Genetic diversity of Rhizoctonia solani associated with potato tubers in France

Genetic diversity of Rhizoctonia solani associated with potato tubers in France

Marie FiersVeronique Edel-Hermann1

Cecile HeraudNadine Gautheron

INRA, Universite de Bourgogne UMR 1229Microbiologie du Sol et de l’Environnement, CMSE,17 rue Sully, BP 86510, Dijon cedex 21065, France

Catherine ChatotGermicopa R&D, Kerguivarch, Chateauneuf du Faou29520, France

Yves Le HingratFNPPPT, Bretagne-Plants Roudouhir, Hanvec 29460,France

Karima Bouchek-MechicheINRA, UMR BiO3P, Domaine de la Motte, BP 35327,Le Rheu 35653, France

Christian SteinbergINRA, Universite de Bourgogne UMR 1229Microbiologie du Sol et de l’Environnement, CMSE,17 rue Sully, BP 86510, Dijon cedex 21065, France

Abstract: The soilborne fungus Rhizoctonia solani isa pathogen of many plants and causes severe damagein crops around the world. Strains of R. solani fromthe anastomosis group (AG) 3 attack potatoes,leading to great yield losses and to the downgradingof production. The study of the genetic diversity ofthe strains of R. solani in France allows the structureof the populations to be determined and adaptedcontrol strategies against this pathogen to be estab-lished. The diversity of 73 French strains isolated fromtubers grown in the main potato seed productionareas and 31 strains isolated in nine other countrieswas assessed by phylogenetic analyses of (i) theinternal transcribed spacer sequences (ITS1 andITS2) of ribosomal RNA (rRNA), (ii) a part of thegene tef-1a and (iii) the total DNA fingerprints ofeach strain established by amplified fragment lengthpolymorphism (AFLP). The determination of the AGsof R. solani based on the sequencing of the ITSregion showed three different AGs among ourcollection (60 AG 3 PT, 8 AG 2-1 and 5 AG 5).Grouping of the strains belonging to the same AG wasconfirmed by sequencing of the gene tef-1a used forthe first time to study the genetic diversity of R. solani.About 42% of ITS sequences and 72% of tef-1a

sequences contained polymorphic sites, suggestingthat the cells of R. solani strains contain several copiesof ITS and the tef-1a gene within the same nucleus orbetween different nuclei. Phylogenetic trees showed agreater genetic diversity within AGs in tef-1a sequenc-es than in ITS sequences. The AFLP analyses showedan even greater diversity among the strains demon-strating that the French strains of R. solani isolatedfrom potatoes were not a clonal population. Moreoverthere was no relationship between the geographicalorigins of the strains or the variety from which theywere isolated and their genetic diversity.

Key words: amplified fragment length polymor-phism, anastomosis group, elongation factor, internaltranscribed spacer, polymorphic site, potato, Rhizoc-tonia solani

INTRODUCTION

The fungus Rhizoctonia solani (teleomorph Thanate-phorus cucumeris, Kuhn, 1858) is a widespread plantpathogen that causes severe damage on numerousspecies. R. solani includes many related but geneticallydifferent subspecific groups. The hyphae of the closelyrelated strains can fuse and hence form an anastomosisgroup (AG), whereas the distantly related strains areunable to anastomose (Carling et al. 2002, Kuninagaand Yokosawa 1984, Parmeter 1970). The known strainsof R. solani can be classified into at least 13 AGs, but theclassification is not strictly fixed because some bridgingstrains are able to anastomose with strains of at least twoAGs (Carling et al. 2002, Parmeter 1970, Sharon et al.2008). Each AG is either host specific or with a widehost range (Carling et al. 2002, Ogoshi 1987). Forexample AG 2 is associated with diverse host plants butAG 8 is more specifically associated with cereals. AG 3 isdivided into two genetically different subgroups, AG 3PT associated with potatoes and AG 3 TB associatedwith tobacco (Kuninaga et al. 2000, Woodhall et al.2008). R. solani AG 3 PT reduces tuber quality byproducing sclerotia (black scurf) on progeny potatotubers. The pathogen also can infect undergroundorgans (stems, stolons and roots), which affects cropyield (tuber size and number) (El Bakali and Martin2006). In addition to those typical symptoms R. solani isassociated with several types of blemishes on potatotubers (Fiers et al. 2010). Other AGs of R. solanisometimes are considered potential pathogens ofpotato in France and in the United Kingdom, althoughKoch’s postulates have not been assessed (Campion etal. 2003, Woodhall et al. 2008).

Submitted 23 Jul 2010; accepted for publication 5 Apr 2011.1 Corresponding author. E-mail: [email protected]

Mycologia, 103(6), 2011, pp. 1230–1244. DOI: 10.3852/10-231# 2011 by The Mycological Society of America, Lawrence, KS 66044-8897

1230

The AG differentiation is traditionally carried outby pairing unknown isolates with reference strainsand by identifying the hyphal anastomosis reaction(Carling 1996, Guillemaut et al. 2003). However thismethod is time consuming, needs experienced eyesand does not reflect the diversity among AGs.Sequencing of the internal transcribed spacer (ITS)of the ribosomal DNA (rDNA) is now a moreconvenient and rapid method to differentiate R.solani AGs (Kuninaga et al. 2000, Lehtonen et al.2008, Woodhall et al. 2007). However this region isless variable for detection of differences betweenisolates of the same AG. The tef-1a gene, encoding thetranslation elongation factor 1a, is more variable thanthe ITS region and already has proved useful inrevealing genetic variability within fungal genera,including Fusarium (Geiser et al. 2004) and Tricho-derma (Anees et al. 2010). This genetic marker couldbe useful to reflect polymorphism both between andwithin AGs of R. solani. In addition to targeted DNAmarkers, strategies based on amplified fragmentlength polymorphism (AFLP) allow a large numberof DNA fragments to be screened to assess intraspe-cific variability to differentiate closely related isolatesand reveal clonal lineages (McDonald 1997).

The aim of this study was to characterize thegenetic diversity of isolates of R. solani collected fromthe different potato-growing areas in France. Thegenetic variability between and within AG wasevaluated with ITS and tef-1a sequencing, togetherwith AFLP analysis. The relevance of these tools todetect genetic differences between and within isolatesalso was assessed.

