Generation of induced progenitor-like (iPL) cells using ...

Generation of induced progenitor-like (iPL) cells using

interrupted reprogramming

A novel strategy to produce highly specified functional therapeutic

cell populations for lung regeneration

By

Li Guo

A thesis submitted in conformity with the requirements

for the degree of Doctor of Philosophy

Institute of Medical Science

University of Toronto

© Copyright by Li Guo 2018

ii

Generation of induced progenitor-like (iPL) cells using

interrupted reprogramming

A novel strategy to produce highly specified functional therapeutic

cell populations for lung regeneration

Li Guo

Doctor of Philosophy

Institute of Medical Science

University of Toronto

2018

Abstract

Regenerative medicine is constrained by suboptimal cell sources with either limited

or uncontrolled proliferation and/or incompletely restricted differentiation. We developed a

novel "interrupted reprogramming" strategy without traversing the pluripotent state, to

generate "induced Progenitor-Like (iPL) cells" using carefully timed transient expression of

induced Pluripotent Stem (iPS) cell reprogramming factors (Oct4, Sox2, Klf4 and c-Myc;

OSKM). Interrupted reprogramming is not only able to achieve controlled expansion of the

selected cell type, but results in the "de-differentiation" of the cells to a progenitor-like state

while preserving the parental lineage commitment to generate a limited range of functional

progeny. Lineage-specific iPL cells can be derived from distinct airway epithelial

populations and function as region-specific progenitor cells. For example, bronchiolar

progenitor-like iPL cells can be derived from mature Club cells (Club-iPL cells) and give

rise to Club cells, goblet cells and functional CFTR-expressing ciliated epithelium.

Embryonic bipotent progenitor-like iPL cells can be derived from adult alveolar type II cells

iii

(AEC-II-iPL cells) and the iPL process results in the rescue of the in vitro limited

clonogenic capacity of AEC-II cells.

These highly specified iPL populations are functional and therapeutic that are

capable of directly contributing to lung regeneration through engraftment and differentiation.

In vivo, Club-iPL cells were able to repopulate CFTR-deficient bronchiolar epithelium and

AEC-II-iPL cells showed utility in ameliorating bleomycin-induced pulmonary fibrosis. This

interrupted reprogramming process could be metronomically applied both in vitro and in

vivo, to achieve controlled progenitor-like proliferation.

Furthermore, harnessing the residual epigenetic “memory” and the plasticity existing

in the early stage of the reprogramming process, interrupted reprogramming is able to

rejuvenate aged endogenous progenitor AEC-II cells to a youthful state by ameliorating

multiple hallmarks of aging, including impaired self-renewal, declined telomerase activity,

mitochondrial DNA damages and the epigenome histone alteration. Importantly, cellular

identity and function of parental AEC-II cells were maintained, thereby generating large

numbers of younger AEC-II cells.

In summary, this novel interrupted reprogramming strategy will allow the production

of highly specified functional therapeutic populations which can potentially have significant

implications for regenerative medicine, specifically for, cell replacement therapy, biohybrid

devices, disease modelling, and drug screening for human diseases.

iv

To

Mom and Dad

v

Acknowledgments

I am most grateful to my supervisor Dr. Thomas Waddell, for his kindness, continuous

guidance, constructive criticism, inspiration, encouragement, and patience over the course of

my PhD program. Thank you for teaching me how to become a qualified scientist. I am very

thankful for having the opportunity to learn from you, such a great intelligent knowledgeable

mentor. Without you, I would not be able to have these achievements.

I am grateful to my committee members Dr. Andras Nagy, Dr. Ian Rogers and Dr. Martin

Post for acting as secondary supervisor. Their continuous guidance, advice, constant

encouragement and consideration have played an integral part in my training. Thank you for

your support throughout this long process.

I am also grateful to Dr. Mingyao Liu and Dr. Shaf Keshavjee for providng invaluable

insights into this project and guidance throughout my PhD program.

Many thanks to Dr. Golnaz Karoubi, my dear friend, for the great guidance during my

writing process and the precise mental support.

To Pascal Duchesneau, who contributes to this project tremendously. I appreciate your great

help with all the animal studies. To John Soleas and Dr. Siba Haykal, who were big supports

while we were working at late night and weekends. To Dr. Sherry Zhao and Dr. Xu Feng,

who have been providing me great technical support for years.

vi

A huge thank you to the Institute of Medical Science, for providing me this great

opportunity to pursue my PhD degree.

I am forever grateful to my family (especially mom and dad) and my best friend-Susannah

Moore, who have been giving me unconditional love and support.

vii

List of contributors

Li Guo is the main contributor on this thesis and was involved in project design, performing

all experiments, analyzing the results and writing the papers.

Dr. Thomas K Waddell is the supervisor and contributed to project design, provided

facilities and resources and input in paper writing.

Dr. Andras Nagy and Dr. Ian Rogers provided animal resources, contributed to project

design and input in paper editing.

Dr. Golnaz Karoubi contributed to project design and input in paper editing.

Pascal Duchesneau-performed in vivo animal injury models and cell delivery for Chapter 3

and 4, and Flexivent lung functional measurement for Chapter 4.

Dr. Hoon-Ki Sung-performed teratoma assay for Chapter 3.

Dr. Maria Shutova and Dr. Peter Tonge-analysed the microarray data for Chapter 3.

Dr. Fabio Gava Aoki-performed Flexivent lung functional measurement and analysed

pressure-volume (PV) curves for Chapter 4.

Dr. Christine Bear- provided instrument and reagents for iodide efflux assay for Chapter 3

viii

Table of Contents

ACKNOWLEDGMENTS ................................................................................................................................. V

LIST OF CONTRIBUTORS .......................................................................................................................... VII

TABLE OF CONTENTS .............................................................................................................................. VIII

LIST OF TABLES ........................................................................................................................................ XIV

LIST OF FIGURES ........................................................................................................................................ XV

LIST OF APPENDICES ............................................................................................................................... XIX

LIST OF ABBREVIATIONS ......................................................................................................................... XX

CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW ................................................................. 1

1.1 RESPIRATORY EPITHELIUM ...................................................................................................................... 1

1.1.1 The physiological function of respiratory epithelium .................................................................... 1

1.1.2 Epithelial organization of adult mouse and human lungs ............................................................. 1

1.1.2.1 The size and structure ......................................................................................................................... 1

1.1.2.2 Cellular composition ........................................................................................................................... 2

1.1.3 Epithelial lineages in adult lungs .................................................................................................. 2

1.1.3.1 Conducting airways ............................................................................................................................ 2

1.1.3.1.1 Basal cells ...................................................................................................................................... 2

1.1.3.1.2 Pulmonary neuroendocrine cells.................................................................................................... 3

1.1.3.1.3 Club cells ....................................................................................................................................... 4

1.1.3.1.4 Goblet cells .................................................................................................................................... 4

1.1.3.1.5 Ciliated cells .................................................................................................................................. 5

1.1.3.2 Distal airways ..................................................................................................................................... 5

1.1.3.2.1 Alveolar type I (AEC-I) cells ........................................................................................................ 5

1.1.3.2.2 Alveolar type II (AEC-II) cells ...................................................................................................... 6

1.2 EPITHELIAL BIOLOGY IN THE PATHOGENESIS OF PULMONARY DISEASE ................................................... 6

1.2.1 Obstructive lung diseases .............................................................................................................. 6

1.2.1.1 Chronic obstructive pulmonary diseases ............................................................................................. 6

1.2.1.1.1 Airway epithelium remodeling ...................................................................................................... 7

1.2.1.1.2 Epithelial dysfunction .................................................................................................................... 8

1.2.1.2 Asthma .............................................................................................................................................. 10

1.2.1.2.1 Epithelium alteration and dysfunction ......................................................................................... 11

1.2.1.2.2 Dysregulation of epithelium-mesenchymal network ................................................................... 11

1.2.1.2.3 Current treatments of asthmatic epithelium ................................................................................. 12

1.2.1.3 Cystic fibrosis ................................................................................................................................... 13

1.2.1.3.1 Defects of CFTR gene and protein .............................................................................................. 13

ix

1.2.1.3.2 Epithelium dysfunction attributes to the adaptive and innate immune defect .............................. 14

1.2.1.3.3 Cystic fibrosis disease models ..................................................................................................... 15

1.2.2 Restrictive lung diseases ............................................................................................................. 16

1.2.2.1 Interstitial lung disease-idiopathic pulmonary fibrosis ..................................................................... 16

1.2.2.1.1 Profoundly altered differentiation of alveolar epithelial cells in IPF ........................................... 17

1.2.2.1.2 Epithelial cells contribute to the profibrotic microenvironment .................................................. 17

1.2.2.1.3 Mechanisms of epithelium damage ............................................................................................. 18

1.2.2.1.4 Cell-based therapeutic approaches for treating IPF ..................................................................... 20

1.2.3 Acute respiratory distress syndrome (ARDS) .............................................................................. 21

1.2.3.1 Damage in epithelial tight junctions ................................................................................................. 22

1.2.3.2 Apoptosis of alveolar epithelial cells ................................................................................................ 22

1.2.3.3 Direct injury to alveolar epithelium .................................................................................................. 23

1.2.3.4 Inflammatory-induced epithelial injury ............................................................................................ 24

1.2.3.5 Epithelium repair in ARDS ............................................................................................................... 24

1.3 STEM CELLS IN LUNG EPITHELIAL REGENERATION ................................................................................. 26

1.3.1 Stem cells category ...................................................................................................................... 26

1.3.2 Adult stem cell hierarchy ............................................................................................................. 26

1.3.3 Endogenous lung stem cells......................................................................................................... 27

1.3.3.1 Basal stem cells ................................................................................................................................ 27

1.3.3.2 Trp63+/Krt5+ basal-like stem cells .................................................................................................. 28

1.3.3.3 Variant Club cells ............................................................................................................................. 29

1.3.3.4 Bronchioalveolar stem cells (BACs) ................................................................................................. 30

1.3.3.5 Neuroendocrine cells ........................................................................................................................ 30

1.3.3.6 Alveolar type II (AEC-II) cells ......................................................................................................... 31

1.3.3.7 Alveolar type I (AEC-I) cells ............................................................................................................ 32

1.3.4 Derivation of pulmonary epithelium from pluripotency stem cells ............................................. 32

1.3.4.1 ESCs and iPS cells ............................................................................................................................ 33

1.3.4.2 Differentiation approaches ................................................................................................................ 33

1.4 INDUCED PLURIPOTENT STEM (IPS) CELL REPROGRAMMING .................................................................. 36

1.4.1 Reprogramming methods ............................................................................................................ 36

1.4.1.1 Reprogramming factors .................................................................................................................... 37

1.4.1.2 Delivery systems ............................................................................................................................... 38

1.4.1.3 Target cell type ................................................................................................................................. 39

1.4.1.4 Derivation conditions ........................................................................................................................ 40

1.4.1.5 Identification of pluripotency ........................................................................................................... 41

1.4.2 Roadmap of faithful reprogramming ........................................................................................... 42

1.4.2.1 The early phase ................................................................................................................................. 43

1.4.2.2 The intermediate phase ..................................................................................................................... 44

1.4.2.3 The stabilization phase...................................................................................................................... 45

1.4.3 Epigenetic alteration during reprogramming ............................................................................. 46

x

1.4.4 Cooperation of reprogramming transcription factors ................................................................. 47

1.4.5 Molecular and functional similarities and differences between ESCs and iPS cells ................... 49

1.5 AGING AND IPS REPROGRAMMING......................................................................................................... 51

1.5.1 Molecular and cellular hallmarks of aging ................................................................................. 51

1.5.1.1 Stem cell exhaustion ......................................................................................................................... 51

1.5.1.2 Telomere attrition/dysfunction.......................................................................................................... 51

1.5.1.3 Mitochondrial dysfunction ................................................................................................................ 52

1.5.1.4 Epigenetic alterations ........................................................................................................................ 53

1.5.2 Aging in the lung ......................................................................................................................... 55

1.5.3 Rejuvenation using iPS reprogramming strategy ........................................................................ 56

CHAPTER 2 RATIONALE, HYPOTHESES AND OBJECTIVES............................................................. 58

CHAPTER 3 GENERATION OF INDUCED PROGENITOR-LIKE (IPL) CELLS FROM MATURE

EPITHELIAL CELLS USING INTERRUPTED REPROGRAMMING .................................................... 61

3.1 RATIONALE, OBJECTIVES, HYPOTHESES AND SPECIFIC AIMS ................................................................ 61

3.2 ABSTRACT ............................................................................................................................................. 62

3.3 INTRODUCTION ...................................................................................................................................... 63

3.4 MATERIAL AND METHODS ..................................................................................................................... 65

3.4.1 Animal Husbandry ....................................................................................................................... 65

3.4.2 Naphthalene Administration and Cell Delivery .......................................................................... 65

3.4.3 Teratoma Assay ........................................................................................................................... 65

3.4.4 Cell Isolation and Culture ........................................................................................................... 66

3.4.4.1 Isolation of Club Cells from Mouse Lung ........................................................................................ 66

3.4.4.2 Cell Culture ...................................................................................................................................... 66

3.4.4.3 Matrigel-based iPL Induction ........................................................................................................... 67

3.4.4.4 In Vitro Differentiation Assays ......................................................................................................... 67

3.4.4.5 Air-liquid Interface (ALI) Differentiation Assay .............................................................................. 67

3.4.4.6 In Vitro Pluripotency Assay .............................................................................................................. 67

3.4.4.7 Neuron Differentiation Assay ........................................................................................................... 68

3.4.5 Fluorescence Activated Cell Sorting and Analysis ...................................................................... 68

3.4.6 Bottom-feeder conditioned CFSE assay ...................................................................................... 68

3.4.7 Immunofluorescence .................................................................................................................... 69

3.4.8 Iodide Efflux Assay ...................................................................................................................... 71

3.4.9 Western Blot ................................................................................................................................ 71

3.4.10 Real-time PCR Analysis .......................................................................................................... 71

3.4.11 Microarray and Data Analysis ............................................................................................... 73

3.4.12 Statistics .................................................................................................................................. 73

3.5 RESULTS ................................................................................................................................................ 74

3.5.1 Isolation and Identification of Terminally Differentiated Club Cells .......................................... 74

xi

3.5.2 Interrupted Reprogramming Allows OSKM-dependent Proliferation of EpCAMhigh

-Club Cells 74

3.5.3 Interrupted Reprogramming Results in Clonal Expansion of Quiescent Mature Club Cells

without Traversing the Pluripotent State ................................................................................................... 79

3.5.4 Interrupted Reprogramming Allows Club-iPL Cells to Return to Their Original Epithelial

Phenotype upon Withdrawal of Factors .................................................................................................... 84

3.5.5 Interrupted Reprogramming Allows Preservation of Lineage Commitment ............................... 88

3.5.6 Club-iPL Cells Function as Multipotent Bronchiolar Progenitor-Like Cells ............................. 92

3.5.7 Club-iPL Cells are Able to Generate Functional CFTR-Expressing Ciliated Epithelium .......... 94

3.5.8 Club-iPL cells Are Useful in Cell Replacement Therapy for Cystic Fibrosis in Vivo ................. 94

3.5.9 Cyclical Interrupted Reprogramming Enables Greater Expansion of Club-iPL Cells ............... 99

3.6 DISCUSSION ......................................................................................................................................... 103

CHAPTER 4 INTERRUPTED REPROGRAMMING OF ALVEOLAR TYPE II CELLS INDUCES

PROGENITOR-LIKE CELLS THAT AMELIORATE PULMONARY FIBROSIS ............................... 108

4.1 RATIONALE, OBJECTIVES, HYPOTHESES AND SPECIFIC AIMS .............................................................. 108

4.2 ABSTRACT ........................................................................................................................................... 109

4.3 INTRODUCTION .................................................................................................................................... 109

4.4 MATERIALS AND METHODS ................................................................................................................. 111

4.4.1 Animal husbandry...................................................................................................................... 111

4.4.2 Bleomycin administration and cell delivery .............................................................................. 112

4.4.3 Measurement of respiratory mechanics .................................................................................... 112

4.4.4 Isolation of AEC-II cell from mouse lung .................................................................................. 112

4.4.5 Cell culture ................................................................................................................................ 113

4.4.6 Fluorescence activated cell sorting and analysis ...................................................................... 113

4.4.7 Matrigel-based iPL cell induction ............................................................................................. 113

4.4.8 Immunofluorescence .................................................................................................................. 114

4.4.9 Real-time PCR analysis ............................................................................................................. 115

4.4.10 Statistics ................................................................................................................................ 116

4.5 RESULTS .............................................................................................................................................. 117

4.5.1 Interrupted reprogramming rescues the limited clonogenic capacity of AEC-II cells while

achieving expansion ................................................................................................................................ 117

4.5.2 Interrupted reprogramming allows preservation of AEC-II lineage commitment without

traversing the pluripotent state ................................................................................................................ 119

4.5.3 Interrupted reprogramming induces expression of alveolar progenitor markers Hopx and α6β4

121

4.5.4 AEC-II-iPL cells ameliorate bleomycin-mediated pulmonary fibrosis ..................................... 123

4.5.5 AEC-II-iPL cells are able to engraft and differentiate to mature AEC-II and AEC-I cells in

severely injured alveolar epithelium of male mice .................................................................................. 127

xii

4.6 DISCUSSION ......................................................................................................................................... 133

CHAPTER 5 REJUVENATION OF AGED AEC-II CELLS TO A YOUTHFUL STATE USING

INTERRUPTED REPROGRAMMING ....................................................................................................... 136

5.1 RATIONALE, OBJECTIVES, HYPOTHESES AND SPECIFIC AIMS .............................................................. 136

5.2 ABSTRACT ........................................................................................................................................... 137

5.3 INTRODUCTION .................................................................................................................................... 138

5.4 MATERIALS AND METHODS ................................................................................................................. 140

5.4.1 Animal Husbandry ..................................................................................................................... 140

5.4.2 Cell Isolation and Culture ......................................................................................................... 140

5.4.2.1 Isolation of AEC-II Cells from Mouse Lung .................................................................................. 140

5.4.2.2 Matrigel-based 3D condition .......................................................................................................... 140

5.4.2.3 Mix-culture of young and aged AEC-II cells .................................................................................. 141

5.4.3 Fluorescence activated cell sorting and analysis ...................................................................... 141

5.4.4 Immunofluorescence .................................................................................................................. 141

5.4.5 Real-time PCR analysis ............................................................................................................. 142

5.4.6 Statistics .................................................................................................................................... 142

5.5 RESULTS .............................................................................................................................................. 142

5.5.1 The clonogenic capacity of AEC-II cells declines with age ....................................................... 142

5.5.2 Interrupted reprogramming is able to “rejuvenate” aged AEC-II cells to a younger state to form

large numbers of alveolar-like colonies .................................................................................................. 144

5.5.3 ROCK inhibitor failed to rescue the aged-related decline of clonogenic capacity in AEC-II cells

146

5.5.4 Interrupted reprogramming of aged AEC-II cells results in controlled expansion of alveolar-like

colonies 148

5.5.5 Interrupted reprogramming allows controlled restoration of telomerase gene expression ...... 149

5.5.6 Interrupted reprogramming ameliorates mitochondrial DNA damage ..................................... 150

5.5.7 Interrupted reprogramming allows restoration of age-related expression of H3K4me3,

H3K9me3 and H3K27me3 ....................................................................................................................... 152

5.6 DISCUSSION ......................................................................................................................................... 154

CHAPTER 6 SUMMARY AND DISCUSSION ........................................................................................... 157

6.1 SUMMARY OF KEY FINDINGS ................................................................................................................ 157

6.2 DISCUSSION ......................................................................................................................................... 158

6.2.1 What are iPL cells? ................................................................................................................... 158

6.2.2 The regenerative capacity of iPL cells ...................................................................................... 159

6.2.3 The mechanisms underlying the iPL phenomenon .................................................................... 160

6.2.4 Target cell type in iPL induction ............................................................................................... 162

xiii

6.2.5 Derivation condition for iPL cells ............................................................................................. 164

6.2.6 The heterogeneity observed in iPL induction ............................................................................ 166

6.2.7 Highlights of interrupted reprogramming-compared to other approaches ............................... 166

CHAPTER 7 FUTURE DIRECTIONS AND CONCLUSION ................................................................... 169

7.1 CHARACTERIZATION OF THE PROGENITOR CELL MARKERS EXPRESSED BY IPL CELLS ......................... 169

7.2 EPIGENETIC CHARACTERIZATION OF IPL INDUCTION ........................................................................... 170

7.3 IDENTIFICATION OF EPIGENETIC TARGETS RESULTING REJUVENATION VIA INTERRUPTED

REPROGRAMMING.......................................................................................................................................... 170

7.4 EVALUATION OF THE REPARATIVE CAPACITY OF AGED AEC-II-IPL CELLS IN REVERSAL OF PULMONARY

FIBROSIS INDUCED IN AGED MICE .................................................................................................................. 171

7.5 GENERATION OF HUMAN AEC-II-IPL CELLS AND AMELIORATION OF AGED-RELATED DETERIORATION

172

7.6 CONCLUSION ....................................................................................................................................... 173

CHAPTER 8 APPENDIX ............................................................................................................................... 174

REFERENCES ................................................................................................................................................ 182

xiv

List of Tables

Chapter 3:

Table 1. Tabulated list of all antibodies used in the studies.............................................69

Table 2. Tabulated list of all qPCR primers used in the studies......................................72

Chapter 4:

Table 1. Tabulated list of all antibodies used in the studies...........................................114

Table 2. Tabulated list of all qPCR primers used in the studies....................................116

xv

List of Figures

Chapter 1:

Figure 1.

Schematic graph depicting the generation of lung epithelial cells in development................34

Chapter 3:

Figure 1.

CD31-CD45

-EpCAM

high epithelial cells are a highly purified naphthalene-sensitive Club cell

population in which regulation of inductive factors results in controlled proliferation.........76

Figure 2.

Carefully defined length of interrupted reprogramming results in efficient clonal expansion

of quiescent mature Club cells without traversing the pluripotent state in vitro....................81

Figure 3.

Interrupted reprogramming allows EpCAMhigh

-Club cell derived iPL colonies to return to

their original epithelial phenotype upon factor-withdrawal...................................................85

Figure 4.

Interrupted reprogramming allows preservation of lineage preference and commitment......89

Figure 5.

Club-iPL cells function as multipotent bronchiolar progenitor-like cells..............................93

Figure 6.

Club-iPL cells are able to generate functional CFTR-expressing ciliated epithelium in vitro

which are useful as a component of cell replacement therapy for cystic fibrosis in vivo.......96

Figure 7.

Cyclical interrupted reprogramming enables further expansion of Club-iPL cells..............102

xvi

Supplementary Figures

Figure S1.

Characterization of freshly isolated EpCAMhigh

population; 2D bottom-feeder culture

condition.................................................................................................................................78

Figure S2.

Hollow-luminal colony formation during iPL induction; H&E staining of teratomas

developed in NOD/SCID mice 3 weeks post R1-ESC and 5w+Dox

cells transplant...............83

Figure S3.

Relative gene expression of Oct4, Sox2, klf4, c-Myc, EpCAM and E-Cadherin; hierarchical

clustering analysis of Club cell and pluripotency-related gene expression in different groups

of cells....................................................................................................................................87

Figure S4.

Lineage commitment of Club-iPL cells at the single cell level..............................................91

Figure S5.

Club-iPL cells are able to engraft and differentiate to mature Club cells and Ciliated cells in

CFTR-deficient injured airway; Club-iPL cell lines lack of tumorigenicity..........................98

Figure S6.

Preliminary study of interrupted reprogramming on human epithelial cells........................107

Chapter 4:

Figure 1.

Interrupted reprogramming rescues the in vitro limited clonogenic capacity of AEC-II cells

while achieving expansion in cell numbers..........................................................................118

xvii

Figure 2.

A defined period of interrupted reprogramming allows preservation of AEC-II phenotype

without traversing pluripotency............................................................................................120

Figure 3.

The expression of alveolar progenitor markers in AEC-II-iPL cells....................................122

Figure 4.

AEC-II-iPL cells are able to engraft and contribute to alveolar epithelial lineage in vivo...125

Figure 5.

AEC-II-iPL cells are able to engraft and differentiate to mature AEC-II and AEC-I cells in

severely fibrotic lungs...........................................................................................................129

Figure 6.

Treatment with AEC-II-iPL cells ameliorates severe pulmonary fibrosis...........................132

Supplementary Figures

Figure S1.

Time course of expression of Hopx and SPC in embryonic lungs.......................................123

Figure S2.

Transplant of AEC-II-iPL cells ameliorates bleomycin-mediated pulmonary fibrosis........126

Chapter 5:

Figure 1.

The clonogenic capacity of AEC-II cells declines with age.................................................143

Figure 2.

xviii

Aged AEC-II cells exhibit a limited clonal proliferation of epithelial colony forming

units.......................................................................................................................................144

Figure 3.

Interrupted reprogramming ameliorates the aged-related decline of clonogenic capacity in

aged AEC-II cells..................................................................................................................146

Figure 4.

Comparison of clonal proliferation of young and aged AEC-II cells under OSKM iPL

induction and ROCK inhibitor treatment..............................................................................147

Figure 5.

Interrupted reprogramming allows controlled expansion of rejuvenated AEC-II cells........148

Figure 6.

Interrupted reprogramming allows controlled restoration of telomerase gene expression...150

Figure 7.

Mitochondrial DNA damage presents in cultured AEC-II cells that accumulate with the

aging process.........................................................................................................................151

Figure 8.

Interrupted reprogramming ameliorates the aged-related mitochondrial DNA damage......152

Figure 9.

Interrupted reprogramming restores the age-associated expression of H3K4me3 and

H3K9me3 in AEC-IIs...........................................................................................................153

Figure 10.

Interrupted reprogramming restores the age-associated expression of H3K27me3 in AEC-IIs

..............................................................................................................................................154

xix

List of Appendices

Appendix 1

Comparison of OSKM iPL induction and N-myc induction alone in mature Club cells

Appendix 2

The proliferative response of EpCAMhigh

and EpCAMlow

cells to the inductive factors

Appendix 3

Characterization of induced colonies derived from EpCAMhigh

and EpCAMlow

populations in

2D conditions

Appendix 4

Early induction failed to efficiently expand AEC-IIs and preserve AEC-II phenotype

Appendix 5

Transient activation of inductive factors results an enhanced clonal proliferation of

EpCAMlow

population.

Appendix 6

Comparison of the proliferative response of EpCAMhigh

-Club cells to the OSKM inductive

factors and ROCK inhibitor treatment.

xx

List of Abbreviations

8-OHdG 8-hydroxy-guanosine

ARDS Acute respiratory distress syndrome

ATP adenosine triphosphatase

ARGLS age-associated gland-like structures

ALI air-liquid Interface

AEC alveolar epithelial cell

AEC-I alveolar epithelial type I

AEC-II alveolar epithelial type II

BCs Basal cells

BLPCs basal luminal precursor cells

BSCs basal stem cells

BMC bone marrow cell

BMP bone morphogenetic protein

BADJ bronchioalveolar duct junctions

BAL bronchioalveolar lavage

BASCs bronchioalveolar stem cells

CGRP calcitonin gene-related peptide

CFSE carboxyfluorescein diacetate, succinimidyl ester

COPD chronic obstructive pulmonary disease

Cldn10 Claudin10

CCSP Club cell secretory protein

CFU% colony forming-efficiency

CHARM comprehensive high-throughput array-based relative methylation

COX cyclooxygenase

CF cystic fibrosis

CFTR cystic fibrosis transmembrane conductance regulator

Krt14 cytokeratins 14

Krt5 cytokeratins 5

Dppa3 developmental pluripotency associated 3

Dppa5 developmental pluripotency associated 5

DAPI diamidino-2-phenylindole

DASCs distal alveolar stem cells

DNMT1 DNA methyltransferase

ESC embryonic stem cell

ER endoplasmic reticulum

EGF epidermal growth factor

EGFR epidermal growth factor receptor

xxi

EMT epithelial-mesenchymal transition

EpiS epithelial-specific

ECM extracellular-matrix

FGF-10 fibroblast growth factor-10

FoxJ1 forkhead transcription factor

H3K27me3 H3K27 trimethylation

H3K4me3 H3K4 trimethylation

H3K9me3 H3K9 methylation

H4K20me3 H4K20 trimethylation

HA hemagglutinin

HGF hepatocyte growth factor

HSVtk herpes simplex virus thymidine kinase

H4K16Ac histone H4K16 acetylation

Hopx homeodomain only protein x

HHV human herpesvirus

HGPS Hutchinson–Gilford progeria syndrome

IPF Idiopathic pulmonary fibrosis

iPS induced pluripotent stem cells

iPL induced Progenitor-Like

IMM inner mitochondrial membrane

IGF insulin growth factor

KGF keratinocyte growth factor

LTA4 leukotriene A4

LNEP lineage negative epithelial precursor

MET mesenchymal epithelial transition

MSC mesenchymal stromal cell

mtDNA mitochondrial DNA

MEFs mouse embryonic fibroblasts

Muc mucin

PNECs neuroendocrine cells

NEBs neuroepithelial bodies

ncRNAs noncoding RNAs

OSKM Oct4, Sox2, Klf4 and c-Myc

PFA paraformaldehyde

PBS phosphate buffered saline

PEG poly ethyleneglycol

PcG polycomb group protein

ROS reactive oxygen species

RA retinoic acid

ROCK Rho-associated kinase

Pol II RNA polymerase II

xxii

Scgb1a1 secretoglobin family 1a member 1

SCLC small cell lung carcinoma

SSEA1 stage-specific embryonic antigen 1

SPC/Sftpc surfactant protein C

Trf2 telomeric repeat-binding factor 2

TGF transforming growth factor

P63 Trp-63

Utf1 undifferentiated embryonic cell transcription factor 1

Zfp42 zinc finger protein 42

ZO zona occludens

1

Chapter 1

Introduction and Literature Review

1.1 Respiratory epithelium

1.1.1 The physiological function of respiratory epithelium

The respiratory system, develop from the primary bud stage, is composed of tree-like

branched tubes where gases exchange takes place. The maintenance of this function relies on

the proper organization and specification of airway epithelium and the surrounding capillary

network lining the entire airspace (Knight and Holgate, 2003). The gas exchange is carried

out and maximized by hundreds of millions of sacs known as alveoli and the airway

epithelium acts as the conduit for air to and from the alveoli. The airway epithelium not only

serves as a physical barrier, it is also composed of various types of epithelial cells that play a

critical role in maintaining normal airway function from the trachea to the alveoli. It

regulates fluid balance, modulates metabolism and provides host defense against

environmental insults, such as pathogens, inhaled noxious gases and particulates, and

through the production of biologically active factors and cellular self-renewal. The airway

epithelium functions interdependently with other cellular components in the lung, including

mesenchymal cells, endothelial cells, and the extracellular matrix (Crystal et al., 2008).

Dysregulation of airway epithelium function contribute to the pathogenesis of major

respiratory disorders, such as chronic obstructive pulmonary disease (COPD), asthma, cystic

fibrosis, IPF and cancer (Thompson et al., 1995; Puchelle et al., 2006).

1.1.2 Epithelial organization of adult mouse and human lungs

1.1.2.1 The size and structure

Interspecies differences are found between rodents and human respiratory systems.

The average internal diameter of human trachea is ~12 mm.The mouse trachea has an

internal diameter of ~1.5 mm that is equivalent to the size of small peripheral airways in the

2

human lung. Human lungs have more generations of intralobar branches (6-8 branches) than

the mouse lungs (Metzger et al., 2008).

In mice, the trachea, bronchi and most proximal intralobar airways are lined with a

pseudostratified columnar epithelium, while the remaining airways are lined by a simple

cuboidal or columnar epithelium. In humans, the pseudostratified epithelium lines to the

very distal airways (Rock et al., 2010).

1.1.2.2 Cellular composition

In both mouse and human lungs, the pseudostratified epithelium contains basal

(30%), ciliated (55% in mouse; 30% in human), secretory (goblet, serous and Club cells)

and neuroendocrine cells, and the alveolar epithelium consists of type I and type II cells.

However, differences are found in the cellular composition of the airways between mouse

and human along the proximal-distal axis. Human basal cells are contained in the

pseudostratified epithelium which extends to the terminal bronchioles, but not in part of the

bronchioles which are lined with a simple cuboidal epithelium. In contrast, mouse basal cells

only exist in the pseudostratified epithelium restricted to trachea, but not in the columnar

bronchi epithelium. Moreover, mucin-producing goblet cells are relatively abundant in

humans, whereas these cells are rare in mouse lungs (Mercer et al., 1994).

1.1.3 Epithelial lineages in adult lungs

1.1.3.1 Conducting airways

1.1.3.1.1 Basal cells

Basal cells (BCs) are present in the pseudostratified epithelium of mouse trachea and

human airways including the bronchioles (Boers et al., 1998; Evans et al., 2001). They

appear to be the only cells that have abundant hemidesmosomes (Evans et al., 2001) and are

attached to the basement membrane by integrin α64. The number of BCs attached to the

basement membrane is correlated with the thickness of the epithelium and progressively

decreases in smaller airways (Evans and Plopper, 1988; Knight and Holgate, 2003). In

human lungs, BCs form a monolayer in larger airways and are distributed in clusters or as

individual cells in the smaller bronchioles (Nakajima et al., 1998). Despite the interspecies

3

differences between rodents and human airways, BCs in both species are similar with

respect to histology and molecular function.

Basal cells play a critical structural and functional role in conducting airway

epithelium. They are relatively undifferentiated and characterized by high expression levels

of transcription factor Trp-63 (P63) and cytokeratins 5 and 14 (Krt5/14). In mouse trachea,

there is a differential expression of Krt5 and Krt14 within the basal population. In

homeostasis, Krt14 is co-expressed in a subset of Krt5+

BCs which is upregulated in

response to epithelial injury (e.g. naphthalene-induced injury) (Hong, 2003a; Hong et al.,

2004).

Studies have demonstrated that BCs possess stem cell properties that are capable of

self-renewal and repopulating secretory and ciliated lineages during homeostasis and repair

after injury (Hong et al., 2004; Rock et al., 2009a). In addition to their critical role in

maintaining epithelium structural and repopulating injured epithelium, BCs involve in host

defense by their production of a number of bioactive molecules, such as cytokines, neutral

endopeptidase and 15-lipoxygenase products (Knight and Holgate, 2003).

1.1.3.1.2 Pulmonary neuroendocrine cells

During lung development, neuroendocrine cells (PNECs) are the first cells to form

and differentiate within the respiratory epithelium (Ito et al., 2000; Shan et al., 2006). In

morphology, PNECs are tall and pyramidal in shape and have apical microvilli (Gustafsson

et al., 2008). They extend from the basal lamina of the airway epithelium and are located

within the trachea, bronchi, and bronchiole alveolar junctions (Lauweryns et al., 1985). The

number of PNECs increases after birth and reach the peak in neonatal stage (Gustafsson et

al., 2008). In adult lungs, PNEC distribute as individual cells in proximal airways or in

clusters, termed neuroepithelial bodies (NEBs), in intralobar airways representing the lung

stem cell niche (Cutz et al., 2007; Van Lommel, 2001). PNECs play a critical role in the

maintenance of immune function, flow of air and blood by secreting serotonin, calcitonin

(CGRP or Calca), and bombesin. In addition, PNECs can transmit stimuli to the central

nervous system upon the innervations by sensory nerve fibers (Van Lommel et al., 1998).

Importantly, the PNECs system contributes to airway epithelium regeneration and involes in

the pathogenesis of small cell lung cancer (Ito et al., 2003; Cutz et al., 2007).

4

1.1.3.1.3 Club cells

Mucociliary clearance, to clear inhaled microorganisms and particulates from the

lung, is primarily driven by Club and ciliated cells located within the columnar epithelium.

Club cells are secretory cells that are prominently found in the small bronchioles (Knight

and Holgate, 2003). These cells contain electron-dense granules and produce secretoglobin

Scgb1a1 and/or Scgb3a2 and Scgb3a1 (in proximal airways) (Reynolds et al., 2002). Club

cells regulate bronchiolar epithelial integrity and immunity by secretion of bronchiolar

surfactants and specific antiproteases, such as secretory leukocyte protease inhibitor. In

addition to their secretory role, Club cells shown to metabolize xenobiotic compounds such

as aromatic hydrocarbons by production of p450 mono-oxygenases (De Water et al., 1986).

The mature Club cells possess limited proliferative capacity. After injury, they are replaced

from a pool of “variant” Club cells, which are resistant to toxins such as naphthalene. This

population also then act as stem cells for ciliated and mucous cell populations (Rawlins et

al., 2009; Reynolds and Malkinson, 2010).

1.1.3.1.4 Goblet cells

Mucin-producing goblet cells are sparse in the mouse airways but are relatively

abundant in human airways. Goblet cells are characterized by electron-lucent acidic-mucin

granules that secrete mucous into the airway from the level of the trachea to the bronchioles

to trap pathogens and dust particles (Jeffery, 1983). The amount and viscoelasticity of

mucus are critical for maintaining efficient mucociliary clearance. In a healthy condition,

there is a fine equilibrium between mucous production and clearance (Evans and Koo,

2009). However, mucous cells become hyperplasic and metaplasic in chronic airway

inflammatory diseases, such as chronic bronchitis and asthma, which result in excessive

sputum production (Lumsden et al., 1984). Goblet cells can self-renew and

transdifferentiate into ciliated cells (Evans and Plopper, 1988). Evidence from pathological

remodeling in human airways and mouse models of lung disease showed the abundance of

goblet cells is regulated by the Notch pathway (Evans et al., 2004; Williams et al., 2006).

Activation of Notch in developing airways transgenically in vivo or by stimulated molecular

pathways in vitro results in expansion of goblet cell population at the expense of ciliated

5

cells. Conversely, inhibition of Notch signaling blocks the transdifferention of goblet cells

and results in an increased proportion of ciliated cell lineage (Guseh et al., 2009).

1.1.3.1.5 Ciliated cells

Ciliated cells are predominant cell type in the airways, which account for over 50%

of all epithelial cells (Spina, 1998). These cells typically contain 300 cilia per cell and

numerous mitochondria that provide energy to the cilia for ciliary beating and the transport

of mucus from the lung to the throat for mucociliary clearance. Ciliated cells are terminally

differentiated cells which arise from either basal or Club cells (Ayers and Jeffery, 1988).

The differentiation and maturation of ciliated cells are dependent on their expression of

forkhead transcription factor (FoxJ1) (Brody et al., 2000).

1.1.3.2 Distal airways

Gas exchange is carried out in the alveolus. Alveolar walls cover more than 99% of

the internal surface area of the lung (Dobbs and Johnson, 2007). The thin layer of liquid

lining the epithelial surface of alveolus contains surfactant phospholipids and an aqueous

subphase (Bastacky et al., 1995). In additions to regulating gas exchange within the

alveolus, surfactants are responsible for the maintenance of surface tension which is

essential for elastic recoil of the lung. The alveolar ion and liquid transport is tightly

regulated by local alveolar epithelial cells (Olivera et al., 1994). In normal adult lung, the

alveolar epithelium facing the air-filled compartment is composed of two major cell types,

the alveolar epithelial type I (AEC-I) and alveolar epithelial type II (AEC-II) cells.

