec, 55°C for 20 sec and 12°C for 15 sec.

6.3.3 HEV transmission modelling

The model to describe HEV transmission in a pig herd with the same structure has

been described by Backer et al [251]. Each age group was subdivided into three

distinct compartments consisting of pigs which are susceptible (S), infectious (I) or

recovered (R) [21]. For the analyses, it was assumed that each susceptible animal

can be infected by an infectious animal in its own group or any other group with the

same probability.

These dynamics are characterized by the average infectious period p and the

transmission rate parameter P that signifies the number of infections one infectious

animal can cause per time unit. The product of these two parameters is the

reproductive number Rq = p*p that expresses the number of infections one

infectious animal can cause during its entire infectious period in a fully susceptible

population. When the reproduction number is larger than one unity, Rq > 1, an

outbreak can grow exponentially. Otherwise, when Ro < 1 the outbreak will die out.

Our model assumes HEV transmission to be in endemic equilibrium, i.e. the disease

can sustain itself in the regenerating pig population. For this reason, we have

omitted the herds with few positive or only negative results, as endemic equilibrium

could not be justified.

169

The UK data sets (UK2007 and UK2008) consisted of herds subdivided into three

groups: weaners (6-9 weeks of age), growers (10-12 weeks of age) and fatteners

(13-26 weeks of age). Animals entering the weaning group are assumed to be

uninfected. In the Portugal data set, the herds were assumed to consist of one group

that was tested at entering (weaning age of 3 weeks) and at departure (slaughtering

age of 21 weeks). The test results of the growers (age of 7 weeks) are used as proxy

for the infection pressure in the entire herd. The data sets of Italy and The

Netherlands comprise of test results of just one fattening group. For this reason, we

cannot estimate the transmission rate parameter and the average infectious period

separately, but only their product, the reproduction number. For both data sets the

total residence time is assumed to be 20 weeks from weaning to slaughtering age.

The data set of Spain and the Czech Republic did not include a significant number

of positive samples. For this reason, we cannot estimate the reproduction number.

170

Results

HEV prevalence in different age groups in the UK (2007, 10 farms and 2008, 10

farms), in Portugal (2011, 5 farms), Italy (2010, 3 farms). The Netherlands (2011, 1

farm), Czech Republic (2010, 10 farms), Spain (one farm between 2010 and 2011)

are depicted in Figure 6.1. Briefly, the prevalence of weaners, growers, fatteners

and sows in UK 2007 was 26%, 44%, 10% and 6% respectively. The prevalence of

prevalence of weaners, growers, fatteners and sows in UK 2008 was 8%, 22%, 8.8%

and 2%. The prevalence of weaners, growers, fatteners and sows in Portugal was

30%, 20%, 30% and 4% respectively. The prevalence of fatteners in Italy was 23%.

The prevalence of fatteners in The Netherlands was 73%, meaning that 44 out of 60

pigs were shedding virus in the faeces on the day of the sample collection. The data

set is similar between the age groups and the prevalence is in line with other studies.

The prevalence in The Netherlands was relatively higher in the fattening groups

compared to the other European fattening groups. One hundred and forty-four faecal

samples from sows collected in Spain and tested by real time RT-PCR were found

to be HEV negative, while 4.3% of the boars (1 positive out of 23) was positive. In

none of the weaners and fatteners tested in the Czech Republic, HEV RNA was

detected. Only one grower out of 32 (3.1%), 5 sows out of 103 (5%) and 1 boar

(3.5%) out of 28 tested HEV positive by real time RT-PCR.

Table 6.2 shows the transmission rate parameter p, average infectious period p and

reproductive number Rq of UK 2007 and 2008 and Portugal and the reproductive

number R q for Italy and The Netherlands. The data set from Spain and Czech

Republic could not be used in this study since all or almost all animal tested were

HEV negative and we could not apply the model to those data. Briefly the

transmission rate parameter p, that means how often a pig gets infected with HEV is

171

one pig every 9 days for UK 2007, one pig every 11 days for UK 2008 and one pig

every 27 for Portugal. The average of the infectious period p that means how long

an animal stays infected with HEV is 43 day for both UK 2007 and 2008, and 101

days for Portugal. The reproductive number for all countries where the model has

been applied was greater than one, indicating that HEV is endemic.

172

mean prevalence

4>OC0>(V>2a.

100% T

20% -

weaners

□ UK 2007

m UK2008

■ Portugal

□ Spain

■ The Netherlands

□ Italy

■ C zech Republic

growers fatteners

age group

sows boar

Figure 6.1 HEV swine prevalence in six different EU countries. HEV RNA

prevalence plotted for six countries and 5 pig age groups. The X axis represents the

age groups weaners (UK 2007, UK2008 and Portugal), growers (UK 2007, UK

2008, Portugal and CZ), fatteners (UK 2007, UK 2008, Portugal, The Netherlands

and Italy), sows (UK 2007, UK 2008, Portugal and CZ) and boar (Spain and CZ).

The Y represents the HEV prevalence in percentage observed in the different age

groups and in the different EU countries. Error bars denote the standard error of the

mean.

173

Dataset transmission rate parameter p average infections reproductive number(dayh period ) i (days)

UK 2007 0.11 (0.070-0.17) 43 (3 3 -5 9 ) 4.7 (3 .6 -6 .4 )(10 herds)

UK 2008 0.071 (0.041 -0 .13) 43 (2 9 -7 3 ) 3.1 (2 .5 -4 .1 )(8 herds)

Portugal 0.037 (0.0035-0.16) 101 (70 -403) 3.7 (1 .2 - 14)(6 herds)

Italy - - 2.0 (1 .4 -3 .6 )(3 herds)

Netherlands - - 8.4 (5 .3 -15 )(1 herd)

Spain - - -

Czech Republic - - -

Table 6.2 Transmission rate parameter, average of infectious period and

reproductive number. The first column describes the dataset (UK 2007, UK 2008,

Portugal, Italy, The Netherlands, Spain and Czech Republic). The second column

describes the estimated transmission rate parameter p. The third column shows the

average infectious period \x and the fourth column describes the reproductive

number Rq of each country. Median maximum likelihood estimates and 5% - 95%

credible interval between brackets.

174

6.4 Discussion

The HEV transmission dynamics in commercial pig farms in six different European

countries (UK, Portugal, Italy, The Netherlands, Spain and Czech Republic) was

studied.

The data collected show the HEV RNA prevalence in weaners ranging from 8% to

30%. The average HEV prevalence in growers was between 3% and 44%. The

fatteners prevalence ranged between 8% and 73%. Sow prevalence was similar in

all countries ranging between 2% and 6%. Boar faeces were tested for HEV only in

Spain and Czech Republic, and the prevalence was 4.3% and 3.5% respectively.

The prevalence detected in these 6 European countries shows that HEV is actively

circulating.

Overall, Figure 6.2 describes HEV RNA prevalence comparing Czech Republic,

Italy, Portugal, Spain, The Netherlands and UK 2007, 2008. The data set is similar

between the age groups and the prevalence is of the same order as with other studies

[223, 252]. The prevalence in the Dutch fattening group was relatively higher

compared to other European fattening groups [255] possibly due to an outbreak

during the sampling collection.

Our data are similar to previously published Italian [255] and Spanish [252] data,

confirming that HEV circulation during time is constant in terms of HEV

prevalence detected in faeces and HEV is circulating in all farms in all age groups,

from weaners to fatteners and that pigs close to the slaughter age can still be

infected with HEV.

175

The collected data sets were analyzed using a recently developed model to estimate

the transmission dynamics of HEV in the different countries.

Satou et al in 2007 [207] using serology, studied HEV transmission in 6 different

Japanese provinces and found the reproductive number in the order of 4.02 - 5.17,

which agrees with our estimated reproductive numbers ranging from 2.0 to 8.4. The

study by Satou et al [207] was the first report on HEV transmission estimated from

field data. Bouwknegt et al in 2008 performed the first HEV transmission dynamics

study in an animal experiment [86]. In this study, the Rq was found to be 8.8 and 32

in two separate experiments, much higher than 1.0, indicating that swine could be

assumed to be a true reservoir of HEV. The Rq values calculated by us are lower

than the Rq values calculated by Bouwknegt et al [86]. This is because the

infectious periods are comparable, but the transmission rate parameters for the

experimental and field situation are different.

The average infectious period p in UK 2007 data was for instance estimated to be

43 (33 - 59) days, whereas Bouwknegt et al [86] estimated average infectious

periods of 49 (17-141) days and 13 (11 - 17) days.

The transmission rate parameter in our study was 0.11 (0.070 - 0.17) day'^ for UK

2007, meaning that one infectious animal infects another animal every 9 days. The

transmission rate parameters were 0.071 (0.041-0.13) day'^ for UK 2008 and 0.037

(0.0035-0.16) day'^ for Portugal 2011. In the animal experiments, Bouwknegt et al

[86] estimated a higher rate of transmission , i.e. 0.66 (95% Cl: 0.32-1.35) day '\

The difference can be explained by the fact that transmission experiment encounter

animals that are in the early and possibly more infectious stages of virus shedding

176

since they have been infected intravenously while in other hand the animals in the

commercial farms are infected due to faecally-orally transmission.

The transmission rate parameters for the other EU countries could not be estimated

because either only one age group was tested or the majority of the animals were

negative and the model was not applicable.

This study gave a genuine contribution to better understand HEV prevalence in six

different European countries by a mathematical model.

In conclusion, HEV is widely circulating in many pig farms in Europe and can be

present in fattening pigs, where usually this age group is the one arriving to the

table. In industrialized regions, although the incidence of clinical hepatitis E in

humans is low, the seroprevalence is relatively high [86], indicating a high

proportion of subclinical disease and/or underdiagnosis [124]. It is likely that a

small proportion of this exposure to HEV results from travel to endemic regions, or

migration from endemic regions [117], this still leaves a substantial level of

exposure to HEV that appears to have an indigenous source and might be related to

the presence of endemic HEV infections in the pig population.

HEV positive fatteners were found in all European countries where the fattening

group samples were collected. This may pose an important risk for public health

especially in those countries where pork products are eaten undercooked or raw.

177

CHAPTER 7 Overall discussion

178

This PhD project was funded by the EU FP7 project VITAL (Integrated monitoring

and control of foodborne virus in European food supply chains).

The EU FP7 project VITAL aimed to develop a system for monitoring viral

contamination of foodstuff intended for human consumption, by examination of

selected food chains from production through processing to point of sale.

The main areas investigated during this PhD were:

• Standardization of methods for detection of viruses in different foodstuff

(for example: soft fruit, fresh vegetables and pork products) via the VITAL ring

trial.

• Investigation of HEV prevalence in the pork food supply chain in the UK

(slaughterhouse, processing plant and points of sale).

• Development of a cell culture system for HEV.

• Investigation of resistance of HEV to different inactivation strategies.

• Investigation of HEV prevalence and transmission dynamics in pig farms in

Europe.

As part of the VITAL project, standard methods were developed to facilitate

harmonization of testing between the partner laboratories. In the first instance, this

harmonization took the form of a Ring Trial where a panel of samples of soft fruit

and pork products were tested blind by each data gathering laboratory. The aim of

the ring trial was to assess the efficacy of the SOPs developed during the first year

of the project, and to assess the capability of the different data gathering laboratories

in their implementation. Developing and validating SOPs for detection of viruses in

179

foodstuff was needed considering the complexity of these matrices and the number

of participating laboratories. Furthermore, viruses present in food matrices do not

replicate in situ, and can therefore be present in small numbers, close to the limit of

detection of the technique used but still potentially infectious. The nucleic acid

extraction process is for this reason normally preceded by a concentration step and

by a lysis step in the case of intracellular viruses. Particular attention had to be paid

in reducing the concentration of inhibitors in the viral suspensions and extracts,

such as not to compromise the PCR reactions. Real Time RT-PCR was selected as

the best detection method for it's sensitivity in detecting viruses and the potential

use for quantification.