MATERIALS AND METHODS

Fungal isolates.—73 isolates of R. solani were collected frompotato tubers of several varieties and from nine Frenchdepartments producing potatoes in 2006 and 2007 (TA-

BLE I). The tubers were affected by various superficialblemishes (Fiers et al. 2010). In addition 31 isolates of R.solani from other countries were analyzed: six from Finland,one from Germany, one from Japan, four from Morocco,one from the Netherlands, two from Poland, one fromSpain, 12 from Switzerland and three from the UnitedKingdom (TABLE I).

DNA extraction, PCR amplification, DNA sequencing andphylogenetic analyses.—DNA of all the fungal isolates wasextracted from freeze-dried powder of mycelium with theDNeasy plant mini kit according to the protocol of Fiers etal. (2010).

For each fungal isolate the ITS region of the rDNA andpart of the tef-1a gene were amplified by PCR. ITS PCR wasperformed with the primers ITS1-F (CTTGGTCATTTA-GAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGA-TATGC) (Gardes and Bruns 1993, White et al. 1990) in a

final volume of 50 mL by mixing 2 mL DNA with 0.5 mM ofeach primer, 150 mM dNTP, 6 U Taq DNA polymerase (Q-Biogen, Evry, France) and PCR reaction buffer. PCRamplifications of tef-1a were performed with primers EF1–645F (TCGTCGTYATCGGMCACGTCGA) and EF1–1190R(TACCAGTGATCATGTTCTTGATGA) (Andersen et al.2009) in a final volume of 25 mL by mixing 1 mL DNA with0.068 mM of each primer, 1.5 mM MgCl2, 150 mM dNTP, 1 UTaq DNA polymerase (Q-Biogen, Evry, France) and PCRreaction buffer. Amplifications were conducted in a master-cycler (Eppendorf, Hambourg, Germany). ITS amplifica-tion consisted of an initial denaturation of 3 min at 94 C,followed by 35 cycles of 1 min at 94 C, 1 min at 50 C, 1 minat 72 C, and a final extension of 10 min at 72 C.Amplification of tef-1a was carried out with an initialdenaturation of 5 min at 94 C, followed by 40 cycles of30 s at 94 C, 30 s at 52 C, and 80 s at 72 C and a finalextension of 7 min at 72 C. Aliquots of PCR products werechecked by electrophoresis on a 1% agarose gel, revealedwith ethydium bromide and visualized by UV trans-illumination.

ITS and tef-1a PCR products were sequenced by BeckmanCoulters Genomics (Takeley, UK) with primers ITS1-F andITS4 and EF1-645F and EF1-1190R respectively. For eachPCR product sequences from both strands were assembledto produce a consensus sequence with the software SeqMan(DNASTAR Lasergene, GATC Biotech SARL, Marseille,France). The identities of the sequences were determinedwith BLAST analyses from the National Center forBiotechnology Information (NCBI) available online. Foreach DNA region sequences were aligned with Clustal X(Thompson et al. 1997). The multiple sequence alignmentswere carried out with PHYLO-WIN (Galtier et al. 1996)using the Kimura’s two-parameters distance model (Kimura1980) and neighbor joining (Saitou and Nei 1987). Thetopology of the resulting tree was tested by bootstrappingwith 1000 resamplings of the data. Phylogenetic trees weredrawn with the NJPLOT program (Perriere and Gouy1996).

AFLP analyses.—The digestion and ligation of 125 ngextracted DNA were carried out according to the manufac-turer’s specifications of the AFLP Core Reagent kit(Invitrogen) (Vos et al. 1995). The ligation products werepre-amplified by PCR. PCR amplifications were performedin a final volume of 25.5 mL by mixing 2.5 mL DNA with0.3 mM each primer E-0 (GACTGCGTACCAATTC) and M-0(GATGAGTCCTGAGTAA), 212 mM dNTP, 2.5 U Taq DNApolymerase (Q-Biogen, Evry, France) and PCR reactionbuffer. Amplification was conducted in a thermal-cyclerGeneAmp PCR system 9600 (Perkin Elmer Applied Biosys-tems, Foster City, California) with 20 cycles of 30 s at 94 C,1 min at 56 C, and 1 min at 72 C. A 1 : 50 dilution wasperformed with 1.5 mL pre-amplified product diluted in73.5 mL TE buffer. Selective amplification was performed ina final volume of 20 mL by mixing 5 mL DNA with 0.4 mM E-AA 59-IRD800 fluorescent primer (GACTGCGTACCAATT-CAA) (MWG), 0.30 mM M-C primer (GATGAGTCCTGAG-TAAC), 202.5 mM dNTP, 0.5 U Taq DNA polymerase (Q-Biogen) and PCR reaction buffer. PCR was conducted in a

FIERS ET AL.: RHIZOCTONIA SOLANI DIVERSITY 1231

TABLE I. Isolates of Rhizoctonia solani analyzed in this study

Anastomosisgroup Strains

MIAEaccessionnumber a Geographical origin

Host oforigin

(potatocultivar)

ITSsequence

type b

tef-1asequence

type b

Two-locustype

2-1 0722-092 2 B PDA MIAE00269 France Cotesd’Armor

Juliette m1 m1 1

2-1 0629-011 1 WA MIAE00231 France Finistere Rosanna p1 m2 22-1 0680-006 2 Ab WA MIAE00208 France Somme Hybride m2 p1 32-1 0680-006 1 PDA MIAE00262 France Somme Hybride m2 p1 32-1 0680-006 1 WA MIAE00263 France Somme Hybride m2 p1 32-1 0680-006 2 A PDA MIAE00264 France Somme Hybride m2 p1 32-1 0680-006 2 Aa WA MIAE00265 France Somme Hybride m2 p1 32-1 0680-006 2 Bb WA MIAE00266 France Somme Hybride m2 p1 32-1 173-4 MIAE00348 Finland Unknown Nd m12-1 R114 MIAE00349 Finland Unknown Nd p22-1 R25 MIAE00357 Finland Unknown m1 m1 12-1 0799-001 2 N WA MIAE00189 Morocco Unknown p2 p3 42-1 Y25 MIAE00350 United