1.1.3.2.1 Alveolar type I (AEC-I) cells

AEC-I cells are squamous in shape. They interface with pulmonary capillaries and

cover more than 90% of the alveolar surface providing a physical barrier between the air and

blood compartments (Whitsett et al., 2010). AEC-I cells are the primary sites of gas

exchange and regulate fluid homoeostasis through the expression of ion channels and pores,

including AQP5 and CFTR. The presence of of caveolae (Gumbleton, 2001) and small

intracellular vacuoles in AEC-I cells suggests they possess endocytic function and metabolic

activities. In addition, AEC-I cells have active biosynthetic functions in regards to their

6

cellular components-microvilli, abundant mitochondria, and both rough and smooth

endoplasmic reticulum (Dobbs and Johnson, 2007).

Although it is widely assumed that AEC-I cells are terminally differentiated cells

derived from AEC-II cells during postnatal growth, a recent lineage-tracing study showed

Hopx+ AEC-I cells are able to proliferate and give rise to AEC-II cells following partial

pneumonectomy in adult mouse lungs (Jain et al., 2015).

1.1.3.2.2 Alveolar type II (AEC-II) cells

Unlike AEC-I cells, AEC-II cells are small cuboidal cells located in the corners of

alveoli that cover only 5% of the alveolar surface. They are characterized by lamellar bodies

and intracellular storage organelles for pulmonary surfactants (Dobbs and Johnson, 2007b).

AEC-II cells are multifunctional cells that produce, secrete and recycle pulmonary

surfactants, regulate alveolar fluid balance, and synthesize and secrete a number of immune-

modulatory proteins involved in host defense (Fehrenbach, 2001). Importantly, a subset of

surfactant protein C-positive (SPC+) AEC-II cells act as regional stem cells in the alveoli

and differentiate into AEC-I cells, playing a crucial role in replenishing the alveolar

epithelial barrier during both homeostasis and repair after injury (Barkauskas et al., 2013a;

Rock and Hogan, 2011a; Whitsett and Alenghat, 2014).

1.2 Epithelial biology in the pathogenesis of pulmonary disease

The airway epithelium plays a crucial role in providing host defense against

environmental insults. Therefore, to better understand the development and progression of

pulmonary diseases, one must consider how epithelial dysfunction could lead to pathologic

outcomes.

1.2.1 Obstructive lung diseases

1.2.1.1 Chronic obstructive pulmonary diseases

Chronic obstructive pulmonary disease (COPD), a critical condition with high

morbidity and mortality, is characterized by non-reversible progressive airflow limitation.

Although cigarette smoke is the main cause, air pollution, biomass fuel, and occupational

exposures have also been linked to the development of COPD (Eisner et al., 2010).

7

Emphysema and chronic bronchitis are the two major pathologic subjects with COPD.

Emphysema involves the destruction of alveolar structure. Chronic bronchitis refers to

chronic inflammation and the resultant airway remodeling. To date, although numbers of

medications with bronchodilating and/or anti-inflammatory effects have been prescribed in

clinical practice, no definite treatments are able to successfully repair the severely injured

lungs of patients with COPD (Hochberg and Sidhaye, 2017).

The respiratory epithelium, as the first line of exposure to the noxious particles and

gases, provides a protective barrier of which functions include physical, chemical, and

immunological roles. It plays a central role in the pathophysiology of COPD that the

abnormal response of epithelial cells to these insults results in the remodeling of airway and

air spaces which are the major characteristic of COPD.

In COPD, the large airways and the alveoli present distinct pathological changes. In

the airways, the remodeling process results in an altered epithelial cell lining, fibrosis,

smooth muscle hypertrophy, and inflammatory infiltration (Hogg and Timens, 2009). In

alveoli, the remodeling is characterized as emphysema showing abnormal permanent

enlargement of air spaces and the destruction of epithelium walls without obvious fibrosis

(1985).

1.2.1.1.1 Airway epithelium remodeling

In normal lungs, the larger airways are pseudostratified mucociliated epithelium

comprising of ciliated cells in the majority and mucin-producing goblet cells and basal cells.

The number of both goblet and basal cells declines towards the distal branching and the

pseudostratified epithelium is gradually replaced with cubodial epithelium consisting of

serous secreting cells and Club cells.

In COPD, the morphology and function of airways epithelium are altered. Goblet cell

hyperplasia and metaplasia occur as a result of transdifferentation of other cell types into

goblet cells. In addition, metaplasia is seen in the transdifferentiation of epithelial cells into

mesenchymal and squamous cell-types (Gohy et al., 2016). These pathological changes lead

to ciliary dysfunction, fibrosis, and inflammatory cell infiltration seen in the airway wall and

the airway lumen (Hogg and Timens, 2009). In the chronic bronchitis which is a subject

8

with COPD, mucous cells become hyperplasic and hypersecretory which lead to chronic

cough and sputum production.

1.2.1.1.2 Epithelial dysfunction

A healthy airway epithelium serves as a physical barrier, as well as restores proper

barrier function responding to injury. The breakdown in these functions attributes to the

development of COPD.

1.2.1.1.2.1 Physical barrier dysfunction

Epithelial barrier dysfunction has been observed in airway epithelium injury by

cigarette smoke and in the disease state of COPD (Jones et al., 1980; Gangl et al., 2009;

Heijink et al., 2012).

The junctional proteins and ion channels are involved in the physical barrier function

of the airway epithelium by regulating epithelium permeability. The integrity of the airway

epithelium is maintained by tight junctions, adherent junctions, and desmosomes (Brune et

al., 2015). There are multiple tight junction proteins involved in regulating ion transport,

including claudins, occludins, junctional adhesion molecules, and the zona occludens (ZO).

The adherent junction composed of E-cadherin which regulates tight junction formation and

cell adhesion (Hartsock and Nelson, 2008a). E-cadherin interacts with α-catenin and β-

catenin to form a complex. This cadherin/catenin complex plays a critical role in cellular

signaling pathways to regulate cell proliferation, differentiation and the reparative response

of epithelium to injury (Ganesan et al., 2013; Hartsock and Nelson, 2008). Importantly, E-

cadherin also interacts with epidermal growth factor (EGF) receptor (EGFR) to maintain

normal polarity and function of epithelium. In COPD, the EGFR pathway is altered and the

increased EGFR activity contributes to pathologic consequences, including barrier

dysfunction, goblet cell hyperplasia/metaplasia, mucous hypersecretion, and epithelial-

mesenchymal transition (EMT) (Gohy et al., 2016b; Petecchia et al., 2009; Shaykhiev et al.,

2013). Furthermore, the oxidative stress from smoking and chronic injury result in protein

modification and disruption of epithelium tight junctions (Rao, 2008).

9

1.2.1.1.2.2 Mucociliary clearance defect

The efficient mucociliary clearance is regulated by mucin (Muc) production, and the

transmembrane ion channels such as the cystic fibrosis transmembrane conductance

regulator (CFTR), and the apical membrane Na+ channel (Boucher, 2003).

Abnormal mucociliary clearance occurs in COPD, causing increased mucous which

leads to mucous plugging and airflow obstruction. This mucociliary dysfunction is a

consequence of mucous hypersecretion from goblet cell hyperplasia, metaplasia and

subsequent stimulus for mucous release, altered types of mucin expressed, and the decrease

of ciliary function from the shortening and loss of cilia. The number of mucin-producing

cells is markedly increased in COPD airways as a result of goblet cell hyperplasia and

metaplasia, as well as the trans-differentiation of both ciliated and Club cells into the

secretory cell type (Rogers, 2005). In addition, an increased quantity and altered

composition of mucous are seen in COPD. Under the normal condition, Muc5AC and

Muc5B are the predominant mucins that are expressed in goblet cells and mucosal gland,

respectively. In COPD, the ratio of Muc5B/Muc5AC increases as Muc5B is expressed in

both goblet and glandular cells (Rose and Voynow, 2006). As seen in cystic fibrosis (CF),

there is an increase of viscosity of mucus found in COPD, which is partially due to CFTR

dysfunction (Cantin et al., 2006). Furthermore, the dysfunction of ciliated epithelium as a

result of the decreased number of ciliated cells and shortened cilia contributes to mucociliary

dysfunction in COPD (Lam et al., 2013).

1.2.1.1.2.3 Aberrant repair of airway epithelium

In response to injury, the airway epithelium initiates endogenous repair process to

replenish the pool of epithelial cells and restore lung function. EMT is seen in normal tissue

repair process, characterized by the loss of epithelial markers (e.g. E-cadherin) and gain of

mesenchymal markers including vimentin, alpha smooth muscle actin and fibroblastic-

specific protein 1/S100A4 (Kalluri and Weinberg, 2009). A proper EMT, which is mainly

driven by TGF-β, EGF, and fibroblast growth factors, allows cell migration and the secretion

of the extracellular-matrix (ECM) products to restore the damaged epithelial barrier.

However, EMT is also involved in the development of fibrosis due to the excessive

propagation of ECM materials produced in response to the constitutive inflammatory insults

10

(Kalluri and Weinberg, 2009). Studies showed EMT plays a crucial role in the pathogenesis

of COPD that persistent EMT presents in the large and small airways of COPD subjects

(Milara et al., 2013; Sohal et al., 2010) and contributes to the development of airway fibrosis

in the COPD subjects with severity of airway obstruction (Gohy et al., 2015). Furthermore,

squamous metaplasia is observed in the bronchial epithelium of COPD lungs. These

mataplasic squamous cells produce large amount of IL-1β which results in the EMT-

associated fibrosis and small airways remodeling via the TGF-β pathway (Araya et al.,

2007). Importantly, both squamous metaplasia and EMT alter cell polarity and adhesion,

causing fibroblast proliferation, secretory-cell hyperplasia, and smooth muscle hypertrophy.

Taken together, the airway epithelium plays a crucial role in the pathogenesis of COPD due

to the dysregulation of the epithelium barrier resulting in the failure to protect airways from

prolonged pathogen insults and tissue repair. Thus, a better understanding of the underlying

pathophysiology of COPD and the restoration of a functional epithelium in COPD will be

the targets in future studies.

1.2.1.2 Asthma

Asthma, a chronic lung disease, features respiratory distress with airway

inflammation and airflow obstruction. The increased incidence of asthma over the past

decades is correlated with the increased inhaled environmental stimuli. As the host defense

barrier, healthy airway epithelium effectively clears out the majority of inhaled substances.

Once this epithelium barrier is broken-down, the following inflammatory response is

initiated to protect the internal milieu of the lungs. In asthma, the structure and function of

the airway epithelium become abnormal. Similar to that of COPD, the disruption of

epithelium structure is found in asthma, accompanied with an increased number of mucin-

producing cells compared to normal airways. Functionally, the airway epithelium barrier in

asthma lungs is breached and become more permeable and susceptible to the oxidative

products, resulting a deficient immune response that fails to protect the lungs from virus

infection. Therefore, the disruption and dysfunction of airway epithelium play a crucial role

in the development and progression asthma.

11

1.2.1.2.1 Epithelium alteration and dysfunction

In asthmatic airways, the epithelium structure is altered with marked loss of

columnar epithelial cells and goblet cells hyperplasia and metaplasia (Ordoñez et al., 2001).

In addition, the barrier function of asthmatic epithelium changes so the epithelium becomes

more permeable and susceptible to the oxidative stress from inhaled stimuli, including

allergens, airborne particulates, infectious agents, and noxious gases. These barrier function

defects in asthma are caused by genetic or /and the alteration of junctional complex proteins.

Studies of epithelial junctional complexes in the biopsies from subjects with asthma showed

the remarkable reductions of α-catenin, β-catenin, E-cadherin, and ZO-1 compared with lung

tissues from non-asthmatic controls (Hackett et al., 2013). In addition, Claudin 18, one of

the key tight junction proteins, was also significantly down-regulated in epithelial cells

brushed from asthmatic airways (Sweerus et al., 2017). Moreover, studies have identified

PCHD1, IL-33, and ORMDL3, genes that are expressed in the airway epithelial cells, as

being closely associated with the increased susceptibility of asthmatic lungs to inhaled

substances.

The airway epithelium is also a key component of the immune system with the

ability of regulating the protective activities of inflammatory cells (Swindle et al., 2009).

Thus, the breakdown of the epithelium barrier is also attributed to the deficient innate

immune response to virus infection in asthma (Xiao et al., 2011). In addition, the

dysregulation of the stem cell population is observed in asthmatic epithelium reflecting an

abnormal repair response. Although stem cells increase up to 40 times in number in

asthmatic lungs compared to that in normal lungs, asthmatic lungs still fail to efficiently

restore the function of injured lungs (Hackett et al., 2008).

1.2.1.2.2 Dysregulation of epithelium-mesenchymal network

In the airways, epithelium and the underlying fibroblast sheath are functionally

accompanied to control the microenvironment during lung growth and development, in

response to injury and during tissue repair. During normal repair process, epithelial cell

located at the edges of the wound undergo EMT and these epithelial-derived mesenchymal-

like cells migrate into the matrix to temporally restore the barrier function. Meanwhile, the

underlying fibroblasts proliferate and differentiate to myofibroblasts to support the injured

12

epithelium surface. Following the efficient restoration of the epithelial barrier, the remaining

epithelial cells differentiate to mucin-producing cells and later to ciliated cells to restore the

epithelial surface and mucoclilary clearance. Thereafter, the myofibroblasts undergo

apoptosis and the extracellular matrix is remodeled to normal architecture (Crosby and

Waters, 2010).

In asthma, this epithelial-mesenchymal network is dysregulated and results in

aberrant repair and airway remodeling. As mentioned before, the activation of EGFR

regulates cell proliferation and migration which plays a critical role during normal tissue

repair (Xiao et al., 2012). However, in asthmatic lungs, there is a markedly increased

expression of EGFR which is responsible for the impeded reparative response (Fedorov et

al., 2005). Concurrently, the cell cycle inhibitor genes (e.g. P21 waf1) are upregulated in

asthmatic lungs (Puddicombe et al., 2003). These may directly contribute to

hyperprolifeation of the stem cell population seen in the asthmatic epithelium. Furthermore,

studies using bronchial biopsy specimens from children with asthma showed the correlation

of the overexpression of EGFR with the extensive collagen deposition indicating the

abnormal communication between asthmatic epithelium with the underlying fibroblasts

(Fedorov et al., 2005).

1.2.1.2.3 Current treatments of asthmatic epithelium

Epithelium dysfunction has been considered as a main driver in the initiation and

progression of asthma. Therefore, current approaches to treating asthma focus on the

restoration of the barrier function of the epithelium to inhaled insults. As asthmatic

epithelium suffers from cycled oxidative stress, tight control of pollution while exercising

and antioxidant therapy would be beneficial to protect the epithelial barrier. Studies of the

response of asthmatic lungs to viral infection suggest that IFN replacement might decrease

the severity of viral infection and regulate immune pathway (Kroegel et al., 2009). To

reestablish the damaged tight junction of injured epithelium, studies showed apical

application of supplemental epidermal growth factor (EGF) which can increase tight

junction formation of columnar epithelial cells and maintain epithelial integrity, maybe

beneficial. Although EGF stimulates cell proliferation, a tight control of the amount and

13

length of apical delivery of EGF could be ideal as the intact tight junctions could prevent

excessive EGF penetrating across the epithelium (Sinha et al., 2003).

In future studies, a better understanding of the underlying mechanisms of epithelial

barrier dysfunction in asthma will be an important advance and will help the development of

specific therapies to maintain and restore the protective function of asthmatic epithelium is

required.

1.2.1.3 Cystic fibrosis

Cystic fibrosis (CF) is a lethal genetic disease characterized by obstructive

pulmonary disorder and pancreatic insufficiency (Davis, 2006). The progressive obstructive

pulmonary disease, which is responsible for the high mortality in CF patients, features

airway obstruction, thick mucus production, extensive inflammation and defects in host

defense to pathogen (Elborn, 2016). CF is caused by the defect of the CF transmembrane

conductance regulator protein (CFTR). In the airways, defect of CFTR causes aberrant

chloride ion transport (Quinton, 1983; Welsh and Liedtke, 1986) and alterations in surface

fluid, mucus and host defenses resulting in chronic airway infection and occlusion. Thus,

CFTR has been a target gene for development of gene therapies treating CF, although no

successful approach has yet been proven. In addition to the CFTR gene itself, the epigenetic

and microbiological interactions are closely associated with CFTR defects and contribute to

the progression and this complex multi-systemic disorder (Elborn, 2016).

1.2.1.3.1 Defects of CFTR gene and protein

Cystic fibrosis transmembrane conductance regulator (CFTR), mainly expressed in

the apical surface of the ciliated epithelium in the lung, encodes a cAMP-regulated chloride

channel that plays a critical role in regulating chloride and water transport. There is also

evidence suggesting that CFTR may transport bicarbonate and glutathione (Schwiebert et

al., 1999) and interact with ENaC to maintain the airway surface liquid (ASL) (Knowles et

al., 1983).

To date, mutation of the CFTR gene has been extensively studied showing over 1800

mutations, though the effects on CFTR protein function with many of these mutations have

not yet been fully understood (Castellani et al., 2008). These effects of these mutations range

14

from a completely deficient CFTR protein to a functional CFTR protein with insufficient

quantities. It is known that the prevalence of mutation depends on the race and region. In

North America, the most common CFTR mutation is the loss of phenylalanine at codon 508-

ΔF508. Approximately, 90% of CF patients only have one copy of ΔF508 with 50% of them

homozygous for this mutation. The ΔF508 mutation results in misfolded CFTR protein that

fails to reach the apical surface to function normally (Rohlfs et al., 2011). Notably, there is

significant individual variability in lung functions of the patients homozygous for ΔF508.

Nevertheless, manipulation of CFTR modulators and application of supplemental functional

CFTR protein are the important aspect in the development of therapies treating CF.

1.2.1.3.2 Epithelium dysfunction attributes to the adaptive and

innate immune defect

In addition to causing a failure of the host defense, the dysregulation of airway

epithelium contributes to the innate immune dysfunction seen in CF.

The epithelium interacts with inhaled infection substances, modulates airway fluid

clearance and is able to resists infection and recruit immune cells to infected areas by the

secretion of anti-infective proteins, including defensins and anti-microbial enzymes and

chemotactic products (Hiemstra et al., 2015). The neutralization of infectious insults relies

on the neurophils migrating through the epithelium to the airway (Whitsett and Alenghat,

2015). Neutrophil is the main component of the adaptive immune system in the airways

which function to clear infective substances by producing reactive oxygen species, protease

and cytokines (Gifford and Chalmers, 2014; Twigg et al., 2015). To the airway epithelium,

elastase secreted by neurophils is a destructive protease which decreases ciliary beating

frequency, increases permeability of epithelial barrier (Peterson et al., 1995), and stimulates

epithelium to produce cytokines (Taggart et al., 2000). Therefore, the activity of neutrophils

could be a source of epithelial dysfunction in CF. For example, the pro-inflammatory

cytokines secreted by CF neutrophils, including IL-1, IL-6, IL-8, IL-17, CCL10, and

CXCL10, affect the ability of airway epithelial cells to recruit other types of immune cells

(Taylor et al., 2016). Importantly, studies showed many of these cytokines destroy epithelial

tight junctions and cause epithelial barrier dysregulation in ion and fluid balance, as well as

metabolites in response to infection in CF lungs (Molina et al., 2015).

15

1.2.1.3.3 Cystic fibrosis disease models

Disease models are critical in understanding the pathophysiological mechanisms

underlying the disease and to develop therapeutic strategies.

1.2.1.3.3.1 In vivo CF models

Mouse models are the most commonly used in in vivo CF studies. There are over 15

strains of mice have developed, including the simple deletion of the mouse CFTR and ENaC

genes (Fisher et al., 2011). Although mouse models could present many of the

manifestations of human CF, including epithelium dysfunction and exaggerated immune

response, they fail to faithfully replicate the human CF pathophysiology (Scholte et al.,

2004).

Thus, great efforts have been placed on creating new in vivo models in larger

animals, including rats, ferrets, and pigs (Rogers et al., 2008). Pigs are specifically important

for studying CF as pigs have a longer lifespan compared to other species; the size and

structure of pig lungs resemble that of human lungs; and CF pigs develop CF-related

pancreatic disease similar to that in human CF patients (Lavelle et al., 2016). One of the

major differences between mice and human airways is that mouse airways lack of

submucosal glands. CF pig studies are able to show submucosal glands contribute to CF

airway dysfunction by aberrant mucus production (Hoegger et al., 2014). In addition, the

recurrent and progression of infected bacteria colonization is one of the phenotypic

pathological changes in human CF that is absent in mouse models. The increased

colonization of bacterial infection is aided once the airway surface liquid PH is acidified.

Mouse models fail to replicate the acidification of human CF airways because of the lack of

the nongastric H+/K+ adenosine triphosphatase (ATP12A) protein, which is the key

hydrogen-potassium exchanger. In contrast, the CF pig model is able to replicate the airway

acidification in human CF and show CFTR deficiency contributes to the increased bacterial

colonization in the airways (Shah et al., 2016).

1.2.1.3.3.2 In vitro CF models

In vitro, models of epithelial cells and immune cells are important for understanding

the cell molecular mechanisms underlying CF and identification of potential therapeutic

16

targets. Primary epithelial cells isolated from human bronchial, tracheal and nasal epithelial

cells have been used in in vitro CF studies (Fulcher and Randell, 2013). Many of the initial

studies of CFTR used epithelial cell lines generated from cells isolated from donor lungs or

cancerous tissue upon viral transduction to overexpress mutant CFTR genes. However, the

cells of origin and their deviance from normal cell physiology limit their ability to faithfully

replicate the physiology/pathophysiology of epithelial cells in CF (Molenda et al., 2014).

Human epithelial cells are poorly grown under regular cell culture condition. To date, much

progress has been made in derivation of human epithelial cells by conditional

reprogramming (Reynolds et al., 2016) or multi-step differentiation of pluripotent cells

(Huang et al., 2013a; Zhou et al., 2014). However, in regards to the significant individual

variability in CF patients, identification of the effective drug combination for individual

patients relays on responses of their own cells to the drugs. Thus, the progress of

personalized medicines (individual patient-directed therapy) acquires new techniques that

allow larger scale expansion of epithelial cells while retaining the genotype of each patient.

1.2.2 Restrictive lung diseases

1.2.2.1 Interstitial lung disease-idiopathic pulmonary fibrosis

Idiopathic pulmonary fibrosis (IPF) is an irreversible, fatal interstitial lung disease

characterized by progressive decline in lung function with death occurring in most patients

within 5 years of diagnosis. The precise molecular mechanisms underlying the progressive

fibrosis which leads to the relentless destruction of the lungs are still not completely

understood. However, increasing evidence suggests that the pathogenesis of IPF is driven by

alveolar epithelial cell dysfunction, followed by aberrant regeneration of epithelium,

persistent activation of fibroblasts and alterations in epithelial-mesenchymal communication

with the extracellular matrix (ECM), together resulting in the disruption of architecture and

progressive loss of lung function (King et al., 2011; Yanagi et al., 2015; Zoz et al., 2011a).

Currently, medical therapy for IPF is limited and lung transplantation is the only option for

patients with end-stage IPF (Akram et al., 2014; Lomas et al., 2012). Clinical studies of

Pirfenidone and Nintedanib, the two anti-fibrotic drug approved by FDA for IPF, showed no

evidence on arresting or reversing fibrosis (King et al., 2014; Richeldi et al., 2014).

17

1.2.2.1.1 Profoundly altered differentiation of alveolar epithelial

cells in IPF

In response to injury, AEC-II stem cells undergo self-renewal and differentiate to

AEC-I cells to replenish the damaged alveolar epithelial pool. However, differentiation of

AEC-II to AEC-I cells is profoundly altered in IPF airway, as a result of the vast

abnormalities in ECM, epithelial basement membrane damages and destruction of the

airway architecture. The ECM is not only a supportive structure but also functions to

regulate cell proliferation and differentiation. It has been shown that changes in ECM

component influence the morphology, the phenotype of alveolar epithelial cells and the

differentiation of AEC-II to AEC-I-like cells (Olsen et al., 2005). In addition, mechanical

changes have been shown to regulate AEC phenotype. For instance, mechanical distension

in favor of the AEC-I cell phenotype and inhibit the AEC-II phenotype, while contraction

promotes AEC-II phenotype (Dobbs and Gutierrez, 2001).

Furthermore, many growth factors and cytokines produced in response to injury can

influence AEC-II differentiation. For instance, keratinocyte growth factor (KGF) which is an

epithelial mitogen can induce apoptosis and differentiation of hyperplasic AEC-II cells to

restore the normal alveolar epithelium in vivo (Fehrenbach et al., 1999). In addition, insulin

growth factor (IGF) signaling has been found to regulate the differentiation of AEC-II cells

to AEC-I-like cells. The inhibition of IGF receptors in AEC-II cells derived from hyperoxia-

exposed lung is able to maintain the AEC-II phenotype without the transdifferentiation to

AEC-I-like cells (Narasaraju et al., 2006). The activity of leukotriene A4 (LTA4) hydrolase

has also been linked to AEC-II to AEC-I differentiation. In normal AEC-IIs and the ones

located in the fibrotic regions of IPF airways, LTA4 hydrolase is predominantly expressed in

the nucleus. While in AEC-I and AEC-II-derived AEC-I-like cells, LTA4 hydrolase

accumulates in the cytoplasm, suggesting nuclear export of LTA4 hydrolase influences

AEC-II differentiation (Brock et al., 2005).

1.2.2.1.2 Epithelial cells contribute to the profibrotic

microenvironment

Epithelial cells can induce fibroblast activation, proliferation, and migration as well

as ECM accumulation in IPF by secreting platelet-derived growth factor, TGF-, connective

18

tissue growth factor, tumor necrosis factor α, endothelin-1, and osteopontin (Pardo et al.,

2005). Polarized T cells regulate lung fibrosis by secreting cytokines, including interleukin 4

(IL-4) and IL-13, which induce fibroblast proliferation and accumulation of ECM. There is

evidence showing that AEC-II cells can also produce IL-4 in IPF potentially causing the

imbalance of profibrogenic cytokines. In addition to providing activation signals to

mesenchymal cells, injured epithelium fail to suppress fibroblasts due to the decreased

production of PGE2 and two cyclooxygenase (COX) enzymes, COX-1 and COX-2 (Lama et

al., 2002; Petkova et al., 2003).

1.2.2.1.3 Mechanisms of epithelium damage

In IPF, the combination of various types of injuries repeatedly acts on AEC cells and

results in epithelium dysfunction and aberrant repair.

1.2.2.1.3.1 Viral infection

Viral infection has been considered to be one of the major sources causing repetitive

injury to alveolar epithelium. While the involvement of some specific virus in IPF is not

universal, the etiologic significance needs to be further evaluated.

The Epstein-Barr virus (EBV) has been identified in the human IPF lung tissues that

mainly infects AECs and promotes the development of pulmonary fibrosis (Egan et al.,

1995; Lok et al., 2002). A study on the presence of eight herpesviruses in human IPF lung

tissues showed one or more of four herpesviruses, including cytomegalovirus, EBV, human

herpesvirus (HHV)-7 and HHV-8, were detected in all IPF lung tissues. Furthermore,

detection of viral antigens expression in lung sections showed EBV and HHV-8 infection

localized to AECs (Tang et al., 2003).

1.2.2.1.3.2 Induced apoptosis

Epithelial cell apoptosis is an essential feature of IPF. Studies showed that the up-

regulation of Fas signaling and the angiotensin peptides produced by fibroblasts induce

alveolar epithelial cell apoptosis (Selman and Pardo, 2003). Oxidative stress also induces

damages in epithelial cells. In response to injury, H2O2 produced by myofibroblasts acts as

an apoptosis signal on epithelial cells. Moreover, oxidative stress and reactive oxygen

19

species cause DNA modifications in AECs and result in cell damage and apoptosis

(Waghray et al., 2005).

1.2.2.1.3.3 Telomerase mutation and telomere dysfunction

To date, an increasing body of evidence has shown the intrinsic abnormalities in

alveolar epithelial cells contributing to the development and progression of IPF. Mutations

in telomerase have been identified to be the most common genetic risk factor for IPF.

Telomeres protect the chromosome ends for DNA repair and degradation activities

and telomerase is the enzyme responsible for maintaining telomere length and for cell self-

renewal (Blackburn et al., 2006). Telomerase has two major components: hTERT, the

telomerase reverse transcriptase, and hTR, a specialized RNA has a template for telomere

repeat addition. The genetic defect caused by mutations in hTERT and hTR accounts for 8-

15% of IPF familial cases (Armanios, 2012-37,38).

IPF is an age-related disease in that the majority of patients are age 60 or older

(Raghu et al., 2006). Telomeres and telomerase are susceptible to age-related deterioration.

Studies using genetically modified animal models have demonstrated the causal links of

telomere dysfunction, cellular senescence and aging. Although telomere attrition manifests

during normal physiological aging, pathological telomere dysfunction provokes aging

(Blackburn et al., 2006; Flores and Blasco, 2010) and plays a causal role in premature

development of various human diseases, including IPF (Tsakiri et al., 2007; Cronkhite et al.,

2008). The mechanisms of telomere defects provoking IPF are not fully understood, but

numbers of evidence has revealed the causal links of telomere defects with epithelial

dysfunction observed in IPF (Alder et al., 2008; Zoz et al., 2011b). Importantly, mutations in

telomerase and telomere genes cause abnormal telomere shortening. The shortening of

telomere length is a common feature of IPF observed in lymphocytes, granulocytes as well

as alveolar epithelial cells, even when no mutations in telomerase genes are detected (Alder

et al., 2008). AEC-II cells are the distal stem cells that response to injury and replenish the

alveolar epithelial pool. Recent studies using telomeric repeat-binding factor 2 (Trf2) mutant

mice model (de Lange, 2009) demonstrated that the telomere dysfunction restricted to AEC-

II cells caused their stem cell function failure by inducing senescence and contributed to the

pathogenesis of IPF (Alder et al., 2015; Chen et al., 2015).

20

1.2.2.1.4 Cell-based therapeutic approaches for treating IPF

To date, numerous putative distal stem cell populations have been described that are

able to self-renew and repair damaged epithelium in response to certain types of injury

(Barkauskas et al., 2013b; Chapman et al., 2011; Jain et al., 2015; Kim et al., 2005;

McQualter et al., 2010; Teisanu et al., 2011; Vaughan et al., 2014). However, these cells are

rare, which limits their expansion, and they usually change rapidly upon in vitro culture

(Bertoncello and McQualter, 2010; Kosmider et al., 2011; Liebler et al., 2016; Raiser and

Kim, 2009). Importantly, these endogenous stem cell populations are limited in number and

function in certain pathological conditions (Randell, 2006). Thus, recent focus has been

placed on using exogenous cell-based therapeutic approaches for ameliorating pulmonary

fibrosis. Tremendous efforts have been made in application of bone marrow (BMC) cells

(Ghadiri et al., 2016; Kotton et al., 2005; Weiss, 2014), mesenchymal stromal (MSC) cells

(Cargnoni et al., 2009; Ortiz et al., 2003; Tashiro et al., 2015; Toonkel et al., 2013) and

respiratory epithelial cells derived from pluripotent sources such as embryonic stem (ESC)

and induced pluripotent stem (iPS) cells (Ghaedi et al., 2013; Gotoh et al., 2014; Huang et

al., 2013a; Zhou et al., 2014).

Studies argued against the direct contribution of bone marrow derived circulating

cells to epithelial lineage. Kotton et. al. (Kotton et al., 2005) showed there was no detectable

reconstitution of injured epithelium by unfractionated bone marrow cells or purified

hematopoietic stem cells transplanted to the recipients subjected to bleomycin-induced lung

injury.

Amongst these cell sources, MSCs have advantages as a practical source for use in

cell-based therapies for lung disease. The vast majority of studies report some biological

effects after MSC delivery during the early inflammatory phase of bleomycin-induced

pulmonary fibrosis. However, low levels of cell engraftment or retention suggest a

paracrine-based mechanisms of action responsible for repair (Kumamoto et al., 2009; Lee et

al., 2012; Ortiz et al., 2003).

In contrary, freshly isolated AEC-II cells appear to be effective even after

administration in later stages of IPF where fibrosis is prevalent (Serrano-Mollar et al.,

2007),(Serrano-Mollar et al., 2016). Nevertheless, the practical usages of freshly isolated

21

AEC-IIs are limited by donor availability and maintenance in culture (Kosmider et al., 2011;

Liebler et al., 2016).

Numerous studies have shown the successful derivation of distal epithelial cells from

directed differentiation of ESC and iPS cells (Ghaedi et al., 2013; Gotoh et al., 2014; Huang

et al., 2013a; Zhou et al., 2014). However, current differentiation protocols remain limited

by the yield and purity of AEC-II cells and the potential risk of tumorigenicity of the

contaminated undifferentiated cells needs to be addressed for clinic-relevant applications

(Kimbrel and Lanza, 2015; Shi et al., 2016).

1.2.3 Acute respiratory distress syndrome (ARDS)

ARDS, firstly described in 1967 (Ashbaugh et al., 1967), is clinically characterized

by bilateral infiltrates and hypoxemia attributed to acute non-cardiogenic pulmonary edema

(Matthay et al., 2012; Spragg et al., 2010). ARDS, with a morality of 22%-40%, is a

heterogeneous syndrome as a result of diverse etiologies, including pneumonia, sepsis,

trauma, pancreatitis, aspiration, transfusion related acute lung injury, and ventilation induced

lung injury (Matthay et al., 2012).

One of the pathophysiologic hallmarks of ARDS is the alveolar epithelium injury.

The extent of epithelium injury correlates with severity of the disease (Nakamura et al.,

2011) and its repair is a predictive factor of clinical recovery (Ware and Matthay, 2001)

During ARDS, the injury to alveolar epithelium results in the impairment of barrier

function with an enhanced permeability that results in the airspaces being flooded with

protein fluid (Wiener-Kronish et al., 1991). In addition, other impairments of epithelial

functions are observed, including surfactant deficiency (Gregory et al., 1991; Ingenito et al.,

2001) causing alveolar atelectasis and impaired ion and fluid transport resulting in failure in

edema fluid clearance (Ware and Matthay, 2001). While the direct injury to the alveolar

epithelium occurs in some of the cases of ARDS by certain insults, the inflammatory

induced epithelium injury is universally implicated in ARDS. Although no specific

pharmacologic treatments to restore injured epithelium has yet been developed, the

supportive management therapy including low tidal volume ventilation and fluid restriction

has been reported to improve the survival of ARDS patients (National Heart, Lung, and

22

Blood Institute Acute Respiratory Distress Syndrome (ARDS) Clinical Trials Network et al.,

2006).

1.2.3.1 Damage in epithelial tight junctions

The expression of tight junction proteins in epithelium correlates with barrier

function and is critical to barrier integrity. Studies using animal models of ARDS showed

decreased expression levels of claudins and occludins in alveolar epithelial cells after injury

(Ohta et al., 2012). Specifically, the downregulation of claudin 4 and 5 results in an impaired

interaction with claudin 18 and ZO-1 that decreases epithelial barrier function and

contributes to the development of ARDS (Moss et al., 1996). In addition, the altered

expression of PTEN responding to severe injury has been proposed as another underlying

mechanism disassembly of epithelial tight junctions. Targeted deletion of PTEN in AEC-II

cells causes marked downregulation of claudin 4 and E-cadherin and results in aberrant

alveolar flooding (Miyoshi et al., 2013).

1.2.3.2 Apoptosis of alveolar epithelial cells

The loss of functional alveolar epithelial pool is another dominant feature of ARDS.

In addition to the alteration in epithelial tight junction protein expression, the injury-induced

alveolar epithelial cell death contributes to the barrier dysfunction. Studies of epithelial

injury during ARDS showed AEC-I cells are particularly susceptible to injury while AEC-

IIs damages are also observed (Bachofen and Weibel, 1982).

Apoptosis of alveolar epithelial cells has been observed in the lungs of ARDS

patients and animal models of ARDS induced by LPS, bacterial, virus and so on (Imai et al.,

2003). It's known that apoptosis occurs by the activation of extrinsic (e.g. death receptors) or

intrinsic (e.g. mitochondrial damage) pathways. Fas, one of the classic extrinsic death

receptors, binds cell surface by its ligand FasL to induce apoptosis. High levels of FasL have

been detected in the alveolar epithelial cells from ARDS patients and animal models of

ARDS. The beneficial effect of prevention of apoptosis has been demonstrated that

inhibition of apoptosis pathways attenuates lung injury in animal models of ARDS

(Budinger et al., 2011).

23

1.2.3.3 Direct injury to alveolar epithelium

Direct injury to alveolar epithelium is found in some causes of ARDS depending on

the types of the insults. Mechanical stress, such as mechanical ventilation, can cause direct

injury to epithelium. Mechanical stress induces necrosis of epithelial cells and activation of

some specific inflammatory signaling pathways in epithelial cells which in turn causes the

secondary inflammatory injury (Slutsky and Ranieri, 2013). Mechanical ventilation can

cause lung overdistention and disrupt epithelial tight junctions and adherent junctions (Wang

et al., 2011). The correlation of ventilation and induced epithelial injury has been examined

in animal models showing high tidal volume ventilation provokes epithelial injury while low

tidal volume ventilation is able to reduce the damage in epithelium (Slutsky and Ranieri,

2013). Likewise, decreased epithelium injury is observed in ARDS patients treated with low

tidal volume ventilation.

Viral infection can cause pneumonia which is the most common etiology of ARDS.

Particularly, influenza virus infection results in both direct and inflammatory injury to

epithelium. The type of epithelial cells which influenza viruses target is related to the

specificity of the hemagglutinin (HA) expressed on the surface of the virus and the specific

sialic acid residing on the epithelial cell surface (Herold et al., 2015). Avian influenza

viruses preferentially infect AEC-II cells and cause pneumonia. Once HA binds to sialic

acid, virus enter AEC-II cells by endocytosis, replicate, and release viral particles causing

AEC-II cell death (Hashimoto et al., 2007).

Bacterial infection can cause direct injury to epithelial cells by their exotoxins, in

addition to inducing inflammatory injury. For instance, pseudomonas produces exoenzymes

resulting in lysis of epithelial cells. These exoenzymes disrupt integrin survival signalling

and activate intrinsic apoptosis pathways (Wood et al., 2015) causing epithelial cell death.

Gram-positive infection also induces alveolar epithelial cells lysis by their toxins (e.g.

pneumolysin) forming transmembrane pores in host epithelial cells (Rubins and Janoff,

1998). Besides exoenzymes, hydrogen peroxide released from bacterial causes DNA damage

in alveolar epithelial cells and results in apoptosis (Rai et al., 2015).

24

1.2.3.4 Inflammatory-induced epithelial injury

The inflammatory-induced damage in epithelium is broadly implicated in the

pathogenesis of ARDS. Among all types of inflammatory cells, the most strongly implicated

in ARDS are neutrophils, of which the number correlates with the mortality of ARDS

patients. In response to injury, neutrophils are recruited to airway spaces and activated to

participate in host defense via phagocytosis and secretion of mediators killing pathogens

(Zemans et al., 2009). A growing body of evidence from animal studies showed that the

dysregulation of neutrophils, as the case seen in ARDS, results in injury to the alveolar

epithelium. Furthermore, in various animal models of ARDS (e.g. LPS, virus, bacteria,

surfactant depletion, VILI-induced ARDS), inhibition of neutrophil migration or depletion

of neutrophils can prevent the progression of epithelial injury showing a reduction of fluid

and protein content in the bronchioalveolar lavage (BAL) fluid (José et al., 2015; Koma et

al., 2014).