Data on the presence of HEV in abattoirs and points of sale have been published

previously [121] but a systematic investigation of the pork food chain was needed to

assess where a risk of HEV contamination can occur. The results obtained in this

project confirm the presence of HEV at slaughter, and underline the presence of

HEV in fresh pork products at point of sale. Detection by real time RT-PCR showed

the presence of HEV nucleic acid but gives no information of the virus viability,

and therefore the infection transmission risk of PCR-positive food and

environmental samples. The virus detected at point of sale was not able to cause

active infection in cell cultures, most likely because it was inactivated during the

meat preparation process or because the RNA detected by real time RT-PCR was

not enough to infect the cells. The failure of the infection of the 3D cells culture

could be also due to a prolonged -20°C storage or multiple freeze/thaw of the UK

sausages. The sample size was very small however, and it would be valuable to

follow up these results with a more focussed study involving a greater number of

180

samples, with the power to generate significant results in order to inform evidence-

based risk assessments and codes of practice for the food industry.

Detection by real time RT-PCR shows the presence of nucleic acid and gives no

information of the virus viability, and therefore the risk, of PCR-positive food and

environmental samples. The lack of a reliable HEV cell culture system for viral in

vitro culture inhibits studies into the replication and environmental survival

properties of HEV and into vaccine research. As HEV has proved difficult to

propagate in conventional cell monolayer systems, we investigated the 3D cell

culture [200, 231] for more efficient virus propagation. The results obtained with

HEV-inoculated 3D cultures have showed detectable HEV RNA in real time RT-

PCR at all dpi in the first 3D cell culture infection, although a big variation in copy

number was detected during the data analysis. The wide copy number variation could

be due to virus internalisation in the cells while it is replicating. In contrast, in the 2D

cell culture system HEV RNA was not detectable at any dpi. These data illustrate

that the 3D system is more efficient when compared to the conventional 2D system.

Other studies have also demonstrated that the 3D cell-culture system is a useful tool

in the propagation of fastidious viral pathogens such as Norovirus [256]. Although it

proved very useful during the course of this project, the 3D cell culture system could

still benefit from further optimisation and standardisation such as be able to run the

experiments in duplicate to have a better and more efficient overview of the results

obtained. For example, further studies could examine the reasons why there is a big

variation in Ct values during the experiment.

The observation of HEV replication in PLC/PRF/5 cells in this system indicates that

the 3D system may potentially be used as a tool to investigate elements of the

181

pathobiology of HEV, which may, in turn, facilitate vaccine research, monitoring of

HEV contamination and survival through processing to point of sale, and survival in

other environmental samples and viricidal agents. Once developed, the 3D cell

culture HEV infection system was used to investigate the infectivity of selected

foodstuff that tested positive by RT-PCR (three UK sausages and four smoked

French sausages-figatelli). Only one of the French sausages used as inoculum to

infect the 3D cells culture system showed HEV replication in the 3D cell culture

system, suggesting the presence of viable virus in the original sample and providing

further corroboration of the evidence implicating consumption of these sausages with

outbreaks of clinical hepatitis E in France. Furthermore, to better confirm that the

HEV positive supernatant of cells infected with homogenate of HEV positive

figatelli contained viable virus, the supernatant was tested by EM and a rare image of

several HEV-like particles was obtained from the supernatant of the infected culture.

The presence of HEV along the pork food chain is a cause for concern, and

inactivation strategies have been explored to reduce the contact of the consumer

with viable virus. We investigated inactivation strategies that could either be applied

during the production and processing phase of the pork meat, or during the

preparation of foodstuff in the kitchen. Ultraviolet light inactivation (that can be

applied in processing plants for disinfection) did not appear to be sufficiently

effective in inactivating HEV under the conditions applied. The use of NaOCl

caused a complete inactivation effect, but this could have been due to the toxic

effect of this chemical on cell culture systems. The lesson learned from this is to be

cautious when directly adopting published work without some initial pilot trial. Heat

inactivation at 100°C caused viral inactivation, whilst viable virus was still

182

detectable after exposure of pig tissue at 56°C for an hour. These data stress the

importance of thoroughly cooking pork meat and other pig products prior to

consumption.

Data on HEV prevalence in pigs of different age classes were collected across

Europe, to study transmission dynamics and develop a model that could help the

understanding HEV transmission dynamics in the pig population. HEV was

confirmed to be endemic in pig farms across Europe. A mathematical model (SIR)

was applied by Backer et al for studying HEV transmission dynamics in the field

[251]. The results of this model suggested that the circulation of HEV is endemic in

pig farms in all age groups (weaners, growers, fatteners).

It is now generally accepted that HEV gt 3 is zoonotic and strict safety measures

should be taken to prevent the increasing of number of people detected with HEV.

Until now, the only preventative advice can be found on the website of the America

Ministry of Agriculture and DEFRA. The two websites suggest that pork foodstuff

should be safe to eat within an internal temperature of 71°C [87]. Both Defra and

the UK Food Standards Agency have been informed of the data relating to the

presence of HEV in the UK pork chain and HEV inactivation and guidelines will be

written and available for the public. For example providing cooking information and

conditions in all pork foodstuff products could be a way to control HEV infection in

humans.

In conclusion, the work carried out in this project helped in progressing the

knowledge on HEV epidemiology and pathogenesis, with particular attention to the

public health implications related to the consumption of pork meat [197].

183

During the course of this PhD a broad range of biological disciplines were

employed, including, classical and molecular virology, epidemiology, HEV

transmission dynamics, advanced cell culture techniques, experimental design and

data interpretation. With this PhD a better figure regarding HEV has been generate

and it will hopefully help to improve future studies on this virus.

Future plans

Without doubt more studies are still necessary to better understand hepatitis E Virus

in all its characteristics. I would mainly like to focus on 3 aspects:

1) Hepatitis E virus monitoring in the pork production chain in a larger scale: A

bigger UK study investigating the presence of HEV in pork food stuff is necessary to

provide more confidence in the data on the prevalence of HEV in pork products in

the UK. Furthermore, HEV investigation in pork food stuff should be planned also in

resource limited regions to evaluate and confront which genotype is circulating in the

humans and in the pig population.

Furthermore, thinking of what are the major unknown areas, principally on the

veterinary side, but with links through to HEV in humans it is pretty well accepted

now that the only credible source for the autochthonous, clinical hepatitis E

infections in developed regions is the pig. Despite our evidence of foodborne virus, a

significant number of the clinical cases of hepatitis E in the UK and other developed

regions appear not to have this risk factor, according to retrospective questionnaires,

indicating that other (i.e. other than direct foodborne) transmission routes from the

pig to people may be contributing to the clinical (and possibly subclinical) cases. In

this context the presence and survival (i.e. viability) of HEV in all sorts of

184

environmental samples could shed light on some of the possible alternative

transmission routes. These could include soil and water samples close to pig farms or

sewage outfalls, slurry lagoons, vegetables and fruits at various points, including the

water used to irrigate them (in fact one task of the VITAL project was the detection

of HEV on fruit and vegetables) and shellfish samples. Analysis of these samples by

the real-time RT-PCR and the 3D culture system could provide quantitative and

qualitative information on the potential risk pathways, enabling an appropriate

response to reduce or eliminate the HEV contamination. In addition, (as I already

mentioned in chapter 5 but it would be good to re-emphasise at this point) this work

could be supported by an extended examination by means of the 3D culture system,

of HEV inactivating agents to improve our ability to eliminate HEV contamination at

appropriate or practicable points in the transmission cycle. It should be remembered

though that achievement of these objectives would be enhanced by further

refinement of the 3D cell culture system to improve sample throughput numbers and

robustness.

2) In vitro studies

a) The 3D cell culture system, with a little more refinement, should be employed to

undertake cell infection and replication characteristics, to understand how this virus

enters the cells and which mechanism is used to replicate in and exit the cells.

b) Since that the 3D cell culture system is an expensive technique and it allows the

testing of maximum 8 samples for each experiment and it is time consuming (i.e. 28

days are required to allow the cells to differentiate in the 3D configuration before

infection). It is still necessary to study different cell lines (i.e. stem cells) that allow

185

HEV replication with the same efficiency but reducing the costing, the time and

more important to have as many sample is possible in each experiment.

3) Diagnostic tools: Real-time RT-PCR, conventional RT-PCR, and ELISA, are the

only practicable and reliable techniques able to detect HEV and HEV antibodies

respectively. In developing countries, there is a need for reliable techniques able to

detect HEV (RNA) faster and without the need of trained personnel and specialized

laboratories.

a) Evaluate the use of isothermal nucleic acid amplification techniques, especially

LAMP (loop mediated isothermal amplification). The main characteristics of this

techniques include high sensitivity and specificity, rapid testing, constant

temperature operation, easy to perform and interpret and the possibility of combining

it with portable detection devices. This technique is used with great success for the

detection of other RNA viruses and it could represent a great advantage for point of

care screening of HEV in both specialized and non-specialized diagnostic labs,

hospitals and pork production points.

b) The PCRs currently available are genotype specific or in the case of Jothikumar’s

real time PCR based on recognising the 4 genotypes but without distinction, so

sample sequencing is necessary to distinguish which genotype the possible positive

sample belongs. The need of a multiplex RT-PCR able to detect and discriminate all

four major genotypes it would be beneficial.

186

References1. Aggarwal R, Naik S: Epidemiology of hepatitis E: current status. Journal of

gastroenterology and hepatology 2009, 24(9): 1484-1493.2. Khuroo MS: Seroepidemiology of a second epidemic of hepatitis E in a population that

had recorded first epidemic 30 years before and has heen under surveillance since then. Hepatol Int 2010, 4(2):494-499.

3. Chandra V, Taneja S, Kalia M, Jameel S: Molecular hiology and pathogenesis of hepatitis E virus. Journal of biosciences 2008, 33(4):451-464.

4. Granoff DM: Correlates of clinical performance of acellular pertussis vaccines: implications for development of DTaP combination vaccines. Biologicals 1999, 27(2):87- 8&

5. Rzezutka A, D A gostino M, Cook N: An ultracentrifugation-hased approach to the detection of hepatitis A virus in soft fruits. Int J Food Microbiol 2 0 0 6 ,108(3):315-320.

6. Hundesa A, Maluquer de Motes C, Bofill-M as S, Albinana-Gimenez N, Girones R: Identifîcation of human and animal adenoviruses and polyoma viruses for determination of sources of fecal contamination in the environment. Appl Environ Microbiol 2006, 72(12):7886-7893.

7. Purcell RH, Emerson SU: Hepatitis E: an emerging awareness of an old disease. J Hepatol 2008, 48(3):494-503.

8. Meng XJ: Swine hepatitis E virus: cross-species infection and risk inxenotransplantation. Curr Top Microbiol Immunol 2003, 278:185-216.

9. Dalton HR, Bendall R, Ijaz S, Banks M: Hepatitis E: an emerging infection in developed countries. Lancet Infect Dis 2008, 8(11):698-709.

10. Erker JC, Desai SM, Schlauder GG, Dawson GJ, Mushahwar IK: A hepatitis E virus variant from the United States: molecular characterization and transmission in cynomolgus macaques. J Gen Virol 1999, 80 ( Ft 3):681-690.