KingdomUnknown m2 m3 5

3 0602-001 1 B PDA MIAE00072 France Aisne Unknown p3 p4 63 0722-001 1 B PDA MIAE00267 France Cotes

d’ArmorCharlotte m3 m4 7

3 0722-001 2 A PDA MIAE00268 France Cotesd’Armor

Charlotte m4 p5 8

3 0628-006 1 A WA MIAE00150 France Eure-et-Loir Amandine m5 p6 93 0628-006 3 A WA MIAE00152 France Eure-et-Loir Amandine p4 Nd3 0628-006 3 A PDA MIAE00219 France Eure-et-Loir Amandine p4 Nd3 0728-012 PDA MIAE00270 France Eure-et-Loir Amandine p5 p7 103 0728-091 A PDA MIAE00271 France Eure-et-Loir Ditta p3 Nd3 0629-049 2 WA MIAE00006 France Finistere Juliette p6 p8 113 0629-033 2 B WA MIAE00082 France Finistere Juliette m6 m4 123 0629-036 1 A WA MIAE00083 France Finistere Juliette m4 p9 133 0629-038 3 A WA MIAE00087 France Finistere Samba m7 p8 143 0629-039 2 A WA MIAE00090 France Finistere Amandine p7 Nd3 0629-040 2 A WA MIAE00092 France Finistere Samba p8 p8 153 0629-040 2 A PDA MIAE00093 France Finistere Samba p8 p8 153 0629-004 1A WA MIAE00164 France Finistere Spunta m8 p10 163 0629-014 3 WA MIAE00165 France Finistere Cherie p9 p8 173 0629-023 1 A PDA MIAE00170 France Finistere Charlotte m6 p11 183 0629-030 2 PDA MIAE00176 France Finistere Samba m5 Nd3 0629-055 3 WA MIAE00179 France Finistere Pamela p10 p10 193 0629-059 3 PDA MIAE00185 France Finistere Hybride m7 p12 203 0629-004 1 B WA MIAE00222 France Finistere Spunta p4 m5 213 0629-004 3 WA MIAE00224 France Finistere Spunta p9 m5 223 0629-004 4 WA MIAE00225 France Finistere Spunta p10 p13 233 0629-005 1 A PDA MIAE00226 France Finistere Spunta m5 m4 243 0629-005 1 WA MIAE00227 France Finistere Spunta m5 m4 243 0629-005 3 B PDA MIAE00228 France Finistere Spunta p11 p14 253 0629-005 3 WA MIAE00229 France Finistere Spunta p12 p14 263 0629-014 1 WA MIAE00232 France Finistere Cherie m5 p9 273 0629-014 2 WA MIAE00233 France Finistere Cherie p5 p9 283 0629-017 4 WA MIAE00235 France Finistere Charlotte p8 p15 293 0629-021 1 A WA MIAE00236 France Finistere Atlas m4 m4 303 0629-023 1 B WA MIAE00237 France Finistere Charlotte m6 m4 123 0629-023 2 B WA MIAE00238 France Finistere Charlotte m6 m4 123 0629-030 2 A WA MIAE00239 France Finistere Samba m5 p9 273 0629-038 1 A PDA MIAE00240 France Finistere Samba p4 m5 21

1232 MYCOLOGIA

TABLE I. Continued

Anastomosisgroup Strains

MIAEaccessionnumber a Geographical origin

Host oforigin

(potatocultivar)

ITSsequence

type b

tef-1asequence

type b

Two-locustype

3 0629-038 1 WA MIAE00241 France Finistere Samba p4 m5 213 0629-038 3 A PDA MIAE00242 France Finistere Samba m7 p16 313 0629-038 3 B WA MIAE00243 France Finistere Samba m7 p9 143 0629-049 1 A PDA MIAE00248 France Finistere Juliette p13 p17 323 0629-049 1 Ba PDA MIAE00249 France Finistere Juliette m5 p18 333 0629-051 1 A WA MIAE00250 France Finistere Marine p8 p19 343 0629-055 2 PDA MIAE00251 France Finistere Pamela m5 p13 353 0629-055 2 WA MIAE00252 France Finistere Pamela m5 p13 353 0629-059 2 B PDA MIAE00253 France Finistere Hybride m5 p20 363 0729-015 PDA MIAE00272 France Finistere Urgenta m9 m4 373 0729-032 C PDA MIAE00273 France Finistere Bintje m8 Nd3 0729-093 1 PDA MIAE00274 France Finistere Nicola p13 p8 383 0729-093 2 PDA MIAE00275 France Finistere Nicola p14 p8 393 0745-001 1 B PDA MIAE00276 France Loiret Bintje p15 Nd3 0745-001 2 A PDA MIAE00277 France Loiret Bintje p16 m4 403 0656-003 2 WA MIAE00255 France Morbihan Kennebec p17 p21 413 0656-004 1 A WA MIAE00256 France Morbihan Spunta p8 p22 423 0656-004 2 B WA MIAE00257 France Morbihan Spunta m5 Nd3 0656-004 2 PDA MIAE00258 France Morbihan Spunta p8 p23 433 0656-006 2 N A WA MIAE00259 France Morbihan Charlotte m4 p9 443 0656-006 2 O PDA MIAE00260 France Morbihan Charlotte m4 p9 443 0656-006 2 O WA MIAE00261 France Morbihan Charlotte m4 p24 453 0756-091 A PDA MIAE00280 France Morbihan Nicola p18 Nd3 0762-002 3 PDA MIAE00281 France Pas-de-

CalaisHermes m5 p25 46

3 R11 MIAE00356 Finland Unknown p19 m5 473 R98 MIAE00359 Finland Unknown p20 Nd3 CBS 363.82 MIAE00352 Germany Unknown p7 p8 483 i1 MIAE00351 Japan Unknown p21 m6 493 0799-001 2 N PDA MIAE00217 Morocco Unknown p7 p8 483 0799-001 3 N A