In addition to neutrophils, monocyte-derived cells can affect the injury to epithelium.

Studies showed a sub-population of monocyte-derived dendritic cells, which express antigen

to cytotoxic CD8+ T cells, contributes to epithelium injury during viral infection (Aldridge

et al., 2009). The effects of monocyte-derived macrophages on epithelium injury are

conflicting. In animal model of ARDS induced by LPS, recruited monocyte-derived

macrophages act as a protective role which can significantly reduce epithelial cell apoptosis

by producing IL-1 receptor antagonist production (Herold et al., 2011). However, monocyte-

derived macrophages can also induce apoptosis of epithelial cells by interacting with death

receptors on the surface of epithelial cells. During influenza infection, blockage of the

recruited macrophages protects epithelium against injury induced by virus (Lin et al., 2011).

Thus, future studies need to dissect the distinct subpopulations of macrophages based on

their response to specific injuries.

1.2.3.5 Epithelium repair in ARDS

In alveolar epithelium, AEC-I cells are more susceptible to injury while AEC-II cells

are also damaged in severe injury, particularly when pathogens preferentially infect AEC-II

cells (e.g. Avian influenza viruses). In mild lung injury, when AEC-IIs largely survive,

surviving AEC-II cells function as distal stem cells that are able to proliferate and

25

transdifferentiate to AEC-I cells to effectively replenish the alveolar epithelium (Barkauskas

et al., 2013).

The ability of AEC-IIs-derived AEC-I cells to replace lost AEC-I cells requires

sufficient cell spreading. Cell spreading is limited in certain circumstances (e.g. ventilation

induced acute lung injury) (Crosby et al., 2011) due to the altered expression of factors

regulating cell spreading, such as β-catenin (Zemans et al., 2013), KGF (Waters and Savla,

1999), and PTEN inhibition (Mihai et al., 2012).

In more severe cases of injury, with the loss of huge numbers of AEC-IIs as seen in

influenza infection (Zuo et al., 2014) or genetic disorder (Lawson et al., 2011), the

regeneration of injured alveolar epithelium relies on the mobilization of an alternative stem

cell population and their ability to differentiate to AEC-I and AEC-II cells (Barkauskas et

al., 2013). Particularly, recent animal studies of influenza virus infection specifically targets

AEC-II cells showed that a Krt5+ basal-like population contributes to the repair of injured

alveolar epithelium which may migrate from upper airways or derived from a rare lineage

negative epithelial stem/progenitor (LNEP) cells (Chapman et al., 2011; Vaughan et al.,

2014). However, the existence of these putative stem cells in human lungs and their

reparative capacity in human ARDS still remain to be determined.

A subset of ARDS patients with high mortality developed excessive fibrosis and

collagen deposition in their lung caused by the aberrant repair (Horowitz et al., 2006;

Marshall et al., 2000).

In summary, alveolar epithelial cells play a crucial role in the pathogenesis of ARDS.

During ARDS, the disruption of the epithelial barrier is attributed to damage to tight

junctions and the loss of functional epithelial cells. The direct and inflammatory injury to the

epithelium can result in impaired epithelium regeneration and patient mortality. Although

the supportive management therapy, including low tidal volume ventilation and fluid

restriction, has been reported to improve the outcome of ARDS patients, effective

therapeutic approaches to attenuate inflammatory injury and repair damaged alveolar

epithelium need to be the goal of future studies.

26

1.3 Stem cells in lung epithelial regeneration

Lung stem cells play a crucial role in maintaining lung homeostasis and regeneration.

The cellular turnover of the adult lung during homeostasis is remarkably slow. However,

facultative endogenous lung stem cells which are normally quiescent but become activated

in response to injury or insult, undergo self-renew and differentiate to desired progeny to

regenerate the damaged lungs (Beers and Morrisey, 2011). Disruption of this reparative

process leads to fibroproliferation, aberrant tissue remodeling and lung dysfunction

contributing to the pathogenesis of many pulmonary diseases (Beers and Morrisey, 2011;

Wansleeben et al., 2013a). Recent advances in the identification of specialised putative lung

stem cell populations by in vivo lineage tracing approach and development of organiod

cultures have increased our knowledge about the presence and regenerative potential of lung

stem cells.

1.3.1 Stem cells category

Stem cells are characterized by their ability to divide (self-renew) and differentiate

into progeny. All stem cells can be categorized into five groups according to their

differentiation potential: totipotent, pluripotenty, multipotent, oligopotent and unipotent.

Totipotent cells, like zygote and early embryonic cells, are able to give rise to any cell type

during development. Pluripotent cells have the ability to give rise to all of the cell types of

three germ layers (ectoderm, mesoderm and endoderm), such as embryonic stem cells

(ESCs) and induced pluripotent stem (iPS) cells. Multipotent cells, which have a more

limited differentiation potential, can development to more than one cell types. Oligopotent

cells, such as lineage stem cells, differentiate to two or more mature cell types. Unipotent

cells can only give rise to one cell type (Smith, 2006). Most of the defined endogenous lung

stem cells are multipotent or oligopotent cells, while AEC-II stem cells are unipotent that

only give rise to AEC-I cells (Barkauskas et al., 2013).

1.3.2 Adult stem cell hierarchy

In the classical stem cell hierarchy, the adult stem cells function to maintain tissue

homeostasis and can give rise to transit-amplifying cells which are relatively

undifferentiated and able to self-renew. In nonclassical stem cell hierarchy, the adult stem

27

cells only participate in tissue repair process in response to injury, but not in the

maintenance of tissue under normal conditions.

1.3.3 Endogenous lung stem cells

A number of studies in both mouse lineage tracing models and human lung tissues

describe multiple specialized stem cell populations in distinct anatomic locations of the adult

lung (Rock and Hogan, 2011; Wansleeben et al., 2013). These region-specific stem cell

populations reside in trachea, bronchi, bronchiolar, and alveoli to maintain lung homeostasis

or/ and participate in repair.

1.3.3.1 Basal stem cells

Basal cells, located in tracheobronchial region, are considered as one of the major

tissue-specific stem cells in the upper airways marked by the expression of transcription

factors Trp63, surface receptor NGFR, GSIβ4 lectin and cytokeratin5 (Krt5). They are able

to self-renew and give rise secretory and ciliated cells (Tata et al., 2013). In addition to

maintaining local epithelial homeostasis, basal stem cells can respond to sulfur dioxide

injury (Rock et al., 2009) or naphthalene injury (Hong, 2003), and migrate to repopulate

alveolar epithelium after H1N1 influenza infection (Kumar et al., 2011). The differentiation

of basal cells is regulated by Notch signaling which is altered in certain injury conditions.

Recent lineage tracing studies further dissect the distinct subpopulations of basal

cells and their functional differences in homeostatic and injury conditions. During

homeostasis, rare expression of Krt14 is found in either basal stem cells (BSCs) or basal

luminal precursor cells (BLPCs) both expressing Trp63 and Krt5. After injury, the

expression of Krt14 is remarkably up-regulated and the proportion of Krt5+Krt14+ cells

increases (Cole et al., 2010; Ghosh et al., 2011), suggesting Krt14 could serve as a maker for

activated basal stem cells. BLPCs are the progeny of BSCs with a lower rate of self-renewal

and differentiation, and can be distinguished from BSCs by its Krt8 expression (Watson et

al., 2015). A study using Notch transgeneic mice showed Notch3 signaling regulates the

expansion and differentiation of a basal population that the deletion of Notch3 results in an

increased number of both BSCs and Krt5+Krt8 basal cells, but not in other epithelial

lineages (Mori et al., 2015). Additionally, a new study showed Trp63+ basal cells specific

28

segregate into two distinct subpopulations-N2ICD+ (the active Notch2 intracellular domain)

and c-Myb+ cells after injury, but not in homeostatic conditions. These two basal

populations exhibit distinct differentiation potentials that N2ICD+ cells generate mature

secretory lineage cells whereas c-Myb+ cells only give rise to ciliated cells (Pardo-Saganta

et al., 2015).

1.3.3.2 Trp63+/Krt5+ basal-like stem cells

In addition to basal stem cells residing in the upper airways, other putative

Trp63+/Krt5+ basal-like stem cell populations have been found to present in the distal

airway under certain injury conditions.

Clusters of Trp63+/Krt5+ cells, termed distal alveolar stem cells (DASCs), present in

the distal airways after H1N1 influenza virus infection. In response to influenza-induced

lung injury, these DASCs are able to proliferate and differentiate to alveolar epithelial cells

to replace the damaged alveolar epithelium. Although these DASCs can express basal cell

marker, Trp63 and Krt5, they exhibit a different cell fate from the tracheal basal stem cells.

In both in vitro and in vivo, tracheal basal cells only commit to a proximal epithelial lineage

whereas the DASCs can generate alveolar epithelial cells and secretory cells (Zuo et al.,

2014). Furthermore, Krt5 lineage tracing studies demonstrate that these cells are not pre-

existing but only appear in response to injury. However, the reparative capacity of this stem

cell population for alveolar epithelium seems limited to the alveolar architecture of influenza

infected lungs, which it can only partially restore.

Another Trp63+/Krt5+ stem cell population, the lineage negative epithelial

stem/progenitor (LNEP) cells, have been proposed that are capable of regenerating

bleomycin-injured alveolar epithelium. The differentiation of this population is regulated by

Notch signaling. The activation of Notch signalling maintains their expression of Trp63 and

Krt5 and prevents the differentiation to AEC-II cells (Vaughan et al., 2014).

In conclusion, basal/basal-like cells function as tissue-specific stem cells that are able

to maintain homeostasis of the airway epithelium and/or response to injury. Future studies

need to further investigate the heterogeneity in the basal population, the underlying

molecular mechanisms and signaling pathways regulating the stem cell property of basal

29

cells, and to validate the existence and function of different subsets of basal cells in human

lungs.

1.3.3.3 Variant Club cells

After injury to Club cells in the trachea, basal cells serve as stem cells to repopulate

airways. However, if injury targets ciliated cells, Club cells become the stem cell population

responsible for repair (Hong et al., 2001).

Naphthalene is a Club cell-specific toxicant that can induce airway injury in mice.

The majority of Club cells are sensitive to naphthalene and ablated after naphthalene

exposure, while a subset of Club cells expressing secretoglobin family 1a member 1

(Scgb1a1) but not cytochrome p450, are resistant to naphthalene. Distinguished from mature

Club cells, these naphthalene-resistant Club cells are associated with neuroepithelial bodies

(NEBs) and within the bronchioalveolar duct junctions (BADJ), express lower levels of

CCSP protein, and are negative for the phase I xenobiotic enzyme Cyp2f2 (Rawlins et al.,

2009; Reynolds et al., 2000a, 2000b). These cells, termed as "variant club cells", are

designated as facultative stem cells of bronchiolar airways and are capable to self-renew to

repopulate the damaged airways by differentiating into Cyp2f2+ mature Club cells, goblet

cells and ciliated cells. The proliferation of these variant Club cells can be stimulated by

injury and is associated with NEB hyperplasia and hypertrophy (Reynolds et al., 2000b). In

addition to naphthalene models, transgenic (CCtk) mice expressing herpes simplex virus

thymidine kinase (HSVtk) under CCSP promoter have been used to control the depletion of

CCSP-expressing cells by gangcyclovir (GCV) administration. Upon GCV treatment, the

number of CCSP-expressing cells dramatically decreased whereas the number of variant

Club cell significantly increased, suggestive of a proliferative response to injury and during

repair (Hong et al., 2001; Reynolds et al., 2000a). Moreover, studies using various animal

injury models suggest that the extent and degree of injury influences the reparative response

of CCSP+ Club cells. Responding to mild injury, Club cells are activated and differentiate to

ciliated cells. In severe injury conditions, variant Club cells located around NEBs and within

the BADJ become activated to regenerate injured epithelium, which is regulated by Notch

and FGF-10 signaling (Giangreco et al., 2009).

30

1.3.3.4 Bronchioalveolar stem cells (BACs)

In the mouse lungs, another subset of Scgb1a1+ cells coexpressing the AEC-II cell

marker surfactant protein C (Sftpc) are found within the BADJ. These Scgb1a1+ / Sftpc +

cells are termed as bronchioalveolar stem cells (BASCs) which are able to expand in vivo

after bleomycin-induced lung injury. In vitro, these cells can be clonally expanded and

function as multipotent stem cells to differentiate into both bronchiolar and alveolar lineages

(Kim et al., 2005).

The differentiation potential of these cells has been extensively studied using various

lineage tracing approaches and injury models. In response to influenza and bleomycin-

induced injury, BACs are capable of differentiating AEC-II cells, although their expansion

and contribution to repair seem limited. In contrast, BACs don't contribute in alveolar

lineage reconstitution during development or hyperoxia-induced alveolar injury (Rawlins et

al., 2009b; Zheng et al., 2012). These conflicting results could attribute to different subsets

of Scgb1a1+ cells being labeled, or the different signaling pathways been activated under

certain injury conditions.

In future, advanced lineage tracing tools allowing cell-specific labelling are required

to clarify the correlation or distinction of BACs with variant club cells located within the

BADJ. Moreover, BACs are not the only cells co-expressing Scgb1a1and Sftpc. In the

alveolar regions, a subset of AEC-II, although it is rare, has been found co-expressing both

markers (Kotton and Morrisey, 2014). Thus, further evaluations are required to distinguish

BACs from those rare AEC-II cells.

1.3.3.5 Neuroendocrine cells

The airway epithelium of both human and mouse lungs contains pulmonary

neuroendocrine cells (PNEC), which are distributed as single cells and as clusters,

neuroepithelial bodies (NEB). These cells are marked by expression of calcitonin gene-

related peptide (CGRP). PENC/NEB can function as the pulmonary stem cell niche to

provide the microenvironment for stem cell populations to participate tissue repair.

Moreover, CGRP-expressing PNEC have proposed to be the stem cells in the lung. Lineage

tracing studies show these cells are able to proliferate in homeostasis and contribute to

airway epithelium regeneration by differentiating into Club and ciliated cells after

31

naphthalene injury (Song et al., 2012). However, the reparative capacity of PNEC seems

limited because they were not able to, by default, restore normal airway architecture after

depletion of Scgb1a1+ cells in the CCtk model (Hong et al., 2001).

Studies showed that PENC/NEB are invovled in the pathogenesis of small cell lung

carcinoma (SCLC) (Rawlins and Hogan, 2006) and pediatric lung diseases, such as

congenital lung disorders, bronchopulmonary dysplasia, cystic fibrosis, and pulmonary

hypertension (Cutz et al., 2007).

1.3.3.6 Alveolar type II (AEC-II) cells

Alveolar sacs where the gas exchange takes place are lined with elongated alveolar

type I (AEC-I) and cuboidal type II (AEC-II) cells. The stem cell role of AEC-II cells has

been known since the 1970s (Miller and Hook, 1990). Classically, a fraction of Sftpc-

expressing AEC-II cells is categorized as the progenitors in the distal airways. These AEC-II

cells are able to self-renew and generate AEC-I cells to replenish alveolar epithelium during

homeostasis and during repair after injury. A growing body of evidence from in vivo lineage

tracing and injury studies shows the reparative capacity of AEC-II cells in response to injury

are to proliferate and differentiate into AEC-I progeny. Even in some case of severe injury,

when large numbers of AEC-II cells are ablated, the surviving AEC-II cells can function as

stem cells to rapidly expand and spread to repair. In vitro, AEC-II cells show clonogenic

capacity to self-renew and give rise to alveolar-like spheres composed of cells expressing

AEC-I and AEC-II markers (Barkauskas et al., 2013). Recent studies using single-cell RNA

sequencing technique demonstrate that AEC-I and AEC-II cells arise from a bipotent

progenitor cell marked by the expression of homeodomain only protein x (Hopx) during

lung development; whereas, in postnatal stage, AEC-I cells are only derive from a subset of

mature AEC-II cells (Treutlein et al., 2014).

Numbers of growth factors and signaling pathways have been shown to regulate

AEC-II cell proliferation. For instance, TGF-, heparin-binding EGF, and NRG1, these

EGFR ligands can induce AEC-II cell proliferation in vitro, but do not affect the

differentiation of AEC-II to AEC-I cells. The activation of the kras signalling pathway

contributes to the proliferative response of AEC-II cells to injury in vivo (Desai et al.,

2014). Thus, the EGFR-kras pathway regulates AEC-II cell proliferation, but not the

32

differentiation. Although the molecular mechanisms underlying differentiation of AEC-II

cells into AEC-I cells are not completely understood, it has been suggested that β-catenin

signaling is involved by regulating cell spreading and flattening, which is a key component

of the regenerative capacity of AEC-II cells (Liu et al., 2015; Mutze et al., 2015; Rieger et

al., 2016).

Future comprehensive studies on different pathways and their alterations in response

to injury are required in order to better harness the therapeutic potential of AEC-IIs.

1.3.3.7 Alveolar type I (AEC-I) cells

Alveolar type I (AEC-I) cells are long assumed to be a terminally differentiated

epithelial cell type. A recent study using lineage tracing and injury model suggests that a

subset of Hopx-expressing AEC-I cells can function as alveolar stem cells to generate new

AEC-I and AEC-II cells after pneumonectomy (Jain et al., 2015). Similar to AEC-II stem

cells, isolated Hopx+ AEC-I cells are able to give rise to alveolar-like colonies comprising

of cells positive for makers of AEC-I and AEC-II cells in vitro. However, it is still unknown

whether these putative AEC-I stem-cell-like cells directly differentiate to AEC-II cells or

they firstly dedifferentiate to bipotent progenitor-like cells then give rise to new AEC-I and

AEC-II cells. Moreover, the stem cell property of these AEC-I progenitors needs to be

further evaluated in different disease model

In conclusion, numbers of epithelial populations have been designated as

endogenous lung stem cells. Specifically, their activation and regenerative capacity seem to

depend on the stem cell niches and the injury been induced. Whether these stem cell

populations are intrinsically different or arise from a common precursor but exhibit different

phenotypes due to the specific type of injury induced, needs to be further elucidated.

1.3.4 Derivation of pulmonary epithelium from pluripotency

stem cells

A major obstacle of lung regeneration is the lack of a suitable source of large

numbers of epithelial cells. Primary cultures of airway epithelium possess limited

proliferative capacity and gradually lose differentiation. Although numbers of putative

endogenous lung stem cell populations have been described, these cells are rare, which

33

limits their expansion in vitro (Bertoncello and McQualter, 2010; Kosmider et al., 2011;

Liebler et al., 2016; Raiser and Kim, 2009). Importantly, the number and function of

endogenous stem cells are limited in certain pathological conditions (Randell, 2006).

Pluripotent embryonic stem cells (ESCs) and induced pluripotent stem (iPS) cells, capable

of generating cells of all three embryonic germ layers, offer enormous potential for lung

regeneration. Thus, tremendous efforts have been placed on the derivation of pulmonary

epithelial cells by differentiation of pluripotent stem cells.

1.3.4.1 ESCs and iPS cells

ESCs are derived from the inner cell mass of preimplantation blastocysts of an

embryo. In vitro, their undifferentiated state can be maintained, with the ability to

differentiate into specialized cell types upon the application of specific signalling

transduction mimicking tissue development (Odorico et al., 2001). Classically, iPS cells are

generated from fibroblasts by induction of exogenous reprogramming factors Klf4, Sox2,

Oct4, and c-Myc. Unlike ESCs, iPS cells can be derived from most of somatic cell types and

all these iPS cell lines express pluripotency genes and are able to generate chimeric mice.

They have a great differentiation potential as ESCs to differentiation to desired cell types

(Takahashi and Yamanaka, 2006a; Takahashi et al., 2007a; Yu et al., 2007). In addition to

avoiding the ethical issue of destroying embryos to obtain ESCs, iPS cells can be derived

from individual patients, known as patient-specific iPS cells, to generate genetically

matched somatic cells. This phenomenal feature of iPS cells offers great hope for the

developing patient-specific cell therapy, drug screening, and in vitro human diseases models

(Leeman et al., 2014).

1.3.4.2 Differentiation approaches

During development, definitive endoderm cells give rise to tissue of thyroid, lung,

liver, and pancreas. Anterior foregut endoderm which derived from definitive endoderm

generates lung endoderm. The lung epithelium development then processes a primordial

progenitor stage at which Nkx2.1 expression initiates whereas Sox2 expression is

downregulated. The proximal airway (trachea, bronchus, and bronchioles) epithelial cells

arise from the Nkx2.1+ embryonic progenitors with the upregulated expression of Sox2

34

(Que et al., 2009). Distal airway epithelium is derived from Sox9+Id2+ multipotent

embryonic distal progenitors (Perl et al., 2005; Rawlins et al., 2009).

Figure 1. Schematic graph depicting the generation of lung epithelial cells in development

The initial studies showed successful generation of functional airway epithelium

from ESCs, but the contamination of undifferentiated cells in the ending products still

remain the risk of teratoma formation (Van Haute et al., 2009). How to obtain pure, fully

differentiated lung epithelial population from is one of the major obstacles in differentiation

of pluripotent stem cells. Therefore, large amount of efforts have been placed on how to

increase the efficiency at each steps in differentiation.

In most of the differentiation protocols, the initial specification of definitive

endoderm from ESCs is directed by activin treatment and subsequent dual inhibition of

TGF- and BMP signalling to enrich anterior foregut endoderm (Green et al., 2011).

Recently, significant progress has been made to generate different airway epithelial

populations by carefully timed signaling induction. Herein, we will review some of the

major findings. Mou et al. (Mou et al., 2012) described a step-wise differentiation protocol

that was able to generate multipotent embryonic lung progenitor and airway progenitors

from ESCs. They found that carefully-timed TGF-, BMP-4, FGF-2, and Wnt signalling

treatments after conversion of mouse ESCs to foregut endoderm, allowed the generation of

Nkx2.1-expressing lung endoderm. These mouse Nkx2.1+ lung endoderm were capable of

35

generating lung progenitors with the ability to form tracheospheres after transplantation to

NOD-SCID mice. They also demonstrate this mouse differentiation protocol can be applied

to human cystic fibrosis iPS cells to obtain disease-specific lung progenitor population. A

similar approach described by Longmire et al. (Longmire et al., 2012) showed that definitive

endodermal precursors can be generated via the inhibition of TGF- and BMP signalling

with subsequent stimulation of BMP-4 and FGF-2 signalling in ESC differentiation. These

precursors show their utility in the recellularization of a decellularized lung scaffold. Huang

and colleagues are able to improve the differentiation efficiency to obtain lung progenitor

cells up to 80% by the refinement of differentiation protocol. As they described, definitive

endoderm is derived from hESC and iPS cells by Activin/BMP-4/bFGF treatment;

subsequent derivation of anterior foregut endoderm was through the dual inhibition of TGF-

(SB431542) and BMP (dorsomorphin) signalling, activation of Wnt signalling

(CHIR99021), and sequential treatment of exogenous growth factors (FGF-10, KGF, BMP-4

and retinoic acid). The obtained lung progenitor population is capable of differentiating to

both airway epithelial lineage (basal, Club, goblet and ciliated cells) and alveolar epithelial

lineage (AEC-I and AEC-II cells) in vivo and in vitro (Huang et al., 2013).

Furthermore, the potential of developing iPS patient-specific epithelial cells from iPS

for drug screening, and in vitro human lung diseases models cells has been demonstrated.

Ciliated cells are the major epithelial cells expressing cystic fibrosis transmembrane

conductance regulator (CFTR) in the lung. Especially for CF, the generation of patient-

specific ciliated epithelium in vitro is extremely important for testing CF drugs and studying

the precise cellular molecular mechanism underlying the disease. Wong et al. described a

direct differentiation protocol for generating functional CFTR-expressing airway epithelium

from human ESCs and CF-derived iPS cells. To achieve this, they used precisely-timed

treatment of exogenous growth factors (FGF-7, FGF-10, FGF-18 and BMP-4) with

subsequent air-liquid interface culture which can induce the maturation of ciliated cells.

In summary, both ESCs and iPS cells with superior self-renewal and differentiation

capacity offer enormous potential for lung regeneration. However, some protocols remain

limited by low yield and purity of the desired mature cell types; heterogeneous final

products (Plath and Lowry, 2011; Schwartz et al., 2014) and contamination by potentially

tumorigenic undifferentiated cells (Ben-David and Benvenisty, 2011; Tapia and Schöler,

36

2016). A variety of approaches may overcome these problems but producing each unique

cell that may be desirable will require the development of hundreds of unique protocols.

Therefore, efforts need to be placed on the standardization of differentiation protocols in

future studies.

1.4 Induced pluripotent stem (iPS) cell reprogramming

In 2006, the group of Yamanaka introduced their milestone strategy to generate cells

with pluripotency properties from somatic cells, so called induced pluripotent stem (iPS)

cells. This is achieved by ectopic expression of four reprogramming factors: Oct4 (also

known as POU5F1), Sox2, KLF4, and c-Myc (Takahashi and Yamanaka, 2006a).

In the last decade, using novel experimental strategies, tremendous progress has been

made on understanding the mechanisms underlying somatic cell fate changes during the

multi-step reprogramming and the factor-induced ESC-like transcriptional network

established to confer pluripotency. Many studies have demonstrated the similarities of both

mouse and human iPS cells and their respective ESCs counterparts, including morphology,

self-renew capacity, differentiation property, and the molecular levels of transcription and

genome-wide chromatin modifications. Notably, differences are found between ESCs and

iPS cells, such as the epigenetic memory of the cell of origin presenting both in human and

mouse iPS cells which greatly influences the molecular epigenetic profile and functional

differentiation potential of the iPS cells (Kim et al., 2010; Polo et al., 2010; Shipony et al.,

2014). Therefore, the generation of iPS cells from various somatic cell types constuties a

route to derive patient-specific iPS cells and opens new paths to model diseases and develop

cell therapy for tissue regeneration.

1.4.1 Reprogramming methods

There are several variables need to be considered to obtain faithful reprogrammed

iPS cell lines, including the choice of reprogramming factors; the delivery methods; target

cell type; the induction conditions and identification of the pluripotency of generated iPS

cells.

37

1.4.1.1 Reprogramming factors

iPS reprogramming was initially performed in mouse fibroblasts through retroviral

transduction of four transcription factors: Oct4 (also known as POU5F1), Sox2, KLF4, and

c-Myc (Takahashi and Yamanaka, 2006a). This core set of factors has been shown to

successfully generate iPS cell lines across many types of both human and mouse somatic

cells (Aoi et al., 2008; Eminli et al., 2008; Hanna et al., 2008; Kim et al., 2008; Stadtfeld et

al., 2008a, 2008b).

Various combinations of transcription factor cocktails have been described that are

capable of successfully reprogramming somatic cells to iPS cells. In the reprogramming of

mouse fibroblasts, Sox2 can be replaced by Sox1 and Sox3, but results in a lower

reprogramming efficiency; Klf4 can be replaced by Klf2; and c-Myc can be replaced by L-

Myc and N-Myc (Blelloch et al., 2007; Nakagawa et al., 2008). In addition, a partially

different combination of factors, Oct4, Sox2, Nanog and Lin28, is able to reprogramming

human fibroblasts (Kastenberg and Odorico, 2008). It has also been shown that the certain

reprogramming factors can be excluded from the reprogramming cocktail when the target

cell type can express them endogenously, although with a lower reprogramming efficiency

compared to that with Yamanaka factors. For instance, neural precursors expressing

endogenous Sox2 and c-Myc can be reprogrammed using only Oct4/Klf4 or Oct/c-Myc.

Exogenous c-Myc can be omitted for the reprogramming of both mouse and human

fibroblasts expressing endogenous c-Myc (Nakagawa et al., 2008; Wernig et al., 2008).

Numbers of small molecules and soluble factors have been reported that are able to

replace the need of the transcription factors and/or enhance the reprogramming efficiency,

including Valproic Acid (Huangfu et al., 2008), 5-azacytidine/shRNA against Dnmt

(Mikkelsen et al., 2008), BayK8644 (Shi et al., 2008), BIX01294 (Silva et al., 2008), Wnt3a

(Marson et al., 2008), and siRNA against p53 / Utf1 cDNA (Zhao et al., 2008). These non-

integrative, non-viral methods of reprogramming avoid permanent geneome modification in

contrast to the use of retrovirus or lentivirus. However, it still remains to be determined if

these small molecules and soluble factors can recapitulate the gradient transcriptional and

epigenetic changes occurring during the reprogramming by the four transcription factors.

38

1.4.1.2 Delivery systems

Retroviral and lentiviral approaches were employed in the initial iPS reprogramming

efforts (Blelloch et al., 2007; Brambrink et al., 2008; Hockemeyer et al., 2008; Takahashi

and Yamanaka, 2006b; Takahashi et al., 2007b), which have been criticized for their risk of

causing insertional mutagenesis that potentially limits clinical application.

Other delivery systems have been developed to limit the genomic integration,

especially for the derivation of human iPS cells. Low-risk reprogramming using non-viral

methods, including adenovirus (Stadtfeld et al., 2008a), plasmids (Okita et al., 2008),

excision of reprogramming factors using Cre/LoxP 19252477(Soldner et al., 2009) and

piggyBAC transposition (Woltjen et al., 2009) have been reported, but suffers from relative

low reprogramming efficiencies and may require intense screening of excised lines due to

the left-behind residual vector sequences. The non-integrating DNA-based system including

adenoviral, episomal plasmids and minicircle vector has been used in reprogramming

various somatic cell types. Studies showed adenovirus carrying the reprogramming factors is

able to reprogram mouse fibroblast, hepatocytes and human fibroblasts without genomic

integration, but also suffer from low reprogramming efficiency (Stadtfeld et al., 2008a).

Episomal vectors, which are derived from the Epstein-Barr virus, have been reported in the

successful derivation of iPS cells from human neonatal foreskin fibroblasts with a low

genomic integration (Yu et al., 2009). However, this method is technically challenging in

that three individual plasmids are required to carrying a total of seven factors, including

oncogene SV40. Minicircle vector, a plasmid (P2PhiC31-LGNSO) contains a single cassette

of four reprogramming factors (Oct4, Sox2, Lin28, Nanog), has been used in reprogramming

of human adipose stem cells and fibroblasts showing no footprint (Jia et al., 2010). Although

minicircles benefits from a higher transfection efficiency and longer ectopic expression, the

reprogramming efficiency is still fairly low.

In addition, non-integrating DNA-free system, including sendai virus, protein,

modified mRNA, microRNA and small molecules, allows no genomic integration or

footprint. Sendai virus and modified mRNA reprogramming both have a good efficiency,

but the usage is limited by the high cost. Protein-based iPS cells have been successfully

generated from both mouse and human

fetal and neonatal cells, but require multiple

applications due to the short half-life of protein and high handling-skills (Kim et al., 2009;

39

Zhou et al., 2009). In addition, it has been shown that small molecules are able to reprogram

mouse embryonic fibroblast to iPS cells. Nevertheless, this approach needs to be validated in

human cells (Liao et al., 2011).

1.4.1.3 Target cell type

Since the successful generation of iPS cells from fibroblasts of both mouse and

human, many other somatic cells types have been reprogrammed, including stomach cells

(Aoi et al., 2008), liver cells (Aoi et al., 2008; Stadtfeld et al., 2008a), pancreatic ß cells

(Stadtfeld et al., 2008b), lymphocytes (Hanna et al., 2008), neural progenitor cells (Eminli et

al., 2008; Kim et al., 2011), keratinocytes (Aasen et al., 2008; Maherali et al., 2008), and

others. Genetic labeling methods have been employed in many of these studies to confirm

the cell of origin of derived-iPS cells, ruling out the possibility of iPS cells derive from the

residual fibroblasts contaminated in the starting population.

There is the notion that the cell type influences reprogrammability, including the

efficiency and kinetics of the reprogramming process, and which reprogramming factors can

be delivered. For instance, mouse stomach cells, hepatocytes (Aoi et al., 2008) and human

keratinocytes (Aasen et al., 2008; Maherali et al., 2008) were reprogrammed to iPS cells

much faster and more efficiently than fibroblasts. In addition, variation of the effective

delivery of reprogramming factors is found among different cell types. For example, 100- to

200-fold higher titer of adenoviral vectors is required in reprogramming of mouse fibroblasts

than that in liver cells (Stadtfeld et al., 2008a).

Although it is still debated whether the degree of differentiation of cells within a

lineage influences the efficiency and kinetics of the reprogramming process, the former

hypothesis that only adult stem cells are amenable for reprogramming has been discarded

since terminally differentiated cells, such as pancreatic islets are capable of generating iPS

cells (Stadtfeld et al., 2008b). In addition, given time, all cells in a pre-B-cell population

showed the ability to undergo reprogramming with more than 90% of the wells contained

cells expressing pluripotency markers (Hanna et al., 2009). Although it seems every cell is

reprogrammable to iPS cells, the correlation of the heterogeneous reprogrammability and the

degree of differentiation of cells within a lineage needs to be precisely studied.

40

1.4.1.4 Derivation conditions

Both mouse and human iPS cells are derived under the same culture conditions used

to support the growth and maintenance of ESCs (Lerou et al., 2008). While ESC conditions

are sufficient to maintain iPS cells derived from various somatic cell types, the conditions

that enhance the derivation of ESCs may also enhance the derivation of iPS cells. For

example, knockout serum replacement used to enhance the ESC derivation can improve the

reprogramming of mouse fibroblasts (Blelloch et al., 2007). Knockout serum replacement

could be used in the reprogramming of some somatic cell types for which the standard

serum (e.g. fetal bovine serum) is not suitable.

In addition, the feeder cells or fibroblast-derived factors have been used to support

the growth of ESCs. As mouse ESCs can be maintained on gelatin, a feeder-free condition,

mouse iPS cells been reported can be derived in the absence of feeder cells (Wernig et al.,

2008). To date, majority of the human iPS cells were derived under feeder conditions. Thus,

for clinical relevant applications, culture conditions for human iPS derivation remain to be

defined to avoid the use of animal products.

Furthermore, when iPS cells are derived from some non-fibroblast somatic cells

types, the culture conditions need to be optimized to satisfy both somatic cells and the

derived iPS cells. This has been reported in the reprogramming of lymphocytes that both B

lineage growth factors and LIF were used to support the growth of both lymphocytes and

iPS cells, respectively (Hanna et al., 2008).

To note, there are some unique cases with human iPS reprogramming. When using

inducible systems in human cell reprogramming, one needs to consider that human iPS cells

are more sensitive to doxycycline exposure compared to their mouse counterparts. In

addition, human iPS cells and ESCs poorly grow as single cells so the additional chemical

compounds are required to enhance single-cell survival, such as Rho-associated kinase

(ROCK) inhibitor (Watanabe et al., 2007).

While most of the reprogramming studies were preformed under two-dimensional

(2D) cell-culture system, a recent study demonstrated the successful derivation of both

mouse and human iPS cells using a chemical defined 3D ECMs (Caiazzo et al., 2016). As

described, fibroblasts were reprogrammed in enzymatically crosslinked poly

(ethyleneglycol) (PEG)-based hydrogels inserted with the fibronectin-derived adhesion

41

peptide RGDSP which mimic the biochemical features of native ECMs. They demonstrated

that this defined 3D condition can boost induction of pluripotency by accelerating the two

key events for the initiation of iPS programming, MET and chromatin remodelling. As

known, the stem cell niche plays a crucial role in manipulating stem cell fate, including self-

renewal, differentiation, as well as the response to injury. In this first proof-of-principle 3D

reprogramming study, they raised a novel "reprogramming niche" concept that

microenvironment can modulate reprogramming process by manipulating somatic cell fate.

1.4.1.5 Identification of pluripotency

Pluripotent stem cells are able to give rise to all cells of an organism. The definition

of pluripotency is predicated on functional assays of differentiation potential and diagnostic

transcriptional, epigenetic and metabolic signatures.

A set of core transcription factors have been selected as the molecular hallmarks of

pluripotency: Oct4, Sox2 and Nanog, which play essential roles in establishing pluripotency

network in both mice and humans (Masui et al., 2007; Takahashi et al., 2007b; Wang et al.,

2012).

A range of functional assays have been employed to examine the developmental

potential of iPS cells: in vitro differentiation assay; in vivo teratoma formation and

chimaeras formation.

In vitro analysis is the basic layer of pluripotency characterization, including colony

morphology, self-renewal /expansion capacity, and differentiation capacity of generating

cells of all three embryonic germ layers. In vitro differentiation assay is typically preceded

by replacing conditions for maintaining undifferentiated state with different cocktails

containing lineage- specific inducers, and characterization of the expression of specific

makers of target tissues.

In vivo assays measuring differentiation potential have been regarded as more robust

parameters of pluripotency. Teratoma formation assay measuring developmental potency at

a population-based level is the gold standard for define plutipotency in human iPS cells.

Cells are injected into immune-compromised NOD-SCID mice and the generation of

differentiated tissues of all the three germ layers is assessed by histology analysis of possible

cell types. To note, cells injected with matrices or scaffold could provoke inflammatory

42

response which can be mistaken as tissue differentiation. In this case, lineage-tracing should

be applied to distinguish injected cells from reactive recipient tissues. Blastocyst chimaera

formation is used to examine the ability of mouse pluripotency cells to re-enter development

upon introduction into host embryos (Nagy et al., 1990). Cells with good kinetic

development potency are able to generate high-grade chimaeras with colonization of all

embryonic tissues including the germ line. Chimaeras assay in humans is ethically

impermissible.

1.4.2 Roadmap of faithful reprogramming

Since the innovation of iPS technology a decade ago, enormous progress has been

made in understanding the molecular mechanisms underlying somatic cell reprogramming to

pluripotency.

Although iPS cells can be derived from many somatic cell types by various

combinations of transcription factors and small molecules, our knowledge of the

mechanisms underlying the steps leading to faithful reprogramming is mainly learned from

the studies performed with the original Yamanaka factors on mouse embryonic fibroblasts

(MEFs).

During iPS reprogramming, only a small subset of cells within the starting somatic

cell population are able to proceed to the next steps of reprogramming and eventually

commit to pluripotency within a certain timeframe. Evidences from the studies on the events

that occur between the initial expression of the reprogramming factors in somatic cells and

the establishment of faithful reprogramming suggest that successful reprogramming of

fibroblasts is a stepwise process, through key intermediate steps (Brambrink et al., 2008;

Mikkelsen et al., 2008; Smith et al., 2010; Sridharan et al., 2009).

Studies using gene expression profiling and RNAi screening revealed the three

reprogramming phases: initiation, maturation, and stabilization (Li et al., 2010; Samavarchi-

Tehrani et al., 2010). A rapid induced cell proliferation and suppression of somatic cell-

specific transcription occurs initially, followed by acquisition of epithelial characteristics

and activation of some markers of ESCs, including alkaline phosphatase and stage-specific

embryonic antigen 1 (SSEA1). The final step is marked by the activation of pluripotency

genes, such as Nanog (Mikkelsen et al., 2008; Wernig et al., 2007). The ectopic expression

43

of reprogramming factors is required until the iPS state is established. The maintenance of

iPS cells is factor-independent, representing a stable conversion of somatic cell fate

(Stadtfeld et al., 2008c; Brambrink et al., 2008).

