Top Banner
Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology – Restriction enzymes – Gel Electrophoresis
15

Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

Dec 25, 2015

Download

Documents

Robert O'Brien
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

Happy Monday!

Checking off: Notes on Ch 20.1, 20.2

With your group, discuss what you know about these:– Methylation and Acetylation– Genetic Engineering/Biotechnology– Restriction enzymes– Gel Electrophoresis

Page 2: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

Methylation and Acetylation

Page 3: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

2005-2006

The BIG Questions…• How can we use our knowledge of DNA to:– diagnose disease or defect?– cure disease or defect?– change/improve organisms?

• What are the techniques & applications of biotechnology?– direct manipulation of genes for practical purposes

Page 4: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

2005-2006

Biotechnology Today• Genetic Engineering– manipulation of DNA– if you are going to engineer DNA & genes &

organisms, then you need a set of tools to work with

– this “unit” is a survey of those tools…

Our tool kit…

Page 5: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

2005-2006

Bioengineering Tool kit• Basic Tools– restriction enzymes– ligase– plasmids / cloning– DNA libraries / probes

• Advanced Tools– PCR – DNA sequencing – gel electrophoresis – Southern blotting– microarrays

Page 6: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

2005-2006

Cut, Paste, Copy, Find…• Word processing metaphor…– cut• restriction enzymes

– paste• ligase

– copy• plasmids

– Bacteria transformation• PCR

– find• Southern blotting / probes

Page 7: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

2005-2006

Cut DNA• Restriction enzymes– restriction endonucleases– discovered in 1960s– evolved in bacteria to cut up foreign DNA

(“restriction”) • protection against viruses & other bacteria

Page 8: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

2005-2006

What do you notice about these phrases?

radarracecarMadam I’m AdamAble was I ere I saw Elbaa man, a plan, a canal, PanamaWas it a bar or a bat I saw?

Page 9: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

Restriction Enzymes

Also known as restriction endonucleases, are enzymes that cut a DNA molecule at a particular place. They are essential tools for recombinant DNA technology. The enzyme "scans" a DNA molecule, looking for a particular sequence, usually of four to six nucleotides.

Page 10: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.
Page 11: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

2005-2006

Restriction Enzymes, c’td• Action of enzyme – cut DNA at specific sequences• restriction site

– symmetrical “palindrome”– produces protruding ends• sticky ends

• Many different enzymes– named after organism they are found in• EcoRI, HindIII, BamHI, SmaI

Madam I’m Adam

CTGAATTCCGGACTTAAGGC

CTG|AATTCCGGACTTAA|GGC

Page 12: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

2005-2006

AATTC

AATTC

AATTC

GAATTC

G

G

GG

G

GAATTCCTTAAG

GAATTCCTTAAG

CTTAA

CTTAA

CTTAAG

DNA ligasejoins the strands.

DNA

Sticky ends (complementarysingle-stranded DNA tails)

Recombinant DNA molecule

AATTCGG

CTTAA

How restriction enzymes are used

Restriction enzymecuts the DNA

Add DNA from another source cut with same restriction enzyme

Page 13: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

2005-2006

Paste DNA• Sticky ends allow:– H bonds between

complementary bases to anneal

• Ligase– enzyme “seals”

strands • bonds sugar-

phosphate bonds• covalent bond of

DNA backbone

Page 14: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

Then what?

• DNA, cut at restriction sites, will be different lengths and will contain genes within those lengths.

• To analyze, mix with solutions that will allow them to travel through a medium based on size, shape, and charge.

• Gel electrophoresis is a method for separation and analysis of macromolecules (DNA, RNA and proteins) and their fragments, based on their size and charge.

Page 15: Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

Homework

• Complete Pre-lab activity for Transformation Lab– Get to Know Bacterial Transformation– Flowchart all steps