PDAMIAE00283 Morocco Unknown Nd p8

3 0799-001 3 N WA MIAE00284 Morocco Unknown p22 p24 503 CBS 163.83 MIAE00374 The

NetherlandsUnknown p9 p8 51

3 P1 MIAE00354 Poland Unknown m9 m7 523 P2 MIAE00355 Poland Unknown m9 m7 523 S1 1 MIAE00361 Switzerland Bellini m4 Nd3 S1 2 MIAE00362 Switzerland Bellini m4 Nd3 S1 3 MIAE00363 Switzerland Bellini m4 m5 533 S2 1 MIAE00364 Switzerland Magnum p23 Nd3 S2 2 MIAE00365 Switzerland Magnum Nd p83 S3 2 MIAE00366 Switzerland Charlotte p24 Nd3 S3 3 MIAE00367 Switzerland Charlotte p25 p26 543 S4 1 MIAE00368 Switzerland Gourmandine m4 p8 443 S5 1 MIAE00369 Switzerland Hybride p26 p27 553 S5 2 MIAE00370 Switzerland Hybride p3 Nd3 S6 2 MIAE00371 Switzerland Ludmilla p27 Nd3 S7 2 MIAE00372 Switzerland Naviga p28 m5 563 CBS 117241 MIAE00373 Spain Unknown p12 p8 383 HA MIAE00353 United

KingdomUnknown m4 p8 44

FIERS ET AL.: RHIZOCTONIA SOLANI DIVERSITY 1233

thermal-cycler GeneAmp PCR system 9600 with a first cycleof 30 s at 94 C, 30 s at 65 C, and 1 min at 72 C. The 12following cycles were performed by reducing the annealingtemperature by 0.7 C at each cycle. Then 23 cycles wereperformed (30 s at 94 C, 30 s at 56 C and 1 min at 72 C).Aliquots of PCR products were checked by electrophoresison a 1% agarose gel, revealed with ethydium bromide andvisualized by UV transillumination. Separation of theamplified fragments was performed on a 41 cm polyacryl-amide gel (Li-Cor, Germany) with 6.5% acrylamide KB (Li-Cor), for 10 h 30 min at 1500 V for resolution of fragments50–700 bp. A size standard (50–700 bp sizing standard, Li-Cor) and a reference strain for which the profile is knownwere added to each gel in at least five wells. Each gel wasphotographed. For each strain the analysis was performedin duplicate from independent DNA extracts.

Li-Cor gel pictures were analyzed with ONE-Dscansoftware (Scanalytics BD Biosciences-Bioimaging 2.05),measuring the 115 most intense bands, 100–500 bp, foreach profile. Categories grouping fragments, whose lengthsdiffered by less than 1.5 bp, were created with LisAFLPprogram (Mougel et al. 2002). The LecPCR application(ADE-4 2001, Thioulouse et al. 1997) was applied to thedata to transform the fragment weights matrix into a binarymatrix. The binary matrix indicated the absence (0) orpresence (1) of each fragment for each profile. Finally onlyfragments present in the two repeats performed for eachstrain were included in the analysis. Genetic relationshipsbetween each profile were estimated with the Nei and Lisimilarity index (Nei and Li 1979), and bootstrap valuescorresponding to the appearance frequency of branches in1000 data permutations were calculated with Treeconsoftware (Vandepeer and Dewachter 1994 1.3b). Thesimilarity matrix was represented by a dendrogram withthe UPGMA (unweighted pair grouping method witharithmetic mean) algorithm (Sneath and Sokal 1973).

RESULTS

ITS and tef-1a sequences analysis.—PCR amplificationof the ITS region with primers ITS1-F and ITS4 gave asingle product of approximately 700 bp for eachisolate. The ITS1, 5.8S and the ITS2 regions weresequenced for 100 isolates (TABLE I, GenBank acces-sion numbers HQ898669–HQ898768). For all isolatesBLAST queries allowed the determination of thecorresponding AG on the basis of 99–100% similaritywith corresponding sequences. Among the 73 Frenchisolates 60 were identified as R. solani AG 3 PT, theremaining were AG 2-1 (eight isolates) and AG 5 (fiveisolates). A total of 64 variable sites were identified inITS1 but only 24 variable sites in ITS2. Variable sitesrefer to those where several different nucleotideswere observed among the 73 sequences of collectedisolates. Among the large number of AG 3 PT isolatesanalyzed, 10 and three polymorphic sites wereobserved respectively in ITS1 and ITS2 (FIG. 1).Heterogeneity within individual isolates was observedin 48 out of the 100 ITS sequences analyzed in thisstudy. This heterogeneity corresponded to twooverlapping peaks at some positions in the electro-phoregram, indicating that multiple ITS types mightexist within individual isolates. Among the AG 3 PTsequences this heterogeneity within individual iso-lates was observed at all the 13 polymorphic sitesidentified within the AG. Conversely only twopolymorphic sites were within AG 2-1 sequences andfour polymorphic sites within AG 5 sequences.However the number of sequences also was lowerwith 11 and six isolates from AG 2-1 and AG 5respectively.

TABLE I. Continued

Anastomosisgroup Strains

MIAEaccessionnumber a Geographical origin

Host oforigin

(potatocultivar)

ITSsequence

type b

tef-1asequence

type b

Two-locustype

3 Rs08 MIAE00360 UnitedKingdom

Unknown m6 Nd

5 0628-023 1 B PDA MIAE00159 France Eure-et-Loir Cherie m10 p28 575 0628-023 1 B WA MIAE00213 France Eure-et-Loir Cherie m10 p28 575 0628-023 1A PDA MIAE00221 France Eure-et-Loir Cherie m10 p28 575 0747-001 1 A PDA MIAE00278 France Lot-et-

GaronneHybride p29 Nd

5 0747-002 2 A PDA MIAE00279 France Lot-et-Garonne

Samba m10 p29 58

5 R96 MIAE00375 Finland Unknown m10 p28 57

a Collection MIAE, Microorganisms of Interest for Agriculture and Environment (INRA Dijon, France; http://www2.dijon.inra.fr/umrmse/).

b m and p followed by a number designate the different monomorphic and polymorphic sequence types, respectively. Ndindicates not determined.

1234 MYCOLOGIA

FIG. 1. Sequence alignment of part of the ITS1 (a) and ITS2 (b) regions among isolates of Rhizoctonia solani collectedfrom potatoes. Y indicates C and T, W indicates A and T, M indicates A and C and R indicates A and G. Polymorphic basesindicated in gray are common to those found by Justesen et al. (2003) in the ITS1 region.

FIERS ET AL.: RHIZOCTONIA SOLANI DIVERSITY 1235

FIG. 1. Continued.