1.4.2.1 The early phase

A high-resolution time-lapse imaging approach tracking the reprogramming process

demonstrated that the first noticeable changes are the rapid induction of cell proliferation

and a decrease in cell size immediately upon induction of the reprogramming factors (Smith

et al., 2010). Concomitantly, there are transcriptional changes including downregulation of

somatic genes which occurs in the majority of cells and upregulation of cell proliferation

genes (e.g. Ccdn1, Ccnd2) (Stadtfeld et al., 2008c).

Although the vast majority of cells are able to initiate reprogramming, only a small

subset of the cells are able to successfully induce the initial morphological change while the

remaining cells undergo apoptosis, senescence and cell-cycle arrest which are thought to be

the one of the roadblocks of reprogramming and associated with reprogramming efficiency.

Indeed, evidence showed silencing of genes regulating these responses (e.g. p53 and

CDKN2A) (Hanna et al., 2009; Hong et al., 2009; Utikal et al., 2009) or promotion of the

cell cycle allowing more cells to transit through S phase (Hanna et al., 2009; Ruiz et al.,

2011) could enhance the reprogramming efficiency.

Another proposed barrier to reprogramming is the extinction of the somatic program

that the efficient silencing of somatic fate is required to en route to the iPS state. Supportive

studies showed that the expression of lineage-specific genes blocks reprogramming

(Mikkelsen et al., 2008; Pereira et al., 2010).

Both ESCs and iPS cells have epithelial cell characteristics, with the expression of

the key epithelial markers, including E-cadherin and EpCAM. Therefore, the loss of somatic

mesenchymal signature (e.g. Snail1/2; Zeb1/2) and acquisition of epithelial characteristics

(e.g. E-cadherin, EpCAM) are required during reprogramming of fibroblasts to iPS cells,

and the signalling pathways regulating MET or EMT would affect the reprogramming

efficiency (Li et al., 2010). For example, Samavarchi-Tehrani et al. demonstrated that BMP

signaling drives the mesenchymal-to-epithelial (MET) in the initiation phase of

reprogramming of fibroblasts and the activation of bone morphogenetic protein (BMP)

44

signalling enhances reprogramming through the upregulation of pro-MET microRNAs

(Samavarchi-Tehrani et al., 2010). This may explain the higher reprogramming efficiency

observed in epithelial cells, such as keratinocytes and hepatocytes that their already existing

epithelial character allows them to avoid the MET transition.

1.4.2.2 The intermediate phase

After MET, a subset of E-cadherin+ cells proceed to the next reprogramming phase

that larger colonies are formed, many embryonic genes regulating housekeeping functions

are upregulated (Samavarchi-Tehrani et al., 2010; Sridharan et al., 2009), and ESC makers

(e.g. SSEA-1) are induced (Li et al., 2010; Stadtfeld et al., 2008b). Studies tracing the

SSEA-1-positive and SSEA-1-negative populations during reprogramming process

demonstrate that only SSEA-1-positive cells give rise to faithfully iPS cells and only a few

of them can make the final transition.

Lujan et al. (Lujan et al., 2015) preformed a high-dimensional mass cytometry to

identify the surface markers of cells at different phases of reprogramming and demonstrated

that cells reprogrammed to faithful iPS cells acquire surface marker expression in a stepwise

manner. In this study, they performed a systematic functional surface maker screening on the

cell lines representing the early, intermediate and late pluripotency stages and identified 21

candidate surface markers, of which the expression was then characterized in primary cells

by mass cytometry over the reprogramming process. Consistent with previous reports, they

also demonstrate that the transient, intermediate stage is a general property of iPS

reprogramming that presents across multiple reprogramming systems. They showed that the

intermediate cells can be identified by a unique set of surface markers, including CD73,

CD49d and CD200, which are absent in both parental fibroblasts and the generated iPS cells.

Partially reprogrammed (pre-iPS) cells, which have already efficiently silenced

somatic genes but have not induced the endogenous pluripotency program, arise from this

intermediate stage. These pre-iPS cells have ESC-like colonies morphology, but not yet

gained Nanog expression or induced pluripotency-related genes. However, pre-iPS cells are

capable of transition to iPS cells with additional treatments, such as inhibition of MAPK and

GSK3; TGF inhibition and Nanog overexpression (Silva et al., 2009; Theunissen et al.,

2011).

45

Studies mapping the binding sites of 4 reprogramming factors in pre-iPS cells

revealed that c-Myc is largely engaged at this intermediate phase and many of its target

genes have already been bound, while the pluripotency network hasn't yet been established

(Sridharan et al., 2009).

1.4.2.3 The stabilization phase

The stabilization phase is characterized by the activation of the core plutipotency

network which marks the acquisition of a stable pluripotent stage. At this final step of

reprogramming, transcriptional or developmental regulators which are highly expressed in

ESCs have been activated, including endogenous Oct4, Sox2 and Nanog, and many other

pluripotency-related genes (Sancho-Martinez and Izpisua Belmonte, 2013; Zhang et al.,

2012).

Aside from iPS cells, alternative pluripotent stem cells obtained from reprogramming

have been documented, specifically the F-class cells described by Tonge et al. (Tonge et al.,

2014), and Nanoglow

Sox2low

Lin28high

population identified by Zunder et al. (Zunder et al.,

2015).

The F-class (fuzzy colony forming) cells, which do not morphologically resemble

ESCs, are derived from the cells which skip the MET during the early reprogramming.

These Nanog-expressing F-class cells are pluripotent, can be stably maintained in cell

culture, but their existence is dependent on the high expression of reprogramming factors. In

addition, although both F-class cells and intermediate pre-iPS cells require the continuous

expression of reprogramming factors, F-class cells are transcriptionally and epigenetically

distinct from pre-iPS cells (Tonge et al., 2014).

To construct the molecular roadmap of iPS reprogramming, Zunder et al. (Zunder et

al., 2015) developed a novel combination of high-dimensional mass cytometry and time-

resolved progression analysis that allowed for the comprehensive measurement of the

protein expression at the single cell level. They analyzed three different MEF

reprogramming systems (Oct4-GFP primary MEFs, Nanog-GFP secondary MEFs, and

Nanog-Neo secondary MEFs) and identified a group of proteins of which the expression can

represent reprogramming landmarks. They found that cells express high levels of both Oct4

and Klf4 (Oct4high

Klf4high

cells) at the early phase of reprogramming of which a subset

46

transitioned to a CD73high

CD104high

CD54low

population at the intermediate phase. Further

analysis of Ki67 expression in this intermediate population revealed two distinct

subpopulations: the Ki67low

cells which revert to the parental MEF-like cells, and the

Ki67high

cells which undergo MET and then to pluripotency. During the late stage of

reprogramming, Ki67high

cells segregated into two subpopulations: an ESC-like

Nanoghigh

Sox2high

CD54high

population and a mesendoderm-like Nanoglow

Sox2low

Lin28high

CD24high

PDGFR-αhigh

population representative of an alternative stem cell state.

1.4.3 Epigenetic alteration during reprogramming

Epigenetic alteration is the major underlying mechanism driving somatic cells from

the differentiated to the pluripotent state during the reprogramming process. The epigenetic

feature of the starting somatic cells has been erased to some extent during the conversion to

adopt a pluripotent stem cell epigenome. The epigenetic alterations during reprogramming

have been extensively studied, including genome-wide resetting of histone posttranslational

modifications, DNA demethylation of promoter regions of pluripotency genes, chromatin

reorganization, and reactivation of the somatically silenced X chromosome (Fussner et al.,

2011; Takahashi et al., 2007b).

According to several independent reports describing the molecular mechanisms of

iPS reprogramming at bulk population or single-cell levels, epigenetic remodeling is

observed during the distinct transcriptional phases.

Changes in histone modifications occur immediately after induction of

reprogramming factors. Accumulation of H3K4me2 is observed at the promoters of many

pluripotency genes (e.g. Sall4 and Fgf4) and enhancer regions (Koche et al., 2011). Changes

in H3K4me2 occur in the majority of starting fibroblasts in response to the induction of

reprogramming factors, even before cell division is initiated (Koche et al., 2011). The loss of

H3K4me2 at the promoters of somatic cells is associated with the suppression of somatic

MEF markers (Thy1 and Postn) (Sridharan et al., 2009; Stadtfeld et al., 2008c). In parallel,

somatic gene enhancer also loses H3K4me2 which leads to hypermethylation and silencing

at the late phase of reprogramming. The gradual depletion of H3K27me3 and promoter

hypomethylation in the regions responsible for cell fate conversion also occurs during the

early phase of reprogramming. However, at this early phase, chromatin remodeling has not

47

yet completed, including the correlation of H3Kme2 with H3k26me3, occupancy of RNA

PolII, and transcriptional activity (Koche et al., 2011). More histone makers are robustly

modified in later stages, including activation of H3K4me3 and repression of H3K27me3.

DNA demethylations and X reactivation occur during late stages of reprogramming

process (Polo et al., 2012). The expression of microRNA, such as let-7, miR34c, miR-294

and miR-106a changes during the whole reprogramming process. DNA hypermethylation is

observed in the regions of many pluripotency-related genes, including Oct4, Nanog,

undifferentiated embryonic cell transcription factor 1 (Utf1), developmental pluripotency

associated 3 (Dppa3) and 5 (Dppa5), and zinc finger protein 42 (Zfp42) in both somatic cells

and pre-iPSCs, concomitant with the repression of H3K4me3 (Maherali et al., 2007). Loss

of repressive histone methylation markers, such as H3K27me3 and H3K9me3, at many

pluripotency-related genes and binding of the reprogramming factors Oct4, Sox2 and Klf4

occur at the end of reprogramming process (Mikkelsen et al., 2008).

1.4.4 Cooperation of reprogramming transcription factors

Understanding of the contribution of individual reprogramming factors to the

different phases of reprogramming is required to yield mechanistic insights into

reprogramming and the induced pluripotent state. A growing body of evidence reveals that

each individual reprogramming factor plays a distinct role during stepwise reprogramming

process (Li et al., 2010; Nakagawa et al., 2008; Sridharan et al., 2009). The initial

transcriptional wave is mainly mediated by c-Myc whereas the later wave is mediated by

Oct4 and Sox2 which facilitate the expression of pluriptency-related genes and establish

pluripotnecy network. Klf4 is involved in both stages including repression of somatic genes

at the early stage and activation of pluripotency genes at the second stage (Polo et al., 2012).

Studies have mapped the binding sites of 4 reprogramming factors during fibroblast

reprogramming and shown OSKM binds promoters of genes which are active or repressed

immediately after induction (Koche et al., 2011). During MET, that occurs in the initial

phase of reprogramming, both Oct4 and Sox2 suppress pro-mesenchymal genes (e.g. Snail);

Klf4 is involved in the activation of epithelial-related genes, including E-cadherin; c-Myc

repress the expression of Tgfb1 and Tgfbr1 to reduce TGFβ signalling (Li et al., 2010). This

collaboration of 4 reprogramming factors in suppression of pro-MET regulators and

48

promotion of pro-MET signals enable the MET process during fibroblast reprogramming.

During the later stage of reprogramming, c-Myc, unlike Oct4, Sox2 and Klf4, is not

involved in the upregulation of pluripotency-related genes (Sridharan et al., 2009). Oct4 and

Sox2 co-occupy promoters of pluripotency-related genes, and Klf4 shares nearly half of its

targets with Oct4 and Sox2, together to form the pluripotency network. By contrast, c-Myc

only targets the promoters involved in regulating cell proliferation, metabolism and

biosynthetic pathways. Recently, it has been demonstrated that c-Myc also acts as an

amplifier of gene expression. For instance, c-Myc binds to promoter regions associated with

H3K4me3 and H3K27ac and promotes the production of promoter-proximal pausing of

RNA polymerase II (Pol II) to enhance transcriptional elongation (Lin et al., 2012; Rahl et

al., 2010). Therefore, although c-Myc is not absolutely required for reprogramming, it is still

able to enhance transdifferentiation, the kinetics of reprogramming process, and build a

foundation for the other reprogramming factors to activate the pluripotency network

(Nakagawa et al., 2008; Rahl et al., 2010).

Moreover, studies of the binding site of reprogramming factors in pre-iPS cells

demonstrate c-Myc is largely engaged at the intermediate stage of reprogramming and that

many of the c-Myc target genes in iPS cells have already been bound in pre-iPS cells. In

contrast to that in iPS cells, many pluripotency-related genes targeted by Oct4, Sox2 and

Klf4 lack of binding and are not activated in pre-iPSCs (Buganim et al., 2012). This can

explain why additional transcription factors with the ability to cooperatively bind with Oct4,

Sox2 and Klf4 are required to enable the transition of pre-iPS cells to faithful pluripotenct

iPS cells. For example, Nanog can interact with Oct4 and Sox2 and other pluripotency genes

to promote their function and overexpression of Nanog in pre-iPS cells can enhance the

induction of pluripotency by lowering the intrinsic barriers (Hanna et al., 2009; Silva et al.,

2009; Theunissen et al., 2011).

Furthermore, taking the advantages of the collaboration of the 4 reprogramming

factors to open chromatin and induce cell plasticity during the early reprogramming process,

studies show that transient induction of these factors is sufficient to open the chromatin and

enable direct conversion of fibroblasts to other somatic cell types, such as neural progenitors

and cardiomyocytes (Efe et al., 2011; Kim et al., 2011).

49

1.4.5 Molecular and functional similarities and differences

between ESCs and iPS cells

ESCs and iPS cells share similarities in morphology, self-renew capacity,

differentiation potential, and age-affected cellular systems such as telomeres and

mitochondria. However, numbers studies comparing ESCs and iPS cells at the epigenetic,

transcriptional, proteomic and metabolic levels have demonstrated the molecular differences

between ESCs and iPS cells (Bock et al., 2011; Chin et al., 2009, 2010; Doi et al., 2009;

Ghosh et al., 2010; Kim et al., 2010b; Lister et al., 2011; Loewer et al., 2010; Marchetto et

al., 2009; Polo et al., 2010b).

At the transcriptional level, human iPS cells and ESCs can be distinguished by their

differential expression of protein-coding RNAs which mainly attributes to the residual

expression of somatic genes but dissipate upon extended passaging (Chin et al., 2009, 2010).

In addition, ten large intergenic non-coding RNAs (lincRNAs) are differentially expressed

between human iPS cells and ESCs. Some of these lincRNAs participate in the

reprogramming process that their overexpression enhances and the downregulation inhibits

reprogramming (Loewer et al., 2010).

These transcriptional differences can result in functional differences between iPS

cells and ESCs. For example, the repression of a small group of non-coding RNAs encoded

in the Dlk1–Dio3 gene cluster could affect the functionality of mouse iPS cells. Although

some iPS cells lacking of expression at this locus are capable of generating chimaeras, fail

the tetraploid complementation assay (the gold standard for examining mouse pluripotency)

to show animals are entirely derived from these cells (Stadtfeld et al., 2010).

The chromatin state of iPSCs and ESCs has been extensively examined to date and

consistent differences are observed. Among histone modifications, genome-wide studies

showed the expression patterns for H3K4me3 and H3K27me3 are indistinguishable between

both mouse and human iPS cells and their respective ESCs counterparts (Maherali et al.,

2007; Mikkelsen et al., 2008). However, the expression patterns of H3K9me3 within

promoter regions are different (Hawkins et al., 2010) and its overexpression was found

among the genes which are differentially expressed between human iPS cells and ESCs.

Notably, many of the transcriptional and chromatin differences described are

observed in the early-passage iPS cells and disappeared at a later passage, suggestive of a

50

residual ‘epigenetic memory’ persisting in the early-passage iPS cells, reflecting the cell of

origin (Chin et al., 2009; Ghosh et al., 2010; Marchetto et al., 2009).

Specifically, Kim et.al and Polo et al. provide functional evidence showing that an

epigenetic memory of cell of origin persist in mouse iPS cells which is linked to the residual

DNA methylation within lineage-specific genes. This persisting DNA methylation pattern

influences the functionality and differentiation potential of derived iPS cells (Kim et al.,

2010; Polo et al., 2010). For example, iPS cells derived from blood cells are more easily

differentiated to their original blood cell lineage than fibroblast-derived iPS. This may due to

the DNA hypermethylation of blood cell markers in fibroblast-derived iPS cells that

potentially prevent their upregulation under the induction of blood lineage differentiation.

Reversely, treatments of non-blood cell-derived iPS cells with DNA methylation inhibitors

enable a more efficient differentiation towards blood lineage. Notably, this residual

epigenetic memory in mouse iPS cells could be erased upon extended passaging.

Furthermore, this epigenetic memory has been uncovered in human iPS cells. Single-

cell based whole-genome DNA methylation mapping studies reveal that the somatic DNA

methylome was only partially erased during reprogramming and an epigenetic memory of

the somatic DNA methylation pattern persists in human iPS cells. In addition, some iPS cells

fail to establish ESC-like methylation pattern which is associated with transcriptional and

functional differences found between late-passage iPS cells and ESCs (Lister et al., 2011).

Nevertheless, genetic abnormalities have been seen in some iPS cells. One study

suggests that these abnormalities might due to the oncogenic stress induced by

reprogramming factors. They observed a higher level of phosphorylated histone H2AX, one

of the earliest indicators of DNA double-strand breaks, in the cells induced with OSKM or

OSK. They demonstrated that the homologous recombination pathway is essential for repair

DNA double-strand breaks to maintain genomic integrity during reprogramming process

(González et al., 2013). Nevertheless, more evidence are required to settle whether these

defects are as a result of reprogramming process or due to the genetic and epigenetic

differences existing within the individual parental fibroblasts (Abyzov et al., 2012; Cheng et

al., 2012).

51

1.5 Aging and iPS reprogramming

1.5.1 Molecular and cellular hallmarks of aging

Aging is generally characterized by a progressive loss of physiological fecundity,

increased impaired tissue regeneration and susceptibility to diseases (e.g., cancer, diabetes,

cardiovascular disorders and pulmonary diseases), leading to increased risk of mortality

(Hayflick, 2007; Kirkwood, 2005; Kirkwood and Shanley, 2010). Aging is caused by time-

dependent accumulation of cellular damages. A large body of evidence describes molecular

and cellular hallmarks of aging that mediate the aging process and phenotype. The nine

proposed pivotal hallmarks include stem cell exhaustion, telomere attrition, mitochondrial

dysfunction, epigenetic alterations, genomic instability, cellular senescence/apoptosis,

deficient proteostasis, dysregulated nutrient sensing and distorted intercellular

communication (Gems and Partridge, 2013; López-Otín et al., 2013; Vijg and Campisi,

2008).

1.5.1.1 Stem cell exhaustion

One of the most obvious characteristics of aging is tissue degeneration. Adult stem

cells, dividing throughout an organism’s lifespan for maintenance of the structure and

function of adult tissues, experience both chronological (e.g., neurons and myofibers) and

replicative exhaustion (e.g. the epithelia of the skin, gut and lung) during aging (Rando,

2006; Liu and Rando, 2011; Charville and Rando, 2011). The age-related progressive

decline in the number and cell-cycle activity of stem cells, leading to depletion of the

functional stem cell pool and tissue dysfunction, unfolds as a consequence of multiple types

of damages, such as telomere shortening, DNA mutations occurring during cell division, and

the imbalance of stem cell quiescence and proliferation (Flores, 2005; Rando, 2006;

Sharpless and DePinho, 2007; Liu and Rando, 2011).

1.5.1.2 Telomere attrition/dysfunction

Telomeres protect the chromosome ends for DNA repair and degradation activities

and telomerase is the enzyme responsible for maintaining telomere length and cell self-

renewal (Blackburn et al., 2006). Many types of in-vitro-cultured cells experience telomere

52

exhaustion and exhibit limited proliferative capacity, a process termed replicative

senescence (or Hayflick limit) (Hayflick and MOORHEAD, 1973).

Telomeres and telomerase are susceptible to age-related deterioration. Studies using

genetically modified animal models have demonstrated the causal links of telomere

dysfunction, cellular senescence and aging. Although telomere attrition manifests during

normal physiological aging, pathological telomere dysfunction provokes aging (Blackburn et

al., 2006; Flores and Blasco, 2010) and plays a causal role in premature development of

various human diseases, such as idiopathic pulmonary fibrosis (Tsakiri et al., 2007;

Cronkhite et al., 2008), aplastic anaemia (Yamaguchi et al., 2005; Du et al., 2008) and

dyskeratosis congenital (Armanios et al., 2005; Calado et al., 2009).

Importantly, telomere and telomerase are the main components of stem cell

"ignition" mechanism, referring to uncontrolled proliferation resulting in tumor formation

or, inversely, impaired self-renewal as happens in age-related tissue degeneration (Flores

and Blasco, 2010). Thus, tremendous efforts have been drawn on the manipulation of

telomere and telomerase to restrain cancer and delay aging. Among these, Armanios et al.,

and Toma´s-Loba et al., demonstrated that shortened telomere length caused tissue

degeneration whereas lengthened telomere increased lifespan in mice (Armanios et al., 2009;

Tomás-Loba et al., 2008). Moreover, normal physiological aging in mice can be delayed by

systemic viral transduction of telomerase (Bernardes de Jesus et al., 2012) and reactivation

of telomerase in aged telomerase-deficient mice showing reverted premature aging

phenotypes in testes, spleens, and intestines (Jaskelioff et al., 2011).

1.5.1.3 Mitochondrial dysfunction

As cellular power centers, the main function of mitochondria is to produce ATP via

the process of oxidative phosphorylation, which is carried out by the four respiratory chain

complexes and ATP synthase located in the inner mitochondrial membrane (IMM). Other

biochemical functions of mitochondria include the regulation of metabolic (both catabolic

and anabolic), signaling pathways and apoptosis (Nunnari and Suomalainen, 2012).

Mitochondria are unique cellular organelles that contain their own genetic information, the

mitochondrial DNA (mtDNA), a double-stranded and circular molecule of 16.5 kb in size

(Yue et al., 2015).

53

Emerging evidence has elucidated the precise relationship between mitochondrial

function, and signaling pathways regulating lifespan and aging. During aging, decline in the

number of mitochondrial, mtDNA copy number and protein levels of mitochondria were

observed both in human and in mice (Bratic and Larsson, 2013). Damage in mtDNA with

aging causes defects in the encoding proteins for the respiratory chain which in turn

amplifies ROS production and mitochondrial dysfunction (Van Houten et al., 2006).

Furthermore, this age-related progressive mitochondrial dysfunction results in further

increased levels of ROS production causing severe mitochondrial deterioration and

extensive cellular damage.

Accumulating evidence has shown mitochondrial dysfunction works in conjuction

with several other aging hallmarks (including loss of proteostasis, cellular senescence, and

stem cell exhaustion) to accelerate the aging process (Vermulst et al., 2008). Aggravated

mitochondrial dysfunction and DNA are associated with a variety age-related human

diseases, including cancer, diabetes and COPD (Ahmad et al., 2015; Boland et al., 2013;

Montgomery and Turner, 2014; Rera et al., 2012). Therefore, improvement of mitochondrial

function is a potential therapeutic strategy to delay the onset of age-related diseases.

1.5.1.4 Epigenetic alterations

All cells in a multicellular organism are genetically identical as they share the same

DNA sequence, but have variable gene expression patterns as the result of epigenetic

mechanisms. Epigenetic alterations affects all cells, both dividing and non-dividing cells,

and tissues throughout life (Talens et al., 2012). The essence of epigenetics is the

maintenance of not only the biological function and fate of all cells and tissues, but also their

response to environmental influences (Rando and Chang, 2012). Connecting the genotype

with the phenotype, epigenetics is a reversible heritable mechanism that changes either

spontaneously or driven by external or internal influences, but without altering the

underlying DNA sequence (O’Sullivan and Karlseder, 2012; Zane et al., 2014). Epigenome

composes multiple types of epigenetic information, including histones on DNA sequence,

DNA methylation, chromatin remodeling, variable structural and functional in histones,

posttranslational modifications of the histone proteins, and transcription of noncoding RNAs

(ncRNAs) (Brunet and Berger, 2014; Feser and Tyler, 2011).

54

Chromatin, which carries much of the epigenetic information, is the polymer of

nucleosomes that consists of 147 bp DNA wrapping around core histone proteins, H2A,

H2B, H3, and H4 (Luger et al., 1997). Epigenetic mechanisms are primarily regulated by a

series of enzymes that modify DNA directly or the core histones (methyltransferases,

demethylases, acetyltransferases, deacetylases) to regulate gene expression (Rando and

Chang, 2009). Epigenetic regulation proceeds by direct methylation and demethylation of

DNA bases referring to “Cis-epigenetics” (Bonasio et al., 2010). Histones can be altered by

modifications of methylation and acetylation which are closely associated with the

expression [e.g., histone 3 trimethylated at lysine 4 (H3K4me3)] and repression of genes

[e.g., histone 3 trimethylated at lysine 27 (H3K27me3)] (Wang et al., 2008). Particular

modifications on DNA and histones can result in alteration or ease of chromatin states.

Growing evidence from aging research show progressive loss in epigenome

configuration results in changes in the chromosomal architecture, genomic integrity, and

gene expression patterns during aging and in age-related disorders (O’Sullivan and

Karlseder, 2012; Brunet and Berger, 2014; Pal and Tyler, 2016).

DNA methylation plays a crucial role during development and functions to silence

genes no longer needed. Global alterations in DNA methylation patterns at specific sites

have been observed during aging. In young cells, the majority of CpGs are methylated

leading to transcriptional repression while the rest of CpGs referring to CpG islands are

demethylated resulting in upregulated gene expression (Jung and Pfeifer, 2015). During

aging, CpG hypomethylation occurs and increases the risk of genomic instability (Bormann

et al., 2016; Zampieri et al., 2015). In addition, the progressive decline in the levels of the

DNA methyltransferase (DNMT1) also contributes to the decreased DNA methylation

during aging (Jung and Pfeifer, 2015). A study using a DNMT1+/− mouse model showed

DNA methylation contributes to age-dependent impaired learning and memory function (Liu

et al., 2011b). The contribution of DNA methylation to aging is further demonstrated in a

recent study of aged pancreatic cells showing loss of DNA methylation and decreased

activity of DNMT1 resulting in aberrant gene expression (Avrahami et al., 2015). Among

the histone modifications known to associate with aging and affect longevity, the most

conspicuous ones are acetylation and methylation of lysine residues. Studies have

demonstrated the age-associated histone modifications including increased levels of histone

55

H4K16 acetylation (H4K16Ac), H4K20 trimethylation (H4K20me3), or H3K4

trimethylation (H3K4me3), and decreased levels of H3K9 methylation (H3K9me3) or

H3K27 trimethylation (H3K27me3) (Fraga and Esteller, 2007; Han and Brunet, 2012).

DNA methylation and histone modifications function interdependently and both

exert changes during aging. During development in both mice and human, the repression of

polycomb group protein (PcG)-mediated target genes in specific DNA hypermethylated loci

is regulated by H3K27me3 and reversed by H3K4me3. In contrast, during aging, DNA

hypermethylation is enriched at the regions carrying bivalent histone marks-both H3K4me3

and H3K27me3 (Weidner and Wagner, 2014; Weidner et al., 2014). Moreover, DNA

hypomethylation couples with the histone marks H3K9Ac, H3K27Ac, H3K4me1~3 found in

enhancer regions (Raddatz et al., 2013).

1.5.2 Aging in the lung

Like other organs, the lungs also age, manifesting degenerative changes during

aging. At the cellular level, age-related deterioration in the lungs includes the depletion of

stem cell pool, increased oxidative stress and accumulated DNA damages leading to

telomere shortening and mitochondrial dysfunction (Sahin et al., 2011). As a global

phenomenon in the lung, aging affects various cell types, including epithelial, endothelial,

mesenchymal and immune cells.

The lung harbors distinct stem cell populations which reside in the supporting niches

to maintain tissue homeostasis and respond to injury (Kim et al., 2005a; Rawlins et al.,

2009a; Rock et al., 2009a; Barkauskas et al., 2013a; Hogan et al., 2014; Vaughan et al.,

2014; Jain et al., 2015a). During aging, the number and function of lung stem cells decline

and gradually lose their regenerative capacity. Age-related replicative exhaustion, depletion

of stem cell pool, and alterations in stem cell niches result in lung dysfunction. Growing

evidence reveals that the dysfucntion of epithelial cell populations is a key component of the

aging process. For instance, a recent study showed age-associated changes in the cellular

composition, organization and local microenvironment of the mouse tracheal epithelium.

They found that the number and proportion of basal cells in the airways of aged mice

decreased and the appearance of age-associated gland-like structures (ARGLS) in the

56

submucosa may due to a response to chronic changes in the microenvironment (Wansleeben

et al., 2014).

Lung aging is closely associated with the development and pathogenesis of chronic

respiratory diseases, of which the prevalence and diagnosis increase with age. These include

chronic obstructive pulmonary disease (COPD), idiopathic pulmonary fibrosis (IPF),

emphysema, submucosal gland hypertrophy and cancer (Chilosi et al., 2013; Faner et al.,

2012). Studies in tissues from emphysema patients showed that the depletion of stem cell

pool in aged lungs was due to the inability of turnover and increased cellular senescence,

resulting in the loss of normal alveolar structures and diminished tissue regeneration (Tsuji

et al., 2006; Yokohori et al., 2004). Telomere shortening, cellular senescence and stem cell

exhaustion, have been found to be closely associated with the development of IPF. For

instance, mutations in the enzyme telomerase and the consequential telomere shortening are

involved in the pathogenesis of both familial and sporadic IPF, which also link to the

development of COPD and emphysema (Alder et al., 2011; Armanios et al., 2007).

Furthermore, age also causes extracellular changes in the lung that influence the activation

of signaling pathways of proliferation, differentiation and senescence in the seeded cells

(Sokocevic et al., 2013). Overall, aging alters the lungs at both cellular and extracellular

levels and these age-associated changes cause tissue dysfunction and the development of

chronic pulmonary disorders.

1.5.3 Rejuvenation using iPS reprogramming strategy

Great efforts have been placed on rejuvenation of aged cells in regenerative medicine

research. Numerous studies demonstrate that the iPS reprogramming is not only able to alter

cell fate, from terminally differentiated to pluripotent state, but also enable aged cells to

adopt a more youthful state. The reprogramming process ameliorates many cellular

hallmarks of aging, such as mitochondrial dysfunction, telomere length shortening, stem cell

exhaustion, cellular senescence, and changes in histone marks.

During reprogramming of aged somatic cells, the expression of telomerase gene can

be reactivated that attributes to the rejuvenation consequence (Marión and Blasco, 2010). In

addition, the restoration of telomere length is observed during reprogramming aged

fibroblasts to iPS cells (Lapasset et al., 2011a; Marion et al., 2009). Notably, certain types of

57

genetic defects in telomerase components hindered the full restoration of telomerase activity

and its ability to lengthen telomeres during reprogramming (Batista et al., 2011).

Furthermore, studies in reprogramming of aged fibroblasts show that the aging

phenotypic mitochondrial dysfunction and the associated production of reactive oxygen

species (ROS) are restored to a rejuvenated state in iPS cells and in their derivatives at early

passages (Lapasset et al., 2011b; Prigione et al., 2011; Suhr et al., 2010)

Epigenetic dysregulation is a major driver of cellular damage observed during aging

and in age-related disorders (Benayoun et al., 2015; Pollina and Brunet, 2011). The

restoration of aging hallmarks to the youthful state during iPS reprogramming is mainly

driven by epigenetic remodeling. For instance, iPS reprogramming of fibroblasts from

Hutchinson–Gilford progeria syndrome (HGPS) patients results in restoration of age-

associated epigenetic marks to wild-type levels (e.g., H3K9me3) (Liu et al., 2011a).

Moreover, a recent study showed that iPS reprogramming erases age-associated epigenetic

memory in aged cells showing the efficient restoration of epigenetic markers (e.g., 5hmC,

H3K4me3, H3K9me3, and H3K27me3) and achieves enhanced rejuvenation in iPS-derived

neurons compared with the neurons derived via direct conversion process (Yang et al.,

2015).

Thus, based on the plastic and reversible nature of epigenetic mechanisms,

epigenetic reprogramming/remodeling which referrers to changes in the stable

transcriptional profile of a cell without alteration in DNA sequences could provide a

promising avenue for therapeutics against age-related decline and diseases.

58

Chapter 2

Rationale, Hypotheses and Objectives

Introduction

Regenerative medicine approaches for airway diseases such as cell replacement

therapy of lung allograft rejection and tissue engineering (such as the ultimate goal of

recellularizing a decellularized lung scaffold) all require a source of proliferative epithelial

cells with restricted differentiation. As a source for cell therapies, primary cultures of

airway epithelium possess limited proliferative capacity and gradual loss of differentiation is

seen, at least, in vitro. Endogenous progenitor cells are rare, which limits their expansion,

and their number and function decline in certain pathological conditions. Furthermore,

directed differentiation protocols of ES and iPS cells to generate large numbers of pure, fully

differentiated cells are still imperfect and derivation of each unique cell will require the

development of hundreds of unique protocols. Therefore, we aimed to develop an alternative

approach to obtain large number of progenitor-like cells which can theoretically be applied

to almost any cell type that can be isolated and purified.

This thesis describes the generation of induced Progenitor-Like (iPL) cells using a

novel interrupted reprogramming strategy. The approaches described in this thesis are 3-

fold: 1. Generation of bronchiolar progenitor-like iPL cells from quiescent mature Club cells

which are useful in cell replacement therapy for cystic fibrosis; 2. Generation of bipotent

progenitor-like iPL cells from adult AEC-IIs capable of ameliorating bleomycin-induced

pulmonary fibrosis; and 3. Rejuvenation of aged AEC-II cells to a youthful state using

interrupted reprogramming.

Rationale

The generation of iPS cells is a multistep process

59

Reprogramming is a multistep process comprising of initiation, maturation and

stabilization phases. One of the phenotypic changes in the early reprogramming process is

the rapid induction of proliferation with upregulatios of proliferation genes such as Ccnd1,

Ccnd2 and DNA replication genes. Moreover, ectopic expression of the four reprogramming

factors (Oct4, Sox2, Klf4 and c-Myc) is required until the iPS state is established, otherwise

cells return to a differentiated state.

The epigentic fingerprint of iPS cells

Induced pluripotent cells can be derived from not only fibroblasts, but also other

somatic cell types, such as blood, stomach and liver cells, keratinocytes, melanocytes,

pancreatic B cells and neural progenitors. All these iPS cell lines express pluripotency genes

and are able to generate chimeric mice. However, reprogrammed cells retain epigenetic

“memory” during the process for a significant number of doublings, with the cell of origin

influencing the molecular epigenetic profile and functional differentiation potential of the

iPS cells.

Herein, to create therapeutically valuable intermediate cellular products, we took

advantage of this early proliferation, and speculated that even greater residual epigenetic

“memory” exists early in the reprogramming process.

Hypothesis

Carefully timed transient expression of induced Pluripotent Stem (iPS) cell

reprogramming factors OSKM (termed "interrupted reprogramming") allows controlled

expansion yet preservation of lineage commitment.

Objectives

To isolate and purify distinct lung epithelial populations

To determine if define length of interrupted reprogramming leads to controlled

expansion of purified epithelial cells;

60

To determine if interrupted reprogramming allows preservation of lineage

commitment;

To characterize iPL cells derived from distinct epithelial populations;

To determine if iPL cells are able to engraft, survive and repopulate injured

epithelium in vivo.

61

Chapter 3

Generation of induced progenitor-like (iPL) cells from mature

epithelial cells using interrupted reprogramming

Contents of this chapter have been modified from Guo, L. et al. Generation of Induced

Progenitor-like Cells from Mature Epithelial Cells Using Interrupted Reprogramming. Stem

Cell Reports 9, 1780–1795 (2017).

The published paper can be found at the following link

http://www.cell.com/stem-cell-reports/fulltext/S2213-6711(17)30477-0

3.1 Rationale, Objectives, Hypotheses and Specific Aims

Rationale:

Induction of cells to iPS cells through delivery of 4 reprogramming transcription

factors (OSKM) activates proliferation far before full pluripotency is obtained. Residual

‘epigenetic memory’ persists in the early-passage iPS cells, reflecting the cell of origin, and

influences the molecular epigenetic profile and functional differentiation potential of the iPS

cells.

Objective:

To evaluate the potential of induced progenitor-like (iPL) cells to repopulate the

airway epithelium in lung injury models in mice.

Hypothesis:

Transient expression of iPS reprogramming transcription factors leads to expansion

of epithelial populations which return to their original phenotype after withdrawal.

62

Specific Aims:

To isolate and purify mature Club cells from mouse lung;

To determine if transient expression of iPS reprogramming factors leads to expansion

of purified mature Club cell population;

To determine if Club-iPL cells return to quiescent upon withdrawal of

reprogramming factors;

To determine if Club-iPL cells return to parental lineage epithelial cells upon factors-

withdrawal;

To characterize Club-iPL cells

To evaluate if Club-iPL cells are able to engraft, survive and repopulate injured

bronchiolar epithelium in vivo

3.2 Abstract

We present a novel "interrupted reprogramming" strategy to generate "induced

Progenitor-Like (iPL) cells" using carefully timed transient expression of induced

Pluripotent Stem (iPS) cell reprogramming factors (Oct4, Sox2, Klf4 and c-Myc; OSKM)

from highly purified mature Club cells. Interrupted reprogramming allowed controlled

expansion yet preservation of lineage commitment. Under clonogenic conditions, iPL cells

expanded and functioned as a bronchiolar progenitor-like population to generate mature

bronchiolar Club cells, mucin-producing goblet cells, and CFTR-expressing ciliated

epithelium in vitro. In vivo, iPL cells were able to repopulate CFTR-deficient epithelium.

This interrupted reprogramming process could be metronomically applied, to achieve

controlled progenitor-like proliferation. By carefully controlling the duration of transient

expression of OSKM, iPL cells do not become pluripotent and maintain their memory of

origin and retain their ability to efficiently return to their original phenotype. A generic

technique to produce highly specified populations may have significant implications for

regenerative medicine.

63

3.3 Introduction

A major block in the critical path of regenerative medicine is the lack of suitable cells

to restore function or repair damage. An ‘ideal’ cell for cell therapy will possess the

following attributes: (1) non-immunogenic, ideally patient-derived; (2) controllable

proliferation, allowing directed expansion; and (3) regulatable differentiation, with intrinsic

restriction to the appropriate lineage. Primary cultures of somatic cells are not ideal as they

possess limited proliferative capacity and gradually lose their differentiated properties.

Endogenous progenitor cells exist in various organs, including the lung (Kim et al., 2005;

Rawlins et al., 2009; Rock et al., 2009; Barkauskas et al., 2013; Vaughan et al., 2014; Jain et

al., 2015). However, these endogenous progenitor populations are often difficult to identify

and isolate, and usually rapidly change upon in vitro culture (Bertoncello and McQualter,

2010; Raiser and Kim, 2009). In several disease or injury states, they may be limited in

number and function (Rock, 2012; Randell, 2006). Therefore, great efforts have been placed

on exogenous cell sources. Despite significant progress to generate mature cell types using

embryonic stem cells (ESCs) and induced pluripotent stem (iPS) cells (Christodoulou et al.,

2011; Longmire et al., 2012; Mou et al., 2012; Wong et al., 2012; Ghaedi et al., 2013; Huang

et al., 2013; Firth et al., 2014), some protocols remain limited by low yield and purity of the

desired mature cell types. There is no standardized approach applicable to all cell types.

Development of personalized therapies based on autologous pluripotent cells remains very

expensive. Moreover, for many cell therapy applications, the cells will need externally

controllable proliferative capacity to maintain homeostasis or respond to injury.