11. Ijaz S, Arnold E, Banks M, Bendall RP, Cramp ME, Cunningham R, Dalton HR, Harrison TJ, Hill SF, Macfarlane L et al: Non-travel-associated hepatitis E in England and Wales: demographic, clinical, and molecular epidemiological characteristics. J Infect Dis 2005, 192(7):1166-1172.

12. Mansuy JM, Peron JM, Abravanel F, Poirson H, Dubois M, Miedouge M, Vischi F, Alric L, Vinel IP, Izopet J: Hepatitis E in the south west of France in individuals who have never visited an endemic area. J Med Virol 2004, 74(3):419-424.

13. Zhuang H: [Advances in the research on non-A, non-B hepatitis in China]. Zhonghua Liu Xing Bing Xue Za Zhi 1991,12(6):377-379.

14. Naik SR, Aggarwal R, Salunke PN, Mehrotra NN: A large waterborne viral hepatitis E epidemic in Kanpur, India. Bull World Health Organ 1992, 70(5):597-604.

15. Corwin AL, Tien NT, Bounlu K, Winarno J, Putri MP, Laras K, Larasati RP, Sukri N, Endy T, Sulaiman HA et al: The unique riverine ecology of hepatitis E virus transmission in South-East Asia. Trans R Soc Trop Med Hyg 1999, 93(3):255-260.

16. Arankalle VA, Tsarev SA, Chadha MS, Ailing DW, Emerson SU, Banerjee K, Purcell RH: Age-specific prevalence of antibodies to hepatitis A and E viruses in Pune, India, 1982 and 1992. J Infect Dis 1 9 9 5 ,171(2):447-450.

17. Khuroo MS: Chronic liver disease after non-A, non-B hepatitis. Lancet 1980, 2(8199):860-861.

18. Wong KH, Liu YM, Ng PS, Young BW, Lee SS: Epidemiology of hepatitis A and hepatitis E infection and their determinants in adult Chinese community in Hong Kong. J Med Virol 2004, 72(4):538-544.

19. Wong DC, Purcell RH, Sreenivasan MA, Prasad SR, Pavri KM: Epidemic and endemic hepatitis in India: evidence for a non-A, non-B hepatitis virus aetiology. Lancet 1980, 2(8200):876-879.

20. Arankalle VA, Chadha MS, Mehendale SM, Tungatkar SP: Epidemic hepatitis E: serological evidence for lack of intrafamilial spread. Indian J Gastroenterol 2000, 19(l):24-28.

21. Assis SB, Souto FJ, Fontes CJ, Caspar AM: [Prevalence of hepatitis A and E virus infection in school children of an Amazonian municipality in Mato Grosso State]. RevSoc Bras Med Trop 2002, 35(2):155-158.

187

22. Ataei B, Nokhodian Z, Javadi AA, Kassaian N, Shoaei P, Farajzadegan Z, Adibi P: Hepatitis E virus in Isfahan Province: a population-hased study. Int J Infect Dis 2 0 0 9 ,13(1):67-71.

23. Clayson ET, Shrestha MP, Vaughn DW, Snitbhan R, Shrestha KB, Longer CF, Innis BL: Rates of hepatitis E virus infection and disease among adolescents and adults in Kathmandu, Nepal. J/n /ecr Dw 1 9 9 7 ,176(3):763-766.

24. Tran HT, Ushijima H, Quang VX, Phuong N, Li TC, Hayashi S, Xuan Lien T, Sata T, Abe K: Prevalence of hepatitis virus types B through E and genotypic distribution of HBV and HCV in Ho Chi Minh City, Vietnam. Hepatol Res 2003, 26(4):275-280.

25. Margolis H AM, Hadler SC. Viral hepatitis. In Evans AS, Kaslow RA, eds. Viral infections of humans: epidemiology and control, 4th edn. New York: Plenum Medical Books Co, 1997: 363-418.

26. Balayan MS: Epidemiology of hepatitis E virus infection. J Viral Hepat 1997, 4(3):155-165.

27. Khuroo MS, Teli MR, Skidmore S, Sofi MA, Khuroo MI: Incidence and severity of viral hepatitis in pregnancy. Am J Med 1981, 70(2):252-255.

28. Khuroo MS, Kamili S, Khuroo MS: Clinical course and duration of viremia in vertically transmitted hepatitis E virus (HEV) infection in babies horn to HEV-infected mothers. Journal of viral hepatitis 2009,16(7):519-523.

29. Kar P, Jilani N, Husain SA, Pasha ST, Anand R, Rai A, Das BC: Does hepatitis E viral load and genotypes influence the final outcome of acute liver failure during pregnancy? Am J Gastroenterol 2 0 0 8 ,103(10):2495-2501.

30. Emerson SU, Nguyen H, Graff J, Stephany DA, Brockington A, Purcell RH: In vitro replication of hepatitis E virus (HEV) genomes and of an HEV replicon expressing green fluorescent protein. J Virol 2004, 78(9):4838-4846.

31. Reyes GR, Yarbough PO, Tam AW, Purdy MA, Huang CC, Kim JS, Bradley DW, Fry KE: Hepatitis E virus (HEV): the novel agent responsible for enterically transmitted non-A, non-B hepatitis. Gastroenterol Jpn 1991, 26 Suppl 3:142-147.

32. Huang RT, Li DR, Wei J, Huang XR, Yuan XT, Tian X: Isolation and identification of hepatitis E virus in Xinjiang, China. J Gen Virol 1992, 73 ( Pt 5): 1143-1148.

33. Panda SK, Ansari IH, Durgapal H, Agrawal S, Jameel S: The in vitro-synthesized RNA from a cDNA clone of hepatitis E virus is infectious. J Virol 2000, 74(5):2430-2437.

34. Purcell RH, Emerson SU: Animal models of hepatitis A and E. ILAR J 2001, 42(2): 161-177.

35. Tam AW, Smith MM, Guerra ME, Huang CC, Bradley DW, Fry KE, Reyes GR: Hepatitis E virus (HEV): molecular cloning and sequencing of the full-length viral genome. Virology 1991,185(1):120-131.

36. C M. Fauquet M, M.A., Maniloff, J., Desselberger, U., Ball, : Taxonomy London; 2005.37. Koonin EV, Senkevich TG: Evolution of thymidine and thymidylate kinases: the

possibility of independent capture of TK genes by different groups of viruses. Virus Genes 1992, 6(2): 187-196.

38. Krawczynski K, Aggarwal R, Kamili S: Hepatitis E. Infect Dis Clin North Am 2000, 14(3):669-687.

39. Krawczynski K, Mast EE, Purdy MA: Hepatitis E: an overview. Minerva Gastroenterol Dietol 1999, 45(2): 119-130; discussion 130-115.

40. Aggarwal R, Krawczynski K: Hepatitis E: an overview and recent advances in clinical and laboratory research. J Gastroenterol Hepatol 2 0 0 0 ,15(l):9-20.

41. Magden J, Takeda N, Li T, Auvinen P, Ahola T, Miyamura T, Merits A, Kaariainen L: Virus-specific mRNA capping enzyme encoded by hepatitis E virus. J Virol 2001, 75(14):6249-6255.

42. Panda SK, Thakral D, Rehman S: Hepatitis E virus. Reviews in medical virology 2007, 17(3):151-180.

43. Karpe YA, Lole KS: RNA 5'-triphosphatase activity of the hepatitis E virus helicase domain. J Virol 2010, 84(18):9637-9641.

44. Zhang M, Purcell RH, Emerson SU: Identification of the 5' terminal sequence of the SAR- 55 and MEX-14 strains of hepatitis E virus and confirmation that the genome is capped. JMed Virol 2001, 65(2):293-295.

45. Zhang M, Emerson SU, Nguyen H, Engle RE, Govindarajan S, Gerin JL, Purcell RH: Immunogenicity and protective efficacy of a vaccine prepared from 53 kDa truncated hepatitis E virus capsid protein expressed in insect cells. Vaccine 2001, 20(5-6):853-857.

188

46. Kaur R, Gur R, Berry N, Kar P: Etiology of endemic viral hepatitis in urban North India.Southeast Asian J Trop Med Public Health 2002, 33(4):845-848.

47. Okamoto H: Genetic variability and evolution of hepatitis E virus. Virus Res 2007, 127(2):216-228.

48. Lu L, Li C, Hagedorn CH: Phylogenetic analysis of global hepatitis E virus sequences: genetic diversity, subtypes and zoonosis. Rev Med Virol 2006,16(l):5-36.

49. Jameel S, Zafrullah M, Ozdener MH, Panda SK: Expression in animal cells and characterization of the hepatitis E virus structural proteins. J Virol 1996, 70(1):207-216.

50. Zafrullah M, Ozdener MH, Kumar R, Panda SK, Jameel S: Mutational analysis of glycosylation, membrane translocation, and cell surface expression of the hepatitis E virus ORF2 protein. J Virol 1999,73(5):4074-4082.

51. Tsarev SA, Emerson SU, Reyes GR, Tsareva TS, Legters LJ, Malik lA , Iqbal M, Purcell RH: Characterization of a prototype strain of hepatitis E virus. Proc Natl Acad Sci U SA 1992, 89(2):559-563.

52. Meng XJ, Purcell RH, Halbur PG, Lehman JR, Webb DM, Tsareva TS, Haynes JS, Thacker BJ, Emerson SU: A novel virus in swine is closely related to the human hepatitis E virus. Proc Natl Acad Sci USA 1997, 94(18):9860-9865.

53. Graff J, Zhou YH, Torian U, Nguyen H, St Claire M, Yu C, Purcell RH, Emerson SU: Mutations within potential glycosylation sites in the capsid protein of hepatitis E virus prevent the formation of infectious virus particles. J Virol 2008, 82(3): 1185-1194.

54. Pelham HR, Munro S: Sorting of membrane proteins in the secretory pathway. Cell 1993, 75(4):603-605.

55. Torresi J, Li F, Locarnini SA, Anderson DA: Only the non-glycosylated fraction of hepatitis E virus capsid (open reading frame 2) protein is stable in mammalian cells. J Gen Virol 1999, 80 ( Pt5):l 185-1188.

56. Panda SK, Nanda SK, Zafrullah M, Ansari IH, Ozdener MH, Jameel S: An Indian strain of hepatitis E virus (HEV): cloning, sequence, and expression of structural region and antibody responses in sera from individuals from an area of high-level HEV endemicity. J Clin Microbiol 1995, 33(10):2653-2659.

57. Torresi J, Johnson D: Hepatitis A and E Infection in International Travellers. Curr Infect Dis Rep 2011.

58. Robinson RA, Burgess WH, Emerson SU, Leibowitz RS, Sosnovtseva SA, Tsarev S, Purcell RH: Structural characterization of recombinant hepatitis E virus ORF2 proteins in haculovirus-infected insect cells. Protein Expr Purif 199S, 12(l):75-84.

59. Carl M, Isaacs SN, Kaur M, He J, Tam AW, Yarbough PO, Reyes GR: Expression of hepatitis E virus putative structural proteins in recombinant vaccinia viruses. Clin Diagn Lab Immunol 1994, l(2):253-256.

60. Tyagi S, Jameel S, Lai SK: The full-length and N-terminal deletion of ORF2 protein of hepatitis E virus can dimerize. Biochem Biophys Res Commun 2001, 286(1):214-221.

61. Tsarev SA, Emerson SU, Tsareva TS, Yarbough PO, Lewis M, Govindarajan S, Reyes GR, Shapiro M, Purcell RH: Variation in course of hepatitis E in experimentally infected cynomolgus monkeys. J Infect Dis 1993,167(6): 1302-1306.