1236 MYCOLOGIA

Each sequence was assigned to a type number, m1–m10, for the 10 monomorphic sequences observedand p1–p29 for the 29 sequences with polymorphicsites, coded as m and p followed by a numberdesignating the different monomorphic and poly-morphic sequence types respectively (FIG. 1). Com-parisons of all sequences allowed identifying 39 ITStypes. Four types were identified within AG 2-1 (m1,m2, p1, p2), 33 within AG 3 PT (m3–m9 and p3–p28)and two within AG 5 (m10, p29) (TABLE I).

The 52 sequences without any polymorphic siteswere compared in a phylogenetic tree (FIG. 2). Thethree AGs were genetically different because theyappeared on three distinct branches of the tree withsignificant bootstrap values above 99%. Isolatesbelonging to AG 5 were more similar to isolates fromAG 2-1 than to isolates from AG 3 PT (FIG. 2). Thetree of ITS sequences showed seven ITS types amongAG 3 PT. Type m3 comprised one isolate(MIAE00267) from France (Cotes d’Armor) andisolated from cultivar Charlotte. Type m5 included12 isolates from France (Finistere, Eure-et-Loir, Pas-

de-Calais) isolated from cultivars Spunta, Samba,Pamela, Cherie, Amandine, Hermes and Juliette.ITS type m4 comprised 11 isolates from France(Finistere, Morbihan, Cotes d’Armor), Switzerlandand the United Kingdom, isolated from cultivarsCharlotte, Juliette, Atlas, Gourmandine; Bellini. Typem7 included four isolates, all from France (Finistere),isolated from cultivar Samba or a hybrid. ITS typesm6, m8 and m9 were grouped in the same branch,distantly related to the other types in AG 3 PT. Typem6 comprised five isolates from France (Finistere)and the United Kingdom, isolated from cultivarsCharlotte and Juliette. Type m8 comprised twoisolates from France (Finistere), isolated from culti-vars Spunta and Bintje. Type m9 comprised threeisolates from Poland and France (Finistere), isolatedfrom Urgenta and unknown cultivars.

Two ITS types were observed among AG 2-1. Typem2 included seven isolates from France (Somme) andthe United Kingdom. They were isolated from ahybrid cultivar and an unknown cultivar. Type m1included two isolates from Finland and France (Cotes

FIG. 2. Neighbor joining tree (Kimura two-parameter distance) of 52 monomorphic ITS sequences of Rhizoctonia solaniisolated from potato tubers. Bootstrap values ($ 60%) are near the equivalent branches.

FIERS ET AL.: RHIZOCTONIA SOLANI DIVERSITY 1237

d’Armor) and were isolated from an unknowncultivar and cultivar Juliette. Finally, monomorphicisolates from AG 5 were grouped in only one ITS type(m10). They were five isolates from France (Eure-et-Loir, Lot-et-Garonne) and Finland, isolated fromcultivars Cherie, Samba, a hybrid and an unknowncultivar.

The PCR amplification of the tef-1a gene with theprimers EF1-645F and EF1-1190R gave a single productof approximately 400 bp. The tef-1a gene wassequenced for 86 isolates (TABLE I, GenBank accessionnumbers HQ898769–HQ898854). In BLAST queriesidentification of R. solani AG through tef-1a sequenceconfirmed the identification of AG made through ITSsequence, with a similarity of 93–100%. Among the 86sequenced isolates 13 belonged to AG 2-1, 68 to AG 3PT and five to AG 5.

A total of 60 variable sites were identified among tef-1a sequences (FIG. 3). Among the 68 sequences of AG3 PT 20 variable sites were identified. Among AG 2-1and AG 5 isolates 42 and eight variable sites wereobserved respectively. As in the ITS sequences someheterogeneity within individual isolates was observedfor 62 isolates out of the 86, such as polymorphic sitesthat revealed polymorphism within the tef-1a gene inthe same individual. This heterogeneity was observedat 17, seven and five variable sites observed respec-tively within AG 3 PT, AG 2-1 and AG 5 sequences(FIG. 3). According to the variations in the tef-1asequences, 36 different elongation factor types wereidentified: six within AG 2-1 (m1–m3 and p1–p3), 28within AG 3 PT (m4–m7 and p4–p27) and two withinAG 5 (p28, p29) (TABLE I).

A phylogenetic tree was inferred on the basis of the24 tef-1a sequences without any polymorphic sites,together with one sequence of AG 5 (MIAE00279)including only one polymorphic site. Indeed all thesequences of R. solani AG 5 analyzed had at least onepolymorphic site (FIG. 3). The phylogenetic treeshowed four different elongation factor types withinAG 3 PT (FIG. 4). Type m6 comprised one isolate(MIAE00351) from Japan; type m5 comprised sevenisolates from France (Finistere), Switzerland andFinland, isolated from cultivar Spunta, Samba, Navigaand Bellini. Type m4 comprised nine isolates fromthree departments of France (Cotes d’Armor, Finis-tere and Loiret), isolated from cultivars Atlas, Bintje,Charlotte, Juliette, Spunta and Urgenta. Finally, m7included two isolates from Poland, isolated fromunknown cultivars. All the strains belonging to m7 intef-1a analysis corresponded to m9 in ITS analysis;both being distantly related to other AG 3 PTsequences (FIGS. 2, 4). Among AG 2-1 sequencesthree elongation factor types, m1, m2 and m3, wereidentified.

Combined data from ITS sequences and tef-1asequences revealed a total of 58 two-locus sequencetypes among the 82 isolates for which both loci wereanalyzed (TABLE I). Among the 58 types, only ninetwo-locus sequence types were monomorphic for bothloci.

AFLP analysis.—Eighty-nine isolates were analyzed.The number of bands analyzed (100–500 bp) was 60–102 per profile, with an average of 78 bands, for atotal of 254 useful markers. The phylogenetic tree ofAFLP profiles showed three groups supported bysignificant bootstrap values above 96%, correspond-ing to the three AGs (FIG. 5). Regarding AFLPprofiles, the AG 5 isolates were more closely relatedto the AG 3 PT isolates than to the AG 2-1 isolates, asit was shown on the tree of tef-1a sequences. Asignificant diversity was observed within each AG withso many AFLP profiles as isolates, but no particularclusters could be identified within AGs. Among AG 3PT isolates, the French isolates were spread across thetree. At a smaller scale isolates originating from thesame French department (Finistere) also were foundall along the tree, showing no direct relation of thediversity observed with the geographic origin.