The early steps of reprogramming have recently been the subject of intense

investigations (Clancy et al., 2014; Hussein et al., 2014; Lujan et al., 2015; Shakiba et al.,

2015). Two papers have documented additional alternative pluripotent stem cell states,

specifically the F-class cells described by Tonge et al. (Tonge et al., 2014), and separate

populations expressing identified as either Lin28high

or Nanoghigh

by Zunder et al. (Zunder et

al., 2015). In this work, we explore the earlier stages of iPS reprogramming for potentially

useful intermediate cell states. Reprogramming is a multi-step process comprising initiation,

maturation and stabilization phases (Samavarchi-Tehrani et al., 2010) during continuous

expression of exogenous reprogramming factors until the iPS cell state is established

64

(Sridharan et al., 2009). There is a rapid induction of cell proliferation during the early

phase of reprogramming (Woltjen et al., 2009). Reprogrammed cells retain epigenetic

“memory” in the process for significant number of doubling, with the cell of origin

influencing the molecular epigenetic profile and functional differentiation potential of the

iPS cells (Kim et al., 2010; Polo et al., 2010; Shipony et al., 2014). Herein, to create

therapeutically valuable intermediate cellular products, we took advantage of this early

proliferation, and speculated that even greater residual epigenetic “memory” exists early in

the reprogramming process.

For proof of principle, we chose the lung, in which there has been recent progress in

the identification of progenitor cells and their hierarchical relationships (Raiser and Kim,

2009; Rawlins et al., 2009; Rock et al., 2009; McQualter et al., 2010; Chapman et al., 2011;

Teisanu et al., 2011; Barkauskas et al., 2013; Lee et al., 2014; Treutlein et al., 2014;

Vaughan et al., 2014; Zuo et al., 2014; Jain et al., 2015) but there remains an unmet need to

produce highly purified epithelial populations. For specificity, we selected mature Club

cells, which possess limited proliferative capacity in vitro. Interrupted reprogramming

resulted in the generation of large numbers of epithelial progenitor-like cells that

demonstrated controlled proliferation and restricted differentiation. This was achieved by

optimized, controlled, transient induction of reprogramming factors, turning off their

expression prior to reaching independent pluripotency (Figure 1A). We term these cells

"induced Progenitor-Like (iPL)" cells.

Compared to the difficulty of developing directed differentiation protocols for each

cell type required, isolation of highly purified populations of adult cells from most organs is

already possible using flow cytometric sorting and cell culture techniques. These

populations, if bestowed controllable proliferative capacity and limited differentiation

potential, would be extremely useful in a variety of regenerative medicine practices,

including cell replacement therapy, biohybrid devices, disease modelling, and drug screening

for human diseases.

65

3.4 Material and Methods

3.4.1 Animal Husbandry

ROSA26-rtTA and Col1a1: tetO-4F2A mice (Jackson Labs, Cat#011004) were used

to generate inducible lung epithelial cells. For in vivo studies, ROSA26-rtTA/Col1a1:: tetO-

4F2A double transgenic mice were bred to actin GFP mice. There were no significant

differences between heterozygotes and homozygotes with respect to inductive factor gene

expression in dox-treated Club cells. Adult (6- to 8-week-old) female FABP/CFTR-

knockout mice (where the FABP [human fatty acid binding protein 1 liver] promoter drives

expression of hCFTR, to facilitate growth and fertility) (Jackson Labs, Cat#002364) were

used for naphthalene treatment studies. Animals were maintained as an in-house breeding

colony under specific pathogen–free conditions. All procedures involving animals were

approved by the Institutional Animal Care and Use Committee of the University Health

Network (Toronto, Ontario, Canada).

3.4.2 Naphthalene Administration and Cell Delivery

Naphthalene (>99% pure; Sigma-Aldrich, St Louis, MO) was dissolved in Mazola

corn oil and injected as described before (Stripp et al., 1995). Busulfan (Otsuka America

Pharmaceutical, Rockville, MD) was given by intra-peritoneal injection 1 day after

naphthalene treatment at a dose of 20–50mg/kg and donor cells were transplanted the

following day (106 cells in 50l PBS) transtracheally using sterile gel-loading tips. The

mice receiving donor cells were rotated to ensure equal dispersion of cell suspension to both

lungs.

3.4.3 Teratoma Assay

Cells were suspended in Matrigel (BD Bioscience) diluted 1:2 (vol/vol) with PBS.

Appropriate numbers of cells (0.25 ~ 2 × 106 cells in 100 μL) were injected subcutaneously

into both dorsal flanks of nude mice (CByJ.Cg-Foxn1nu/J) anaesthetized with isoflurane.

Four to five weeks after injection, mice were killed and teratoma tissues were harvested. For

long-term evaluation for tumorigenic potential of the cells, recipient mice were kept for 6

months. Teratoma tissues were fixed overnight in 10% buffered formalin phosphate, and

66

embedded in paraffin. Three-to-four-micrometre-thick sections were deparaffinized and

hydrated in distilled water. Sections were stained with haematoxylin and eosin for regular

histological examination.

3.4.4 Cell Isolation and Culture

3.4.4.1 Isolation of Club Cells from Mouse Lung

Mice were injected intra-peritoneally with heparin (250U/mouse) and by CO2

narcosis. Lungs were perfused through the right ventricle with cold phosphate buffered

saline (PBS) to remove blood by directing the catheter towards the main pulmonary artery.

Endo-bronchial lavage was then performed to remove alveolar leukocytes. Club cells were

isolated using a previously described protocol (Atkinson et al., 2008) with modifications.

Briefly, lungs were instilled with 0.5mL of 1% low melting temperature agarose in PBS

through the trachea then placed on ice for 2min. For lung digestion, 0.5~1mL of 0.25%

trypsin was instilled into the lung followed by ligation of the trachea with a suture. Lungs

were incubated for 10min at 37°C, then lung tissue was teased away from the large airways,

finely minced to 1mm2 pieces and placed in 250μg/mL of DNAse I in DMEM containing

antibiotic for 10 minutes. The suspension was transferred to a 50mL tube, and FBS was

added to 10% of final volume. The suspension was sieved through 100 and 40μm nylon

meshes and centrifuged at 200g for 10 minutes. The cell pellet was re-suspended in red

blood cell lyses buffer for 3min and the lysis was stopped by addition of an equal volume of

PBS. Cells were centrifuged at 40g for 6min then re-suspended in 10% FBS-DMEM and

centrifuged 2 more times at 40g for 6min. The final pellet was suspended in 0.5 % vol/vol

FBS-PBS for all subsequent procedures.

3.4.4.2 Cell Culture

Epithelial-specific medium comprised of DMEM/F12 (Invitrogen) supplemented

with 10% FBS, penicillin/streptomycin, 10mg/ml insulin, 5mg/ml transferrin-selenium

(Sigma), epidermal growth factor (EGF, 20ng/mL; Sigma), fibroblast growth factor-10

(FGF-10, 50ng/mL; R&D Systems) and hepatocyte growth factor (HGF, 30ng/mL; R&D

Systems).

67

3.4.4.3 Matrigel-based iPL Induction

Feeders (MEF) were seeded on 0.1% gelatin coated 24-well transwell filter inserts

(Corning) one day prior to the addition of epithelial cells. Sorted epithelial cells

resuspended in 100μL of Matrigel (BD Biosciences) prediluted 1:1 (vol/vol) with epithelial-

specific (EpiS) media were added to a MEF-coated 24-well transwell filter inserts in a 24-

well tissue culture plate containing 500μL of epithelial media for 3-5 days then replaced

with ES (embryonic stem cell) medium containing 1.5ug/mL doxycycline (Sigma). Media

was replenished three times per week. For bulk passaging, whole cultures were dissociated

in Collagenase (1mg/mL; Sigma) Dispase (3mg/mL; BD Biosciences) in PBS to generate a

single-cell suspension. For clonal passaging, single colonies were picked and dissociated.

3.4.4.4 In Vitro Differentiation Assays

To examine the in vitro potential of these cells to differentiate along certain lineages

a variety of differentiation assays were performed. iPL cells induced for 3 weeks were

compared to a positive control group consisting of cells exposed to reprogramming factors

for 8 weeks.

3.4.4.5 Air-liquid Interface (ALI) Differentiation Assay

Prior to the ALI assay, induced cells were cultured and recovered in ES medium for

2 weeks. For ALI culture, the ES medium from upper chamber was removed to expose cells

to the air while medium in lower chamber was replaced with ALI-specific medium (Lonza).

Media was replenished 2 times per week and cells were maintained under ALI conditions for

23 weeks.

3.4.4.6 In Vitro Pluripotency Assay

An in vitro pluripotency assay to assess the potential of these cells to develop into a

variety of cell lineages was performed (Levenberg et al., 2003). Briefly, induced cells were

dissociated digested to single cell suspension then re-suspended in 50% (Matrigel) and 20%

FBS containing medium supplemented with: activin-A (20ng/mL), transforming growth

factor (TGF)-1 (2ng/mL), 10g/mL insulin, 5g/mL transferrin and retinoic acid (RA)

68

(300ng/mL) for 2-3 weeks. Lineage differentiation was assessed by immunostaining of Pan-

Cytokeratin, -actinin and -tubulin III.

3.4.4.7 Neuron Differentiation Assay

To determine the lineage commitment of induced cells, we performed a defined

neuron differentiation assay (Millipore) with slight modifications. Briefly, 3-week and >8-

week induced cells from Matrigel cultures were digested to single cell suspension and

differentiated under neuron-specific conditions for 2-3 weeks following the manufacturer’s

protocol. Generation of neurons was accessed by immunostaining of -tubulin III.

3.4.5 Fluorescence Activated Cell Sorting and Analysis

For purification of epithelial cells, fresh isolated cells were suspended and incubated

in 0.5 % vol/vol FBS-PBS containing an optimally pre-titered mixture of antibodies [anti-

CD45, anti-CD31 (BD Biosciences), anti-EpCAM (Abcam) and relevant isotype controls]

for approximately 30min on ice. Labeled cells were washed and re-suspended at 3~5 × 106

cells/mL in 0.5 % vol/vol FBS-PBS. Cell viability was accessed by propidium iodide

(1μg/mL) staining. For intra-cellular antigen analysis, cells were fixed and stained using a

Fix and Perm kit (Invitrogen) as per manufacturer instructions. Sorting was performed using

a Moflo BRU cell sorter (Becton Dickinson), aquisition was performed using a BD LSRII

analyzer (Becton Dickinson) and data was analyzed using FlowJo software.

3.4.6 Bottom-feeder conditioned CFSE assay

CFSE (carboxyfluorescein diacetate, succinimidyl ester) cell proliferation assay was

used to evaluate proliferative capacity. Mitomycin treated in-activated mouse embryonic

fibroblast (MEF) feeders were seeded and allowed to attach to the bottom of the transwell

(Corning) membrane one day prior to addition of sorted cells on the top of the membrane.

CFSE working solution (10-15M106 cells; Invitrogen) was prepared and applied to cells

according to the manufacturer’s protocol. Cell were labelled with CFSE and analyzed using

flow cytometry.

69

3.4.7 Immunofluorescence

Samples were fixed with 4% paraformaldehyde (PFA) for 30min and blocked with

5% goat serum and 2% BSA in PBS containing 0.5% Triton X-100 for 1 hour. Primary

antibodies (Table 1) were diluted in BSA/PBS, applied to samples and incubated overnight

at 4°C. Secondary antibodies AlexaFluors 488, 532, 546, 633 or 647 (Invitrogen) were

applied according to the species in which the primary antibody was used for 2 hours at room

temperature. Nuclear staining was performed using 2mg/ml 4, 6, diamidino-2-phenylindole

(DAPI; Sigma). Stained samples were mounted with immunofluorescent mounting medium

(DAKO). Appropriate non-specific IgG isotypes were used as controls. Immunoreactivities

of antigens were visualized as single optical planes using an Olympus Fluoview confocal

microscope and analyzed using FV10-ASW 2.0 Viewer software.

Antibody name Company Cat. Num

CD45 BD phamingen 553081

CD31 BD phamingen 553373

EpCAM Abcam ab95641

CCSP Cedarlanes/Upstate 07-623

Santa cruz biotechnology sc-9772

Claudin10 Invitrogen 388400

pro-SPC Chemicon AB3786

T1a Santa Cruz sc-53533

-tubulin IV SIGMA-Aldrich T7941

pro-collagen Santa Cruz sc-166007

a-SMA SIGMA-Aldrich A2547

70

E-cadherin Abcam ab11512

CFTR Thermo MA1-935

Abcam ab59394

Pan-cytokeratin Abcam ab86734

Oct4 BD phamingen 611203

Cellsignaling 2840

Nanog Abcam ab80892

BD phamingen 560259

P63 Santa Cruz SC-8431

Thermo Scientic MS-1081-P0

MUC5AC Santa Cruz sc-59951

Tubulin III Millipore MAB1637

Sarcomeric a-actinin Abcam ab9465

GFP Invitrogen A-21311

Invitrogen A31851

Abcam ab6673

ZO-1 Miilipore MABT11

Table 1: Tabulated list of all antibodies used in the studies.

71

3.4.8 Iodide Efflux Assay

ALI-conditioned cells cultured on transwell membranes were loaded with 500 µl NaI

solution [3.0mM KNO3, 2.0mM Ca(NO3)2, 11mM glucose, 20mM HEPES, 136mM NaI]

from the bottom chamber and incubated at 37°C for 1h. To remove the redundant iodide,

cultures were washed out with 5 times ml of washing buffer comprised of nitrate (3.0mM

KNO3, 2.0mM Ca(NO3)2, 11mM glucose, 2 mM Hepes, 136mM NaNO3) and 100μM

amiloride. For time course measurement, 200µl of washing buffer was added to the top

chamber of transwells at one-minute intervals for 3 minutes followed by adding 200µl of

cAMP agonists which contain forskolin (10μM), 3-isobutyl-1-methylxanthine (100μM,

IBMX), and genistein (50μM) in washing buffer at one-minute intervals for 6 minutes.

Reacted solutions at each minute were transferred to a 96-well plate to measure the absolute

iodide electrode value (mV) using halide-selective microelectrode (Lazar Research

Laboratories, Los Angeles, CA). Measured mV values were converted to iodide

concentrations using a standard curve measuring the mV values of 1μM to 1mM iodide.

3.4.9 Western Blot

Lung tissues (~25mg) were lysed in RIPA buffer (Cell Signaling) with one Complete

Mini EDTA-free protease inhibitor tablet (Roche) for 30 minutes on ice then centrifuged at

10 000g and the supernatants were resolved by SDS-PAGE. For detection on PVDF

membrane (Roche), anti-CFTR (rabbit polyclonal, abcam # ab59394) and anti--actin (Cell

signaling #4970) antibodies were used.

3.4.10 Real-time PCR Analysis

Total RNA was prepared using the RNeasy Kit (Qiagen) as per manufacturer’s

instructions. cDNA was prepared and assayed using Superscript III (Sigma) according to

manufacturer’s protocol. Differential gene expression was determined using SYBR green

detection (Roche). All Real-time PCR reactions were done in triplicate for each sample.

GAPDH was used as a housekeeping gene to normalize gene expression levels using

LightCycler 480 software (Roche). Normalized mRNA levels were shown as relative to the

control samples (day 0 fresh isolated cells or adult lung) (Table 2).

72

qPCR primers

Gene name Primer sequence 5’-3’ length

4F2A Forward GGCTGGAGATGTTGAGAGCAA 21

Reverse AAAGGAAATCCAGTGGCGC 19

c-Myc Forward ACCACCAGCAGCGACTCTGA 20

Reverse TGCCTCTTCTCCACAGACACC 21

K1f4 Forward GCACACCTGCGAACTCACAC 20

Reverse CCGTCCCAGTCACAGTGGTAA 21

Oct4 Forward ACATCGCCAATCAGCTTGG 19

Reverse AGAACCATACTCGAACCACATCC 23

Sox2 Forward ACAGATGCAACCGATGCACC 20

Reverse TGGAGTTGTACTGCAGGGCG 20

CyclinD1 Forward CCTGACACCAATCTCCTCAACG 22

Reverse TCTTCGCACTTCTGCTCCTCAC 22

Cyp2f2 Forward GCATACCCCGTCTTTTTCAA 20

Reverse TCATCGTCATAGTCGAAGCG 20

Cld10 Forward CCAGGGTCTGTGGATGAACT 20

Reverse GCCAAGCAAGCAATTTTAGC 20

Aox3 Forward AGAGCCCTCCACAGAACAGA 20

Reverse TGTATTTTGGGACTCCTCGG 20

Pon1 Forward GAACAAGAAGGAGCCAGCAG 20

Reverse AACAACATTGGACCACGACA 20

EpCAM Forward GCTGGCAACAAGTTGCTCTCTGAA 24

Reverse CGTTGCACTGCTTGGCTTTGAAGA 24

73

E-Cadherin Forward AACAACTGCATGAAGGCGGGAATC 24

Reverse CCTGTGCAGCTGGCTCAAATCAAA 24

CCSP Forward ATCTGCCCAGGATTTCTTCA 20

Reverse TCTTGCTTACACAGAGGACTTGTT 24

Sftpc Forward GCAAAGAGGTCCTGATGGAG 20

Reverse GCAGTAGGTTCCTGGAGCTG 20

AQP5 Forward ATGAACCCAGCCCGATCTTT 20

Reverse ACGATCGGTCCTACCCAGAAG 21

CFTR Forward CTGGACCACACCAATTTTGAGG 22

Reverse GCGTGGATAAGCTGGGGAT 19

Foxj1 Forward GCCGGCAGTTCAACTGCCCT 20

Reverse CAGTCCTGCAGGTCAGCGGC 20

Table 2: Tabulated list of all qPCR primers used in the studies.

3.4.11 Microarray and Data Analysis

Total RNA was extracted using RNeasy kit (Qiagen, Canada). Equal amounts of

RNA from three separate samples in each group were used for microarray. Microarray

expression profiling using Mouse Gene 2.0 ST chips was performed by The Centre for

Applied Genomics, (The Hospital for Sick Children, Toronto, Canada). GO term analysis

was performed by the DAVID Bioinformatics tool. Self-organizing map analysis of gene

expression was performed with the use of the analysis tool - MultiExperiment Viewer.

3.4.12 Statistics

Statistical analysis was performed using GraphPad Prism 5.0 statistical software (San

Diego, CA, USA). The statistical significance of multiple groups was compared to each

other using Tukey’s multiple comparison test ANOVA. A p value of <0.05 was considered

significant.

74

3.5 Results

3.5.1 Isolation and Identification of Terminally Differentiated

Club Cells

Club cells are secretory cells prominently found in the small bronchioles,

identifiable by the presence of Club cell secretory protein (CCSP) (Hackett and Gitlin,

1992). The mature cells have very limited proliferative capacity. After injury, they are

replaced from a pool of “variant” Club cells, which are resistant to toxins such as

naphthalene. This population also then serves as progenitors for ciliated and mucous cell

populations (Rawlins et al., 2009; Reynolds and Malkinson, 2010). To demonstrate that the

value of the iPL cell approach, we chose to isolate this terminally differentiated population.

Following a modified Club cell isolation protocol (Atkinson et al., 2008), a

CD45neg

CD31neg

EpCAMpos

profile defined two distinct epithelial populations, namely

EpCAMhigh

and EpCAMlow

cells (Figure 1B). The EpCAMhigh

population was exclusively

Club cells expressing CCSP (Figure 1C) and Claudin10 (Zemke et al., 2008) (Cldn10)

(Figure S1A), whereas the EpCAMlow

population contained both Club cells and type II

alveolar epithelial (AEC-II) cells (Figure 1C, S1B). Club cell-related genes CCSP, Cyp2f2,

Cldn10, Aox3, and Pon1 were detected within both populations with higher levels in the

EpCAMhigh

population (Figure 1D, E). Naphthalene administration results in selective loss

of mature Club cells (Stripp et al., 1995). To evaluate whether EpCAMpos

populations

contained functionally different subtypes of Club cells, we compared EpCAM expression in

cells isolated from naphthalene-treated and non-treated mice. EpCAMhigh

cells were nearly

completely ablated with naphthalene treatment, confirming that they are naphthalene-

sensitive, mature Club cells (Figure 1F).

3.5.2 Interrupted Reprogramming Allows OSKM-dependent

Proliferation of EpCAMhigh

-Club Cells

EpCAMpos

cells were isolated from R26-rtTA/Col1a1::tetO-4F2A double transgenic

mice (Carey et al., 2009) enabling expression of Oct4, Sox2, Klf4 and c-Myc (OSKM)

following treatment with doxycycline (Dox). To measure the proliferative response of

EpCAMpos

cells to inductive factors, we used a specific 2D culture system allowing

75

separation of seeded cells from a feeder population (Kim et al., 2007) (Figure S1C). Control

non-treated and Dox-treated EpCAMhigh

and EpCAMlow

cells were labelled with

carboxyfluorescein diacetate, succinimidyl ester (CFSE) dye at day 7 and maintained in

culture for an additional week in the presence or absence of Dox. Non-treated EpCAMhigh

cells showed very limited proliferation consistent with lower expression of Cyclin D1 while

dox treatment resulted in significant proliferation of the majority of cells (Figure 1G, H).

After treatment with Dox, EpCAMhigh

cells showed significant upregulation of the 4F2A

construct transgene and Cyclin D1 (Figure 1J, K). Withdrawal of Dox stopped proliferation

in the EpCAMhigh

group, while EpCAMlow

cells continued to proliferate (Figure 1H, I). Note

the spontaneous loss of EpCAM in the EpCAMlow

population (Figure 1I). Importantly,

EpCAM and CCSP expression re-emerged following withdrawal of Dox (Figure 1L, M).

Thus, for these proof of principle studies, we selected the EpCAMhigh

population, where, as

non-proliferative mature Club cells, induced proliferation could be easily distinguished from

endogenous proliferation.

76

Figure 1. CD31-CD45

-EpCAM

high Epithelial Cells are a Highly Purified Naphthalene-

Sensitive Club Cell Population in which Regulation of Inductive Factors Results in

77

Controlled Proliferation. (A) Schematic graph depicting generation of iPL cells using

interrupted reprogramming. (B) Representative flow cytometry dot-plots showing

EpCAMhigh

and EpCAMlow

cells in a parental population of CD31-CD45

- fresh isolated lung

tissue digested cells. (C) Dot plots showing EpCAMhigh

cells are exclusive Club cells

showing immunoactivity of CCSP. Relative expression of (D) Club cell and (E) other

epithelial lineage-related genes to adult lung, comparing fold-differences in gene expression

in EpCAMhigh

(solid black bars) and EpCAMlow

(open bars) cells. (F) Representative dot

plots comparing EpCAM expression in CD45-CD31

- freshly isolated lung cells from non-

treated and naphthalene treated mice (n=3). (G) Comparison of Cyclin D1 expression in

EpCAMhigh

cells and EpCAMlow

cells. Representative flow cytometery dot plots showing

CFSE-labeled cells at day 7 (untreated and Dox-treated). (H) EpCAMhigh

cells and (I)

EpCAMlow

cells maintained in feeder-separated semi-supportive culture for an additional 7

days with and without Dox treatment. Control untreated cells were cultured without Dox for

the entire 2 weeks. Expression of (J) mCol4F2A, (K) CyclinD1, (L) EpCAM, and (M)

CCSP, comparing fold-differences in gene expression of EpCAMhigh

freshly isolated (Day0),

EpCAMhigh

one-week Dox-treated (1w+Dox

), induced cells cultured for an additional week in

the presence (2w+Dox

) and absence (1w+Dox

+1w-Dox

) of Dox. In B, C, F, H and I, data are

representative of a minimum of three biological replicates. For D, E, G and J-M, values are

mean S.D. of three independent biological replicates. *, p<0.05; **, p<0.001; ***,

p<0.0001.

78

Figure S1. (A)-left, representative confocal images showing immunohistochemical staining

of frozen mouse lung tissue sections stained with DAPI nuclear stain (blue) and double-

immunolabeled with anti-CCSP (red) and anti-Cldn10 (green) showing that Claudin10 is

localized to the entire lateral surface of only CCSP+ cells (arrowheads show CCSP

neg,

79

Cldn10neg

cells). (A)-right, flow cytometry dot-plots showing freshly isolated lung cells,

stained with antibodies against Cldn10 and EpCAM. (B) Flow cytometry analysis of freshly

isolated lung cells, showing EpCAM-positive epithelial cells marked with antibodies

specific for SPC, T1, -tubulin, Pro-collagen, and -SMA. EpCAMhigh

cells are

exclusively Club cells whereas the EpCAMlow

population is composed largely of Club cells

(>90% CCSP+) with a small number of AEC-II cells (<10%), which are positive for SPC,

the classic marker for AEC-II cells. Both populations are negative for T1 (a marker for

AT-I cells) and -tubulin (a marker for ciliated cells). (C) Schematic graph of bottom-feeder

culture condition which enables the separation of seeded cells from supporting feeder cells.

In A-right and B, data are representative of a minimum of three independent biological

replicates. Scale bar, (A-left) 100 µm.

3.5.3 Interrupted Reprogramming Results in Clonal Expansion

of Quiescent Mature Club Cells without Traversing the

Pluripotent State

To better support epithelial cell growth, EpCAMhigh

Club cells were cultured in

Matrigel-based 3D conditions and seeded on inactivated mouse embryonic fibroblast (MEF)

feeder cells prior to Dox treatment. No colonies were formed in the absence of Dox,

confirming that native EpCAMhigh

cells lack clonogenic ability. Strikingly, Dox-treated

cells exhibited clonogenic growth (Figure 2A) showing epithelial colonies with hollow

lumens (Figure 2B, C). Time course analysis indicated that lumen formation occurred as

early as day4 (Figure S2A). This lumen formation occurs at least in part via apoptosis

(Grant et al., 2006), marked by caspase-3 expression (Figure S2B), and apical-basal

polarization (Martin-Belmonte et al., 2008), as shown by basolateral distribution of EpCAM

(Figure 2C) and apical expression of ZO-1 (Figure S2C). Dox induction for 3 weeks

(3w+Dox

) resulted in suppression of CCSP without activation of the pluripotency marker,

Nanog (Figure 2D, 3E). An additional 2 weeks of Dox treatment (5w+Dox

) resulted in

22.9±8.3% of colonies becoming Nanog-positive (Figure 2E). In vivo, 3w+Dox

cells injected

into NOD/SCID mice failed to form tumors or teratomas over a 6-month observation

period. In contrast, mice developed teratomas 2-3 weeks after injection with either R1-ES

cells (Nagy et al., 1993) or 5w+Dox

cells (Figure 2G, S2D). Thus, we selected a 3-week

induction period during which we achieved the greatest level of expansion without

activation of Nanog expression and hereafter term the 3w+Dox

cells Club-iPL cells. During

80

this 3-week period of expansion, cells were serially passaged in the presence of Dox,

retained colony-forming potential (Figure 2H, right Y axis), and showed an exponential

increase in total cell number (~ 30-fold expansion) (Figure 2H, left Y axis). Microarray

analysis of genome-wide transcriptional changes showed Club-iPL cells have minimal

expression of ES cell-related genes (e.g. Nanog, Utf1, Dapp4) and maintained significant

overlapping expression of Club cell-related genes (Figure 2I).

81

82

Figure 2. Carefully Defined Length of Interrupted Reprogramming Results in

Efficient Clonal Expansion of Quiescent Mature Club Cells without Traversing the

Pluripotent State In Vitro. (A) Light microscopy bright-field images showing the

generation of hollow-luminal colonies in the presence of doxycycline in Matrigel-based

clonogenic 3D conditions. (B) H&E staining of sectioned EpCAMhigh

cell-derived colonies

under Dox-treatment showing hollow-luminal morphology. (C) Confocal microscopy

images of induced colonies derived from GFP-Club cells stained with nuclear stain DAPI

(blue), GFP (green) and EpCAM (red). (D) Confocal microscopy images depicting 3-week

induced colonies (3w+Dox

) stained with nuclear stain DAPI (blue), Oct4 (green) and Nanog

(red). Immunostaining of 5 week-induced colonies (5w+Dox

) (E) showing Nanog

immunactivity as that seen in R-1 ESCs (F). In vivo teratoma assay (G), R1-ESCs (positive

control), 3w+Dox

Club-iPL cells and 5w+Dox

cells were transplanted into NOD/SCID mice.

(N=2 mice for each group). (H) Bulk serial passage of induced colonies during the 3 weeks

of induction. Left Y axis represents the folds change in total cell number relative to day0

seeded cells (10,000 cells/ well). Right Y axis represents the total number of colony forming

units (CFU) generated. (I) Microarray analysis scatter plot showing comparison of iPS

(generated from EpCAMhigh

-Club cells) to day0 and Club-iPL cells (left panel); pie charts

depicting number of genes overlap in cluster A and B (right panel). For H, values are mean

S.D. of three independent biological replicates. Scale bar, 100 µm (A-C), 10µm (D-F).

83

Figure S2. (A) Morphological changes of colonies during the induction process. (B)

Apoptosis occurs during hollow-luminal colony formation marked by caspase-3 expression.

(C) Immunofluorescence staining of induced colonies at day4 and day7 showing apical

distribution of ZO-1. (D) H&E staining of teratomas developed in NOD/SCID mice 3 weeks

post R1-ESC and 5w+Dox

cells transplant. Scale bar, 100 µm.

84

3.5.4 Interrupted Reprogramming Allows Club-iPL Cells to

Return to Their Original Epithelial Phenotype upon

Withdrawal of Factors

We assessed the ability of Club-iPL cells to return to their original epithelial

phenotype following withdrawal of Dox. Two weeks after withdrawal of Dox (3w+Dox

+2w-

Dox) cells turned off transgene 4F2A expression and down-regulated Cyclin D1 (Figure 3A,

B). Expression of the 4 individual factors was also significantly down-regulated (Figure

S3A). Some epithelial genes, such as EpCAM and E-cadherin, were well maintained both

with treatment and upon withdrawal of Dox (Figure S3B). CCSP, which was markedly

suppressed after 3 weeks of Dox, was expressed at robust levels upon withdrawal of Dox

(Figure 3C, E, F, I). Importantly, Nanog expression was not observed in either Club-iPL

cells or 3w+Dox

+2w-Dox

cells (Figure 3D, F) whereas in 4w+Dox

+1w-Dox

cells, a few Nanog+

colonies were observed (Figure 3G, H). Unbiased clustering analysis of the genes with a

change 3-fold (5966/24779 genes) demonstrated that the induced cell groups clustered

with the day0 group (Figure 3J). Further analysis showed that the expression of large

numbers of genes temporally changed during Dox-driven expansion of Club cells but

returned upon withdrawal of the factors. These gene clusters were enriched for epithelial

genes by Gene Ontology analysis (Figure 3K, top). Other genes demonstrating progressive

changes were enriched for metabolism and cell adhesion functions (Figure 3K, bottom),

suggestive merely of adaptation to the in vitro environment. Figure S3C shows a heat map of

the genes shown in Figures 2I across all 4 groups.

85

Figure 3. Interrupted Reprogramming Allows EpCAMhigh

-Club Cell Derived iPL

Colonies to Return to Their Original Epithelial Phenotype upon Factor-Withdrawal.

Expression of (A) The transgene construct mCol4F2A, (B) Cyclin D1, (C) CCSP and (D)

86

Nanog, as measured by qRT-PCR comparing fold-differences in gene expression in freshly

isolated cells (Day0), 3w+Dox

(Club-iPL cells), Club-iPL cells with subsequent 2-week

culture in Dox-free media (3w+Dox

+2w-Dox

), and 5-week induced cells (5w+Dox

). Confocal

microscopy images of (E) 3w+Dox

(Club-iPL cells) colonies, (F) Colonies obtained from

3w+Dox

(Club-iPL cells) maintained in culture for 2 weeks in the absence of Dox (3w+Dox

+

2w-Dox

), (G) Nanog-negative and (H) Nanog–positive colonies obtained from 4-week

induced cells (4w+Dox

) cultured without Dox for one subsequent week (4w+Dox

+1w-Dox

),

showing cells stained with nuclear stain DAPI (blue), Oct4Nanog (grey), Pan-CK (red) and

CCSP (green). (I) Representative flow cytometry dot-plots showing expression of EpCAM

and CCSP in 3w+Dox

Club-iPL cells, and iPL cells cultured without Dox for 2 subsequent

weeks (3w+Dox

+2w-Dox

). (J) Unbiased clustering analysis of all genes expressing 3-fold

change (5966/24779). (K) Self-organizing map analysis of genes that exhibited a >3 fold

gene expression difference between cell samples. For A-D, values are mean S.D. of three

independent biological replicates. For I, data are representative of a minimum of three

independent biological replicates. *, p<0.05; **, p<0.001; ***, p<0.0001. Scale bar, 100

µm (E-H).

87

88

Figure S3. Expression of (A) Oct4, Sox2, klf4, c-Myc, and (B) EpCAM and E-Cadherin, as

measured by qRT-PCR comparing fold-differences in gene expression in R1-ESC cells,

freshly isolated cells (day0), 3-week induced cells (3w+Dox

), 3-week induced cells with

subsequent 2-week culture in doxycycline-free media (3w+Dox

+ 2w-Dox

), and 5-week

induced cells (5w+Dox

). (C) Hierarchical clustering analysis of Club cell and pluripotency-

related gene expression of iPS (derived from Club cells), day0, 3w+Dox

and 3w+Dox

+ 2w-Dox

cells. For A and B, values are mean S.D. of three independent biological replicates.*,

p<0.05; **, p<0.001; ***, p<0.0001.

3.5.5 Interrupted Reprogramming Allows Preservation of

Lineage Commitment

To ensure that Club-iPL cells have restricted differentiation, lineage preference was

accessed by in vitro differentiation assays. Immunostaining of bulk colonies for Pan-CK

(endodermal epithelial cells), -actinin (mesodermal cardiomyocytes) and -tubulin III

(ectodermal neuron cells) demonstrated that Club-iPL cells only developed along an

epithelial lineage (Figure 4A). In contrast, cells treated with Dox for 8 weeks (8w+Dox

), in

addition to showing Pan-CK expression (Figure 4B), were able to generate -actinin+

(Figure 4C) and -tubulin III+ cells (Figure 4E). Nanog

+ undifferentiated cells were also

observed (Figure 4D). Moreover, Club-iPL cells exhibited a higher tendency for generation

of ciliated cells (-tubulin IV+: 66.7%7.6% cells) compared to 8w

+Dox cells (-tubulin IV

+:

25.2%5.1% cells) (Figure 4F). The existence of mixed populations of differentiated cells

and undifferentiated cells from the long-term induced cell group suggests that prolonged

induction results in greater divergence from the original lineage and enhanced pluripotency,

if not full creation of traditional iPS cells. Lineage commitment at the single cell level was

assessed by culturing independent colonies in 3 different media, reported to direct

differentiation to either neuronal, cardiomyocyte, or epithelial lineages (12

coloniescondition) (Figure S4A). Club-iPL colonies remain committed to an epithelial fate

generating Pan-CK+ cells but no cardiac troponin T (cTnT) or -tubulin III-expressing cells

(Figure 4G-I, S4B).

89

Figure 4

90

Figure 4. Interrupted Reprogramming Allows Preservation of Lineage Preference and

Commitment. Confocal microscopy images of bulk-passaged (A) Club-iPL (3w+Dox

) cells,

following in vitro culture under pluripotency assay conditions. Images show staining for

nuclear stain DAPI (blue), Pan-CK (green), -actinin (red), and tubulin III (grey). Cells

induced for 8 weeks (8w+Dox

), under in vitro pluripotency assay conditions with (B) Pan-CK

(green), (C) -actinin (red), and (D) Nanog (red) respectively. Confocal microscopy images

of Club-iPL (3w+Dox

) cells and 8 week induced (8w+Dox

) cells under (E) neuron cell

differentiation assay conditions showing tubulin III (green) staining and (F) under ALI

ciliated cell differentiation conditions showing -tubulin IV (green) staining. Confocal

microscopy images of cells dissociated from single Club-iPL colonies cultured on 10%

Matrigel-coated plate under conditions reported for (G) epithelial cells, (H) cardiomyocytes

and (I) neurons. Images showing staining for nuclear stain DAPI (blue), Pan-CK (red),

tubulin III (green) and cTnT (top panel-grey; middle and bottom panel-green ) (n=12

colonies/each condition). Scale bar, 10µm (C and E), 100 µm (A, B and D-I).

91

Figure S4. Schematic (A) showing different conditions used in single colony assay.

Confocal microscopy images of cells dissociated from single Club-iPL colonies cultured on

(B) gelatin-coated plate under conditions reported for epithelial, cardiomyocyte and neuronal

cells. Images showed staining for nuclear stain DAPI (blue), Pan-CK (red), tubulin III

(green) and cTnT (top panel-grey; middle and bottom panel-green ) (n=12 colonies/each

condition). Scale bar, 100 µm.

92

3.5.6 Club-iPL Cells Function as Multipotent Bronchiolar

Progenitor-Like Cells

We evaluated the differentiation potential of Club-iPL cells using a 2-step protocol

(Figure 5A) in which Club-iPL cells were cultured without Dox for 2 weeks (1st step)

followed by air-liquid interface (ALI) conditions for 2~3 weeks (2nd

step). The 1st step of

differentiation resulted in upregulation of CCSP (Figure 5B, D). Under 2nd

step ALI

conditions, iPL cells spontaneously differentiated to Muc5AC-expressing mucin-producing

goblet cells (Figure 5E) and β-tubulin IV-expressing ciliated cells (Figure 5F) coinciding

with downregulation of CCSP (Figure 5B) and upregulation of Foxj1 mRNA levels (Figure

5C). Thus, Club-iPL cells can function as multipotent bronchiolar progenitor-like cells,

giving rise to Club, goblet and ciliated cells (Figure 5G).

93

Figure 5. Club-iPL Cells Function as Multipotent Bronchiolar Progenitor-Like Cells.

(A) Schematic graph representing a 2-step differentiation protocol. Comparing fold-

differences in CCSP (B) and Foxj1(C) gene expression in adult lung, freshly isolated day0

cells, 3w+Dox

+2w-Dox

cells (pre-ALI), and cells subsequently cultured in ALI conditions for

2-3 weeks (ALI) by qRT-PCR. (D) Confocal microscopy images showing immunostaining

94

of iPL cells after the 1st

step in the differentiation protocol, with nuclear stain DAPI (blue)

Pan-CK (red) and CCSP (green). Immunostaining of cells after the 2nd

step of

differentiation protocol (E) with nuclear stain DAPI (blue), E-cadherin (red) and Muc5AC

(green); (F) with nuclear stain DAPI (blue) and -tubulin IV (green). (G) Schematic graph

depicting the differentiation capacity of 3w+Dox

(Club-iPL) cells. For B-C, values are mean

S.D. of three independent biological replicates. *, p<0.05; **, p<0.001; ***, p<0.0001.

Scale bar, 10 µm (D-F).

