Go to Section: A New Breed The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans.

Go to Section:

A New Breed

The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed breeds of animals and plants that have desirable characteristics. How do breeders predict the results of crossing individuals with different traits?

Section 13-1

Interest Grabber

Go to Section:

Section 13-1

Interest Grabber continued

1. Think of two very different breeds of dogs that are familiar to you. On a sheet of paper, construct a table that has the following three heads: the name of each of the two dog breeds, and “Cross-Breed.

2. The rows of the table should be labeled with characteristics found in both breeds of dogs. Examples might include size, color, type of coat, intelligence, aggression, and so on.

3. Fill in the column for each of the two dog breeds. In the column labeled “Cross-Breed,” write in the characteristic you would expect to see in a cross between the two breeds you have selected.

Go to Section:

13–1 Changing the Living WorldA. Selective Breeding

1. Hybridization

2. Inbreeding

B. Increasing Variation

1. Producing New Kinds of Bacteria

2. Producing New Kinds of Plants

Section 13-1

Section Outline

Go to Section:

Go to Section:

which crosses

consists of

Selective Breeding

for example

Inbreeding Hybridization

Similar organisms

Dissimilar organismsfor

example

Organism breed A

Organism breed A

Organism breed B

Retains desired characteristics

Combines desired characteristics

which

which crosses

which

Section 13-1

Concept Map

Go to Section:

The Smallest Scissors in the World

Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces?

Section 13-2

Interest Grabber

Go to Section:

1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA

2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once.

3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?

Section 13-2

Interest Grabber continued

Go to Section:

13–2 Manipulating DNAA. The Tools of Molecular Biology

1. DNA Extraction

2. Cutting DNA

3. Separating DNA

B. Using the DNA Sequence

1. Reading the Sequence

2. Cutting and Pasting

3. Making Copies

Section 13-2

Section Outline

Go to Section:

Recognition sequences

DNA sequence

Section 13-2

Restriction Enzymes

Go to Section:

Recognition sequences

DNA sequence

Restriction enzyme EcoRI cuts the DNA into fragments. Sticky end

Section 13-2

Restriction Enzymes

Go to Section:

DNA plus restriction enzyme

Mixture of DNA fragments

Gel

Power source

Longer fragments

Shorter fragments

Section 13-2

Figure 13-6 Gel Electrophoresis

Go to Section:

Section 13-2

Figure 13-7 DNA Sequencing

Go to Section:

DNA polymerase adds complementary strand

DNA heated to separate strands

DNA fragment to be copied

PCRcycles 1

DNAcopies 1

2

2

3

4

4

8

5 etc.

16 etc.

Section 13-2

Figure 13-8 PCR

Go to Section:

Sneaking In

You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer.

Section 13-3

Interest Grabber

Go to Section:

1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory?

2. Why would a person download a virus program?

3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?

Section 13-3

Interest Grabber continued

Go to Section:

13–3 Cell TransformationA. Transforming Bacteria

B. Transforming Plant Cells

C. Transforming Animal Cells

Section 13-3

Section Outline

Go to Section:

Recombinant DNA

Flanking sequences match host

Host Cell DNA

Target gene

Recombinant DNA replaces target gene

Modified Host Cell DNA

Section 13-3

Knockout Genes

Go to Section:

Human Cell

Gene for human growth hormone

Recombinant DNA

Gene for human growth hormone

Sticky ends

DNA recombination

DNA insertion

Bacterial Cell

Plasmid

Bacterial chromosome

Bacterial cell for containing gene for human growth hormone

Section 13-3

Figure 13-9 Making Recombinant DNA

Go to Section:

Recombinant plasmid

Gene to be transferred

Agrobacterium tumefaciens

Cellular DNA

Transformed bacteria introduce plasmids into plant cells

Plant cell colonies

Complete plant is generated from transformed cell

Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome

Section 13-3

Figure 13-10 Plant Cell Transformation

Go to Section:

The Good With the Bad

The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

Section 13-4

Interest Grabber

Go to Section:

1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system?

2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?

Section 13-4

Interest Grabber continued

Go to Section:

13–4 Applications of Genetic EngineeringA. Transgenic Organisms

1. Transgenic Microorganisms

2. Transgenic Animals

3. Transgenic Plants

B. Cloning

Section 13-4

Section Outline

Go to Section:

Cloning

Section 13-4

Flowchart

A body cell is taken from a donor animal.

An egg cell is taken from a donor animal.

The fused cell begins dividing, becoming an embryo.

The nucleus is removed from the egg.

The body cell and egg are fused by electric shock.

The embryo is implanted into the uterus of a foster mother.

The embryo develops into a cloned animal.

Go to Section:

A donor cell is taken from a sheep’s udder. Donor

Nucleus

These two cells are fused using an electric shock.

Fused Cell

The fused cell begins dividing normally.

EmbryoThe embryo is placed in the uterus of a foster mother.Foster

Mother

The embryo develops normally into a lamb—Dolly

Cloned Lamb

Egg Cell

An egg cell is taken from an adult female sheep.

The nucleus of the egg cell is removed.

Section 13-4

Figure 13-13 Cloning of the First Mammal

Video

Click the image to play the video segment.

Gene Transfer

Links from the authors on genetically modified foods

Interactive test

For links on recombinant DNA, go to www.SciLinks.org and enter the Web Code as follows: cbn-4132.

For links on genetic engineering, go to www.SciLinks.org and enter the Web Code as follows: cbn-4134.

Go Online

Interest Grabber Answers

1. Think of two very different breeds of dogs that are familiar to you. On a sheet of paper, construct a table that has the following three heads: the name of each of the two dog breeds, and “Cross-Breed. Encourage students to refer only to breeds with which they are familiar.

2. The rows of the table should be labeled with characteristics found in both breeds of dogs. Examples might include size, color, type of coat, intelligence, aggression, and so on.Additional traits might include shape of ears, shape of muzzle (pointed or square), or length of legs with respect to body.

3. Fill in the column for each of the two dog breeds. In the column labeled “Cross-Breed,” write in the characteristic you would expect to see in a cross between the two breeds you have selected.Students will likely assume that traits of the cross-breed are intermediate between those of the two parent breeds.

Interest Grabber Answers

1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA

2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once.1–2: Remind students to check their copies for accuracy before they begin the next step.

3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Students should find three occurrences of the sequence:GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA

Interest Grabber Answers

1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory?A file can be downloaded from a diskette, a CD, or the Internet.

2. Why would a person download a virus program?The computer user would not willingly download a virus but would download a program that was useful.

3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?

Possible answers: a useful protein or a strand of DNA that the cell would recognize and accept

Interest Grabber Answers

1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? Students may say that a mouse with a humanlike immune system would be a good laboratory model for immune research.

2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?Transgenic organisms might disrupt normal balances in ecosystems and could breed with natural populations, changing them.

This slide is intentionally blank.