62. Tsarev VN, Ushakov RV, Vaneeva NP, lastrebova NE, Ushakova TV: [The development of a test system for determining antibodies to Bacteroides melaninogenicus using solid- phase immunoenzyme analysis]. Klin Lab Diagn 1993(5):11-15.

63. McAtee CP, Zhang Y, Yarbough PO, Fuerst TR, Stone KL, Samander S, W illiams KR: Purification and characterization of a recombinant hepatitis E protein vaccine candidate by liquid chromatography-mass spectrometry. J Chromatogr B Biomed Appl 1996,685(0:91-104 .

64. Zhang M, Yi Y, Liu C, Bi S: [Expression of full-length hepatitis E virus structural gene using haculovirus expression system]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 2 0 0 2 ,16(4):354-356.

65. Li F, Riddell MA, Seow HF, Takeda N, Miyamura T, Anderson DA: Recombinant subunit ORF2.1 antigen and induction of antibody against immunodominant epitopes in the hepatitis E virus capsid protein. J Med Virol 2000, 60(4):379-386.

66. Li TC, Yamakawa Y, Suzuki K, Tatsumi M, Razak MA, Uchida T, Takeda N, Miyamura T: Expression and self-assembly of empty virus-like particles of hepatitis E virus. J Virol 1997,71(10):7207-7213.

189

67. Yarbough PO, Tam AW, Fry KE, Krawczynski K, McCaustland KA, Bradley DW, Reyes GR: Hepatitis E virus: identification of type-common epitopes. J Virol 1991, 65(ll):5790-5797 .

68. Grabow WO, Favorov MO, Khudyakova NS, Taylor MB, Fields HA: Hepatitis E seroprevalence in selected individuals in South Africa. 7 Virol 1994, 44(4):384-388.

69. Parvez K, Purcell RH, Emerson SU: Hepatitis E virus ORF2 protein over-expressed hy haculovirus in hepatoma cells, efficiently encapsidates and transmits the viral RNA to naive cells. VirolJ 2D\\, 8(1): 159.

70. Xing L, Li TC, Mayazaki N, Simon MN, Wall JS, Moore M, Wang CY, Takeda N, Wakita T, Miyamura T et al: Structure of hepatitis E virion-sized particle reveals an RNA- dependent viral assembly pathway. 7 Bm/ Chem 2010, 285(43):33175-33183.

71. Emerson SU, Clemente-Casares P, Moiduddin N, Arankalle VA, Torian U, Purcell RH: Putative neutralization epitopes and broad cross-genotype neutralization of Hepatitis E virus confirmed hy a quantitative cell-culture assay. 7 Gen Virol 2006, 87(Pt 3):697-704.

72. Yamada A, Sako A, Nishimura S, Nakashima R, Ogami T, Fujiya K, Tsuda N, Asayama N, Yada T, Shirai K et al: [A case of HIV coinfected with hepatitis B virus treated hy entecavir]. Nippon Shokakibyo Gakkai Zasshi 2009,106(12): 1758-1763.

73. Zafrullah M, Ozdener MH, Panda SK, Jameel S: The ORF3 protein of hepatitis E virus is a phosphoprotein that associates with the cytoskeleton. 7 Virol 1997,71(12):9045-9053.

74. Xing L, Kato K, Li T, Takeda N, Miyamura T, Hammar L, Cheng RH: Recombinant hepatitis E capsid protein self-assemhles into a dual-domain T = 1 particle presenting native virus epitopes. Virology 1999, 265(l):35-45.

75. Kar-Roy A, Korkaya H, Oberoi R, Lai SK, Jameel S: The hepatitis E virus open reading frame 3 protein activates ERK through binding and inhibition of the MAPK phosphatase. 7 Biol Chem 2004, 279(27):28345-28357.

76. Ratra R, Kar-Roy A, Lai SK: The ORF3 protein of hepatitis E virus interacts with hemopexin hy means of its 26 amino acid N-terminal hydrophobic domain II. Biochemistry 2008, 47(7): 1957-1969.

77. Chandra V, Kar-Roy A, Kumari S, Mayor S, Jameel S: The hepatitis E virus ORF3 protein modulates epidermal growth factor receptor trafficking, STAT3 translocation, and the acute-phase response. Journal of virology 2008, 82(14):7100-7110.

78. He S, Miao J, Zheng Z, Wu T, X ie M, Tang M, Zhang J, Ng MH, Xia N: Putative receptor- binding sites of hepatitis E virus. The Journal of general virology 2008, 89(Pt l):245-249.

79. Williams TP, Kasorndorkbua C, Halbur PG, Haqshenas G, Guenette DK, Toth TE, M eng XJ: Evidence of extrahepatic sites of replication of the hepatitis E virus in a swine model. 7 Clin Microbiol 2001, 39(9):3040-3046.

80. Ippagunta SK, Naik S, Jameel S, Ramana KN, Aggarwal R: Viral RNA hut no evidence of replication can he detected in the peripheral blood mononuclear cells of hepatitis E virus-infected patients. 7 Viral Hepat 2010.

81. Aggarwal R, Kamili S, Spelbring J, Krawczynski K: Experimental studies on suhclinicalhepatitis E virus infection in cynomolgus macaques. 7 Infect Dis 2001, 184(11): 1380- 1385.

82. Sriram B, Thakral D, Panda SK: Targeted cleavage of hepatitis E virus 3' end RNAmediated hy hammerhead rihozymes inhibits viral RNA replication. Virology 2003,312(2):350-358.

83. Huang F, Zhou J, Yang Z, Cui L, Zhang W, Yuan C, Yang S, Zhu J, Hua X: RNAinterference inhibits hepatitis E virus mRNA accumulation and protein synthesis in vitro. Vet Microbiol 2 0 1 0 ,142(3-4):261-267.

84. Kamar N, Izopet J, Cintas P, Garrouste C, Uro-Coste E, Cointault O, Rostaing L: Hepatitis E virus-induced neurological symptoms in a kidney-transplant patient with chronic hepatitis. Am 7 Transplant 2 0 1 0 ,10(5):1321-1324.

85. Feagins AR, Opriessnig T, Guenette DK, Halbur PG, Meng XJ: Inactivation of infectious hepatitis E virus present in commercial pig livers sold in local grocery stores in the United States. Int J Food Microbiol 2 0 0 8 ,123(l-2):32-37.

86. Bouwknegt M, Frankena K, Rutjes SA, Wellenberg GJ, de Roda Husman AM, van der Poel WH, de Jong MC: Estimation of hepatitis E virus transmission among pigs due to contact-exposure. Vet Res 2008, 39(5):40.

190

87. Feagins AR, Opriessnig T, Guenette DK, Halbur PG, Meng XJ: Detection andcharacterization of infectious Hepatitis E virus from commercial pig livers sold in local grocery stores in the USA. J Gen Virol 2007, 88(Pt 3):912-917.

88. Matallana-Surget S, Douki T, Meador JA, Cavicchioli R, Joux F: Influence of growthtemperature and starvation state on survival and DNA damage induction in the marine bacterium Sphingopyxis alaskensis exposed to UV radiation. J Photochem Photobiol B 2 0 1 0 ,100(2):51-56.

89. Nuanualsuwan S, Mariam T, Himathongkham S, Oliver DO: Ultraviolet inactivation of feline calicivirus, human enteric viruses and coliphages. Photochem Photobiol 2002, 76(4):406-410.

90. Giese AC: Living with the sun’s ultraviolet rays.. Plenum

Press, New York 1976.91. Nicholson WL, Schuerger AC, Setlow P: The solar UV environment and bacterial spore

UV resistance: considerations for Earth-to-Mars transport hy natural processes and human spaceflight. Mutat Res 2005, 571(l-2):249-264.

92. Borio L, Inglesby T, Peters CJ, Schmaljohn AL, Hughes JM, Jahrling PB, Ksiazek T, Johnson KM, Meyerhoff A, O'Toole T et al: Hemorrhagic fever viruses as biological weapons: medical and public health management. JAMA 2002, 287(18):2391-2405.

93. Lytle CD, Sagripanti JL: Predicted inactivation of viruses of relevance to hiodefense hy solar radiation. J Virol 2005,79(22): 14244-14252.

94. Rzezutka A, Cook N: Survival of human enteric viruses in the environment and food. FEMS Microbiol Rev 2004, 28(4):441-453.

95. W ei H, Zhang JQ, Lu HQ, Meng JH, Lu XX, X ie W: [Construction and screening of hepatitis E virus-specific phage antibody combinatorial library]. Xi Bao Yu Fen Zi Mian YiXue Za Zhi 2 0 0 3 ,19(5):473-475, 485.

96. Schlauder GG, Mushahwar IK: Genetic heterogeneity of hepatitis E virus. J Med Virol 2001,65(2):282-292.

97. Teo CG: Much meat, much malady: changing perceptions of the epidemiology of hepatitis E. Clin Microbiol Infect 2010,16(l):24-32.

98. Geng J, Wang L, Wang X, Fu H, Bu Q, Zhu Y, Zhuang H: Study on prevalence and genotype of hepatitis E virus isolated from Rex Rabbits in Beijing, China. J Viral Hepat 2010 .

99. Zhao K, Liu Q, Yu R, Li Z, Li J, Zhu H, Wu X, Tan F, Wang J, Tang X: Screening of specific diagnostic peptides of swine hepatitis E virus. Virol J 2009, 6:186.

100. Johne R, Plenge-Bonig A, Hess M, Ulrich RG, Reetz J, Schielke A: Detection of a novel hepatitis E-like virus in faeces of wild rats using a nested hroad-spectrum RT-PCR. J Gen Virol 2010, 91(Pt 3):750-758.

101. Takahashi M, Nishizawa T, Sato H, Sato Y, Jirintai, Nagashima S, Okamoto H: Analysis of the full-length genome of a hepatitis E virus isolate obtained from a wild hoar in Japan that is classifiable into a novel genotype. The Journal of general virology 2011, 92(Pt 4):902-908.

102. Zhao C, Ma Z, Harrison TJ, Feng R, Zhang C, Qiao Z, Fan J, Ma H, Li M, Song A et al: A novel genotype of hepatitis E virus prevalent among farmed rabbits in China. J Med Virol 2009, 81(8):1371-1379.

103. Geng JB, Fu HW, Wang L, Wang XJ, Guan J, Chang YB, Li LJ, Zhu YH, Zhuang H, Liu QH et al: [Hepatitis E virus (HEV) genotype and the prevalence of anti-HEV in 8 species of animals in the suburbs of Beijing.]. Zhonghua Liu Xing Bing Xue Za Zhi 2010, 3I(l):47-50.

104. Bilic I, Jaskulska B, Basic A, Morrow CJ, Hess M: Sequence analysis and comparison of avian hepatitis E viruses from Australia and Europe indicate the existence of different genotypes. J Gen Virol 2009, 90(Pt 4):863-873.

105. Haqshenas G, Shivaprasad HL, W oolcock PR, Read DH, Meng XJ: Genetic identification and characterization of a novel virus related to human hepatitis E virus from chickens with hepatitis-splenomegaly syndrome in the United States. J Gen Virol 2001, 82(Pt 10):2449-2462.

106. Banks M, Heath GS, Grierson SS, King DP, Gresham A, Girones R, Widen F, Harrison TJ: Evidence for the presence of hepatitis E virus in pigs in the United Kingdom. Vet Rec2004,154(8):223-227.

191

107. Purdy MA, Khudyakov YE: Evolutionary history and population dynamics of hepatitis E virus. PLoS One 2010, 5(12):el4376.

108. Reuter G, Fodor D, Katai A, Szucs G: [Molecular detection of hepatitis E virus in non­imported hepatitis case-identification of a potential new human hepatitis E virus lineage in Hungary]. Orv Hetil 2 0 0 5 ,146(47):2389-2394.