3.5.7 Club-iPL Cells are Able to Generate Functional CFTR-

Expressing Ciliated Epithelium

Cystic fibrosis transmembrane conductance regulator (CFTR), mainly expressed in

ciliated epithelium in the lung, encodes a cAMP-regulated chloride channel that plays a

critical role in regulating chloride and water transport. Ciliated epithelium derived from iPL

cells expressed functional CFTR protein. We observed that 61.9±6.1% of E-cadherin+ cells

expressed CFTR, consistent with the formation of functional ciliated epithelium with tight

junctions (Figure 6A). We confirmed the apical membrane localization of CFTR while E-

cadherin staining was visualized at the lateral membranes (Figure 6B). ALI-conditioning

resulted in CFTR-expressing cells (Figure 6C). Gene expression analysis of ALI-

conditioned cells compared to pre-ALI cells showed a reduction of CCSP expression

(Figure 5B) and marked up-regulation of CFTR (Figure 6D), suggesting the appropriate

differentiation of expanded Club cells to CFTR-expressing ciliated cells. An iodide efflux

assay measuring cAMP agonist stimulation of the CFTR channel suggests that CFTR seen

in Club-iPL-derived ciliated epithelium was functional and appropriately regulated (Figure

6E).

3.5.8 Club-iPL cells Are Useful in Cell Replacement Therapy for

Cystic Fibrosis in Vivo

The engraftment of Club-iPL cells into CFTR-deficient epithelium was assessed in

vivo. For tracking purposes, ROSA26-rtTA/Col1a1:: tetO-4F2A double transgenic mice

were bred to actin GFP mice and GFP+ Club-iPL cells were delivered to CFTR-knockout

mice transtracheally following our previously reported conditioning regimen (Duchesneau et

al., 2010, 2017) to augment retention of delivered cells. The engraftment and differentiation

95

capacity of Club-iPL cells in recipient lungs were assessed via staining for ZO-1 or E-

cadherin, anti-GFP and epithelial-type specific markers at 7 and 21 days after cell delivery.

CFTR expression in airways of wildtype mice was used as a positive control (Figure 6F)

while non-treated and naphthalene-treated CFTR-knockout mice served as negative controls

(Figure 6G-I). Injected GFP cells expressed ZO-1 and E-cadherin suggestive of their

incorporation in recipient epithelium. CFTR-expressing GFP cells can be found at day 7

and 21 (Figure 6J, K) after iPL treatment. Western blotting (Figure 6L) confirmed

expression of CFTR protein. A faint band of immature hypoglycosylated CFTR seen in the

untreated CFTR-knockout controls as expected (in this transgenic animal where the lung is

known to have low level expression of human CFTR) (Zhou et al., 1994). They also

increased expression of CCSP and partially restored expression of CFTR in CFTR-deficient

lungs (Figure 6M, N). Consistent with in vitro results, CCSP and α-tubulin staining

confirmed the differentiation of engrafted Club-iPL cells to Club cells and ciliated cells in

vivo (Figure S5A-E). No SPC+ or AQP5

+ GFP

+ cells were found, in vitro or in vivo (data

not shown), consistent with restricted commitment to the bronchiolar lineage. To quantify

retention, genomic DNA for GFP was measured using a standard curve. Donor iPL cells

were retained in recipient lungs (Figure S5F) with no significant difference between 7 days

(27.8±12.2% of the initial injected cell number) and 21 days (25.8±12.1%) after cell

delivery. We also examined the long-term tumorigenicity of iPL cell lines in vivo (n=3).

Whole body micro-CT scans taken at 9 months after iPL cell delivery showed no tumors

(Figure S5G).

96

97

Figure 6. Club-iPL Cells are Able to Generate Functional CFTR-Expressing Ciliated

Epithelium in Vitro which are Useful as a Component of Cell Replacement Therapy for

Cystic Fibrosis in Vivo. (A) Confocal microscopy images showing immunostaining of

ALI-conditioned iPL cells, with nuclear stain DAPI (blue), E-cadherin (red) and CFTR

(green). (B) Reconstruction of X-Z projections of horizontal sections showing nuclear stain

DAPI (blue), the apical membrane staining of CFTR (green) and the lateral membrane

staining of E-cadherin (red). (C) Flow cytometry analysis of CFTR expression in freshly

isolated (day0) cells and ALI-conditioned cells. (D) Comparing fold-differences in CFTR

gene expression in adult lung, freshly isolated (day0) cells, pre-ALI, and ALI-conditioned

cells. (E) Iodide efflux assay showing CFTR activity in ALI-iPL cells (blue line) induced

by cyclic AMP agonist. Confocal microscopy images of (F) native B57/L6 airway control,

(G) native CFTR-KO airway epithelium, injured airway epithelium of CFTR-KO mice at

(H) 1 week and (I) 3 weeks post naphthalene treatment showing nuclear stain DAPI (blue)

and CFTR (grey). Confocal microscopy images of iPL cell-treated injured airway sections,

(J) 1 week and (K) 3 weeks post cell delivery, showing nuclear stain DAPI (blue). GFP

(green), ZO-1/E-cadherin (red) and CFTR (grey). (L) Western blot showing the presence of

CFTR protein band appearing at approximately 170 kDa representative of the complex

glycosylated functional form of CFTR in homogenized lung tissue from iPL cell-treated

CFTR-knockout injured mice. Expression levels of (M) CCSP and (N) CFTR in recipient

lungs, as measured by qRT-PCR comparing fold-differences in expression in wildtype

lungs. In C, data are representative of a minimum of three biological replicates. For D-E

and M-N, values are mean S.D. of three independent biological replicates. *, p<0.05; **,

p<0.001; ***, p<0.0001. Scale bar, 10µm (A, B and F-K).

98

99

Figure S5. Confocal microscopy images of CFTR-deficient injured airway treated with

Club-iPL cells at 1 week (1w+iPL treated

, top panel) and 3 weeks (3w+iPL treated

, bottom panel).

(A, B) Immunohistochemistry showing nuclear stain DAPI (blue), GFP (green), ZO-1/E-

cadherin (red) and CCSP (grey). (C, D) Immunohistochemistry showing nuclear stain DAPI

(blue), GFP (green), ZO-1/E-cadherin (red) and α-tubulin (grey). (E) Expression levels of

Foxj1 in recipient lungs, as measured by qRT-PCR comparing fold-differences in expression

in wildtype lungs. (F) Cell retention rate of engrafted cells in recipient lungs (% of day0

injected cells), was calculated using genomic GFP expression at 1 week (1w+iPL treated

) and 3

weeks (3w+iPL treated

) (relative to β-actin GFP lungs) measured by qRT-PCR. (G) Whole body

micro-CT scans on mice injected with Club-iPL cells for 9 months showing no tumors. For

E and F, values are mean S.D. of three independent biological replicates *, p<0.05; **,

p<0.001; ***, p<0.0001. Scale bar, 10µm.

3.5.9 Cyclical Interrupted Reprogramming Enables Greater

Expansion of Club-iPL Cells

To evaluate the similarities of iPL cells to known endogenous progenitors, we

evaluated a number of putative lung progenitor cell markers. We found that P63, absent in

100

normal adult bronchiolar epithelium and in the EpCAMhigh

Club cell starting population

(Figure 7B), is highly expressed in iPL cells (Figure 7C, D). Unlike tracheal basal

progenitors (Tata et al., 2013) and H1N1 infection-induced progenitor pods (Kumar et al.,

2011), we found no expression of CK5 in iPL cells (Figure 7E). Nor was there any

expression of the alveolar progenitor marker-Sox9 (Figure 7F). After careful comparison

using available specific marker expression and microarray data for known lung progenitor

populations (Rock et al., 2009; Vaughan et al., 2014) (Figure 7G, H), Club-iPL cells do not

resemble any currently identified progenitors. However, the two fundamental properties of

endogenous progenitors, that is, proliferation and limited multipotency, could be

recapitulated. Moreover, the ability of progenitor cells to traverse to a transit amplifying

population can also be reproduced. In vitro, cyclical interrupted reprogramming using

intermittent Dox treatment in which iPL-derived Club cells (3w+Dox

+2w-Dox

) were re-induced

with Dox for 1 week (3w+Dox

+2w-Dox

+1w+Dox

; iPL2nd

) followed by an additional 2 week

culture in the absence of factors (3w+Dox

+2w-Dox

+1w+Dox

+2w-Dox

; iPL2nd

-Club cells), showed

that iPL-Club cells can respond to a 2nd

cycle (Figure 7I). Using this approach we were able

to achieve greater expansion in total cell (95±5 fold) and CFU number (Figure 7J). As with

the 1st generation iPL cells, 2

nd generation iPL cells expressed P63 and maintained their

ability to give rise to Club cells upon withdrawal of the inductive factors (Figure 7I, K).

Importantly, no Nanog expression was detected (data not shown).

We also evaluated the value of cyclical interrupted reprogramming in vivo. GFP+

iPL-derived Club cells (3w+Dox

+2w-Dox

) were delivered to naphthalene-busulfan (NAB)

conditioned BL6 mice transtracheally. Recipient mice were administrated with doxycycline

food (625µg/g) for 1 week (+cell 1w+Dox

) followed by an additional 1 week of food without

doxycycline (+cell 1w+Dox

+1w-Dox

) (Figure 7L). These iPL-derived Club cells (3w+Dox

+2w-

Dox), which are non-proliferative, do not engraft as well as iPL cells (3w

+Dox) themselves

(Figure 7M-1 week vs. Figure 5SF-1 week). More importantly, they are not retained (Figure

7M +cell 2w-Dox

). Consistent with in vitro results, iPL-Club cells are able to respond to re-

induction in that the number of retained cells significantly increased after in vivo Dox-

treatment (+cell 1w+Dox

). Subsequent withdrawal of Dox (+cell 1w+Dox

+1w-Dox

) resulted in a

decrease in the number of retained cells, suggesting factor-regulated controlled proliferation

(Figure 7M). The expression of transgene 4F2A was activated in vivo under Dox-treatment

101

and significantly down-regulated upon Dox-withdrawal (Figure 7N). The expression of

CCSP, markedly down-regulated as a result from the loss of mature Club cells in

naphthalene-busulfan-treated lungs, was only partially restored without in vivo induction of

iPL-derived Club cells (+cell 1w-Dox

) (Figure 7O), but, consistent with the increased cell

number (Figure 7M), Dox-treatment for 1 week increased CCSP expression. Strikingly,

CCSP expression was dramatically recovered in induced lungs upon the subsequent removal

of Dox (+cell 1w+Dox

+1w-Dox

). We speculated this is due to the re-differentiation of

expanded iPL cells back to CCSP-expressing Club cells (Figure 7O). Immnostaining result

confirmed the sufficient restoration of CCSP-expressing cells in recipient epithelium by iPL

cells after in vivo interrupted reprogramming (Figure 7P). Together, these results highlight

the potential of cyclical interrupted reprogramming for greater expansion of iPL cells and in

repopulating injured airway epithelium.

102

Figure 7. Cyclical Interrupted Reprogramming Enables Further Expansion of Club-

iPL Cells. Confocal microscopy images showing immunohistochemistry staining of (A)

mouse skin control, (B) day0-Club cells and (C) iPL (3w+Dox

) cells, with nuclear stain DAPI

103

(blue) and P63 (red). Fold-differences in P63 (D), CK5 (E) and Sox9 (F) gene expression in

adult lung, freshly isolated EpCAMhigh

cells (day0), iPL cells (3w+Dox

), and Club-iPL cells

cultured for 2 weeks in the absence of factors (3w+Dox

+2w-Dox

). (G) Comparison of Club-

iPL cells with basal cell progenitors. (H) Comparison of Club-iPL cells with lineage-

negative epithelial stem/progenitor (LNEP) cells. (I) Brightfield images showing the

generation of iPL2nd

(3w+Dox

+2w-Dox

+1w+Dox

) and stained with nuclear stain DAPI (blue),

P63 (red). (J) Fold changes in total cell number of iPL (3w+Dox

) and iPL2nd

(3w+Dox

+2w-

Dox+1w

+Dox) relative to day0 seeded cells (10,000 cells/well) and the total number of colony

forming units (CFU) generated. (K) Representative flow cytometry dot-plots showing

expression of EpCAM and CCSP in iPL2nd

cells and iPL2nd

cells cultured for 2 weeks in the

absence of factors (iPL2nd

+2w-Dox

). (L) Schematic depicting the methodology of in vivo

study. (M) Cell retention rate of engrafted cells in recipient lungs (% of day0 injected cells)

at 1 week and 2 weeks with or without in vivo induction measured by qRT-PCR. Expression

levels of 4F2A construct transgene (N) and CCSP (O) in recipient lungs, as measured by

qRT-PCR comparing fold-differences in expression in wildtype lungs. (P) Confocal

microscopy images of lung sections of the saline control, nathphalene-busulfan treated

nontransplanted (No-cell 2w) and transplanted (+cell 2w-Dox (in vivo)

, +cell 1w

+Dox+1w

-Dox (in

vivo)) showing nuclear stain DAPI (blue) and CCSP (red) and GFP (green). In D-F, J and M-

O, values are mean S.D. of three independent biological replicates. For K, data are

representative of a minimum of three biological replicates. *, p<0.05; **, p<0.001; ***,

p<0.0001. Scale bar, 100 µm (A-C and I), 10 µm (P).

3.6 Discussion

Carefully defined period of interrupted reprogramming enabled quiescent mature

Club cells to proliferate, start the reprogramming process but not pass the point of no-return

(Nagy and Nagy, 2010), thereby generating large numbers of iPL cells. Upon withdrawal of

the inductive factors, P63-expressing iPL cells give rise to CCSP+ Club cells, mucin

+ goblet

cells, and functional CFTR-expressing ciliated epithelium in vitro. They show in vivo utility

by repopulating CFTR-knockout epithelium after a recipient conditioning regimen. Our

results suggest that interrupted reprogramming is not only able to achieve controlled

expansion of the selected cell type, but results in the "de-differentiation" of the cells to a

progenitor-like state while preserving the differentiation potential of the parental population

to generate a limited range of functional progeny.

Recent advances in the understanding of the mechanisms involved in iPS cell

reprogramming have demonstrated that epigenetic memory” found both in human and

mouse iPS cells renders them permissive to preferential differentiation to the original lineage

104

(Ghosh et al., 2010; Kim et al., 2010; Bar-Nur et al., 2011; Shipony et al., 2014; De Los

Angeles et al., 2015). In our study, we harnessed this “residual epigenetic memory” of the

starting cells and generated large numbers of relatively pure progenitor-like populations with

intrinsic restriction to the appropriate lineage.

Despite recent progress in delineating a number of lung progenitor populations and

some of their associated markers (Chapman et al., 2011; Jain et al., 2015; Kim et al., 2005;

McQualter et al., 2010; Rawlins et al., 2009; Rock et al., 2009; Treutlein et al., 2014;

Vaughan et al., 2014), we are still limited in our grasp of the number and characteristics of

the lung stem cell hierarchy. After careful comparison using available specific marker

expression and microarray data for known lung progenitor populations (Rock et al., 2009;

Vaughan et al., 2014), Club-iPL cells do not resemble any currently identified progenitors.

It remains a possibility that they represent a yet unidentified progenitor cell population.

Alternatively, transient expression of OSKM in mature lung epithelial cells could result in

the generation of novel progenitor cells not existing in the developing or mature lung. That

is, bearing no clear relation to cells in the natural state but nonetheless capable of controlled

expansion and differentiation to a limited and appropriate range of progeny. Recent reports

highlight the existence of multiple unique cell states en route to pluripotency (Hussein et al.,

2014; Tonge et al., 2014; Zunder et al., 2015; Treutlein et al., 2016). Whether or not iPL

cells recapitulate a specific developmental stage, enhanced proliferation and restricted

differentiation makes them useful especially given this technology can theoretically be

applied to almost any cell type that can be isolated and purified.

Superior self-renewal and differentiation capacity of ES and iPS cells make both

very useful for regenerative medicine but protocols to generate large numbers of pure, fully

differentiated cells are still imperfect. Problems include low differentiation efficiency,

heterogeneous final products (Plath and Lowry, 2011; Schwartz et al., 2014) and

contamination by potentially tumorigenic undifferentiated cells (Ben-David and Benvenisty,

2011; Tapia and Schöler, 2016). A variety of approaches may overcome these problems but

producing each unique cell that may be desirable will require the development of hundreds

of unique protocols. Direct reprogramming through ectopic expression of combinations of

specific transcription factors (Caiazzo et al., 2011; Pfisterer et al., 2011; Sancho-Martinez et

al., 2012) and/or microRNA (Ambasudhan et al., 2011; Leonardo et al., 2012), resulting in

105

direct conversion from one cell type to another, has also been extensively studied. Direct

conversion does not require a pluripotent intermediate state and thus may raise fewer safety

concerns. Our novel interrupted reprogramming strategy similarly avoids pluripotency but

may be easier to apply to a broad range of cells types, only requiring that they can be

isolated in relative purity.

Recent studies showed in vitro differentiation of iPS and ES cells to lung epithelium,

but were not able to generate large numbers of either Club cells or ciliated cells. Importantly

none of these groups evaluated the in vivo contribution of resultant CFTR-expressing cells in

an animal model. On the contrary, our iPL cells hold great promise for treating respiratory

diseases. Our proof of concept in vivo studies showed successful retention and incorporation

in CFTR-deficient epithelium with injected iPL cells being able to give rise to both Club

cells and ciliated cells.

The novelty of this concept results in a number of key issues that need to be

addressed. Firstly, since iPL cells are never reprogrammed to pluripotency, they are likely

less tumorigenic. However, the sensitivity of our current methodology is not absolute.

Secondly, although we have selected a highly purified population of cells as the starting

material, interrupted reprogramming still produces clones that are variable in size suggesting

some degree of heterogeneity in the system. While proliferation during iPL induction seems

relatively uniform (Figure 1H, middle panel) and the observed return to phenotype upon dox

withdrawal (Figure 2I) is also homogeneous, potential pluripotency (as suggested by Nanog

expression) is more heterogeneous, varying between colonies and amongst cells within an

individual colony after a prolonged induction period (> 5 weeks). This will need further

exploration but is not surprising as evidence suggests higher levels of heterogeneity in the

early phases of iPS induction (Lujan et al., 2015; Treutlein et al., 2016; Zunder et al., 2015).

There is also some heterogeneity in the differentiation capacity of the Club cells after return

from the iPL state although this can be attributed to the normal biology of Club cells

(Rawlins et al., 2009; Reynolds et al., 2000). Finally, for therapeutic use, the current data

was obtained from Col1a1-4F2A mice and it remains to be shown that this technique can be

efficiently applied in human cells. In preliminary studies, we isolated normal human lung

epithelial cells containing Club cells from excess tissue remaining from lung transplant

donors. Cells were transfected with a polycistronic lentiviral vectors driving dox-regulatable

106

OSKM. Although the induction conditions require further optimization, dox-induction

resulted in increased cell numbers compared to that of non-treated native epithelial cells

(Figure S6A). Importantly, consistent with our observation in mouse system, dox-treated

cells lost their somatic CCSP gene expression, but regained it following dox-withdrawal

suggestive of ability to return to their original phenotype (Figure S6B). The iPL cell

induction process will need to be optimized to obtain maximum expansion and scale-up of

cells, but should theoretically benefit from the advances driving iPS cell research towards

non-integrative, non-viral methods of reprogramming. Our studies showed intermittent

Dox-treatment cycles resulted in second generation iPL cells. The number of generations

resulting in maximal expansion of cells without loss of iPL function remains to be

determined. Further refinement is needed to widen the relatively narrow time window

where iPL cell induction and expansion is maximized but before potential factor-

independent pluripotency is possible. This may require optimization of exogenous growth

factors and/or changes to culture conditions. In addition, the precise requirement for each

individual transcription factor remains unknown. Singovski and colleagues evaluated the

effect of transient activation of OSKM, OSK and M alone (Singovski et al., 2016). While c-

Myc was important for driving proliferation, only the full 4 factors resulted in acquisition of

a robust ‘cancer stem cell” phenotype, including increase in colony forming efficiency.

Whether this observation is analogous to our non-malignant “progenitor-like” population

remains to be studied. Theoretically, our iPL concept is broadly applicable and could be

extended to other somatic cell types giving rise to numerous progenitor cell populations.

Future investigations will be needed but these proof-of-concept in vivo studies showed iPL

cells hold great promise for treating respiratory diseases by true engraftment as “induced”

progenitors.

107

Figure S6. (A) Fold change (in total cell number) of transduced human epithelial cells

treated with or without dox relative to day0 seeded cells. Expression of CCSP (B), as

measured by qRT-PCR comparing fold-differences in genes expression in primary human

epithelial cells under dox-induction, and followed subsequent culture in dox-free media.

108

Chapter 4

Interrupted reprogramming of Alveolar Type II cells induces

progenitor-like cells that ameliorate pulmonary fibrosis

4.1 Rationale, Objectives, Hypotheses and Specific Aims

Rationale:

Carefully timed interrupted reprogramming allowed controlled expansion of mature

Club cells yet preservation of bronchiolar epithelial lineage commitment.

SftPC+ AEC-II cells serve as progenitor cells in the alveoli, but their number and

function decrease or deplete in certain pathological conditions and in age-related

decline;

Although AEC-II cells can give rise to alveolar-like colonies in vitro, they possess

limited passaging capacity

Objective:

To evaluate the potential of AEC-II derived iPL cells to ameliorate bleomycin-

induced pulmonary fibrosis

Hypothesis:

Interrupted reprogramming can rescue the in vitro limited clonogenic capacity of AEC-II

cells

Specific Aims:

To isolate and purify AEC-II cells from mouse lungs;

To optimize the iPL induction conditions of AEC-II cells;

To define the length of iPL induction of AEC-II cells which allows expansion yet

preservation of AEC-II-lineage commitment prior to reaching pluripotency;

109

To characterize AEC-II derived iPL cells;

To determine if AEC-II-iPL cells engraft, survive and repopulate bleomycin-induced

injured alveolar epithelium in vivo

4.2 Abstract

We describe here an interrupted reprogramming strategy to generate "induced

Progenitor-Like (iPL) cells" from Alveolar Epithelial Type II (AEC-II) cells. A carefully

defined period of transient expression of reprogramming factors (Oct4, Sox2, Klf4 and c-

Myc; OSKM) is able to rescue the limited in vitro clonogenic capacity of AEC-II cells,

potentially by activation of a bipotential progenitor-like state. Importantly, our results

demonstrate that interupted reprogramming results in controlled expansion of cell numbers

yet preservation of the differentiation pathway to the alveolar epithelial lineage. When

transplanted to injured lungs, AEC-II-iPL cells are retained in the lung and ameliorate

bleoomycin-induced pulmonary fibrosis. Interrupted reprogramming can be used as an

alternative approach to produce highly specified functional therapeutic cell populations and

may lead to significant advances in regenerative medicine.

4.3 Introduction

In normal adult lung, the alveolar epithelium is composed of two major cell types,

the alveolar epithelial type I (AEC-I) and alveolar epithelial type II (AEC-II) cells. It is

generally thought that the squamous AEC-I cells are terminally differentiated cells that

interface with pulmonary capillaries and cover more than 90% of the alveolar surface where

the exchange of CO2/O2 takes place(Whitsett et al., 2010). In contrast, AEC-II cells are

small cuboidal cells located in the corners of alveoli which cover only 5% of the alveolar

surface. They are multifunctional cells that produce, secrete and recycle pulmonary

surfactants, regulate alveolar fluid balance, and synthesize and secrete a number of immune-

modulatory proteins involved in host defense(Fehrenbach, 2001). Importantly, a subset of

surfactant protein C-positive (SPC+) AEC-II cells serve as regional progenitors in the alveoli

and differentiate into AEC-I cells, playing a crucial role in replenishing the alveolar

epithelial barrier during both homeostasis and repair after injury(Barkauskas et al., 2013a;

Rock and Hogan, 2011; Whitsett and Alenghat, 2014). Impaired regeneration of injured

110

alveolar epithelium has been observed in fibrotic interstitial lung diseases, including

idiopathic pulmonary fibrosis (IPF). IPF is an irreversible, fatal interstitial lung disease with

death occurring in most patients within 5 years of diagnosis. While not completely

understood, increasing evidence suggests that the pathogenesis of IPF may be driven by

alveolar epithelial cell dysfunction, followed by aberrant regeneration of epithelium,

persistent activation of fibroblasts and alterations in epithelial-mesenchymal communication

with the extracellular matrix (ECM), together resulting in disruption of architecture and

progressive loss of lung function(King et al., 2011; Yanagi et al., 2015; Zoz et al., 2011).

Currently, medical therapy for IPF is limited and lung transplantation is the only option for

patients with end-stage IPF(Akram et al., 2014; Lomas et al., 2012).

A growing body of evidence describes putative progenitor cell populations in the

distal lung that function to replenish or repair damaged epithelium(Barkauskas et al., 2013b;

Chapman et al., 2011; Jain et al., 2015; Kim et al., 2005; McQualter et al., 2010a; Teisanu et

al., 2011; Vaughan et al., 2014). However, these cells are rare, which limits their expansion,

and they usually change rapidly upon in vitro culture(Bertoncello and McQualter, 2010;

Kosmider et al., 2011; Liebler et al., 2016; Raiser and Kim, 2009). Importantly, in several

disease or injury states, endogenous progenitors are limited in number and function(Randell,

2006). Thus, recent focus has been placed on using cell-based therapeutic approaches for

ameliorating fibrosis via a cell replacement strategy. Tremendous efforts have been made in

application of bone marrow (BMC) cells(Ghadiri et al., 2016; Kotton et al., 2005; Weiss,

2014), mesenchymal stromal (MSC) cells(Cargnoni et al., 2009; Ortiz et al., 2003; Tashiro

et al., 2015; Toonkel et al., 2013) and respiratory epithelial cells differentiated from

pluripotent sources such as embryonic stem (ESC) and induced pluripotent stem (iPS)

cells(Ghaedi et al., 2013; Gotoh et al., 2014; Huang et al., 2013; Zhou et al., 2014).

Amongst these, MSCs have advantages as a practical source for use in cell-based therapies

for lung disease. The vast majority of studies report some biological effects after MSC

delivery during the early inflammatory phase of bleomycin-induced pulmonary fibrosis.

However, low levels of cell engraftment or retention suggest a paracrine-based mechanisms

of action responsible for repair(Kumamoto et al., 2009; Lee et al., 2012; Ortiz et al., 2003).

In contrast, freshly isolated AEC-II cells appear to be effective even after administration in

later stages of IPF where fibrosis is prevalent(Serrano-Mollar et al., 2007),(Serrano-Mollar

111

et al., 2016). However, the practical usages of freshly isolated AEC-IIs are limited by donor

availability and maintenance in culture(Kosmider et al., 2011; Liebler et al., 2016). Despite

recent progress in obtaining distal epithelial cells from directed differentiation of ESC and

iPS cells(Ghaedi et al., 2013; Gotoh et al., 2014; Huang et al., 2013; Zhou et al., 2014),

protocols remain limited by yield and purity of AEC-II cells. Furthermore, the pluripotent

nature of ESC and iPS cells, still present a potential risk of tumorigenicity which must be

addressed for clinical applicability(Kimbrel and Lanza, 2015; Shi et al., 2016). Regardless of

cell source, for most cell therapy applications, the cells will need externally controllable

proliferative capacity to maintain homeostasis or respond to injury.

We present a novel interrupted reprogramming strategy which provides an

alternative approach to generate a functional AEC-II population with high purity. We took

advantage of the rapid induction of cell proliferation and residual epigenetic “memory”

retained during the early phase of reprogramming(Clancy et al., 2014; Hussein et al., 2014;

Lujan et al., 2015; Samavarchi-Tehrani et al., 2010; Shipony et al., 2014; Tonge et al., 2014;

Woltjen et al., 2009; Zunder et al., 2015) to create cells we have termed "induced

Progenitor-Like (iPL) cells". We achieved this by optimizing and carefully controlling the

duration of transient expression of induced Pluripotent Stem (iPS) cell reprogramming

factors (Oct4, Sox2, Klf4 and c-Myc; OSKM), turning off their expression prior to reaching

independent pluripotency. Interrupted reprogramming allows controlled expansion yet

preservation of AEC-II lineage commitment and rescues the limited in vitro clonogenic

capacity of AEC-II cells. Importantly, iPL cells derived from AEC-II cells ameliorate

bleomycin-induced pulmonary fibrosis in vivo. The ability to produce highly specified

populations, retaining critical functions may have significant implications for cell-based

therapies.

4.4 Materials and Methods

4.4.1 Animal husbandry

ROSA26-rtTA and Col1a1: tetO-4F2A mice (Jackson Labs, Cat#011004) and R26-

rtTA/Col1a1::tetO-4F2A;Oct4-GFP mice ( A gift from Dr. Andras Nagy) were used to

generate inducible lung epithelial cells. For in vivo studies, ROSA26-rtTA/Col1a1:: tetO-

4F2A double transgenic mice were bred to actin GFP mice. There were no significant

112

differences between heterozygotes and homozygotes with respect to inductive factor gene

expression in Dox-treated AEC-II cells. Adult (6 to 8-week-old) female C57BL/6 mice were

used for AEC-II-iPL cell replacement therapy studies. Animals were maintained as an in-

house breeding colony under specific pathogen–free conditions. All procedures involving

animals were approved by the Institutional Animal Care and Use Committee of the

University Health Network (Toronto, Ontario, Canada).

4.4.2 Bleomycin administration and cell delivery

For BLM injury, BLM 2.5 U kg-1

body weight was administered intratracheally.

Donor AEC-II-iPL cells or MSCs (106 cells in 50l PBS) were delivered intratracheally 7

days or 14 days after injury. Control animals received the same volume of PBS without any

cells. The mice receiving cells were rotated to ensure equal dispersion of the cell suspension

to both lungs.

4.4.3 Measurement of respiratory mechanics

C57BL/6 male mice (4-5 month old) were anesthetized with ketamine (125 mg/kg,

ip) and xylazine (5 mg/kg, ip) and paralyzed with rocuronium (5 mg/kg, ip). Animals were

tracheostomized with a blunt 18G metal cannula, and supplementary anesthesia was

employed when necessary. Conventional mechanical ventilation was maintained with a

small animal ventilator (FlexiVent, SCIREQ Inc., Canada) using a tidal volume of 10

mL/kg, a frequency of 150 breaths per minute, and a positive end-expiratory pressure

(PEEP) set at 3 cmH2O. PV loops were obtained with a quasi-static pressure-controlled PV

ramp.

4.4.4 Isolation of AEC-II cell from mouse lung

AEC-II cells were isolated using a previously described protocol(Berndt-Weis et al.,

2009) with modifications. Before lung digestion, mice were injected intra-peritoneally with

heparin (250U/mouse) and euthanized by CO2 narcosis. Lungs were flushed through the

right ventricle with cold phosphate buffered saline (PBS). Endobronchial lavage was then

performed to remove alveolar leukocytes. Mouse lung was filled with porcine elastase 10 U

113

/mL and incubated for 20 min at 37C. Trachea and bronchi were cut away. The remaining

tissues were finely minced and incubated in 100μg/mL of DNAse I in DMEM containing

antibiotics for 10 minutes. The suspension was mixed with FBS and sieved through 100 µm,

40 µm and 20 µm nylon meshes. Cells were centrifuged at 32g for 12 min then re-suspended

in red blood cell lysis buffer for 3min and the lysis was stopped by addition of an equal

volume of PBS. Cells were centrifuged at 100g for 12 min then re-suspended in 0.5 %

vol/vol FBS-PBS for all subsequent procedures.

4.4.5 Cell culture

Epithelial-specific medium comprised of DMEM/F12 (Invitrogen) supplemented

with 10% FBS, penicillin/streptomycin, 10mg/mL insulin, 5mg/mL transferrin-selenium

(Sigma), epidermal growth factor (EGF, 20ng/mL; Sigma), fibroblast growth factor-10

(FGF-10, 50ng/mL; R&D Systems) and hepatocyte growth factor (HGF, 30ng/mL; R&D

Systems).

4.4.6 Fluorescence activated cell sorting and analysis

For purification of epithelial cells, fresh isolated cells were suspended and incubated

in 0.5 % vol/vol FBS-PBS containing an optimally pre-titered mixture of antibodies [anti-

CD45, anti-CD31 (BD Biosciences), anti-EpCAM (Abcam) and relevant isotype controls]

for approximately 30min on ice. Labeled cells were washed and re-suspended at 3~5 × 106

cells/mL in 0.5 % vol/vol FBS-PBS. Cell viability was accessed by propidium iodide

(1μg/mL) staining. For intra-cellular antigen analysis, cells were fixed and stained using a

Fix and Perm kit (Invitrogen) as per manufacturer instructions. Sorting was performed using

a MoFlo BRU cell sorter (Becton Dickinson), acquisition was performed using a BD LSRII

analyzer (Becton Dickinson) and data was analyzed using FlowJo software.

4.4.7 Matrigel-based iPL cell induction

Feeders (MEF) were seeded on 0.1% gelatin coated 24-well transwell filter inserts

(Corning) one day prior to the addition of epithelial cells. Sorted epithelial cells resuspended

in 100μL of Matrigel (BD Biosciences) prediluted 1:1 (vol/vol) with epithelial-specific

114

(EpiS) media were added to a MEF-coated 24-well transwell filter inserts in a 24-well tissue

culture plate containing 500μL of epithelial media. To study the clonogenic capacity of

passaged AEC-II cells, AEC-IIs were cultured in EpiS media for 2 weeks, passaged then

exposed to Dox. Media was replenished three times per week. For bulk passaging, whole

cultures were dissociated in Collagenase (1mg/mL; Sigma) Dispase (3mg/mL; BD

Biosciences) in PBS to generate a single-cell suspension. For clonal passaging, single

colonies were picked and dissociated.

4.4.8 Immunofluorescence

Samples were fixed with 4% paraformaldehyde (PFA) for 30min and blocked with

5% goat serum and 2% BSA in PBS containing 0.5% Triton X-100 for 1 hour. Primary

antibodies (Table 1) were diluted in BSA/PBS, applied to samples and incubated overnight

at 4°C. Secondary antibodies AlexaFluors 488, 532, 546, 633 or 647 (Invitrogen) were

applied according to the species in which the primary antibody was used for 2 hours at room

temperature. Nuclear staining was performed using 2mg/mL 4, 6, diamidino-2-phenylindole

(DAPI; Sigma). Stained samples were mounted with immunofluorescent mounting medium

(DAKO). Appropriate non-specific IgG isotypes were used as controls. Immunoreactivities

of antigens were visualized as single optical planes using an Olympus Fluoview confocal

microscope and analyzed using FV10-ASW 2.0 Viewer software.

Antibody name Company Cat. Num

CD45 BD phamingen 553081

CD31 BD phamingen 553373

EpCAM Abcam ab95641

SPC Chemicon AB3786

Santa Cruz sc-7706

Hopx Santa Cruz sc-398703

115

a-SMA SIGMA-Aldrich A2547

Integrin α6 R&D FAB13501G

Integrin 4 Abcam ab182120

Biolegend 123608

CD74 BD phamingen 561941

LAMP3 Novusbio DDX0192P-100

Nanog

Abcam ab80892

BD phamingen 560259

GFP Invitrogen A-21311

AQP5 Abcam ab104751

SSEA-1 Santa Cruz sc-21702

E-cadherin Abcam ab11512

Table 1: Tabulated list of all antibodies used in the studies

4.4.9 Real-time PCR analysis

Total RNA was prepared using the RNeasy Kit (Qiagen) as per manufacturer’s

instructions. cDNA was prepared and assayed using Superscript III (Sigma) according to

manufacturer’s protocol. Differential gene expression was determined using SYBR green

detection (Roche). Real-time PCR reactions were done in triplicate for each sample.

GAPDH was used as a housekeeping gene to normalize gene expression levels using

LightCycler 480 software (Roche). Normalized mRNA levels were shown as relative to the

control samples (day 0 fresh isolated cells or adult lung) (Table 2).

116

qPCR primers

Gene name Primer sequence 5’-3’ length

mCol4F2A Forward GGCTGGAGATGTTGAGAGCAA 21

Reverse AAAGGAAATCCAGTGGCGC 19

Sftpc Forward GCAAAGAGGTCCTGATGGAG 20

Reverse GCAGTAGGTTCCTGGAGCTG 20

AQP5 Forward ATGAACCCAGCCCGATCTTT 20

Reverse ACGATCGGTCCTACCCAGAAG 21

-SMA Forward CCCAGACATCAGGGAGTAATGG 22

Reverse TCTATCGGATACTTCAGCGTCA 22

S100A4 Forward TCCACAAATACTCAGGCAAAGAG 23

Reverse GCAGCTCCCTGGTCAGTAG 19

Vimentin Forward CGTCCACACGCACCTACAG 19

Reverse GGGGGATGAGGAATAGAGGCT 21

Table 2: Tabulated list of all qPCR primers used in the studies.

4.4.10 Statistics

Statistical analysis was performed using GraphPad Prism 5.0 statistical software (San

Diego, CA, USA). The statistical significance of multiple groups was compared to each

other using Tukey’s multiple comparison test ANOVA. A p value of <0.05 was considered

significant.

117

4.5 Results

4.5.1 Interrupted reprogramming rescues the limited clonogenic

capacity of AEC-II cells while achieving expansion

AEC-II cells play a central role in alveolar epithelial repair and regeneration. In vitro,

although AEC-IIs can give rise to alveolar-like colonies, they possess limited clonogenic

capacity which decreases with passaging(Lee et al., 2014a). Importantly, their number and

function decline with age and in certain pathological conditions(Chen et al., 2015; Navarro

and Driscoll, 2017), including IPF(Liang et al., 2016). To determine if interrupted

reprogramming is able to rescue the in vitro limited clonogenic capacity of AEC-II cells, we

isolated AEC-IIs from R26-rtTA/Col1a1::tetO-4F2A double transgenic mice(Carey et al.,

2010) enabling expression of Oct4, Sox2, Klf4 and c-Myc (OSKM) following treatment

with doxycycline (Dox). AEC-II cells were isolated using a modified elastase-based protocol

and characterized using anti-CD74(Marsh et al., 2009) in addition to the classical AEC-II

marker anti-SPC. Flow-cytometric analysis of freshly isolated cells showed that over 95% of

CD45neg

CD31neg

EpCAMpos

AEC-II cells expressed both markers (Figure 1a, b). Isolated

AEC-II cells gave rise to colonies when cultured in a Matrigel-based 3D culture system

(Figure 1c). Consistent with previous reports(Lee et al., 2014a), there was a gradual

reduction in colony forming-efficiency (CFU%) with passaging (Figure 1d-ND groups). We

optimized iPL induction conditions for AEC-II cells and found an initial two weeks of

culture without Dox (ND) prior to Dox-treatment (+D) (named "late induction") appeared

advantageous. Induction of AEC-II cells (2WND

+2W+D

) significantly increased the CFU%

and total number of cells (Figure 1d-f). Subsequent withdrawal of Dox for 2 weeks

(2WND

+2W+D

+2W-D

) resulted in a decrease in transgene 4F2A expression (Figure 1g), a

decrease in CFU%, while the colonies that did develop were larger and numerous adherent

epithelial-like cells were seen (Figure 1d, e). Overall, this resulted in a 100-fold cell

expansion (Figure 1f). Non-treated AEC-II cells gradually lost their phenotype with

passaging, possibly due to the differentiation to AEC-I-like cells. In contrast, the AEC-II

phenotype was well preserved in the 2WND

+2W+D

induced cells, even after withdrawal of

Dox for 2 weeks (2WND

+2W+D

+2W-D

) (Figure 1d, h). This data showed that interrupted

118

reprogramming of AEC-II is able to rescue the limited passaging capacity of AEC-II

colonies and efficiently expand cells while preserving AEC-II lineage commitment.