DISCUSSION

In this study 104 isolates of R. solani, all sampled fromblemished potato tubers, were characterized bysequencing of the ITS region and part of the tef-1agene and by AFLP fingerprinting. The 73 Frenchisolates were representative of all areas producingpotatoes in France; they were compared with 31isolates from other countries. AG 3 PT was found tobe predominant, including 82% of the Frenchisolates. The remaining isolates belonged to AG 2-1and AG 5. R. solani isolates belonging to AG 3 areisolated frequently from potato tubers and are knownto be pathogens for this crop (Kuninaga et al. 2000),but AG 2-1 and AG 5 are more rarely isolated fromblemished tubers and their pathogenicity still has notbeen demonstrated (Campion et al. 2003, Fiers et al.2010, Woodhall et al. 2008).

Several distinct sequence types of the ITS regionand of the tef-1a gene were identified among the R.solani isolates and surprisingly in the majority ofindividual isolates the coexistence of multiple typeswas observed. Polymorphism in the ITS region and tef-1a gene within individual isolates can be due to theexistence of different ribosomal DNA units within thesame nucleus or different sequences in differentnuclei. The coexistence of multiple sequence typeswithin individual isolates was confirmed by cloningand sequencing of several clones (Justesen et al.

1238 MYCOLOGIA

2003). This heterogeneity results from mutations thatwould be maintained from generation to generationand become fixed. Several ITS sequence types withinthe same individual also were identified for otherfungi, such as Sclerotium rolfsii (Almeida et al. 2001),

Ascochyta spp. (Fatehi and Bridge 1998) and Botrytisspp. (Yohalem et al. 2003). Among R. solanipopulations ITS polymorphism was studied withinAG 2-1 and AG 3 (Justesen et al. 2003, Pannecoucqueand Hofte 2009). The same 10 within-isolate poly-

FIG. 3. Sequence alignment of part of the tef-1a gene among isolates of Rhizoctonia solani collected from potatoes. Yindicates C and T, W indicates A and T, M indicates A and C and R indicates A and G.

FIERS ET AL.: RHIZOCTONIA SOLANI DIVERSITY 1239

morphic sites identified by Justesen et al. (2003)among ITS1 sequences of R. solani AG 3 also weredetected in our study in addition to others sites. Thefinding of two different ITS types or elongation factortypes within the same isolate and the possibleassociation with two nuclear types is consistent withthe heterokaryotic nature of R. solani, which has beenconfirmed by other DNA marker methods thatrevealed heterozygosity in individual isolates of R.solani AG 3 (Ceresini et al. 2007).

Both loci, the ITS region and tef-1a gene, showed aconsiderable amount of sequence variability amongR. solani sequences. Concerning the ITS region, wefound that ITS1 sequences were much more variablethan ITS2 sequences, with 24% and 11% of variablesites in the whole ITS1 and ITS2 regions respectively.Our results agree with the ITS variability described byNilsson et al. (2008) among R. solani. The secondlocus used, tef-1a gene, was found to be even morepolymorphic, with 26% of variable sites among allthree detected AGs of R. solani, and 9% of variablesites among AG 3 PT isolates. However this variabilitycould not be illustrated in trees because dimorphicsites were excluded from the phylogenetic analysis.

The groupings of isolates varied according to thelocus that was sequenced (FIGS. 2, 4); however in bothITS and tef-1a trees the AG 3 PT branch that divergedfrom other AG 3 PT sequences corresponded to thesame isolates MIAE00354 and MIAE00355. Isolates

MIAE00269 and MIAE00357 also were grouped in thesame branch in both ITS and tef-1a trees.

The analysis of ITS sequences is a widely usedmethod for specific identification of fungal species(Anees et al. 2010, Geiser et al. 2004). Our resultsindicated that the gene tef-1a showed a greaterdiversity among AGs of R. solani than the ITS region.This shows the complementarity of sequences fromtwo or more loci in multilocus sequence typing(MLST) approaches. Such MLST strategy is becomingwidely used to analyze phylogenetic relationshipsamong fungi such as Fusarium (Nitschke et al. 2009,O’Donnell et al. 2009) or Trichoderma (Anees et al.2010, Kullnig-Gradinger et al. 2002). These haveshown the interest of including tef-1a gene in suchstudies; however the use of this gene to analyzegenetic diversity within R. solani has not beenpublished and only 33 sequences of tef-1a gene ofR. solani were available in GenBank before this study.We used primers EF1-645F and EF1-1190R originallydescribed for Alternaria spp. (Andersen et al. 2009).We adapted PCR conditions to amplify part of the tef-1a gene from R. solani. Multigene approaches may beuseful for more precise molecular identifications ofspecies or AGs, when a unique locus such as ITS doesnot always provide clear information (Anees et al.2010).

ITS and tef-1a types did not show any relationshipwith the geographical origin of the isolates or thecultivar of origin. Moreover AFLP data did not showparticular structure among the isolates belonging tothe same AG. R. solani populations are consistentwith predominantly asexual reproduction, shortdistance dispersal of vegetative propagules (myceli-um or sclerotia) and long distance dispersal,possibly via contaminated seed. Our findings suggestthe hypothesis that R. solani populations areconstantly evolving after different genetic events.The absence of sporulation of R. solani may limitthe dissemination of clonal isolates and may preventthe genetic organization of the populations. On theother hand, the diversity of the R. solani popula-tions could be enriched by the spread of the fungalgenes taking place within the field and at largerscale, among French departments and amongcountries separated by several hundred kilometers.As tubers are exchanged on the internationalmarket, seedborne inoculum could be the predom-inant cause of the long distance dispersal of thefungus. Indeed, potato tubers are vegetativelymultiplied, which increases the risk of fungaltransmission through infected seed tubers. There-fore these newly introduced genomes increase thediversity of the population by bringing in andexchanging genes with the endemic isolates.

FIG. 3. Continued.