109. Goens SD, Perdue ML: Hepatitis E viruses in humans and animals. Anim Health Res Rev 2004, 5(2): 145-156.

110. Hakze-van der Honing RW, van Coillie E, Antonis AF, van der Poel WH: First isolation of hepatitis E virus genotype 4 in Europe through swine surveillance in the Netherlands and Belgium. PloS one 2011, 6(8):e22673.

111. Tanaka Y, Takahashi K, Orito E, Karino Y, Kang JH, Suzuki K, Matsui A, Hori A, Matsuda H, Sakugawa H et al: Molecular tracing of Japan-indigenous hepatitis E viruses. J Gen Virol 2006, 87(Pt 4):949-954.

112. Drummond AJ, Ho SY, Phillips MJ, Rambaut A: Relaxed phylogenetics and dating with confidence. PLoS Biol 2006, 4(5):e88.

113. Emerson SU, Purcell RH: Hepatitis E virus. Rev Med Virol 2003,13(3): 145-154.114. Kwo PY, Schlauder GG, Carpenter HA, Murphy PJ, Rosenblatt JE, Dawson GJ, Mast EE,

Krawczynski K, Balan V: Acute hepatitis E hy a new isolate acquired in the United States. Mayo Clin Proc 1997 ,72(12):1133-1136.

115. Pina S, Buti M, Cotrina M, Piella J, Girones R: HEV identified in serum from humans with acute hepatitis and in sewage of animal origin in Spain. J Hepatol 2000, 33(5):826- 833.

116. Takahashi K, Kang JH, Ohnishi S, Hino K, Miyakawa H, Miyakawa Y, Maekubo H, Mishiro S: Full-length sequences of six hepatitis E virus isolates of genotypes HI and IV from patients with sporadic acute or fulminant hepatitis in Japan. Intervirology 2003, 46(5):308-318.

117. Peron JM, Mansuy JM, Poirson H, Bureau C, Dupuis E, Alric L, Izopet J, Vinel JP: Hepatitis E is an autochthonous disease in industrialized countries. Analysis of 23 patients in South-West France over a 13-month period and comparison with hepatitis A. Gastroenterologie clinique et biologique 2006, 30(5):757-762.

118. Meng S, Zhan S, Li J: Nuclease-resistant douhle-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays. Virol J 2009, 6:226.

119. Lees D: International Standardisation of a Method for Detection of Human Pathogenic Viruses in Molluscan Shellfish. Food and Environmental Virology 2010, 2(3): 146-155.

120. Li D, Baert L, De Jonghe M, Van Coillie E, Ryckeboer J, Devlieghere F, Uyttendaele M: Inactivation of murine norovirus 1, coliphage phiX174, and Bacillus fragilis phage B40- 8 on surfaces and fresh-cut iceherg lettuce hy hydrogen peroxide and UV light. Applied and environmental microbiology 2011, 77(4):1399-1404.

121. Banks M, Bendall R, Grierson S, Heath G, Mitchell J, Dalton H: Human and porcine hepatitis E virus strains, United Kingdom. Emerging infectious diseases 2004, 10(5):953- 955.

122. Martin M, Segales J, Huang FF, Guenette DK, Mateu E, de Deus N, Meng XJ: Association of hepatitis E virus (HEV) and postweaning multisystemic wasting syndrome (PMWS) with lesions of hepatitis in pigs. Vet Microbiol 2007,122(1-2): 16-24.

123. Hirano M, Ding X, Li TC, Takeda N, Kawabata H, Koizumi N, Kadosaka T, Goto I, Masuzawa T, Nakamura M et al: Evidence for widespread infection of hepatitis E virus among wild rats in Japan. Hepatol Res 2003, 27(1): 1-5.

124. Meng XJ, Wiseman B, Elvinger F, Guenette DK, Toth TE, Engle RE, Emerson SU, Purcell RH: Prevalence of antibodies to hepatitis E virus in veterinarians working with swine and in normal blood donors in the United States and other countries. Journal of clinical microbiology 2002, 40(1):117-122.

125. Dalton HR, Stableforth W, Thurairajah P, Hazeldine S, Remnarace R, Usama W, Farrington L, Hamad N, Sieberhagen C, Ellis V et al: Autochthonous hepatitis E in Southwest England: natural history, complications and seasonal variation, and hepatitis E virus IgG seroprevalence in blood donors, the elderly and patients with chronic liver disease. Eur J Gastroenterol Hepatol 2 0 0 8 ,20(8):784-790.

126. Aggarwal R, Manadan AM, Poliyedath A, Sequeira W, Block JA: Safety of etanercept in patients at high risk for mycobacterial tuberculosis infections. J Rheumatol 2009, 36(5):914-917.

192

127. Khuroo MS, Kamili S, Jameel S: Vertical transmission of hepatitis E virus. Lancet 1995, 345(8956): 1025-1026.

128. Kruttgen A, Seheithauer S, Hausler M, Kleines M: First report of an autochthonous hepatitis E virus genotype 3 infection in a 5 month old female child in Germany. J Clin Virol 2011, 50(2): 175-176.

129. Thapa R, Pramanik S, Biswas B, Mallick D: Hepatitis E virus infection in a 7-year-old hoy with glucose 6-phosphate dehydrogenase deficiency. J Pediatr Hematol Oncol 2009, 31(3):223-224.

130. Balayan MS, Andjaparidze AG, Savinskaya SS, Ketiladze ES, Braginsky DM, Savinov AP, Poleschuk VF: Evidence for a virus in non-A, non-B hepatitis transmitted via the fecal- oral route. Intervirology 1983, 20(1):23-31.

131. Boeeia D, Guthmann JP, Klovstad H, Hamid N, Tatay M, Ciglenecki I, Nizou JY, Nicand E, Guerin PJ: High mortality associated with an outbreak of hepatitis E among displaced persons in Darfur, Sudan. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 2006, 42(12):1679-1684.

132. Guthmann JP, Klovstad H, Boeeia D, Hamid N, Pinoges L, Nizou JY, Tatay M, Diaz F, Moren A, Grais RF et al: A large outbreak of hepatitis E among a displaced population in Darfur, Sudan, 2004: the role of water treatment methods. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 2006, 42(12): 1685- 1691.

133. Tei S, Kitajima N, Takahashi K, Mishiro S: Zoonotic transmission of hepatitis E virus from deer to human beings. Lancet 2003, 362(9381):371-373.

134. Colson P, Borentain P, Queyriaux B, Kaba M, Moal V, Gallian P, Heyries L, Raoult D, Gerolami R: Pig liver sausage as a source of hepatitis E virus transmission to humans. The Journal of infectious diseases 2010, 202(6):825-834.

135. Legrand-Abravanel F, Kamar N, Sandres-Saune K, Lhomme S, Mansuy JM, Muscari F, Sallusto F, Rostaing L, Izopet J: Hepatitis E virus infection without reactivation in solid- organ transplant recipients, France. Emerg Infect Dis 2 0 1 1 ,17(l):30-37.

136. Wiehmann O, Sehimanski S, Koch J, Kohler M, Rothe C, Plentz A, Jilg W, Stark K: Phylogenetic and case-control study on hepatitis E virus infection in Germany. J Infect Dis 2008,198(12): 1732-1741.

137. Kim YM, Jeong SH, Kim JY, Song JC, Lee JH, Kim JW, Yun H, Kim JS: The first case of genotype 4 hepatitis E related to wild hoar in South Korea. Journal of clinical virology : the official publication of the Pan American Society for Clinical Virology 2011, 50(3):253-256.

138. Yazaki Y, Mizuo H, Takahashi M, Nishizawa T, Sasaki N, Gotanda Y, Okamoto H: Sporadic acute or fulminant hepatitis E in Hokkaido, Japan, may he food-horne, as suggested hy the presence of hepatitis E virus in pig liver as food. J Gen Virol 2003, 84(Pt 9):2351-2357.

139. Lewis HC, Boisson S, Ijaz S, Hewitt K, Ngui SL, Boxall E, Teo CG, Morgan D: Hepatitis E in England and Wales. Emerg Infect Dis 2008,14(1):165-167.

140. De Silva AN, Muddu AK, Iredale JP, Sheron N, Khakoo SI, Pelosi E: Unexpectedly high incidence of indigenous acute hepatitis E within South Hampshire: time for routine testing? JMed Virol 2008, 80(2):283-288.

141. Mitsui T, Tsukamoto Y, Hirose A, Suzuki S, Yamazaki C, Masuko K, Tsuda F, Endo K, Takahashi M, Okamoto H: Distinct changing profiles of hepatitis A and E virus infection among patients with acute hepatitis, patients on maintenance hemodialysis and healthy individuals in Japan. J Med Virol 2 0 0 6 ,78(8):1015-1024.

142. Peron JM, Mansuy JM, Izopet J, Vinel JP: [Hepatitis E virus: an emerging disease]. Sante 2006,16(4):239-243.

143. Amon JJ, Drobeniuc J, Bower WA, Magana JC, Escobedo MA, Williams IT, Bell BP, Armstrong GL: Locally acquired hepatitis E virus infection, El Paso, Texas. Journal of medical virology 2006,78(6):741-746.

144. Nakamura M, Takahashi K, Taira K, Taira M, Ohno A, Sakugawa H, Arai M, Mishiro S: Hepatitis E virus infection in wild mongooses of Okinawa, Japan: Demonstration of anti-HEV antibodies and a full-genome nucleotide sequence. Hepatol Res 2006, 34(3).T37-140.

145. Li TC, Miyamura T, Takeda N: Detection of hepatitis E virus RNA from the bivalve Yamato-Shijimi (Corbicula japonica) in Japan. Am J Trop Med Hyg 2007,76(1): 170-172.

193

146. Arankalle VA, Joshi MV, Kulkarni AM, Gandhe SS, Chobe LP, Rautmare SS, Mishra AC, Padbidri VS: Prevalence of anti-hepatitis E virus antibodies in different Indian animal species. J Viral Hepat 2001, 8(3):223-227.

147. Yarbough PO: Hepatitis E virus. Advances in HEV hiology and HEV vaccine approaches. Intervirology 1999, 42(2-3):179-184.

148. Wang YC, Zhang HY, Xia NS, Peng G, Lan HY, Zhuang H, Zhu YH, Li SW, Tian KG, Gu WJ et al: Prevalence, isolation, and partial sequence analysis of hepatitis E virus from domestic animals in China. J Med Virol 2002, 67(4):516-521.

149. Halbur PG, Kasorndorkbua C, Gilbert C, Guenette D, Potters MB, Pureell RH, Emerson SU, Toth TE, Meng XJ: Comparative pathogenesis of infection of pigs with hepatitis E viruses recovered from a pig and a human. J Clin Microbiol 2001, 39(3):918-923.

150. Chobe LP, Lole KS, Arankalle VA: Full genome sequence and analysis of Indian swine hepatitis E virus isolate of genotype 4. Vet Microbiol 2 0 0 6 ,114(3-4):240-251.

151. Bouwknegt M, Engel B, Herremans MM, Widdowson MA, Worm HC, Koopmans MP, Frankena K, de Roda Husman AM, De Jong MC, Van Der Poel WH: Bayesian estimation of hepatitis E virus seroprevalence for populations with different exposure levels to swine in The Netherlands. Epidemiology and infection 2 0 0 8 ,136(4):567-576.

152. Rutjes SA, Lodder WJ, Bouwknegt M, de Roda Husman AM: Increased hepatitis E virus prevalence on Dutch pig farms from 33 to 55% hy using appropriate internal quality controls for RT-PCR. J Virol Methods 2 0 0 7 ,143(1): 112-116.