119

Figure 1. Interrupted reprogramming rescues the in vitro limited clonogenic capacity

of AEC-II cells while achieving expansion in cell numbers (a) Flow cytometry analysis of

freshly isolated lung cells using a modified elastase-based protocol, showing epithelial cells

marked with antibodies specific for SPC and CD74. Over 95% of EpCAM+, CD45

-, CD31

-

cells are AEC-II cells co-expressing SPC and CD74. (b) Freshly isolated AEC-II cells

express EpCAM (red), CD74 (green) and SPC (grey); nuclei are stained with DAPI (blue).

(c) Isolated AEC-II cells are able to give rise to colonies in a Matrigel-based 3D culture

system. Light microscopy bright-field image and H&E staining are shown. (d) The left panel

shows bright-field images depicting the generation of colonies in the absence (ND), presence

of Dox (+D), and upon subsequent Dox-withdrawal (-D). The right panel shows confocal

microscopy images of colonies obtained from each condition, showing nuclear stain DAPI

(blue), SPC (green) and EpCAM (red). The colony forming efficiency (e) and the fold

changes in total cell number (f) showed relative to day0 seeded cells (5,000 cells/ well).

Expression levels of (g) mCol4F2A and (h) SPC in cells obtained from each condition, as

measured by qRT-PCR comparing fold-differences in expression in day0 freshly isolated

AEC-II cells. In a, data are representative of a minimum of three biological replicates. For e-

h, values are mean S.D. of three independent biological replicates. *, p<0.05; **, p<0.001;

***, p<0.0001. Scale bar, 10 µm (b and d); 50 µm (c-H&E); 100 µm (c-bright field and d).

4.5.2 Interrupted reprogramming allows preservation of AEC-II

lineage commitment without traversing the pluripotent

state

To evaluate the extent of reprogramming of the cells, we cultured AEC-II cells

derived from R26-rtTA/Col1a1::tetO-4F2A;Oct4-GFP mice in which the activation of

endogenous Oct4 could be monitored by GFP expression. AEC-II cells treated with Dox for

3 weeks resulted in the presence of Dox-independent Oct4-GFP cells expressing the

pluripotency markers; Nanog and SSEA-1 (Figure 2b, c). In contrast, AEC-II cells cultured

in the presence of Dox for only 2 weeks (2WND

+2W+D

) cells did not contain any Oct4-GFP+

cells and showed no expression of other pluripotency markers (Figure 2a). We assessed the

ability of induced AEC-II cells to return to their original AEC-Il phenotype following

withdrawal of Dox. Withdrawal of Dox after a 2-week induction (2WND

+2W+D

+2W-D

)

resulted in Oct4-GFP-SPC

+ colonies showing the return to the AEC-II phenotype (Figure

2d). In contrast, colonies obtained upon Dox-withdrawal after 3 weeks induction

(2WND

+3W+D

+2W-D

, 2WND

+4W+D

+2W-D

) contained Oct4-GFP cells and fewer SPC+ cells

suggesting that subsets of 3 week induced cells had already passed the point-of-no return

(Figure 2e, f). Taken together, our results showed that, with our defined length of interrupted

120

reprogramming, specifically this 4-week protocol (2WND

+2W+D

) allows the greatest

expansion of AEC-IIs without potentially traversing the pluripotent state.

Figure 2. A defined period of interrupted reprogramming allows preservation of AEC-

II phenotype without traversing pluripotency Endogenous Oct4-GFP expression in

passaged cultured AEC-IIs (2WND

) derived from R26rtTA

;Col1a14F2A

; Oct4-GFP mice under

Dox induction (+D) and subsequent Dox-withdrawal (-D) showed 3 weeks of induction

resulted in factor-independent Oct4-GFP expression. Confocal microscopy images depict the

expression of pluripotency markers in cells treated with Dox for (a) 2 weeks (2WND

+2W+D

),

(b) 3 weeks (2WND

+3W+D

) and (c) 4 weeks (2WND

+4W+D

), with nuclear stain DAPI (blue),

Oct4-GFP (green), Nanog/SSEA-1 (red) and E-cadherin (grey). Confocal microscopy

images show preservation of the AEC-II phenotype in Dox-treated cells with subsequent 2-

week culture in Dox-free media, (d) 2WND

+2W+D

+2W-D

, (e) 2WND

+3W+D

+2W-D

and (f)

2WND

+4W+D

+2W-D

, with nuclear stain DAPI (blue), Oct4-GFP (green) and SPC (red).

Scale bar, 50 µm (b-bottom panel and c-top panel); 100 µm (a, b-top panel, c-bottom panel

and d-f).

121

4.5.3 Interrupted reprogramming induces expression of alveolar

progenitor markers Hopx and α6β4

Lineage tracing studies have demonstrated that both AEC-I and AEC-II cells arise

from a bipotent progenitor cell during lung development; whereas AEC-I cells derive from

subsets of AEC-IIs after birth and in adult lung. Hopx (homeodomain only protein x), first

expressed in the embryonic lung at day 15.5 marks a bipotent alveolar progenitor in

developing lung (Treutlein et al., 2014). Hopx is turned off in maturing AEC-II cells, and

becomes restricted to AEC-I cells in the mature lung (Figure 3a). We observed that alveolar-

like colonies, generated by freshly isolated AEC-II cells, cultured in Matrigel conditions for

2 weeks without Dox (2WND

), contained SPC+ AEC-II cells as well as Hopx

+ AEC-I cells.

Notably, no co-expression of SPC and Hopx was observed (Figure 3b). In contrast, the

majority of AEC-II cells after interrupted reprogramming expressed SPC with a large

proportion (85.5±4.0% of SPC+ cells) co-expressing Hopx (Fig 3d, f) with a pattern similar

to that seen in E15.5 lungs (Figure 3c, S1). Withdrawal of Dox (2WND

+2W+D

+2W-D

)

resulted in a reduction in the number of SPC+/Hopx

+ cells (Figure 3e, f). While integrin α6 is

ubiquitously expressed in lung epithelium(Lee et al., 2014b), coexpression of integrin α6β4

marks a rare progenitor sub-population within normal distal lung involved in maintenance of

AEC-IIs during lung repair(Chapman et al., 2011; McQualter et al., 2010b). Flow cytometry

showed 4 to be absent in the native α6+ AEC-II starting population but expressed in over

60% of AEC-II cells after interrupted reprogramming (Figure 3g). Immunostaining

confirmed β4 expression (Figure 3h, i) and showed that β4 was co-expressed with Hopx in

these cells, similar to that seen in distal epithelium of E15.5 lungs (Figure 3j, k).

Collectively, our results suggest that interrupted reprogramming rescues the limited

clonogenic capacity of AEC-II cells in vitro as a result of activation of an alveolar progenitor

state. We have therefore termed these cells, induced Progenitor-Like cells (AEC-II-iPL

cells) (Figure 3l).

122

Figure 3. The expression of alveolar progenitor markers in AEC-II-iPL cells Confocal

microscopy images depict the expression of Hopx and SPC in: (a) adult lung; (b) colonies

derived from AEC-II cells after a 2-week culture period in the absence of Dox (2WND

); (c)

E15.5 lungs; (d) passaged 2WND

colonies induced with Dox for 2 weeks (2WND

+2W+D

); (e)

123

colonies were passaged and cultured without Dox for 2 subsequent weeks

(2WND

+2W+D

+2W-D

), with nuclear stain DAPI (blue), SPC (green) and Hopx (red). (f)

Quantification of each cell type (SPC single positive; Hopx single positive; SPC and Hopx

double positive) in colonies obtained from different groups. (g) Flow cytometry analysis of

integrin α6 and 4 expressions in day0 freshly isolated AEC-II cells and 2WND

+2W+D

cells.

Confocal microscopy images of colonies derived from AEC-IIs after 2-week culture without

Dox (2WND

) (h) and 2WND

+2W+D

colonies (2WND

+2W+D

) (i), showing nuclear stain DAPI

(blue), 4 (green) and EpCAM (red). Confocal microscopy images depicting the co-

expression of Hopx and SPC in 2WND

+2W+D

cells (j) and E15.5 lungs (k), with nuclear stain

DAPI (blue), 4 (green) and Hopx (red). (l) Cartoon depicting the generation of iPL cells

using interrupted reprogramming. For f, values are mean S.D. of three independent

biological replicates. In g, data are representative of a minimum of three independent

biological replicates. Scale bar, 10µm (a-e, h-zoom, i-k), 100 µm (h-left panel).

Figure S1. Time course of expression of Hopx and SPC in embryonic lungs

Confocal microscopy images depicting the expression of Hopx and SPC in (a) E12.5, (b)

E15.5 and (c) E18.5 lungs, with nuclear stain DAPI (blue), SPC (green) and Hopx (red).

Scale bar, 10µm.

4.5.4 AEC-II-iPL cells ameliorate bleomycin-mediated

pulmonary fibrosis

Bleomycin (BLM) lung injury predominantly affects the alveolar compartment, has a

prominent early inflammatory phase, and later results in fibrotic remodelling, which has

124

some similarities to idiopathic pulmonary fibrosis (IPF) in humans(Reinert et al., 2013).

Animal studies have demonstrated that MSCs reduce acute inflammation and protect against

subsequent development of fibrosis in BLM-induced injury, only when cells were

administered in the early inflammatory phase(Ortiz et al., 2003). Therefore, we examined

the engraftment and therapeutic benefit of AEC-II-iPL cell treatment in ameliorating

pulmonary fibrosis at both the inflammation and fibrotic phases of BLM-induced injury

(Figure 4a). Female recipients were sacrificed 2 weeks after cell delivery. Lungs of animals

treated with AEC-II-iPL cells (with a constitutive GFP marker) either during the

inflammatory (BLM day7

) or fibrotic phase (BLM day14

) showed a dramatically improved

external appearance (Figure 4b). Retention of AEC-II-iPL cells was greater when cells were

administered during the inflammatory phase (39.1±3.1% of the initial injected cell number)

compared to cells delivered during the fibrotic phase (27.3±4.4%) (Figure 4c). SPC mRNA

levels were also restored in AEC-II-iPL cell-treated lungs (Figure 4d). Bleomycin treatment

results in aberrant differentiation of AEC-II cells into AEC-I cells due to the ECM

abnormalities and interruption of the epithelial basement membrane, with abundant AQP5-

expressing cells and up-regulated expression of AQP5 mRNA. In AEC-II-iPL cell-treated

lungs, AQP5 mRNA was expressed at a normal level (Fig 4e). Compared to control lungs,

there were few AEC-II cells (as marked by LAMP3(Barkauskas et al., 2013) following BLM

treatment, whereas numerous LAMP3+ GFP

+ cells were seen in lungs treated with AEC-II-

iPL cells (Figure 4f). AQP5-expressing GFP cells were found, suggesting the delivered

AEC-II-iPL cells contributed directly to this lineage as well (Figure 4g).

There was evidence of inflammation and epithelial damage, with infiltration of

inflammatory cells in peribronchiolar and interstitial regions 7 days after BLM. Figure 4h

shows Masson’s trichrome stained lung sections. Hematoxylin–eosin staining is shown in

Figure S2a. Two weeks later, without cell therapy, lungs showed extensive fibrosis and

collagen deposition. In contrast, AEC-II-iPL cell–treated lungs showed fewer fibrotic lesions

and less collagen in the parenchyma with normal alveolar architecture, suggesting AEC-II-

iPL cells can prevent the progression to fibrosis. In lungs treated with AEC-II-iPL cells 14

days after BLM administration (fibrotic phase), there was still a marked reduction in the

number of -SMA+ cells in the interstitium (Figure S2b). In addition, we observed a

significant reduction in the expression of mesenchymal cell related genes in AEC-II-iPL

125

treated lungs (Figure S2c, d). Taken together, AEC-II-iPL cells can engraft as epithelial cells

and may be useful as a cell replacement therapy for ameliorating pulmonary fibrosis, even

when administrated at the established fibrotic phase.

126

Figure 4. AEC-II-iPL cells are able to engraft and contribute to alveolar epithelial

lineage in vivo

(a) The experimental schema of the in vivo study using female recipients is shown. (b)

Representative images of whole lungs from all the experimental groups at day 21 and 28

after bleomycin (BLM) treatment. (c) Retention rate of the delivered GFP+ cells in recipient

lungs (% of day0 injected cells), was calculated using genomic GFP measured at day 21 and

day 28 of BLM-treatment (relative to β-actin GFP lungs) measured by qRT-PCR.

Expression levels of (d) SPC and (e) AQP5 in recipient lungs, as measured by qRT-PCR,

comparing fold-differences in expression to control lungs. Confocal microscopy images of

alveolar epithelium of the saline control, BLM untreated (BLM day21

, BLM

day28) and BLM

cell-treated (BLM day7

+iPL+2W

, BLM

day14+iPL

+2W) animals showing nuclear stain DAPI

(blue), GFP (green) and LAMP3 (red) (f) or AQP5 (red) (g), respectively. (h) Representative

images of Masson’s trichrome staining of all the experimental lungs after 7, 14, 21 and 28

days of BLM-induced pulmonary fibrosis showing interstitial collagen (blue) was greatly

diminished in BLM transplanted female recipient lungs 2 weeks after receiving AEC-II-iPL

cells at day7 and day14 of BLM-treatment (BLM day7

+iPL+2w

, BLM

day14+iPL

+2w). For c-e,

values are mean S.D. of three independent biological replicates *, p<0.05; **, p<0.001;

***, p<0.0001. Scale bar, 100 µm (f-h); 10 µm (f and g-zoom).

Figure S2. Transplant of AEC-II-iPL cells ameliorates bleomycin-mediated pulmonary

fibrosis

127

(a) Representative images of hematoxylin–eosin stained lung sections in all the experimental

groups after 7, 14, 21 and 28 days of BLM-induced pulmonary fibrosis. (b) Immunostaining

of lung sections in all experimental groups with nuclear stain DAPI (blue) and αSMA (red).

Expression of mesenchymal genes (αSMA, S100a4 and vimentin) in BLM non-treated (c,

BLMday21

)

(d, BLMday28

) and BLM-treated (c,

BLMday7

+iPL+2w

)

(d,

BLMday14

+iPL+2w

)

recipient lungs, as measured by qRT-PCR comparing fold-differences in expression to saline

treated control (Ctrl) lung. For c and d, values are mean S.D. of three independent

biological replicates. *, p<0.05; **, p<0.001; ***, p<0.0001.

4.5.5 AEC-II-iPL cells are able to engraft and differentiate to

mature AEC-II and AEC-I cells in severely injured alveolar

epithelium of male mice

Male sex is associated with a significant increase in the prevalence of fibrotic

interstitial lung diseases, including IPF(Gribbin et al., 2006; Olson et al., 2007). In BLM

model of pulmonary fibrosis, male mice develop more prominent fibrotic disease compared

with female mice, and the pulmonary functional alterations can be detected by FlexiVent

measurement(Voltz et al., 2008). We therefore selected a male mouse BLM model to do a

direct comparison of AEC-II-iPL cells with MSCs in improving lung function. As no

significant pulmonary dysfunction could be detected 28 days after BLM compared to saline

control (data not shown), we performed lung function analysis using a FlexiVent system 21

days after BLM. The engraftment and therapeutic benefit of AEC-II-iPL cells and MSCs

were examined following cell delivery at both the inflammatory and fibrotic phases of

BLM-induced injury. Animals were sacrificed at BLM day21

(Fig. 5a). Pressure-volume (PV)

loops were obtained using a quasi-static pressure-controlled PV ramp perturbation. Lungs

treated with both AEC-II-iPL and MSC cells during the inflammatory phase (BLM day7

)

showed improved lung function, closer to that of control lungs. (Fig. 5b). No significant

improvement of lung function was found in animals treated with either cell types during the

fibrotic phase (Fig. 5c). This may due to short in situ period of delivered cells (injected on

BLM day 14

and measurement performed on BLM day21

). Similarly, lungs of animals treated

with AEC-II-iPL cells during the inflammatory (BLM day7

) showed an improved external

appearance compared to other groups (Fig. 5d). Compared to the poor cell retention seen in

MSC-treated lungs, AEC-II-iPL cells were retained in higher numbers when delivered

during either the inflammatory or fibrotic phase (Fig. 5e). The contribution of engrafted

128

cells to the alveolar epithelial lineage in recipient lungs was assessed by immunostaining.

Compared to control lungs, there were few AEC-II cells (as marked by LAMP3) following

BLM treatment, whereas numerous LAMP3+ GFP

+ cells were seen in lungs treated with

AEC-II-iPL cells at either the inflammatory or fibrotic phases. The LAMP+ cells found in

MSC-treated lungs were not GFP+

suggesting that MSCs do not directly contribute to the

AEC-II lineage (Fig. 5f). SPC mRNA levels were also greatly restored in AEC-II-iPL cell-

treated lungs (Fig. 5g). AQP5-expressing GFP+ cells were found in AEC-II-iPL cell-treated

lungs, whereas AQP5+ cells found in MSC-treated lungs were not GFP

+ (Fig. 5h, i).

129

130

Figure 5. AEC-II-iPL cells are able to engraft and differentiate to mature AEC-II and

AEC-I cells in severely fibrotic lungs (a) Experimental schema depicting the in vivo study

using male recipients. Lung mechanical function measured by FlexiVent showing PV curves

of all the experimental groups, (b) BLM cell-treated male recipient lungs 2 weeks after

receiving either AEC-II-iPL or MSC cells at day7 of BLM-treatment (BLM day7

+iPL+2W

,

BLM day7

+MSC+2W

) and (c) BLM cell-treated male recipient lungs 1 week after receiving

AEC-II-iPL cells or MSC at day14 of BLM-treatment (BLM day14

+iPL+1W

,

BLM

131

day14+MSC

+1W). (d) Representative images of whole lungs from all the experimental groups

at day 21 of bleomycin (BLM) treatment. (e) The cell retention rate of engrafted GFP cells

in recipient lungs (% of day0 injected cells), was calculated using genomic GFP at day 21 of

BLM-treatment (relative to β-actin GFP lungs) measured by qRT-PCR. (f) Confocal

microscopy images of alveolar epithelium of the saline control, BLM untreated (BLM day21

),

BLM cell-treated at day 7 (BLM day7

+iPL+2W

, BLM

day7+MSC

+2W) or at day 14 (BLM

day14+iPL

+1W, BLM

day14+MSC

+1W) animals showing nuclear stain DAPI (blue) and LAMP3

(red) and GFP (green) expression. (g) Expression levels of SPC in recipient lungs, as

measured by qRT-PCR, comparing fold-differences in expression to control lungs. (h)

Confocal microscopy images of alveolar epithelium of the saline control, BLM untreated

(BLM day21

), BLM cell-treated at day 7 (BLM day7

+iPL+2W

, BLM

day7+MSC

+2W) and at day

14 (BLM day14

+iPL+1W

, BLM

day14+MSC

+1W) showing nuclear stain DAPI (blue) and AQP5

(red) and GFP (green). (i) Expression levels of AQP5 in recipient lungs, as measured by

qRT-PCR, comparing fold-differences in expression to control lungs. For b, c, e, g and i,

values are mean S.D. of three independent biological replicates *, p<0.05; **, p<0.001;

***, p<0.0001. Scale bar, 100 µm (f); 10 µm (f-zoom and h).

Hematoxylin–eosin (Figure 6a) and Masson’s trichrome (Figure 6b) staining showed

evidence of severe inflammation, extensive fibrosis and collagen deposition developed in

BLM-treated male lungs. In contrast, AEC-II-iPL cell–treated lungs showed fewer fibrotic

lesions and less collagen in the parenchyma compared to MSC-treated lungs, suggesting

AEC-II-iPL cells can reduce the progression to fibrosis. Compared to the lungs treated with

MSC, AEC-II-iPL cell-treated lungs, when cells were administered during the fibrotic phase,

showed a marked reduction in the number of -SMA+ cells in the interstitium (Figure 6c).

132

Figure 6. Treatment with AEC-II-iPL cells ameliorates severe pulmonary fibrosis.

Representative images of lung histopathology are shown for all the experimental groups

after 21 days of BLM-induced pulmonary fibrosis, the saline control, BLM untreated (BLM day21

), BLM cell-treated at day 7 (BLM day7

+iPL+2W

, BLM

day7+MSC

+2W) or day 14(BLM

day14+iPL

+1W, BLM

day14+MSC

+1W), (a) lung sections were stained with hematoxylin–eosin,

133

(b) Masson’s trichrome staining of all the experimental lungs showing a remarkable

decrease of interstitial collagen deposition (the blue stain) in BLM-injured lungs treated with

AEC-II-iPL cells compared with the ones treated with MSC. (c) Immunostaining of lung

sections of all experimental groups with nuclear stain DAPI (blue) and αSMA (red). Scale

bar, 4 mm (a and b-whole section tile scan); 600 µm (a and b-4x); 200 µm (a and b-20x) and

100 µm(c).

4.6 Discussion

We show here that a carefully defined period of interrupted reprogramming, where

the reprogramming process is initiated but not allowed to pass the point of no-return(Nagy

and Nagy, 2010), is able to rescue the limited in vitro clonogenic capacity of AEC-II cells.

Importantly, our results demonstrate that using interupted reprogramming we can achieve

controlled expansion of an otherwise difficult to maintain AEC-II phenotype in

vitro(Kosmider et al., 2011; Liebler et al., 2016; Wang et al., 2007). AEC-II-iPL cells, when

delivered to injured lungs, are able to engraft and contribute to both the AEC II and AEC-I

cell lineage. They ameliorated bleomycin-induced pulmonary fibrosis. Our result showed

that interrupted reprogramming is not only able to achieve controlled expansion of AEC-IIs,

but also may result in the “de-differentiation” of the cells to a bipotent progenitor-like state.

While it remains to be determined if AEC-iPL cells truly recapitulate a distinct lung

epithelial progenitor population, our data suggests at least a phenotypic likeness (SPC+

Hopx+ α6β4

+)

to an embryonic bipotent alveolar progenitor(Treutlein et al., 2014).

Interrupted reprogramming may be useful as an alternative approach to generate large

numbers of functional AEC-IIs with high purity.

There continues to be an interest in cell-based therapeutic approaches for lung diseases

including IPF(Ghadiri et al., 2016). A variety of cell types have been investigated with the

majority of studies focusing on mesenchymal stromal cells (MSC) isolated from bone

marrow(Ortiz et al., 2003; Toonkel et al., 2013), umbilical cord(Moodley et al., 2009),

placenta(Cargnoni et al., 2009) and adipose(Tashiro et al., 2015) tissues. A limitation to

using these cells types is they act mainly through paracrine signalling with little contribution

to lung regeneration through engraftment and/or differentiation. Numerous animal studies

have demonstrated that paracrine signalling by MSC reduces acute inflammation and protect

134

against subsequent development of fibrosis in BLM-induced injury(Ortiz et al., 2003; Rojas

et al., 2015; Weiss and Ortiz, 2013). However, these beneficial effects were only observed

when cells were administered in the early inflammatory phase of lung injury, but not in the

later fibrotic phase(Ortiz et al., 2003) where in fact there is even a possibility of stimulating

detrimental fibroblast proliferation and extracellular matrix deposition(Epperly et al., 2003).

Nevertheless, a number of clinical studies using MSC are currently underway for IPF

(NCT02013700, NCT02135380, NCT01919827, NCT01385644, NCT02277145)(Ghadiri et

al., 2016). Low MSC retention suggests that the therapeutic effects are likely via a paracrine

mechanism rather than engraftment. Unlike MSCs, we found that AEC-II derived iPL cells

are retained at a high rate, potentially even engraft, and appear to contribute directly to the

alveolar epithelial lineage. AEC-II-iPL cells, once engrafted as alveolar epithelial cells,

could limit the deleterious effects of BLM by restoring the pool of alveolar epithelial

progenitor cells for the resolution of disrupted alveolar surfaces. Delivery of AEC-II-iPL

cells during the established fibrotic phase, by analogy, when most patients are diagnosed

with IPF, also showed beneficial effects on fibrosis. Importantly, MSC transplanted during

the fibrotic phase were not able to restore the alveolar epithelium barrier or reduce fibrosis,

suggesting that cells capable of directly contributing to tissue mass, such as the AEC-II-iPL

cells are preferred over paracrine signalling of MSC. Our findings are in keeping with recent

studies showing the efficacy of freshly isolated AEC-II cells in ameliorating

fibrosis(Serrano-Mollar et al., 2007, 2016). Our results suggest that the observed therapeutic

effect is at least in part due to localization of AEC-II-iPL cells within the alveolar milieu and

due to their subsequent differentiation to restore damaged alveolar epithelium through the

dual mechanism of engraftment and likely through paracrine or autocrine effects. Future

studies, such as evaluation of cytokine antagonists which can disrupt fibrosis signaling

pathways at cell engraftment sites; and AEC-II-iPL cell secreted chemokine screens for

fibroblast proliferation inhibiting factors or factors promoting collagen degradation(Serrano-

Mollar et al., 2007); are needed to elucidate the underlying mechanisms whereby AEC-II-

iPL cells promote the recovery of injured alveolar epithelium.

Although the BLM model is not an optimal model for human IPF, it is very

commonly used and thus our results can be compared against a large body of experimental

data. One of the limitations of the BLM injury model is the spontaneous repair following

135

the initial development of fibrosis, in contrast to the progressive pathological remodeling

seen in human IPF. In our BLM-injury study in male mice, no significant changes of

pulmonary function were detected at day 28 compared to that of saline control. We

therefore assessed lung mechanics at day 21. This resulted in a shortened in situ period for

cells delivered to male recipients at the fibrotic phase (male recipients: BLMday14

+iPL cells,

sacrificed at day 21 vs. female recipients: BLMday14

+iPL cells, sacrificed at day 28). We

speculate that the reduced efficacy observed in male recipients may be due to both the

increased severity of fibrosis in male lungs as well as the shorter in situ period of the

delivered cells.

Preclinical studies by Serrano-Mollar et al.(Serrano-Mollar et al., 2016)

demonstrated that the therapeutic potential of transplantation of AEC-IIs in treating human

IPF. However, the usage of freshly isolated AEC-IIs is limited by donor lung availability.

Although our current data was generated from transgenic mice as a proof of principle, our

technique may provide an alternative source of AEC-IIs which could be applied in human

cells using non-integrative, non-viral methods of reprogramming(Hou et al., 2013; Zhou et

al., 2009). The iPL cell induction process can be optimized to obtain maximum expansion

and scale-up of any cell. This may require precise regulation of expression of individual

reprogramming factors to widen the time window of interrupted reprogramming, or

optimization of exogenous growth factors, and/or changes to culture conditions.

Combined with other rapidly developing areas of genome editing, addressing issues

such as safety of cell therapy and tolerance of allogeneic cells, the era of “designer cells” is

just beginning. Our method of creating progenitor-like cells for in vitro expansion, and their

ability to integrate and functionally contribute to the repair of the diseased lung could be a

significant component of an efficient cell-based therapy for this vital organ.

136

Chapter 5

Rejuvenation of aged AEC-II cells to a youthful state using

interrupted reprogramming

5.1 Rationale, Objectives, Hypotheses and Specific Aims

Rationale:

The lungs manifest degenerative changes during aging which is closely associated

with the development and pathogenesis of chronic respiratory diseases, including

idiopathic pulmonary fibrosis (IPF). In human IPF, many of the implicated age-related

deteriorations are mainly observed in endogenous progenitor AEC-II cells, including

epigenetic alteration, DNA damage, telomere dysfunction, mitochondria-mediated

(intrinsic) apoptosis and activated endoplasmic reticulum (ER) stress response in apoptotic

AECs. However, there is yet no direct evidence showing the impact of aging on the

regenerative capacity of AEC-II cells and rejuvenation of aged AEC-II cells in vitro.

Amelioration of age-related deterioration in aged cells is critical for reestablishment

of homeostasis and tissue regeneration. Reprogramming enables aged cells to adopt a

pluripotent state associated with a youthful state which can be maintained in iPS cells and

their derivatives at early passages. A recent report showed in vivo partial reprogramming

through transient cyclic expression of iPS reprogramming factors ameliorates hallmarks of

aging and extends the lifespan in premature aging mouse models, and improves recovery

from metabolic disease and muscle injury in older mice. In Chapter 3 and 4, we

demonstrate that interrupted reprogramming allows controlled expansion yet preservation

of lineage commitment without gaining tumorigenic pluripotency.

Objective:

To evaluate if age-related deterioration in aged AEC-II cells can be ameliorated via

in vitro interrupted reprogramming.

137

Hypothesis:

Interrupted reprogramming allows rejuvenation of aged AEC-II cells to a youthful

state while preserving AEC-II identity and function.

Specific Aims:

To examine the influence of aging on the clonogenic capacity of AEC-II cells;

To determine if interrupted reprogramming can rescue the age-related defective

clonogenic capacity of AEC-II cells while preserving cellular identity and function;

To evaluate if other age-related deteriorations in aged AEC-IIs, inlcuding declined

telomerase activity, mitochondrial DNA damge and epigenetic alteration, can be

ameliorated by interrupted reprogramming.

5.2 Abstract

We present a novel "interrupted reprogramming" strategy to achieve rejuvenation of

aged stem cells using carefully timed transient expression of induced Pluripotent Stem (iPS)

cell reprogramming factors (Oct4, Sox2, Klf4 and c-Myc; OSKM) without traversing the

pluripotent stage. Interrupted reprogramming is able to rejuvenate aged alveolar progenitor

AEC-II cells to a youthful state by ameliorating age-related deterioration in stem cell self-

renewal capacity, telomerase activity, mitochondrial DNA and the epigenetic alterations. By

carefully controlling the duration of transient expression of OSKM, interrupted

reprogramming resulted in controlled expansion of younger cells yet preservation of AEC-II

identity and function as that of young AEC-II cells.

Harnessing the residual epigenetic memory and age plasticity existing in the early

reprogramming process, interrupted reprogramming allows controlled expansion of

functional younger cells retaining lineage identity of cell of origin. This novel approach may

provide a promising avenue for therapeutics against age-related decline and diseases.

138

5.3 Introduction

Idiopathic pulmonary fibrosis (IPF) is an irreversible, fatal disease with mortality up

to 50% at 3-4 years (Selman and Pardo, 2014). Although the molecular and cellular

mechanisms underlying IPF are not fully understood, a growing body of evidence shows that

the extent of alveolar epithelial cell (AEC) injury, repair process, and aging are the key

determinants in the pathogenesis of IPF.

At cellular level, many of the proposed pivotal hallmarks of aging have been

implicated in humans with IPF, including epigenetic alterations, DNA damage, stem cell

exhaustion, telomere dysfunction (shortened telomeres), mtDNA damage-mediated alveolar

epithelial cell apoptosis, and activated endoplasmic reticulum (ER) stress response (Liu et

al., 2013; Mossman et al., 2011; Noble et al., 2012; Thannickal, 2013; Uhal and Nguyen,

2013; Weiss et al., 2010). Notably, these age-related deteriorations leading to impaired lung

regeneration and progressive loss of lung function are mainly observed in AEC-II cells,

suggesting a prominent role in triggering the pathogenesis of IPF.

Like other tissue-specific stem cells, AEC-IIs, the endogenous stem cells in alveoli,

may also suffer from a progressive loss in their regenerative capacity during aging.

Mutations in telomerase is the most common distinguishable risk factor for IPF causing

abnormal telomere shortening and dysfunction (Alder et al., 2008, 2011; Armanios, 2013).

Recent studies using genetic animal models demonstrated that telomere dysfunction is

restricted to AEC-IIs and causes stem cell failure/exhaustion as a result of induced cellular

senescence (Alder et al., 2015; Chen et al., 2015). While telomeres are susceptible to age-

related deterioration, the age-associated telomere dysfunction in AEC-IIs could result in

stem cell exhaustion leading to impaired tissue regeneration. Although there is no direct

evidence showing age-related functional decline in AEC-IIs in vitro, a dramatic reduction in

the number and clonogenic capacity has been illustrated in AEC-IIs isolated from human

lung tissue of IPF patients (Liang et al., 2016). Mitochondrial DNA (mtDNA) damage and

consequent dysfunction in AECs are also linked to the pathogenesis of IPF. Evidence

suggests that AEC mtDNA damage induces apoptosis and promotes the development of IPF

and other age-related lung diseases (e.g., lung cancer and COPD) (Schumacker et al., 2014;

Wallace, 2013). Further, the accumulation of mtDNA mutations arising from age-related

139

mtDNA damage is crucial in depleting the longevity of lung stem cells (Held and

Houtkooper, 2015; Schumacker et al., 2014; Wallace, 2013). Therefore, amelioration of age-

related deterioration in aged AEC-II cells is critical for reestablishment of homeostasis and

tissue regeneration in aged lungs.

Rejuvenation as a consequence of iPS reprogramming has recently been the subject

of intense investigation. Reprogramming enables aged cells to adopt a youthful state which

is maintained in iPS cells and their derivatives at early passages. Epigenetic remodeling

during the reprogramming process is the key driver of the restoration of aging hallmarks to a

more youthful state, including telomere shortening, stem cell exhaustion, mitochondrial

dysfunction and cellular senescence. Recent studies yield insight to molecular mechanisms

underlying iPS reprogramming and describe distinct transcriptional phases during this

progressive process (Buganim et al., 2012; Hansson et al., 2012; Polo et al., 2012a).

Notably, one of epigenomic dynamics during the early phase of reprogramming is the

activation and repression of age-associated histone marks, such as H3K4me3 and

H3K27me3 (Polo et al., 2012a). We speculated that rejuvenation of aged lung stem cells can

be achieved by carefully timed transient reprogramming (termed "interrupted

reprogramming”). Interrupted reprogramming is able to rejuvenate aged lung progenitor

AEC-II cells and age-related deterioration in their stem cell self-renewal capacity,

telomerase activity, mitochondrial DNA and the epigenome histone methylation marks

(‘epigenetic clock’) can be reset to a younger state. Furthermore, interrupted reprogramming

resulted in the controlled expansion of youthful induced Progenitor-Like (iPL) cells

retaining AEC-II identity and function. We achieved this by optimized, controlled, transient

induction of reprogramming factors, turning off their expression prior to reaching

independent pluripotency.

To the best of our knowledge, this is the first study demonstrating that the aged

phenotype of endogenous lung progenitor AEC-IIs can be reverted to a youthful state in

vitro. In contrast to the complexity of directed differentiation protocols for each cell type

required, interrupted reprogramming can theoretically be applied to rejuvenate almost any

type of aged cells that can be isolated and purified. Therefore, this novel interrupted

reprogramming approach which results in the generation of large numbers of younger cells

140

may provide a promising avenue for cell-based therapy approaches where age-related

disease is prevalent.

5.4 Materials and Methods

5.4.1 Animal Husbandry

Young (8- to 12-week-old) and old (12- to 16-month-old) ROSA26-rtTA and

Col1a1: tetO-4F2A mice (Jackson Labs, Cat#011004) were used to generate inducible lung

epithelial cells. Animals were maintained as an in-house breeding colony under specific

pathogen–free conditions. All procedures involving animals were approved by the

Institutional Animal Care and Use Committee of the University Health Network (Toronto,

Ontario, Canada).

5.4.2 Cell Isolation and Culture

5.4.2.1 Isolation of AEC-II Cells from Mouse Lung

AEC-II cells were isolated using a previously described protocol (Berndt-Weis et al.,

2009) with modifications. Before lung digestion, mice were injected intra-peritoneally with

heparin (250U/mouse) and euthanized by CO2 narcosis. Lungs were flushed through the

right ventricle with cold phosphate buffered saline (PBS). Endobronchial lavage was then

performed to remove alveolar leukocytes. Mouse lung was filled with porcine elastase 10 U

/mL and incubated for 20 min at 37C. Trachea and bronchi were cut away. The remaining

tissues were finely minced and incubated in 100μg/mL of DNAse I in DMEM containing

antibiotics for 10 minutes. The suspension was mixed with FBS and sieved through 100 µm,

40 µm and 20 µm nylon meshes. Cells were centrifuged at 32g for 12 min then re-suspended

in red blood cell lysis buffer for 3min and the lysis was stopped by addition of an equal

volume of PBS. Cells were centrifuged at 100g for 12 min then re-suspended in 0.5 %

vol/vol FBS-PBS for all subsequent procedures.

5.4.2.2 Matrigel-based 3D condition

Feeders (MEF) were seeded on 0.1% gelatin coated 24-well transwell filter inserts

(Corning) one day prior to the addition of epithelial cells. Sorted epithelial cells

141

resuspended in 100μL of Matrigel (BD Biosciences) prediluted 1:1 (vol/vol) with epithelial-

specific (EpiS) media were added to a MEF-coated 24-well transwell filter inserts in a 24-

well tissue culture plate containing 500μL of epithelial media for 2 weeks then replaced with

ES (embryonic stem cell) medium containing 1.5ug/mL doxycycline (Sigma). For ROCK

inhibitor treatment, 10 μM Y-27632 (Enzo Life Sciences) was added to medium. Media was

replenished three times per week. For bulk passaging, whole cultures were dissociated in

Collagenase (1mg/mL; Sigma) Dispase (3mg/mL; BD Biosciences) in PBS to generate a

single-cell suspension.

5.4.2.3 Mix-culture of young and aged AEC-II cells

Young AEC-IIs were isolated from GFP; ROSA26-rtTA/Col1a1:: tetO-4F2A

transgenic mice. Aged AEC-II cells were derived from non-GFP ROSA26-rtTA/Col1a1::

tetO-4F2A transgenic mice and labeled with CMTMR dye (Thermo Fisher, C2927). Equal

numbers of young and old AEC-II cells were mixed and cultured under Matrigel-based 3D

condition.

5.4.3 Fluorescence activated cell sorting and analysis

For purification of AEC-IIl cells, fresh isolated cells were suspended and incubated

in 0.5 % vol/vol FBS-PBS containing an optimally pre-titered mixture of antibodies [anti-

CD45, anti-CD31 (BD Biosciences), anti-EpCAM (Abcam) and relevant isotype controls]

for approximately 30min on ice. Labeled cells were washed and re-suspended at 3~5 × 106

cells/mL in 0.5 % vol/vol FBS-PBS. Cell viability was accessed by propidium iodide

(1μg/mL) staining. For intra-cellular antigen analysis, cells were fixed and stained using a

Fix and Perm kit (Invitrogen) as per manufacturer instructions. Sorting was performed using

a MoFlo BRU cell sorter (Becton Dickinson), acquisition was performed using a BD LSRII

analyzer (Becton Dickinson) and data was analyzed using FlowJo software.

5.4.4 Immunofluorescence

Samples were fixed with 4% paraformaldehyde (PFA) for 30min and blocked with

5% goat serum and 2% BSA in PBS containing 0.5% Triton X-100 for 1 hour. Primary

142

antibodies were diluted in BSA/PBS, applied to samples and incubated overnight at 4°C.

Secondary antibodies AlexaFluors 488, 532, 546, 633 or 647 (Invitrogen) were applied

according to the species in which the primary antibody was used for 2 hours at room

temperature. Nuclear staining was performed using 2mg/mL 4, 6, diamidino-2-phenylindole

(DAPI; Sigma). Stained samples were mounted with immunofluorescent mounting medium

(DAKO). Appropriate non-specific IgG isotypes were used as controls. Immunoreactivities

of antigens were visualized as single optical planes using an Olympus Fluoview confocal

microscope and analyzed using FV10-ASW 2.0 Viewer software.

