Genetic diversity lecture notes

Genetic Diversity

Prepared by: Karyl Marie Fabricante-Dagoc

What should we study?

• Levels of genetic variety

• Population structure

• Importance of Genetic diversity

• Causes and Impacts of genetic loss

• Current genetic technologies

What is Genetic diversity?

Variation of all living forms at the genetic level: genes, alleles, or nucleic acids

What is a gene?

A gene is a stretch of DNA whose sequence determines the

structure and function of a specific functional molecule

(usually a protein)

DNA

Protein

…GAATTCTAATCTCCCTCTCAA

CCCTACAGTCACCCATTTGGTA

TATTAAAGATGTGTTGTCTACT

GTCTAGTATCC…

Computer program

Specific function

…function

sf(){document.f.q

.focus()}…

Working copymRNA

DNA

(deoxyribonucleic acid)

mR

NA

Protein

How is Genetic diversity measured?

• Examining variation in phenotype

• Molecular sequencing of DNA

“Molcular/genetic techniques have been commonly available for only about 20 years, little information is available for most

species”

Two types of genetic variation:

• Within population – intrapopulational

- measured as amount of variation within ecologically and reproductively

interacting individuals (mountainside, island etc)

- within members of a species in the same area

• Between populations – interpopulational- comparing two or more populations of a species

- geographic variation

“Genetic variation in an entire species is the sum of variation within and variation between all populations that make up the species”

Evolutionary Processes

• Natural Selection

• Gene Flow

• Genetic Drift

Natural Selection

• A major mechanism of evolution as proposed by Darwin

• A filter for genetic variation: the best adapted individuals

survive and reproduce in greater numbers over time

• Not a directed process!

• Changes in direction and intensity depend on conditions and

time span

Gene Flow

• The exchange of genetic material within a population, between populations of

a species, and even between species

• Gene flow among populations of a species maintains the integrity of the

species

• Lack of gene flow can lead to speciation

What gives rise to diversity?

• Mutations – any alteration of a gene• Creates variation within a gene pool

• Acted upon by natural selection

• Neutral mutations – do not affect an organism’s fitness

• DNA repair mechanisms mend changes before becoming permanent mutations

What gives rise to diversity?

• Recombination – DNA strands exchanged

•

What gives rise to diversity?

• Genetic technologies / engineering

“creation of new and improved varieties through insertion of new genes increases

diversity”

Importance of Diversity

Assures possible adaptations to environmental changes and potential survival of species!

At least some individuals have a better chance to inherit

genetic characteristics that are vital for their survival

Dr. Richard Lankau, “Diversity within a species is

necessary to maintain diversity among species.

If any one type is removed from the system, the

cycle can break down, and the community

becomes dominated by a single species

(National Science Foundation, 2007)

Survival

of a

species

Genetic diversity plays a huge

role in survival and adaptability of

a species.

When a species’s environment

changes, slight gene variations

are necessary for it to adapt and

survive.

A species that has a large degree

of genetic diversity among its

population will have more

variations from which to choose

the most fit alleles.

Species that have very little

genetic variation are at a great

risk.

With very little gene variation

within the species, healthy

reproduction becomes

increasingly difficult.

Source of genes

Wild animals and

plants are sources of

genes for

hybridization and

genetic engineering

Source of genes

The loss of genetic diversity is difficult to see or measure.

In contrast, the reduction and extinction of populations is far

easier to see.

Extinction is not only the loss of whole species, but is also

preceded by a loss of genetic diversity within the species.

This loss reduces the species ability to perform its inherent

role in the whole ecosystem.

Furthermore, the loss of genetic diversity within a species can

result in the loss of useful and desirable traits (e.g.

resistance to parasites).

Reduced diversity may eliminate options to use untapped

resources for food production, industry and medicine.

Wild animals and

plants are sources of

genes for

hybridization and

genetic engineering

Loss of Diversity

While some individuals might be able to tolerate an increased load of pollutants in their environment, others, carrying different genes, might suffer from infertility or even die

under the exact same environmental conditions.

Whilst the former will continue to live in the environment the latter will either have to leave it or die.

This process is called natural selection and it leads to the loss of genetic diversity in certain habitats. However, the

individuals that are no longer present might have carried genes for faster growth or for the ability to cope better with

other stress factors.

Loss of Diversity• Monoculture, monocropping

Did you know that more than 7 000 varieties of

tomatoes existed in 1900 ?

Today, the European Union counts approximately 150

when 70 varieties are marketed but only 2 or 3 are found

on stall, a manner of standardizing our food to the

detriment of biodiversity.

The principal cause is the expansion of the commercial

agriculture which encourages monoculture. The new

varieties often used by commercial agriculture replaced

the traditional agricultural varieties and led to their

disappearance.

Up to 90 percent of the varieties of cabbage, corn and of

tomato, for example, disappeared relatively recently and

with them we lost essential knowledge on the production

of various varieties and races and on the soils where they

were growing.

Loss of Diversity

• Habitat degradation

- direct loss of diversity

Any change in the environment - natural or human induced

causes a selection of events that only the fittest survive.

Loss of Diversity

• Habitat degradation

- increases risk of inbreeding

Habitat fragmentation and destruction now produce and will continue to produce small, isolated populations

Conservation Measures

A major goal is to preserve

natural patterns of genetic

diversity to the extent possible

to preserve options for future

evolutionary change.

The worst thing that can happen….is not energy depletion,

economic collapses, limited nuclear war, or conquest by a

totalitarian government.

As terrible as these catastrophes would be for us, they can

be repaired within a few generations.

The one process ongoing… that will take millions of years

to correct is the loss of genetic and species diversity by the

destruction of natural habitats.

This is the folly that our descendants are least likely to

forgive us for."

Edward O. Wilson, Harvard’s Pulitzer Prize-winning

Biologist

What

lies ahead

for me?