153. Wibawa ID, Muljono DH, Mulyanto, Suryadarma IG, Tsuda F, Takahashi M, Nishizawa T, Okamoto H: Prevalence of antibodies to hepatitis E virus among apparently healthy humans and pigs in Bali, Indonesia: Identification of a pig infected with a genotype 4 hepatitis E virus. J Med Virol 2004, 73(l):38-44.

154. Pina S, Jofre J, Emerson SU, Pureell RH, Girones R: Characterization of a strain of infectious hepatitis E virus isolated from sewage in an area where hepatitis E is not endemic. Appl Environ Microbiol 1998, 64(ll):4485-4488 .

155. Hussaini SH, Skidmore SJ, Riehardson P, Sherratt LM, Cooper BT, O'Grady JG: Severe hepatitis E infection during pregnancy. J Viral Hepat 1997, 4(l):51-54.

156. Chauhan A, Jameel S, Dilawari JB, Chawla YK, Kaur U, Ganguly NK: Hepatitis E virus transmission to a volunteer. Lancet 1993, 341(8838): 149-150.

157. Arora NK, Nanda SK, Gulati S, Ansari IH, Chawla MK, Gupta SD, Panda SK: Acute viral hepatitis types E, A, and B singly and in combination in acute liver failure in children in north India. J Med Virol 1996, 48(3):215-221.

158. Clayson ET, Innis BL, Myint KS, Narupiti S, Vaughn DW, Giri S, Ranabhat P, Shrestha MP: Detection of hepatitis E virus infections among domestic swine in the Kathmandu Valley of Nepal. Am J Trop Med Hyg 1995, 53(3):228-232.

159. Nanda SK, Ansari IH, Aeharya SK, Jameel S, Panda SK: Protracted viremia during acute sporadic hepatitis E virus infection. Gastroenterology 19 9 5 ,108(l):225-230.

160. Jameel S: Molecular hiology and pathogenesis of hepatitis E virus. Expert Rev Mol Med 1999,1999:1-16.

161. Aggarwal R, Kini D, Sofat S, Naik SR, Krawczynski K: Duration of viraemia and faecal viral excretion in acute hepatitis E. Lancet 2 0 0 0 ,356(9235):1081-1082.

162. Dawson J, Sedgwick AD, Edwards JC, Lees P: The monoclonal antibody MEL-14 can block lymphocyte migration into a site of chronic inflammation. Eur J Immunol 1992, 22(6): 1647-1650.

163. Favorov MO, Fields HA, Purdy MA, Yashina TL, Aleksandrov AG, Alter MJ, Yarasheva DM, Bradley DW, Margolis HS: Serologic identification of hepatitis E virus infections in epidemic and endemic settings. J Med Virol 1992, 36(4):246-250.

164. Khuroo MS, Kamili S, Dar MY, M oecklii R, Jameel S: Hepatitis E and long-term antibody status. Lancet 1993, 341(8856):1355.

165. Haagsma EB, van den Berg AP, Porte RJ, Benne CA, Vennema H, Reimerink JH, Koopmans MP: Chronic hepatitis E virus infection in liver transplant recipients. Liver Transpl 2 0 0 8 ,14(4):547-553.

166. Kamar N, Guitard J, Ribes D, Esposito L, Rostaing L: A monocentric observational study of darhepoetin alfa in anemic hepatitis-C-virus transplant patients treated with ribavirin. Exp Clin Transplant 2008, 6(4):271-275.

194

167. Kamar N, Mansuy JM, Cointault O, Selves J, Abravanel F, Danjoux M, Otai P, Esposito L, Durand D, Izopet J et al: Hepatitis E virus-related cirrhosis in kidney- and kidney- pancreas-transplant recipients. Am J Transplant 2008, 8(8): 1744-1748.

168. Kamar N, Selves J, Mansuy JM, Ouezzani L, Peron JM, Guitard J, Cointault O, Esposito L, Abravanel F, Danjoux M et al: Hepatitis E virus and chronic hepatitis in organ- transplant recipients. N EnglJ Med 2008, 358(8):811-817.

169. Dalton HR, Bendall RP, Keane FE, Tedder RS, Ijaz S: Persistent carriage of hepatitis E virus in patients with HIV infection. N EnglJ Med 2009, 361(10): 1025-1027.

170. Mandai K, Chopra N: Acute transverse myelitis following hepatitis E virus infection. Indian Pediatr 2006, 43(4):365-366.

171. Sood A, Midha V, Sood N: Guillain-Barre syndrome with acute hepatitis E. Am J Gastroenterol 2000, 95(12):3667-3668.

172. Loly JP, Rikir E, Seivert M, Legros E, Defrance P, Belaiehe J, Moonen G, Delwaide J: Guillain-Barre syndrome following hepatitis E. World J Gastroenterol 2009,15(13):1645- 1647.

173. Kamani P, Baijal R, Amarapurkar D, Gupte P, Patel N, Kumar P, Agal S: Guillain-Barre syndrome associated with acute hepatitis E. Indian J Gastroenterol 2005, 24(5):216.

174. Fong F, Illahi M: Neuralgic amyotrophy associated with hepatitis E virus. Clin Neurol Neurosurg 2009,111(2): 193-195.

175. Rianthavorn P, Thongmee C, Limpaphayom N, Komolmit P, Theamboonlers A, Poovorawan Y : The entire genome sequence of hepatitis E virus genotype 3 isolated from a patient with neuralgic amyotrophy. Scand J Infect Dis 2010, 42(5):395-400.

176. Kamar N, Bendall RP, Peron JM, Cintas P, Prudhomme L, Mansuy JM, Rostaing L, Keane F, Ijaz S, Izopet J et al: Hepatitis E virus and neurologic disorders. Emerg Infect Dis 2011, 17(2): 173-179.

177. Kamar N, Abravanel F, Mansuy JM, Peron JM, Izopet J, Rostaing L: [Hepatitis E infection in dialysis and after transplantation]. Nephrol Ther 2010, 6(2):83-87.

178. Gupta DN, Smetana HF: The histopathology of viral hepatitis as seen in the Delhi epidemic (1955-56). Indian J Med Res 1957, 45(SuppL): 101-113.

179. Hamid SS, Jafri SM, Khan H, Shah H, Abbas Z, Fields H: Fulminant hepatic failure in pregnant women: acute fatty liver or acute viral hepatitis? J Hepatol 1996, 25(l):20-27.

180. McCormick JB: Clinical, epidemiologic, and therapeutic aspects of Lassa fever. Med Microbiol Immunol 1986,175(2-3):153-155.

181. Longer CF, Denny SL, Caudill JD, M iele TA, Asher LV, Myint KS, Huang CC, Engler WF, LeDue JW, Binn LN et al: Experimental hepatitis E: pathogenesis in cynomolgus macaques (Macaca fascicularis). 7 /n/^crDw 1 9 9 3 ,168(3):602-609.

182. Arankalle VA, Chadha MS, Banerjee K, Srinivasan MA, Chobe LP: Hepatitis E virus infection in pregnant rhesus monkeys. Indian J Med Res 1993, 97:4-8.

183. Navaneethan U, Al Mohajer M, Shata MT: Hepatitis E and pregnancy: understanding the pathogenesis. Liver Int 2008,28(9):1190-1199.

184. Kasorndorkbua C, Guenette DK, Huang FF, Thomas PJ, Meng XJ, Halbur PG: Routes of transmission of swine hepatitis E virus in pigs. 7 Clin Microbiol 2004, 42(11):5047-5052.

185. Dalton HR, Keane FE, Bendall R, Mathew J, Ijaz S: Treatment of Chronic Hepatitis E in a Patient With HIV Infection. Ann Intern Med 2011,155(7):479-480.

186. Aggarwal R: Hepatitis E: Historical, contemporary and future perspectives. Journal of gastroenterology and hepatology 2011, 26 Suppl l(April 1979):72-82.

187. Kageyama T, Kojima S, Shinohara M, Uehida K, Fukushi S, Hoshino FB, Takeda N, Katayama K: Broadly Reactive and Highly Sensitive Assay for Norwalk-Like Viruses Based on Real-Time Quantitative Reverse Transcription-PCR. Society 2003, 41(4): 1548- 1557.

188. Kolasa K: Food Hypersensitivity: Diagnosing and Managing Food Allergies and Intolerance. Journal of Nutrition Education and Behavior 2010,42(2):142.el47-142.el47.

189. Dawson GJ, Chau KH, Cabal CM, Yarbough PO, Reyes GR, Mushahwar IK: Solid-phase enzyme-linked immunosorbent assay for hepatitis E virus IgG and IgM antibodies utilizing recombinant antigens and synthetic peptides. 7 Virol Methods 1992, 38(1):175- 186.

190. Pavan S, Varma K, Kumar A, Kapur N, Durgapal H, Aeharya K, Panda SK: HEV replication involves alternating negative and positive sense RNA synthesis. 2010.

195

191. Li T-C, Suzaki Y, Ami Y, Tsunemitsu H, Miyamura T, Takeda N: Mice are not susceptible to hepatitis E virus infection. The Journal of veterinary medical science / the Japanese Society of Veterinary Science 2 0 0 8 ,70(12): 1359-1362.

192. Martelli F, Caprioli A, Zengarini M, Marata A, Fiegna C, Di Bartolo I, Ruggeri FM, Delogu M, Ostanello F: Detection of hepatitis E virus (HEV) in a demographic managed wild hoar (Sus scrofa scrofa) population in Italy. Vet Microbiol 2 0 0 8 ,126(l-3):74-81.

193. Nanda SK, Yalcinkaya K, Panigrahi AK, Aeharya SK, Jameel S, Panda SK: Etiological role of hepatitis E virus in sporadic fulminant hepatitis. J Med Virol 1994, 42(2):133-137.

194. Varma SP, Kumar A, Kapur N, Durgapal H, Aeharya SK, Panda SK: Hepatitis E virus replication involves alternating negative- and positive-sense RNA synthesis. J Gen Virol 2011,92(Pt 3):572-581.

195. Huang R, Nakazono N, Ishii K, Li D, Kawamata O, Kawaguchi R, Tsukada Y: Hepatitis E virus (87A strain) propagated in A549 cells. J Med Virol 1995 ,47(4):299-302.

196. Huang R, Li D, W ei S, Li Q, Yuan X, Geng L, Li X, Liu M: Cell culture of sporadic hepatitis E virus in China. Clin Diagn Lab Immunol 1999, 6(5):729-733.

197. Tanaka T, Takahashi M, Kusano E, Okamoto H: Development and evaluation of an efficient cell-culture system for Hepatitis E virus. The Journal of general virology 2007, 88(Pt 3):903-911.

198. Okamoto H: Efficient cell culture systems for hepatitis E virus strains in feces and circulating blood. Reviews in medical virology 2011, 21(1): 18-31.

199. Nickerson CA, Goodwin TJ, Terlonge J, Ott CM, Buchanan KL, Uieker WC, Emami K, LeBlanc CL, Ramamurthy R, Clarke MS et al: Three-dimensional tissue assemblies: novel models for the study of Salmonella enterica serovar Typhimurium pathogenesis. Infection and immunity 2001, 69(11):7106-7120.

200. Nauman EA, Ott CM, Sander E, Tucker DL, Pierson D, Wilson JW, Nickerson CA: Novel quantitative hiosystem for modeling physiological fluid shear stress on cells. Appl Environ Microbiol 2007, 73(3):699-705.

201. Kageyama T, Kojima S, Shinohara M, Uchida K, Fukushi S, Hoshino FB, Takeda N, Katayama K: Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J Clin Microbiol 2003, 41(4): 1548- 1557.