1240 MYCOLOGIA

Despite the large diversity at intraspecific rankwithin R. solani, no evident relationship betweencultivars and associated populations of R. solani wasshown. Because there is no difference of pathogenic-ity among isolates of R. solani (Fiers et al. 2010) itseems that the severity of the disease depends mainlyon environmental conditions and perhaps on thebehavior of the cultivar. This aspect of the plant-pathogen interaction was not studied in depth.

Our study reveals the first evidence of geneticvariability among R. solani associated with blemishedpotato tubers in France. However the genetic diversityof R. solani populations isolated from blemishedtubers is not dependent on the geographical origin ofthe isolates or on the host cultivar. The lack ofpopulation structure suggests a constant evolutionwithin R. solani. Such evolution should be promoted

by frequent genetic events, genetic mixing andanthropogenic activities. Further research is neededto determine the phenotypical characteristics of theisolates to set up adapted control strategies against R.solani.

ACKNOWLEDGMENTS

The authors thank Jozefa Kapsa, Brice Dupuis, Jean-MarieTorche, James Woodhall, Jari Valkonen, and Shiro Kuni-naga for providing R. solani isolates. We also thank AmandaBennett for comments on the manuscript. Marie Fiers wasfinancially supported by a doctoral grant from the NationalAssociation of Technical Research (ANRT) (CIFRE nu1085/2006).

This work was part of a Program of CollaborativeResearch (PRC) between Bretagne Plants and Germicopa,subsidized by the Regional Council of Brittany.

FIG. 4. Neighbor joining tree (Kimura two-parameter distance) of 23 tef-1a sequences of Rhizoctonia solani isolated frompotato tubers from France and other countries. Strain MIAE00279 belonging to AG 5 includes one polymorphic site. Bootstrapvalues ($ 60%) are near the equivalent branches.

FIERS ET AL.: RHIZOCTONIA SOLANI DIVERSITY 1241

FIG. 5. Phylogenetic relationships among 89 isolates of Rhizoctonia solani inferred from AFLP data with a UPGMA analysisof Nei-Li distances. Bootstrap values ($ 50%) are above the equivalent branches.

1242 MYCOLOGIA

LITERATURE CITED

Almeida AMR, Abdelnoor RV, Calvo ES, Tessnman D,Yorinori JT. 2001. Genotypic diversity among Brazilianisolates of Sclerotium rolfsii. J Phytopathol Z 149:493–502, doi:10.1046/j.1439-0434.2001.00651.x

Andersen B, Sorensen JL, Nielsen KF, van den Ende BG, deHoog S. 2009. A polyphasic approach to the taxonomyof the Alternaria infectoria species group. Fungal GenetBiol 46:642–656, doi:10.1016/j.fgb.2009.05.005

Anees M, Tronsmo A, Edel-Hermann V, Gordon Hjeljord L,Heraud C, Steinberg C. 2010. Characterization of fieldisolates of Trichoderma antagonistic against Rhizoctoniasolani. Fungal Biol 114:691–701, doi:10.1016/j.funbio.2010.05.007

Campion C, Chatot C, Perraton B, Andrivon D. 2003.Anastomosis groups, pathogenicity and sensitivity tofungicides of Rhizoctonia solani isolates collected onpotato crops in France. Eur J Plant Pathol 109:983–992,doi:10.1023/B:EJPP.0000003829.83671.8f

Carling DE. 1996. Grouping in Rhizoctonia solani by hyphalanastomosis reaction. In: Sneh B, Jabaji-Hare S, NeateS, Dijst G, eds. Rhizoctonia species: taxonomy, molec-ular biology, ecology, pathology and disease control.Dordrecht, the Netherlands: Kluwer Academic Publish-ers. p 37–47.

———, Baird RE, Gitaitis RD, Brainard KA, Kuninaga S.2002. Characterization of AG-13, a newly reportedanastomosis group of Rhizoctonia solani. Phytopathol-ogy 92:893–899, doi:10.1094/PHYTO.2002.92.8.893

Ceresini PC, Shew HD, James TY, Vilgalys RJ, Cubeta MA.2007. Phylogeography of the Solanaceae-infectingBasidiomycota fungus Rhizoctonia solani AG-3 basedon sequence analysis of two nuclear DNA loci. BmcEvol Biol 7:163, doi:10.1186/1471-2148-7-163

El Bakali AM, Martin MP. 2006. Black scurf of potato.Mycologist 20:130–132, doi:10.1016/j.mycol.2006.03.006

Fatehi J, Bridge P. 1998. Detection of multiple rRNA-ITSregions in isolates of Ascochyta. Mycol Res 102:762–766, doi:10.1017/S0953756297005704

Fiers M, Chatot C, Edel-Hermann V, Le Hingrat Y, YanougoAK, Gautheron N, Guillery E, Alabouvette C, SteinbergC. 2010. Diversity of microorganisms associated withatypical superficial blemishes of potato tubers andpathogenicity assessment. Eur J Plant Pathol 128:353–371, doi:10.1007/s10658-010-9657-2

Galtier N, Gouy M, Gautier C. 1996. SEAVIEW andPHYLO_WIN: two graphic tools for sequence align-ment and molecular phylogeny. Comput Appl Biosci12:543–548.

Gardes M, Bruns TD. 1993. ITS primers with enhancedspecificity for Basidiomycetes—application to the iden-tification of mycorrhizae and rusts. Mol Ecol 2:113–118,doi:10.1111/j.1365-294X.1993.tb00005.x

Geiser DM, Jimenez-Gasco MD, Kang SC, Makalowska I,Veeraraghavan N, Ward TJ, Zhang N, Kuldau GA,O’Donnell K. 2004. FUSARIUM-ID v. 1.0: a DNAsequence database for identifying Fusarium. Eur JPlant Pathol 110:473–479, doi:10.1023/B:EJPP.0000032386.75915.a0

Guillemaut C, Edel-Hermann V, Camporota P, AlabouvetteC, Richard-Molard M, Steinberg C. 2003. Typing ofanastomosis groups of Rhizoctonia solani by restrictionanalysis of ribosomal DNA. Can J Microbiol 49:556–568,doi:10.1139/w03-066

Justesen AF, Yohalem D, Bay A, Nicolaisen M. 2003. Geneticdiversity in potato field populations of Thanatephoruscucumeris AG-3, revealed by ITS polymorphism andRAPD markers. Mycol Res 107:1323–1331, doi:10.1017/S0953756203008517

Kimura M. 1980. A simple model for estimating evolution-ary rates of base substitutions through comparativestudies of nucleotide sequences. J Mol Evol 16:111–120,doi:10.1007/BF01731581

Kullnig-Gradinger CM, Szakacs G, Kubicek CP. 2002. Phylog-eny and evolution of the genus Trichoderma: a multi-gene approach. Mycol Res 106:757–767, doi:10.1017/S0953756202006172

Kuninaga S, Carling DE, Takeuchi T, Yokosawa R. 2000.Comparison of rDNA-ITS sequences between potatoand tobacco strains in Rhizoctonia solani AG-3. J GenPlant Pathol 66:2–11, doi:10.1007/PL00012917

———, Yokosawa R. 1984. DNA base sequence homology inRhizoctonia solani Kuhn IV. Genet Ann PhytopatholSoc Japan 50:322–330.