202. Klaus DM: Clinostats and bioreactors. Gravit Space Biol Bull 2 0 0 1 ,14(2):55-64.203. Eaton B, Gangluff D, Mengel M: Fetal alcohol spectrum disorders: flying under the

radar. J Ark Med Soc 2 0 1 1 ,107(12):260-262.204. Deveic Z, Rayikanti BA, Hevia JP, Popenko NA, Karimi K, Wong BJ: Nasal tip projection

and facial attractiveness. Laryngoscope 2011,121(7): 1388-1394.205. Shrestha MP, Scott RM, Joshi DM, Mammen MP, Jr., Thapa GB, Thapa N, Myint KS,

Fourneau M, Kuschner RA, Shrestha SK et al: Safety and efficacy of a recombinanthepatitis E yaccinc. N Engl J Med 2007, 356(9):895-903.

206. Casas M, Cortes R, Pina S, Peralta B, Allepuz A, Cortey M, Casal J, Martin M:Longitudinal study of hepatitis E virus infection in Spanish farrow-to-finish swineherds. Vet M /cra^io/2 0 1 1 ,148(l):27-34.

207. Satou K, Nishiura H: Transmission dynamics of hepatitis E among swine: potential impact upon human infection. BMC Vet Res 2007, 3:9.

208. Martinez-Martinez M, Diez-Valearee M, Hernandez M, Rodriguez-Lazaro D: Design and Application of Nucleic Acid Standards for Quantitative Detection of Enteric Viruses by Real-Time PCR. Food Environ Virol 2011, 3(2):92-98.

209. Hundesa A, Bofill-M as S, Maluquer de Motes C, Rodriguez-Manzano J, Bach A, Casas M, Girones R: Development of a quantitative PCR assay for the quantitation of bovine polyomavirus as a microbial source-tracking tool. J Virol Methods 2 0 1 0 ,163(2):385-389.

210. Hernroth BE, Conden-Hansson AC, Rehnstam-Holm AS, Girones R, Allard AK: Environmental factors influencing human viral pathogens and their potential indicator organisms in the blue mussel, Mytilus edulis: the first Scandinavian report. Applied and environmental microbiology 2 0 0 2 ,68(9):4523-4533.

211. Hundesa A, Maluquer de Motes C, Albinana-Gimenez N, Rodriguez-Manzano J, Bofill-M as S, Sunen E, Rosina Girones R: Development of a qPCR assay for the quantification of porcine adenoviruses as an MST tool for swine fecal contamination in the environment. J Virol Methods 2009,158(1-2): 130-135.

196

212. Diez-Valcarce M, Kovac K, Cook N, Rodnguez-Lâzaro D, Hernandez M; Construction and Analytical Application of Internal Amplification Controls (lAC) for Detection of Food Supply Chain-Relevant Viruses hy Real-Time PCR-Based Assays. Food Analytical Methods 2011, 4(3):437-445.

213. da Silva AK, Le Saux JC, Parnaudeau S, Pommepuy M, Elimelech M, Le Guyader PS: Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl Environ Microbiol 2007, 73(24):7891-7897.

214. Svraka S, Duizer E, Vennema H, de Bruin E, van der Veer B, Dorresteijn B, Koopmans M: Etiological role of viruses in outbreaks of acute gastroenteritis in The Netherlands from 1994 through 2005. Journal of clinical microbiology 2007, 45(5):1389-1394.

215. Loisy F, Le Cann P, Pommepuy M, Le Guyader F: An improved method for the detection of Norwalk-like caliciviruses in environmental samples. Lett Appl Microbiol 2000, 31(6):411-415.

216. Baert L, Wobus CE, Van Coillie E, Thackray LB, Debevere J, Uyttendaele M: Detection of murine norovirus 1 hy using plaque assay, transfection assay, and real-time reverse transcription-PCR before and after heat exposure. Applied and environmental microbiology 2 0 0 8 ,74(2):543-546.

217. Ivo MDANCIDBFMRABFMMBPVPK: Multicenter Collaborative Trial Evaluation of a Method for Detection of Human Adenoviruses in Berry Fruit. Food Anal Methods 2011.

218. D ’Agostino M, Cook N, Di Bartolo I, Ruggeri F, Berto A, Martelli F, Banks M, Vasickova P, Kralik P, Pavlik I et al: Multicenter Collaborative Trial Evaluation of a Method for Detection of Human Adenoviruses in Berry Fruit. Food Analytical Methods 2012, 5(1): 1-7.

219. Williams SB, Prasad SM, Weinberg AC, Shelton JB, Hevelone ND, Lipsitz SR, Hu JC: Trends in the care of radical prostatectomy in the United States from 2003 to 2006. BJUInt 2 0 1 1 ,108(l):49-55.

220. Jothikumar N, Cromeans TL, Robertson BH, Meng XJ, Hill VR: A broadly reactive one- step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. Journal of virological methods 2 0 0 6 ,131(1):65-71.

221. Hundesa A, Maluquer de Motes C, Albinana-Gimenez N, Rodriguez-Manzano J, Bofill-M as S, Sunen E, Rosina Girones R: Development of a qPCR assay for the quantification of porcine adenoviruses as an MST tool for swine fecal contamination in the environment. Journal of virological methods 2009,158(1-2): 130-135.

222. Prado T, Silva DM, Guilayn WC, Rose TL, Caspar AM, Miagostovieh MP: Quantification and molecular characterization of enteric viruses detected in effluents from two hospital wastewater treatment plants. Water research 2011, 45(3):1287-1297.

223. MeCreary C, Martelli F, Grierson S, Ostanello F, Nevel A, Banks M: Excretion of hepatitis E virus hy pigs of different ages and its presence in slurry stores in the United Kingdom. The Veterinary record 2 0 0 8 ,163(9):261-265.

224. de Deus N, Seminati C, Pina S, Mateu E, Martin M, Segales J: Detection of hepatitis E virus in liver, mesenteric lymph node, serum, bile and faeces of naturally infected pigs affected hy different pathological conditions. Vet Microbiol 2007,119(2-4): 105-114.

225. Emerson SU, Arankalle VA, Purcell RH: Thermal stability of hepatitis E virus. J Infect Dis 2 0 0 5 ,192(5):930-933.

226. Takahashi M, Tanaka T, Azuma M, Kusano E, Aikawa T, Shibayama T, Yazaki Y, M izuo H, Inoue J, Okamoto H: Prolonged fecal shedding of hepatitis E virus (HEV) during sporadic acute hepatitis E: evaluation of infectivity of HEV in fecal specimens in a cell culture system. Journal of clinical microbiology 2007, 45(ll):3671-3679.

227. Lorenzo FR, Tanaka T, Takahashi H, lehiyama K, Hoshino Y, Yamada K, Inoue J, Takahashi M, Okamoto H: Mutational events during the primary propagation and consecutive passages of hepatitis E virus strain JE03-1760F in cell culture. Virus Res 2 0 0 8 ,137(l):86-96.

228. Goodwin TJ, Schroeder WF, W olf DA, Moyer MP: Rotating-wall vessel coculture of small intestine as a prelude to tissue modeling: aspects of simulated microgravity. Proc Soc Exp Biol Med 1993, 202(2): 181-192.

229. Chopra V, Dinh TV, Hannigan EV: Three-dimensional endothelial-tumor epithelial cell interactions in human cervical cancers. In Vitro Cell Dev Biol Anim 1997, 33(6):432-442.

197

230. Crabbe A, De Boever P, Van Houdt R, Moors H, Mergeay M, Cornells P: Use of the rotating wall vessel technology to study the effect of shear stress on growth behaviour of Pseudomonas aeruginosa PAOl. Environ Microbiol 2 0 0 8 ,10(8):2098-2110.

231. Straub TM, Honer zu Bentrup K, Orosz-Coghlan P, Dohnalkova A, Mayer BK, Bartholomew RA, Valdez CO, Bruckner-Lea CJ, Gerba CP, Abbaszadegan M et al: In vitro cell culture infectivity assay for human noroviruses. Emerg Infect Dis 2007,13(3):396-403.

232. Navran S: The application of low shear modeled microgravity to 3-D cell hiology and tissue engineering. In: Biotechnology Annual Review. Edited by El-Gewely MR, vol. Volume 14: Elsevier; 2008: 275-296.

233. Emerson SU, Anderson, D., Arankalle, V.A., Meng, X.J., Purdy, M.„ Schlauder GG, Tsarev,S.A.,: Hepevirus, Elsevier/Aeademie Press edn. London, ; 2004.

234. Chopra V, Fadl AA, Sha J, Chopra S, Galindo CL, Chopra AK: Alterations in the virulence potential of enteric pathogens and hacterial-host cell interactions under simulated microgravity conditions. J Toxicol Environ Health A 2006, 69(14): 1345-1370.

235. Walker JS, Carter RC, Klein F, Snowden SE, Lincoln RE: Evaluation of factors related togrowth of Rift Valley fever virus in suspended cell cultures. Applied microbiology 1969,17(5):658-664.

236. Rainbow AJ, Mak S: Functional heterogeneity of virions in human adenovirus types 2and 12. Journal of virology 1970, 5(2):188-193.

237. Zand V, Salem-Milani A, Shahi S, Akhi MT, Vazifekhah S: Efficacy of different concentrations of sodium hypochlorite and chlorhexidine in disinfection of contaminated Resilon cones. Med Oral Patol Oral CirBucal 2 0 1 2 ,17(2):e352-355.

238. Sabbah S, Springthorpe S, Sattar SA: Use of a mixture of surrogates for infectious hioagents in a standard approach to assessing disinfection of environmental surfaces. Applied and environmental microbiology 2010, 76(17):6020-6022.

239. Thurston-Enriquez JA, Haas CN, Jacangelo J, Riley K, Gerba CP: Inactivation of felinecalicivirus and adenovirus type 40 hy UV radiation. Appl Environ Microbiol 2003, 69(l):577-582.

240. Benarde MA, Israel BM, Olivieri VP, Granstrom ML: Efficiency of chlorine dioxide as a h2Lctcr\c\dc. Applied microbiology 1965,13(5):776-780.

241. Thurston-Enriquez JA, Haas CN, Jacangelo J, Gerba CP: Chlorine inactivation of adenovirus type 40 and feline calicivirus. Applied and environmental microbiology 2003, 69(7):3979-3985.

242. Meng J, Dai X, Chang JC, Lopareva E, Pillot J, Fields HA, Khudyakov YE: Identification and characterization of the neutralization epitope(s) of the hepatitis E virus. Virology 2001,288(2):203-211.

243. Bouwknegt M, Lodder-Versehoor F, van der Poel WH, Rutjes SA, de Roda Husman AM: Hepatitis E virus RNA in commercial porcine livers in The Netherlands. Journal of food protection 2007,70(12):2889-2895.

244. Jo SH, Back SB, Ha JH, Ha SD: Maturation and survival of Cronohacter hiofilms on silicone, polycarbonate, and stainless steel after UV light and ethanol immersion treatments. J Food Prot 2010, 73(5):952-956.

245. Matallana-Surget S, Douki T, Meador JA, Cavicchioli R, Joux F: Influence of growth temperature and starvation state on survival and DNA damage induction in the marine bacterium Sphingopyxis alaskensis exposed to UV radiation. J Photochem Photobiol B 2 0 1 0 ,100(2):51-56.

246. Fino VR, Kniel KE: UV light inactivation of hepatitis A virus, Aichi virus, and feline calicivirus on strawberries, green onions, and lettuce. J Food Prot 2008, 71(5):908-913.

247. Nuanualsuwan S, Mariam T, Himathongkham S, Cliver DO: Ultraviolet inactivation of feline calicivirus, human enteric viruses and coliphages. Photochem Photobiol 2002, 76(4):406-410.

248. Fino VR, Kniel KE: UV light inactivation of hepatitis A virus, Aichi virus, and feline calicivirus on strawberries, green onions, and lettuce. J Food Prot 2008, 71(5):908-913.

249. Browning ABaG. In: Phenotypic diversity and cell invasion in host subversion by pathogenic mycoplasmas In: Mycoplasmas, molecular biology, pathogenicity and strategies for control

439-483.

198

250. Xing L, Li TC, Mayazaki N, Simon MN, Wall JS, Moore M, Wang CY, Takeda N, Wakita T, Miyamura T et al: Structure of hepatitis E virion-sized particle reveals an RNA- dependent viral assembly pathway. 7 Rio/ Chem 2010, 285(43):33175-33183.

251. J.A. Baeker AB, F. Martelli, W.H.M. van der Poel: Transmission dynamics of Hepatitis E virus in pigs: estimation from field data and effect of vaccination. Epidemics 2011.

252. Fernandez-Barredo S, Galiana C, Garcia A, Vega S, Gomez MT, Perez-Gracia MT: Detection of hepatitis E virus shedding in feces of pigs at different stages of production using reverse transcription-polymerase chain reaction. 7 Vet Diagn Invest 2006, 18(5):462-465.

253. de Deus N, Casas M, Peralta B, Nofrarias M, Pina S, Martin M, Segales J: Hepatitis E virus infection dynamics and organic distribution in naturally infected pigs in a farrow-to- finish farm. Veterinary microbiology 200%, 132(1-2): 19-28.

254. Keeling MJ, Ross JV: On methods for studying stochastic disease dynamics. 7 R Soc Interface 2008, 5(19):171-181.

255. Di Bartolo I, Martelli F, Inglese N, Pourshaban M, Caprioli A, Ostanello F, Ruggeri FM: Widespread diffusion of genotype 3 hepatitis E virus among farming swine in Northern Italy. Veterinary microbiology 2 0 0 8 ,132(l-2):47-55.

256. Straub TM, Honer zu Bentrup K, Orosz-Coghlan P, Dohnalkova A, Mayer BK, Bartholomew RA, Valdez CO, Bruekner-Lea CJ, Gerba CP, Abbaszadegan M et al: In vitro cell culture infectivity assay for human noroviruses. Emerg Infect Dis 2001,13(3):396-403.

257. Sherwood LJ, Osborn LE, Carrion R, Jr., Patterson JL, Hayhurst A: Rapid assembly of sensitive antigen-capture assays for Marburg virus, using in vitro selection of llama single-domain antibodies, at biosafety level 4 .7 Infect Dis 2 0 0 7 ,196 Suppl 2:S213-219.

258. Fray MD, Mann GE, Charleston B: Validation of an Mx/CAT reporter gene assay for the quantification of bovine type-I interferon. Journal of immunological methods 2001, 249(1- 2):235-244.

259. Srivastava R, Aggarwal R, Jameel S, Puri P, Gupta VK, Ramesh VS, Bhatia S, Naik S: Cellular immune responses in acute hepatitis E virus infection to the viral open reading frame 2 protein. Viral Immunol 2001, 20(l):56-65.

260. Yu C, Boon D, McDonald SL, Myers TG, Tomioka K, Nguyen H, Engle RE, Govindarajan S, Emerson SU, Purcell RH: Pathogenesis of hepatitis E virus and hepatitis C virus in chimpanzees: similarities and differences. Journal of virology 2010, 84(21): 11264-11278.

261. Kamar N, Garrouste C, Haagsma EB, Garrigue V, Pisehke S, Chauvet C, Dumortier J, Cannesson A, Cassuto-Viguier E, Thervet E et al: Factors associated with chronic hepatitis in patients with hepatitis E virus infection who have received solid organ transplants. Gastroenterology 2 0 1 1 ,140(5): 1481-1489.

262. Peterhans E, Jungi TW, Sehweizer M: BVDV and innate immunity. Biologicals .'journal of the International Association of Biological Standardization 2003, 31(2): 107-112.

199

Appendix

Appendix A

A.l Attempted construction of an Interferon knock-out cell line

An Interferon knock out cell line was planned to verify if the IFN-KN cells better

allowed more efficient HEV replication. Before the IFN-KN constructions the IFN

production was evaluated by CAT-BLISA to determine if HEV activates the

interferon cascade in the cells otherwise the IFN-KN was not going to be

performed.

A. 1.1 Introduction

This work is reported in the thesis although the experiment did not produce useful

results, the techniques applied should be described.

1) Attempted Production of interferon knockout PLC/PRF/5 cell line to facilitate in-

vitro replication of HEV.

A.1.1.1 Introduction CAT-ELISA test:

Signal Transducing Activator of Transcription-1 (STATl), regulates the innate

cellular antiviral response through the transcriptional activation of interferon.

Activation of the IFN gene and its respective receptor triggers intracellular signaling

pathway resulting in the activation or expression of distinct but related signaling

pathways, known as the Janus kinase and signal transducer and activator of

transcription pathway (JAK-STAT).

These JAK and STAT proteins are known to perform distinct functions in cytokine

signaling, mediating IFN-dependent biological responses, and inducing an antiviral

state.

201

The simian virus 5 (SV-5) V protein is a specific inhibitor of STATl. The

construction and use of cells constitutively expressing the SV-5 V protein in a

lentivirus vector has been established to enable the propagation of viruses that are

difficult to grow in-vitro [257].

The aim was to construct a STATl knockout (IFN KO) of the hepatocarcinoma cell

line PLC/PRF5 to increase permissivity/sensitivity to HEV infection and to evaluate

the cell line in 3 culture systems (2D, 3D and 3D transferred in to 2D). The

approach was to transfect PLC/PRF5 cells with the SV-5 lentivirus vector to alter

gene expression in the target cell line PLC/PRF/5 such that they no longer produce

IFN, therefore allowing a more efficient replication of HEV.

Type I IFN bioactivity of expressed interferon alpha subtypes was determined using

an Mx/CAT (chloramphenicol acetyltransferase) reporter gene assay developed for

the quantification of IFN I [258]. This assay was performed to check if HEV

stimulates IFN activation.

It is known that a large variety of cells can produce IFN-y. In the liver NK cells and

NKT cells are known to be potent sources of IFN-y [259].

In HBV infection, IFN-y produced in the liver has been shown to recruit

neutrophils, macrophages, NK cells, and NKT cells. NK, NKT, and CD4+ cells that

express a glycoprotein that induces cell death. IFN-y also has non cytopathic

antiviral activity, which is important for HBV and HCV clearance [259]. In patients

with hepatitis A virus, HBV, and HCV infections the CD8+ cytotoxic cells play the

major role in the pathogenesis of viral clearance [273]. However, no increase in

HEV-specific cytokine-producing CD8+ cells was found in patients with hepatitis E

[259] and the CD3+ cells produced less IFN-y- and TNF-«- in response to activation

202

with PMA. Srivastava et al [259] noticed an increased of IFN-y production in

patients with acute hepatitis E and this may be important in the pathogenesis of liver

injury in patients with acute hepatitis E virus [259]. Furthermore, the study

suggested [259] that during the acute phase of hepatitis E infection there is no

detectable HEV 0RF2-specific immune activation of CD4+ and CD8+ cells in the

peripheral blood of those patients. However, the increasing of IFN-y production

with no specific CD8+ cell responses suggests that probably no-specific innate

mechanisms are involved in the activation of NK or NKT cells and this could play a

significant role in hepatitis E pathogenesis [259].

A.2 Material and Methods of CAT-ELISA (enzyme immunoassay for the

quantitative determination of chloramphenicol acetyltransferase (CAT) from E. coli

in transfected eukaryotic cells) test:

A.2.1 Type I IFN bioassay of recombinant HEV-IFN-a

The assay is based on MDBK cells transfected with a plasmid, containing a human

MxA promoter driving the expression of the reporter CAT gene.

MDBK-t2 cells maintained under blasticidin selection were seeded into 96-well

microtitre plates at a density of 2.5x10^ cells/well. Expressed recombinant IFNa

proteins alongside a serial dilution of recombinant porcine IFN-al (R&D Systems,

Abingdon, UK) which served as a standard to calculate the activity of the expressed

protein were added to the cells. Cultures were incubated for 24 hours at 37°C 5%

C02. Lysates were prepared from the MDBK-t2 cultures and the amount of CAT

expression induced by recombinant IFNa was quantified by ELISA using an

enhanced substrate (Roche, Welwyn garden City, UK) [258]. Luminescence was

203

read at 405nm using a FLUOstart OPTIMA microplate reader (BMG Labtech,

Aylesbury, UK).

A 3 Results of the CAT ELISA test:

A.3.1 Biological activity of expressed recombinant protein

To confirm that the expressed recombinant proteins are biologically active, the cell

supernatants were analyzed using the Type I IFN bioassay. Addition of cell culture

supernatants to the MDBKt2 reporter cell line alongside quantified commercial

IFNa standards resulted in no expression of CAT enzyme, indicating no induction

of the interferon responsive MX promoter. Figure 1 shows the IFN type I

concentration, measured from each sample (Figure 1).

204

I£

12

1 0

8

6

4

2

O

IFN A l p h a C A T E l i s a

---- i

M ocK tran s fe c t not in fectedmedia

HEV positive media

Figure 1: IFNa CAT ELISA, IFNU/ml comparison between MocK positive control cells, not HEV infected supernatant and HEV positive supernatant. (IFNU = type I interferon unit per ml).

205

A.4 Discussion of CAT ELISA

This assay demonstrated that HEV positive supernatant was apparently not

activating INF signalling. For this reason, INF-KO cells were not produced.

Yu et al described the pathogenesis of Hepatitis E Virus and Hepatitis C Virus in

Chimpanzees. Result of Yu et al [260] study was that the expression of adaptive

immune-associated genes and immune-specific cell markers, was dramatically

lower in HEV-infected chimpanzees than in HCV-infected chimpanzees [260].

Kamar et al [261] described three-month pegylated interferon-alpha-2 a therapy for

chronic hepatitis E virus infection in a haemodialysis patient. Result obtained in the

study was that after 3-month of Peg-IFN-a-2a treatment. Serum HEV RNA patient

became negative by third week of Peg-IFN-a-2a therapy [261].

Furthermore, literature describes infection with bovine viral diarrhea virus (BVDV),

the virus exists in two biotypes, cytopathic and non-cytopathic [262]. BVDV

cytopathic and non-cytopathic biotypes have specific immune response and only the

non-cytopathic BVDV virus can establish persistent infection [262]. Non-cytopathic

BVDV fails to induce interferon type I in cultured bovine macrophages. Non-

cytopathic BVDV may dispose of a mechanism suppressing a key element of the

antiviral defence of the innate immune system [262]. Since interferon is also

important in the activation of the adaptive immune response, suppression of this

signal may be essential for the establishment of persistent infection and

immunotolérance [262].

206

A possible conclusion from these four studies is that probably INF type I probably

does not play a significant role in hepatitis E pathogenesis as also Srivastava et al

[259] suggested.

After this possible explanation, for this study was essential a cell line able to permit

the virus to replicate efficiently and the production of an INF-KO cell line was not

beneficial for the study. The KO cell line would have probably been able to support

HEV replication as the wild type, so there was no point in putting effort in

producing a KO cell line in PLC/PRF-5.

207

MATERIAL REDACTED AT REQUEST OF UNIVERSITY

Reproduced with permission of copyright owner. Further reproduction prohibited without permission.