Lehtonen MJ, Ahvenniemi P, Wilson PS, German-KinnariM, Valkonen JPT. 2008. Biological diversity of Rhizoc-tonia solani (AG-3) in a northern potato-cultivationenvironment in Finland. Plant Pathol 57:141–151.

McDonald BA. 1997. The population genetics of fungi: toolsand techniques. Phytopathology 87:448–453, doi:10.1094/PHYTO.1997.87.4.448

Mougel C, Thioulouse J, Perriere G, Nesme X. 2002. Amathematical method for determining genome diver-gence and species delineation using AFLP. Int J SystEvol Microbiol 52:573–586.

Nei M, Li WH. 1979. Mathematical model for studyinggenetic variation in terms of restriction endonucleases.Proc Natl Acad Sci USA 76:5269–5273, doi:10.1073/pnas.76.10.5269

Nilsson RH, Kristiansson E, Ryberg M, Hallenberg N,Larsson KH. 2008. Intraspecific ITS variability in thekingdom Fungi as expressed in the internationalsequence databases and its implications for molecularspecies identification. Evol Bioinform 4:193–201.

Nitschke E, Nihlgard M, Varrelmann M. 2009. Differentia-tion of Eleven Fusarium spp. isolated from sugar beet,using restriction fragment analysis of a polymerasechain reaction-amplified translation elongation factor 1alpha gene fragment. Phytopathology 99:921–929,doi:10.1094/PHYTO-99-8-0921

O’Donnell K, Gueidan C, Sink S, Johnston PR, Crous PW,Glenn A, Riley R, Zitomer NC, Colyer P, Waalwijk C,van der Lee T, Moretti A, Kang S, Kim HS, Geiser DM,Juba JH, Baayen RP, Cromey MG, Bithell S, Sutton DA,Skovgaard K, Ploetz R, Kistler HC, Elliott M, Davis M,Sarver BAJ. 2009. A two-locus DNA sequence databasefor typing plant and human pathogens within theFusarium oxysporum species complex. Fungal GenetBiol 46:936–948, doi:10.1016/j.fgb.2009.08.006

FIERS ET AL.: RHIZOCTONIA SOLANI DIVERSITY 1243

Ogoshi A. 1987. Ecology and pathogenicity of anastomosisand intraspecific groups of Rhizoctonia-Solani Kuhn.Annu Rev Phytopathol 25:125–143, doi:10.1146/annurev.py.25.090187.001013

Pannecoucque J, Hofte M. 2009. Detection of rDNA ITSpolymorphism in Rhizoctonia solani AG 2-1 isolates.Mycologia 101:26–33, doi:10.3852/08-084

Parmeter JRJ. 1970. Rhizoctonia solani: biology and pathol-ogy. Berkeley: Univ California Press. 255 p.

Perriere G, Gouy M. 1996. www-Query: an online retrievalsystem for biological sequence banks. Biochimie 78:364–369, doi:10.1016/0300-9084(96)84768-7

Saitou N, Nei M. 1987. The neighbor joining method: a newmethod for reconstructing phylogenetic trees. Mol BiolEvol 4:406–425.

Sharon M, Kuninaga S, Hyakumachi M, Naito S, Sneh B.2008. Classification of Rhizoctonia spp. using rDNA-ITSsequence analysis supports the genetic basis of theclassical anastomosis grouping. Mycoscience 49:93–114,doi:10.1007/s10267-007-0394-0

Sneath PHA, Sokal RR. 1973. Numerical taxonomy. Theprinciples and practice of numerical classification (Aseries of books in biology). San Francisco: W.H. Freeman& Co. xv + 573 p.

Thioulouse J, Chessel D, Doledec S, Olivier JM. 1997. ADE-4: amultivariate analysis and graphical display software.Stat Comput 7:75–83, doi:10.1023/A:1018513530268

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F,

Higgins DG. 1997. The Clustal_X windows interface:flexible strategies for multiple sequence alignmentaided by quality analysis tools. Nucleic Acids Res 25:4876–4882, doi:10.1093/nar/25.24.4876

Vandepeer Y, Dewachter R. 1994. Treecon for Windows —asoftware package for the construction and drawing ofevolutionary trees for the Microsoft Windows environ-ment. Comput Appl Biosci 10:569–570.

Vos P, Hogers R, Bleeker M, Reijans M, Vandelee T, HornesM, Frijters A, Pot J, Peleman J, Kuiper M, Zabeau M.1995. AFLP—a new technique for DNA-fingerprinting.Nucleic Acids Res 23:4407–4414, doi:10.1093/nar/23.21.4407

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification anddirect sequencing of fungal ribosomal RNA genes forphylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ,White TJ, eds. PCR protocols: a guide to methods andapplications. San Diego: Academic Press. p 315–322.

Woodhall JW. 2008. Infection of potato by Rhizoctoniasolani: effect of anastomosis group. Plant Pathol 57:897–905, doi:10.1111/j.1365-3059.2008.01889.x

———, Lees AK, Edwards SG, Jenkinson P. 2007. Charac-terization of Rhizoctonia solani from potato in GreatBritain. Plant Pathol 56:286–295, doi:10.1111/j.1365-3059.2006.01545.x

Yohalem DS, Nielsen K, Nicolaisen M. 2003. Taxonomicand nomenclatural clarification of the onion neck-rotting Botrytis species. Mycotaxon 85:175–182.

1244 MYCOLOGIA