5.4.5 Real-time PCR analysis

Total RNA was prepared using the RNeasy Kit (Qiagen) as per manufacturer’s

instructions. cDNA was prepared and assayed using Superscript III (Sigma) according to

manufacturer’s protocol. Differential gene expression was determined using SYBR green

detection (Roche). Real-time PCR reactions were done in triplicate for each sample.

GAPDH was used as a housekeeping gene to normalize gene expression levels using

LightCycler 480 software (Roche). Normalized mRNA levels were shown as relative to the

control samples (day 0 fresh isolated cells).

5.4.6 Statistics

Statistical analysis was performed using GraphPad Prism 5.0 statistical software (San

Diego, CA, USA). The statistical significance of multiple groups was compared to each

other using Tukey’s multiple comparison test ANOVA. A p value of <0.05 was considered

significant.

5.5 Results

5.5.1 The clonogenic capacity of AEC-II cells declines with age

Age-dependent progressive decline in stem cell number and functionality has been

reported in various tissues, such as skeletal muscle stem cells (Cerletti et al., 2012; Sousa-

Victor et al., 2014), neural stem cells (Molofsky et al., 2006) and some lung epithelial stem

cells (Navarro and Driscoll, 2017). The reduction of self-renewal activity in aged stem cells

143

attributes the depletion of the stem cell pool which results in impaired tissue regeneration.

However, the influence of age on the in vitro self-renewal capacity of AEC-II cells has not

yet been examined. Herein, we first compared the clonogenic capacity of AEC-II cells

isolated from mice of different ages (10-week; 1-yeasr; 3-year old) and found that AEC-II

cells derived from older mice are “defective” relative to young AEC-II cells, showing

progressively reduced clonogenic capacity to form alveolar-like colonies in vitro (Figure 1).

Previous studies have demonstrated the age-related defects/disruptions in protein

homeostasis or proteostasis, which can result in increased cellular damage and tissue

dysfunction (Koga et al., 2011; Powers et al., 2009). One of the major functions of AEC-IIs is

secretion of surfactant proteins to prevent alveolar collapse. Thus, we examined the

secretion of SPC protein in the cells of colonies derived from young and old AEC-IIs by

immunostaining and found the number of SPC+ cells and intensity of SPC expression

decline with age.

Figure 1. The clonogenic capacity of AEC-II cells declines with age

Light microscopy bright-field images (Left panel) showing the generation of colonies of

AEC-II cells isolated from mice of different ages after 2-week culturing under Matrigel-

based clonogenic 3D conditions. Confocal microscopy images depicting colonies stained

with nuclear stain DAPI (blue), SPC (green) and EpCAM (red). Scale bar, 100 µm.

144

We also performed a mixed-culture experiment using equal numbers of CMTMR-

labeled aged AEC-IIs (1-year old) and GFP+ young AEC-IIs (8-12-week old) co-culturing

under Matrigel-based 3D condition (Figure 2a). All colonies were exclusively

monochromatic (CMTMR+

or GFP+) demonstrating that epithelial colonies are clonally

derived from the proliferation of single AEC-II progenitors rather than by cell aggregation,

which would generate colonies containing both CMTMR+

and GFP+

cells. Importantly, we

found fewer numbers of CMTMR+

colonies compared to that of GFP+ colonies, further

confirming the age-related decline of clonogenic capacity in aged AEC-IIs, which cannot

even be rescued by culturing in the microenvironment provided by young AEC-II cells

(Figure 2b).

a b

Figure 2. Aged AEC-II cells exhibit a limited clonal proliferation of epithelial colony

forming units (a) Schematic graph representing potential outcomes of mix-culture

experiment. (b) Bright field,green, red and overlay of fluorescence from coculture of GFPpos

young AEC-II cells and CMTMR-labeled aged AEC-II cells. Scale bar, 100 µm.

5.5.2 Interrupted reprogramming is able to “rejuvenate” aged

AEC-II cells to a younger state to form large numbers of

alveolar-like colonies

To study the effect of interrupted programming on the clonogenic capacity of AEC-II

cells, we isolated AEC-II cells from young (8-12-week old) and old (1-year old) R26-

145

rtTA/Col1a1::tetO-4F2A double transgenic mice (Carey et al., 2010) enabling expression of

Oct4, Sox2, Klf4 and c-Myc (OSKM) following treatment with doxycycline (dox, D).

Consistent with our previous findings, although both young and aged AEC-II cells gave rise

to alveolar-like colonies when cultured in Matrigel-based 3D culture system, native aged

AEC-II cells possess a greater limited colony forming ability, which further decreased over

passages.

Following our previously defined AEC-II-iPL induction protocol (2WND

+2W+D

),

which allows the greatest expansion without traversing the pluripotent state, both young and

aged AEC-II cells were cultured in Matrigel-based 3D conditions for 2 weeks prior to dox

treatment (ND). We found that iPL induction is able to "rejuvenate" aged AEC-II cells with an

enhanced self-renewal capacity to form larger numbers of alveolar-like colonies. For example, the

colony forming efficiency (CFU %) of aged AEC-II cells without dox-treatment (2WND

) was

1.2%±0.34% but increased up to 4.96%±0.8% after iPL induction (2WND

+2W+D

) which is similar

to that of non-treated young AEC-II cells (2WND

: 5.2%±0.8%). Importantly, the AEC-II

phenotypic expression of SPC was restored in the aged AEC-II-iPL cells (2WND

+2W+D

), as

seen in young AEC-II cells, even after withdrawal of dox for 2 weeks (2WND

+2W+D

+2W-D

)

(Figure 3). This date showed that interrupted reprogramming is able to restore youthfulness

to aged AEC-II cells, firstly characterized by enhanced capacity of self-renewal and

secretion of surfactant C.

146

Figure 3. Interrupted reprogramming ameliorates the aged-related decline of

clonogenic capacity in aged AEC-II cells Stereomicroscopy images (left panel) showing the

generation of colonies in the absence (ND), present of dox (+D) or dox-withdrawal (-D) in

Matrigel-based clonogenic 3D conditions (seeding density 5,000 cells/well, cells were

passaged every 2 weeks); confocal microscopy images (right panel) of colonies obtained

under different conditions from aged AEC-II cells, showing nuclear stain DAPI (blue), SPC

(green) and EpCAM (red). Scale bar, 100 µm.

5.5.3 ROCK inhibitor failed to rescue the aged-related decline of

clonogenic capacity in AEC-II cells

Recent published work has shown the ability of human keratinocytes (Chapman et

al., 2010) and epithelial cells (e.g. prostate, breast and lung) (Bove et al., 2014; Liu et al.,

2012; Suprynowicz et al., 2012) to proliferate in vitro when co-cultured with inactivated

fibroblast feeder cells in the presence of a Rho kinase (ROCK) inhibitor (Y-27632, “Y”).

Yet no studies have demonstrated the impact of age on the cell proliferation response to

ROCK inhibitor. Thus, we determined whether the age difference would have an impact on

the induced proliferation in AEC-IIs by ROCK inhibitor treatment and whether ROCK

147

inhibitor could rejuvenate the limited self-renewal capacity of aged AEC-IIs. Both young

and aged AEC-IIs were cultured in Matrigel-based 3D conditions for 2 weeks with or

without Rock-inhibitor (Figure 4). For iPL induction, cells were cultured without the

presence of Rock-inhibitor for 2 weeks prior to dox treatment. Induced proliferation was

observed in young AEC-IIs treated Rock-inhibitor showing slightly increased CFU%, but

not as robust as that seen with iPL induction. In contrast, no significant improvement of self-

renewal was observed in aged AEC-IIs treated with Rock-inhibitor, suggesting that the

aged-related endogenous proliferative capacity of the starting AEC-II population influences

their response to Rock-inhibitor treatment.

Figure 4. Comparison of clonal proliferation of young and aged AEC-II cells under

OSKM iPL induction and ROCK inhibitor treatment. The experimental schema of the

148

study (top panel). Bright field images (bottom panel) depicting the generation of colonies in

the presence of doxycycline and ROCK inhibitor in Matrigel-based 3D conditions.

5.5.4 Interrupted reprogramming of aged AEC-II cells results in

controlled expansion of alveolar-like colonies

To evaluate the extent of rejuvenation in aged AEC-II-derived iPL (2WND

+2W+D

)

cells, we serially passaged these cells (every 2 weeks) upon subsequent withdrawal of dox

(2WND

+2W+D

+2W-D

/+4W-D

/+6W-D

/+8W-D

). The "rejuvenated" aged AEC-II-iPL

(2WND

+2W+D

) cells exhibited an enhanced clonogenic capacity over 2 passages upon

factors-withdrawal which decreased after, resulting in a controlled expansion. These results

suggested that the rejuvenated self-renewal capacity of aged AEC-II cells by interrupted

reprogramming is regulated/controlled by the ectopic expression of reprogramming factors.

Importantly, the rejuvenated AEC-II phenotypic expression of SPC and EpCAM was well

maintained in the alveolar-like colonies derived from aged AEC-II-iPL upon factors-withdrawal

over passaging (Figure 5). Taken together, these resulted showed interrupted reprogramming

allows controlled expansion of rejuvenated AEC-II cells.

Figure 5. Interrupted reprogramming allows controlled expansion of rejuvenated

AEC-II cells Bright field images (left panel) showing the generation of colonies from iPL

149

cells upon dox-withdrawal over passaging (seeding density 5,000 cells/well, cells were

passaged every 2 weeks); confocal microscopy images (right panel) of colonies at different

passages, showing nuclear stain DAPI (blue), SPC (green) and EpCAM (red). Scale bar, 100

µm (P0-P2 and P3 bright field), 10 µm (P3 confocal images).

5.5.5 Interrupted reprogramming allows controlled restoration of

telomerase gene expression

Telomeres are particularly susceptible to age-related deterioration (Blackburn et al.,

2006). Telomere dysfunction is involved in the loss of the tissue regeneration and associated

with premature development diseases (Armanios and Blackburn, 2012), including idiopathic

pulmonary fibrosis (IPF) (Armanios, 2012), the most common manifestation of telomere-

medicated disease. Studies using aged telomerase-deficient mice showed the premature

aging phenotypes across multiple organs including testes, spleens, and intestines can be

reverted upon the reactivation of telomerase (Jaskelioff et al., 2011). Most recent studies

showed that induction of telomere dysfunction in AEC-II cells provoke impaired self-

renewal and cellular senescence resulting in lung function abnormalities and secondary

inflammation, as seen in telomere-mediated lung diseases (Alder et al., 2015b; Chen et al.,

2015b). Aging hallmarks can be erased during iPS reprogramming including restoration of

telomere length and telomerase activity to a youthful state (Rando and Chang, 2012;

Ocampo et al., 2016a). Thus, we wondered if interrupted programming is able to restore

telomerase activity in aged AEC-II cells. As a pilot study, we compared the expression level

of telomerase gene in non-treated aged AEC-II cells, aged AEC-II-iPL cells and cells

derived upon subsequent dox-withdrawal at different passages to that in freshly isolated

young AEC-II cells. Without induction, telomerase gene is remarkably down-regulated in

native aged AEC-II cells compared to that in young AEC-II cells, which further decreased

over passaging. Strikingly, significant up-regulation of telomerase gene was observed in

aged-AEC-II-iPL (2WND

+2W+D

) cells which progressively decreased over passaging upon

dox-withdrawal (P0: 2WND

+2W+D

+2W-D

; P1:+4W-D

; P2: +6W-D

) (Figure 6), suggesting the

restoration of telomerase gene expression is regulated the inductive factors. This date

suggest that the previous observed controlled expansion of rejuvenated AEC-II cells results

150

from controllable restoration of telomerase gene expression during interrupted

reprogramming.

Figure 6. Interrupted reprogramming allows controlled restoration of telomerase gene

expression Expression of telomerase gene, as measured by qRT-PCR comparing fold-

differences in gene expression in freshly isolated young AEC-II cells, non-treated aged

AEC-II cells at different passages, aged AEC-II-iPL cells and the iPL cells with subsequent

culture in dox-free media at different passages (P0-P2). Cells were passaged every 2 weeks.

Values are mean S.D. of three independent biological replicates. *, p<0.05; **, p<0.001;

***, p<0.0001

5.5.6 Interrupted reprogramming ameliorates mitochondrial

DNA damage

Studies demonstrate a significant decrease in aggravated mitochondrial dysfunction

and DNA damage (López-Otín et al., 2013) in cells derived via direct differentiation of iPS

generated from aged somatic cells (Yang et al., 2015). As aging is associated with

mitochondrial DNA damage in previously reported cell types (Green et al., 2011; Birch et

al., 2015), we next determined whether aged AEC-II cells exhibited accumulated

mitochondrial DNA (mtDNA) damage, and whether interrupted reprogramming could

ameliorate this damage. Herein, we used 8-hydroxy-guanosine (8-OHdG) anitbody which

151

detects DNA damage in mitochondrial and nucleus (Wang et al., 2014). As expected, an

increased number of 8-OHdG+ cells were detected in the aged AEC-II cells compared with

the young AEC-II cells by immunostaining, indicating a significant enrichment of mtDNA

damaged in the aged AEC-II cells. To note, the presence of aggravated mitochondrial DNA

damage was also observed in both young and aged AEC-II cells over passaging (2WND

,

4WND

, 6WND

) which due to the accumulation of oxidation stress of in vitro culture

(Halliwell and Whiteman, 2004) (Figure 7). In contrast, the number of 8-OHdG+ cells and

intensity of 8-OHdG expression were remarkable decreased in both young and aged AEC-II

groups under iPL induction (iPL), even upon subsequent dox-withdrawal (iPL+2W-D

)

(Figure 8). Taken together, the results above showed interrputed reprogramming can

ameliorate the mtDNA damage which results from both the aging process and accumulated

oxidation stress of in vitro culture.

Figure 7. Mitochondrial DNA damage presents in cultured AEC-II cells which

accumulate with the aging process Confocal microscopy images of colonies generated

from non-treated young and aged AEC-II cells at different passages, showing nuclear stain

DAPI (blue), SPC (green) and 8-OHdG (red). Scale bar, 10 µm.

152

Figure 8. Interrupted reprogramming ameliorates the aged-related mitochondrial

DNA damage Confocal microscopy images of 2WND

+2W+D

(iPL) colonies and colonies

obtained from iPL cells maintained in culture for 2 weeks in the absence of Dox (iPL+2W-D

)

from young and aged AEC-II cells, showing nuclear stain DAPI (blue), SPC (green) and 8-

OHdG (red). Scale bar, 10 µm.

5.5.7 Interrupted reprogramming allows restoration of age-

related expression of H3K4me3, H3K9me3 and H3K27me3

Cellular damage resulting from aging (e.g., genome instability, telomere dysfunction

and mitochondrial dysfunction) are primarily regulated through epigenomic mechanisms

(Blasco, 2007; Issa, 2014). Meeting the criteria for a hallmark of aging, epigenetic alteration

in DNA methylation and histone methylation patterns has been described showing increases

in the levels of histone H4K16 acetylation (H4K16ac), H4K20 trimethylation (H4K20me3),

or H3K4 trimethylation (H3K4me3), together with decreases in the levels of H3K9

trimethylation (H3K9me3) or H3K27 trimethylation (H3K27me3) (Fraga and Esteller,

2007b; Han and Brunet, 2012b). During iPS reprogramming, aging hallmarks are restored to

a youthful state primarily driven by epigenetic remodeling (Ocampo et al., 2016a; Yang et

al., 2015). While changes in histone marks are mainly detected in the early phase of

reprogramming (Polo et al., 2012), we determined whether aging-associated epigenetic

alteration in histone modification could be restored by interrupted reprogramming. The

expression of histone markers, including H3K4me3, H3K9me3, and H3K27me3, in young

AEC-II cells, aged AEC-II cells and their counterpart iPL cells were examined by

immunostaining. Consistent with previously described age-associated histone modification

153

in other cell types (Han and Brunet, 2012), we also found significant increased levels of

H3K4me3 and reduced levels of H3K9me3, and H3K27me3 in aged AEC-II cells compared

to young AEC-II cells. Upon iPL induction, the expression of the above histone markers in

aged AEC-II cells were restored to a youthful state as that of young AEC-II cells (Figure 9,

10). These results suggested that interrupted reprogramming is able to erase some aging-

related epigenetic memories via sufficient restoration of H3K4me3, H3K9me3 and

H3K27me3 expression, as that achieved by iPS reprogramming.

Figure 9. Interrupted reprogramming restores the age-associated expression of

H3K4me3 and H3K9me3 in AEC-II cells Confocal microscopy images of colonies

154

obtained under different conditions from young and aged AEC-II cells, showing nuclear

stain DAPI (blue), H3K4me3 (green) and H3k9me3 (red). Scale bar, 10 µm (2WND

, 4WND

,

6WND

, iPL), 100 µm (iPL+2W-D

).

Figure 10. Interrupted reprogramming restores the age-associated expression of

H3K27me3 in AEC-II cells Confocal microscopy images of colonies obtained under

different conditions from young and aged AEC-II cells, showing nuclear stain DAPI (blue)

and H3K27me3 (green). Scale bar, 10 µm (2WND

, 4WND

, 6WND

, iPL), 100 µm (iPL+2W-D

).

5.6 Discussion

We demonstrated that carefully defined period of interrupted reprogramming allows

rejuvenation of aged lung progenitor AEC-II cells to a youthful state yet preservation of

AEC-II identity and function of cell of origin. The age-related deterioration observed in aged

AEC-II cells, including impaired self-renewal, declined telomerase activity, mitochondrial

DNA damages and the epigenome histone alteration, was reset to a younger state in aged-

155

AEC-II-iPL and their progeny. Meanwhile, controlled expansion of younger cells retaining

the parental AEC-II cellular identity and function was achieved.

A major goal in lung therapy research is to sufficiently maintain or restore lung

function in aged individuals. Lung stem cells play crucial roles in maintaining tissue

homeostasis and tissue regeneration. However, even without extrinsic insults, lung stem

cells experience replicative exhaustion and gradually loss their regenerative capacity during

aging, resulting in lung dysfunction and chronic lung diseases (Meiners et al., 2015). Despite

the recent progress in identifying a number of specialized stem cell populations within the

lung that function to replenish or repair damaged epithelium (Kim et al., 2005; McQualter et

al., 2010; Teisanu et al., 2011; Chapman et al., 2011; Barkauskas et al., 2013; Vaughan et

al., 2014; Jain et al., 2015), all of these studies were performed on young animals. No direct

evidence has been shown on the impact of aging on in vitro behavior and on regenerative

response to injury. Ours is the first in vitro study demonstrating the age-related dysfunction

of airway progenitors. Most recently and in support of our hypothesis, Ocampo et al

demonstrated that in vivo partial reprogramming ameliorates hallmarks of aging and extends

the lifespan in premature aging mouse models. They also show that partial reprogramming

improves recovery from metabolic disease and muscle injury in older mice (Ocampo et al.,

2016a, 2016b). However, the rejuvenation consequence of transient reprogramming on

tissue specific stem cells has not been evaluated in this study. In contrast, we are the first

demonstrated that aged tissue stem cells can be reversed to a youthful state by carefully

timed transient reprogramming in vitro .

It is clear that a number of key issues needed to be addressed in our future studies.

Firstly, although aged-AEC-II cells were rejuvenated to a younger state, whether these

generated iPL cells are consistent with bipotent alveolar progenitors expressing Hopx and

α64 requires further characterization. Secondly, interrupted reprogramming seems to able

to replicate the rejuvenation effects seen in iPS reprogramming, but how aging-related

epigenetic memory has been erased and how the epigenome is remodeled, needs further

exploration. In addition, the role of each individual reprogramming factor on the aging

process or reversal of needs to be determined.

Notch signaling pathway plays a crucial role in regulating the regenerative capacity

of numerous stem cell populations, including basal stem cells and lineage-negative epithelial

156

stem/progenitor population (LNEP) (Vaughan et al., 2014) that excessive Notch signaling

dysregulates their ability to repair. Altered levels of Notch signaling have been observed in

human IPF, suggesting the age-associated alteration in pathways could be one of the

underlying factors responsible for the failure of endogenous stem cells to repair injured

tissue or even accelerate the development of disease. Therefore, our future studies need to

yield insight into the pathways, including Notch signaling, to determine their roles in

regulating AEC-II aging and rejuvenation consequence induced by interrupted

reprogramming.

The limited regenerative capacity of aged stem cells has been demonstrated in in vivo

disease models of other tissues, but not yet in the lungs. Although the age-related impaired

reparative capacity has been observed in bleomycin-induced fibrosis in aged mice (Hecker et

al., 2014), the contribution of aged AEC-II stem cells to the impaired tissue regeneration

needs to be evaluated by transplantation into the microenvironment of young recipients.

Moreover, the rejuvenated regenerative capacity of aged-AEC-II-iPL cells and the derived

younger AEC-II-like cells to ameliorate age-related pulmonary fibrosis needs to be

examined in vivo by cell transplantation to belomycin-treated aged recipients.

Finally, for therapeutic use, the current data was obtained from transgenic mice and

it remains to be shown that this technique can be efficiently applied in human cells to rescue

the aging phenotype.

Theoretically, this technique is broadly applicable and could be extended to other

aged stem cell populations giving rise to large numbers of highly specified younger cell

populations, holding great promise for treating age-related disorders.

157

Chapter 6

Summary and Discussion

6.1 Summary of key findings

Regenerative medicine is constrained by suboptimal cell sources with either limited

or uncontrolled proliferation and/or incompletely restricted differentiation. Seeking an

alternative approach to produce highly specified functional cell sources for tissue

regeneration, we have developed a novel "interrupted reprogramming" strategy, harnessing

the residual epigenetic memory in combination with the rapid induction of cell proliferation

existing early in the reprogramming process.

We show that this strategy, using a carefully timed transient expression of iPS cell

reprogramming factors (OSKM), allows the generation of lineage-specific induced

progenitor-like (iPL) cells from both mature and progenitor epithelial populations without

gaining tumorigenic pluripotency. Both our in vitro and in vivo results support our

hypothesis that interrupted reprogramming, where the reprogramming process is initiated

but not passing the point of no-return (Nagy and Nagy, 2010), allows controlled expansion

and preservation of the cell’s memory of origin and thus their ability to efficiently return to

their original phenotype.

In chapter 3, we showed that iPL cells derived from bronchiolar mature Club cells

function as bronchiolar progenitor-like cells to generate mature bronchiolar Club cells,

goblet cells and functional CFTR-expressing ciliated epithelium and show in vivo utility in

repopulating CFTR-deficient epithelium. In chapter 4, we further explored the utility and

generalizability of interrupted reprogramming to a lung progenitor cell population and

showed that interrupted reprogramming is able to rescue the limited in vitro clonogenic

capacity of AEC-II cells and generate large numbers of AEC-II-iPL cells which

phenotypically and functionally resemble a bipotent distal epithelial progenitor seen in

embryonic lung. Importantly, these AEC-II-iPL cells can ameliorate bleomycin-induced

pulmonary fibrosis in vivo via cell engraftment and subsequent differentiation to the alveolar

epithelial lineage.

158

In chapter 4, we demonstrated that interrupted reprogramming is able to rejuvenate

aged AEC-II cells to a youthful state by ameliorating multiple aging hallmarks, including

impaired self-renewal, declined telomerase activity, mitochondrial DNA damages and the

epigenome histone alteration. These results are consistent with ‘age’-related plasticity in the

early stages of reprogramming. Concomitantly, the cellular identity of AEC-II is well

preserved thereby generating large number of younger AEC-II cells.

6.2 Discussion

We showed that interrupted reprogramming can be used as an alternative approach to

produce highly specified functional therapeutic cell populations that may lead to significant

advances in regenerative medicine. The novelty of this concept and the relevant issues will

be further discussed with perceived future directions. The key focus in this discussion

includes the progenitor features of iPL cells; variables need to be considered to obtain iPL

cells-the target cell types and induction conditions; the heterogeneity observed during iPL

induction and cellular mechanisms underlying iPL phenomenon.

6.2.1 What are iPL cells?

We designate these intermediate products "induced progenitor-like cells" which

takes into account their controlled proliferation and restricted differentiation to a limited

range of progeny, which resemble the fundamental functional characteristic of adult stem

cells. We think “progenitor-like” is a fair description and gets to the heart of our findings –

an approach to create cells which can function as progenitors from any mature, readily

available cell type. However, whether the reprogramming is a stepwise de-differentiation

process that multipotent iPL cells could de-differentiate to foregut endoderm, and then into

definitive endoderm upon continuous reprogramming is yet to be determined. To do this,

further refinement of precise regulation of expression of individual reprogramming factors

is needed to widen the relatively narrow time window between where factor-dependent iPL

cells are created and factor-independent pluripotency is established.

159

We selected two distinct populations from different regions in the lung: (1) mature

bronchiolar Club cells, and (2) AEC-II cells, which possess limited proliferative or

clonogenic capacity in vitro, respectively.

Club-iPL cells function as bronchiolar progenitor-like cells that are able to give rise

to Club, goblet and ciliated lineage in both in vitro and in vivo. This induced multipotency

resembles that of basal stem cells and variant Club cells. Scgb1a1+ variant Club cells can

respond to naphthalene or allergen challenge and give rise to ciliated and goblet cells

(Rawlins et al., 2009a; Pardo-Saganta et al., 2013); basal stem cells respond to sulfur

dioxide injury (Rock et al., 2009a) or naphthalene injury (Hong, 2003) and differentiate into

club and ciliated cells, but also able to migrate and repopulate alveolar epithelium after

H1N1 influenza infection (Kumar et al., 2011). At the molecular level, Club-iPL cells are

distinguished from variant Club cells and basal stem cells by their expression of P63,

lacking of CK5 activity, respectively. Furthermore, comparison of microarray data for

known facultative progenitor populations suggests that Club-iPL cells are not identical to

any currently identified progenitors. Nevertheless, it remains a possibility that Club-iPL

cells are similar to a yet unidentified naturally existing progenitor cell population.

Alternatively, Club-iPL cells function as a novel "artificial" progenitor cell population not

existing in the developing or mature lung. In contrast, we found that AEC-II-iPL cells may

recapitulate an identified distal lung epithelial progenitor population. Their phenotypic

expression of SPC, Hopx, and intergin α6β4

bares likeness to an embryonic bipotent

alveolar progenitor (Treutlein et al., 2014).

Although multiple unique cell states en route to pluripotency during iPS

reprogramming have been documented, whether iPL cells represent a unique intermediate

stage and/or recapitulate a specific developmental stage requires further characterization and

dissection of the early reprogramming process.

6.2.2 The regenerative capacity of iPL cells

As proof of concept, we evaluated the utility of iPL cells for lung cell-based

therapeutic applications by assessing the retention and differentiation of the cells in (1) a

CFTR-knockout mouse; and (2) a bleomycin-induced pulmonary fibrosis model. We found

that lineage-specific iPL cells can directly contribute to the repair of injured lungs by

160

engraftment and incorporation in the epithelium and differentiation into the desired

functional progeny.

Although the in vivo models we applied are very commonly used and have many of

the manifestations of human lung diseases, including epithelium dysfunction and

exaggerated immune response, they fail to faithfully replicate the pathophysiology in

humans (Scholte et al., 2004). Naphthalene treatment of recipient animals was used simply

as a conditioning regimen to augment retention of delivered iPL cells and is not a model or

airway lung injury. The dose of naphthalene is not lethal and animals fully recover after a

period of time. The BLM injury model is not an optimal model for human IPF in that the

spontaneous repair following the initial development of fibrosis is in contrast to the

progressive pathological remodeling seen in human IPF. Thus, in vivo models that better

recapitulating the pathophysiology in human pulmonary diseases should be employed in

future evaluation of the therapeutic potential of iPL cells. For instance, the use of Club-iPL

cells in reversing the susceptibility of CFTR-deficient animals to Pseudomonas infection; as

well as AEC-II-iPL for functional restoration of alveolar architecture in H1N1 influenza

virus infected lungs.

6.2.3 The mechanisms underlying the iPL phenomenon

Since the innovation of iPS technology a decade ago, tremendous progress has been

made on understanding the mechanisms underlying somatic cell fate changes during the

multi-step reprogramming and the factor-induced ESC-like transcriptional network

established to confer pluripotency. Whether the mechanisms underlying interrupted

reprogramming preformed on epithelial populations share similarity with or differ from what

we learn from the studies on fibroblasts reprogramming needs to be explored.

It has been demonstrated that certain reprogramming factors can be omitted from the

reprogramming cocktail when the target cell type can express them endogenously

(Nakagawa et al., 2008; Wernig et al., 2008). In our case, Club cells can express endogenous

Sox2, but at a much lower level compared to that in ESCs. It remains to be determined if

Sox2 can be excluded from the OSKM cocktail to generate Club-iPL cells.

Numerous studies of iPS reprogramming have demonstrates that each individual

reprogramming factor plays a distinct role during the stepwise reprogramming process (Li et

161

al., 2010; Nakagawa et al., 2008; Sridharan et al., 2009). Although c-Myc is the main factor

mediating the initial transcriptional wave, the successful MET occurring in the initial phase

of fibroblast reprogramming relies on the collaboration of all four factors. The second

transcriptional wave is mainly mediated by Oc4, Sox2 and Klf4, whereas c-Myc acts as an

amplifier of gene expression to build a foundation for the other reprogramming factors to

activate the pluripotency network (Nakagawa et al., 2008; Rahl et al., 2010). Notably, this

knowledge is mainly learned from the studies performed with the Yamanaka factors on

mouse embryonic fibroblasts (MEFs). Therefore, whether the role of each individual factor

in lung epithelial reprogramming process is similar to that seen in fibroblast reprogramming

remains to be determined.

Furthermore, the contribution of each of the individual reprogramming factors to the

iPL phenomenon during the interrupted programming process needs to be investigated in the

future. In our proof-of-principle study, all experiments were performed on cells carrying a

doxy-inducible polycistronic 4F (OSKM) 2A cassette. We suspect that the permutations of

the 4 factors and the relative expression levels of the individual factors play a crucial role in

iPL induction. However, we cannot assess all four single gene transgenic mice and siRNA

techniques may not fully knockdown genes. Similarly, if cells are virally transduced with

individual factors, the expression levels of factors will be different from that in 4F2A cells.

In all of these approaches, distinguishing between quantitative differences based on

expression levels of individual factors versus synergistic effects in any of the combinations

would be extremely difficult. To overcome these difficulties, other reprogramming systems

should be employed in future studies to examine the effects of different combinations of the

various 4 factors in iPL induction.

During iPS reprogramming of fibroblasts, c-Myc targets the promoters involved in

regulating cell proliferation, metabolism and biosynthetic pathways. In addition,

overexpression of oncogenic c-Myc has been shown to induce proliferation of mature cells

and lead to partial transformation. In contrast to c-Myc which is transcribed only in

mesenchyme, N-myc is specifically expressed in the epithelium and is essential for

maintaining undifferentiated and proliferating progenitor cells in the lung (Okubo, 2005).

Thus, we wondered if the generation of iPL from epithelial populations is distinct from

simple proliferation induced by over-expression of oncogenic N-myc. We compared four-

162

factor iPL induction to induction with N-myc alone using mature Club cells derived from

Rosa-rtTA-EGFP; teto-Nmyc transgenic mice. Although N-myc induction alone was able to

generate colonies, they were much smaller in number and showed morphological

heterogeneity (Appendix 1). In contrast, OSKM iPL induction resulted in a larger number of

hollow-luminal colonies with greater homogeneity. Transient induction of OSKM was able

to achieve a greater expansion of cells than N-myc induction alone. Our results with N-myc

transgenic mice are not surprising and show that colonies can be formed. However, these are

far less homogeneous and fewer in number in comparison to colonies obtained from OSKM

transgenic mice suggesting that the presence of all 4 factors is optimal for the iPL cell

generation process. It is important to stress that iPL cells have not committed to pluripotency

and long-term in vivo assays have shown no teratoma or tumor formation suggesting that it

is not partial transformation.

Meanwhile, a recent study evaluated the effect of transient activation of OSKM,

OSK and M alone in cancer cell system (Singovski et al., 2016). Although c-Myc was

important for driving proliferation of tested cancer cells, only the full four factors can result

in acquisition of a robust ‘cancer stem cell” phenotype, including increase in colony forming

efficiency. Whether this observation is analogous to our non-malignant iPL population

remains to be studied.

6.2.4 Target cell type in iPL induction

Numerous factors, including cell proliferation, target cell types and epigenetic

remodelling, have been identified that could influence iPS reprogramming and are

associated with reprogramming efficiency and therefore they may also be involved in the

generation of iPL cells.

Promotion of the cell cycle allowing more cells to transit through S phase (Hanna et

al., 2009; Ruiz et al., 2011) could enhance the iPS reprogramming efficiency. Although it is

still debating whether the degree of proliferation of starting population influences the effi-

ciency and kinetics of the iPS reprogramming process, we found that the proliferative

property of the starting epithelial population influences the induced proliferation at early

stage of reprogramming and the ability to obtain pluripotency at the later stage.

163

In our attempt to isolate and purify Club cells, we have defined two distinct epithelial

populations, EpCAMhigh

and EpCAMlow

cells. Compared to EpCAMhigh

mature Club cells,

non-treated EpCAMlow

cells exhibited a greater endogenous proliferative capacity showing

larger portion of CFSEnegative

proliferative cells. Although dox-induction results in more

CFSEnegative

proliferative cells within both groups, a higher induced proliferation was

observed in EpCAMlow

population, suggesting the proliferative status of starting epithelial

population influences their response to the inductive factors to proliferate (Appendix 2).

Regarding the induction of pluripotency, both EpCAMhigh

and EpCAMlow

cells were

seeded on transwell membrane pre-coated with MEF feeders (2D condition) and treated with

doxycycline. Activation of the inductive factors was monitored by immunostaining of Oct4

and pluripotency was accessed by expression of alkaline phosphatase, SSEA-1, and Nanog.

The induced colonies derived from EpCAMhigh

mature Club cell population failed to express

pluripotency markers and were unable to gain pluripotency up to 12~13 weeks under dox-

treatment. In contrast, dox-independent induced colonies expressing all the classical

pluripotency markers can be derived from EpCAMlow

population after 3-4 week of induction

(Appendix 3). These observations suggest that the proliferative property of the starting cells

could influence their ability to obtain pluripotency at the later stage.

Evidence from previous studies revealed that cell type could influence the

reprogrammability (Aoi et al., 2008; Aasen et al., 2008; Maherali et al., 2008). Although it

seems every cell is able to be reprogrammed to iPS cells (Hanna et al., 2009), whether the

degree of differentiation of starting cells within the same lineage influences the efficiency

and kinetics of the reprogramming process is still under debate.

In our study, both mature and progenitor epithelial cells were selected for iPL

induction. Progenitor AEC-II cells can give rise to Nanog-expressing Dox-independent

endogenous Oct4+ cells 1 week earlier than mature Club cells during reprogramming. In

addition, the expansion is much higher in iPL induction of AEC-II cells. These results

suggest that the proliferative capacity and the degree of differentiation of the starting cells

within the lung epithelial lineage could influence the reprogramming process and the

generation of iPL cells.

Epigenetic remodelling is the major underlying mechanism driving somatic cells

from the differentiated to the pluripotent state during the reprogramming process. The

164

epigenetic features of the starting somatic cells need to be erased to some extent to adopt a

pluripotent stem cell epigenome. Supportive studies showed that the expression of lineage-

specific genes blocks reprogramming (Mikkelsen et al., 2008; Pereira et al., 2010). Thus, we

speculate that the extent of epigenetic memory of the cell of origin linked to the residual

DNA methylation within lineage-specific genes persisting in mature and progenitor

epithelial cells is different, and may influence the extinction of the somatic program during

the early stage of reprogramming and attribute to the variation seen in their iPL induction.

Changes in histone modifications occur immediately after induction of

reprogramming factors. The loss of H3K4me2 at the promoters of somatic cells and the

gradual depletion of H3K27me3 and promoter hypomethylation in the regions responsible

for cell fate conversion all occurs during the early phase of reprogramming (Sridharan et al.,

2009; Stadtfeld et al., 2008). Whether these epigenetic alternations are responsible for the

variation seen in iPL induction of mature and progenitor lung epithelial cells remains to be

studied.

6.2.5 Derivation condition for iPL cells

One of the advantages of the iPL process is the resulting expansion of epithelial

cells. There are several factors that could influence the transgene activation and the induced

proliferative capacity. Thus, interrupted reprogramming culture conditions need to be

optimized to satisfy both starting epithelial populations and the derived iPL cells.

While most of the reprogramming studies were preformed under two-dimensional

(2D) cell-culture system, our initial experiments were carried out in 2D conditions. We

tested multiple factors and found that the cell seeding density, doxycycline concentration

and the differentiation status of starting cells could influence the transgene activation and the

induced proliferative capacity. Moreover, a greater induced proliferation was observed when

cells were induced under the conditions of transwells coated with supporting MEF feeders.

Nevertheless, optimized 2D conditions result in the loss of epithelial phenotype which can

only be partial restored upon factor-withdrawal.

It is well known that Matrigel can better support epithelial growth and maintain

epithelial phenotype in vitro. Furthermore, iPS cells can be maintained in Matrigel

conditions as embryonic bodies. Thus, we developed a Matrigel-based 3D culture system

165

and examined its ability to support iPL induction. Compared to the 2D reprogramming

condition, we found this Matrigel-based 3D condition can boost induction of iPL cells and

pluripotency. During interrupted reprogramming, large numbers of luminal iPL colonies can

be obtained from mature Club cells in 3D conditions. Importantly, induced colonies obtained

under 2D conditions were not able to gain pluripotency even after 12~13 weeks of dox-

treatment, whereas Nanog+ colonies can be obtained in 3D conditions after 4 weeks of

induction. Although the precise underlying mechanisms are unknown, we speculate that this

Matrigel-based 3D condition provides a more supportive "reprogramming niche" and

modulates the reprogramming process of epithelial cells. Meanwhile, a recent report

highlights the importance of mimicking the biochemical features of native

microenvironment during reprogramming and demonstrates that a chemical defined 3D

ECMs can accelerate the two key events for initiation of iPS programming, MET and

chromatin remodeling (Caiazzo et al., 2016).

Furthermore, the timing of induction may require some optimization to "satisfy"

target cell type to obtain maximum expansion of iPL cells. In our study of iPL induction of

AEC-II cells, we first adopted the induction conditions used in Club cells that AEC-II cells

were immediately induced after cell isolation (named "early induction") in Matrigel-based

3D conditions. We found that AEC-II cells treated with Dox for 4weeks (4W+D

, 6W+D

)

resulted in the generation of type A (epithelial-like) and type B (mesenchymal-like) colonies

with distinct morphologies. Importantly, there is no significant increase in colony forming

efficiency and the resultant cell expansion was not satisfactory (6W+D

results in 19.73± 2.4

fold expansion relative to day0 seeded cells). In terms of the ability of the induced cells to

return to their original phenotype, SPC, which was suppressed after 2 weeks of Dox, was

only expressed in type A colonies upon withdrawal of Dox but not in type B colonies

(Appendix 4). This result suggests some cells under 2-week early induction have already

passed the point-of-no return and fail to return to AEC-II phenotype. Therefore, we

developed a slightly different condition for AEC-II cells, which is an initial two weeks of

culture without Dox prior to Dox-treatment (named "late induction"), and found it appears

advantageous for greater expansion and preservation of lineage commitment.

166

6.2.6 The heterogeneity observed in iPL induction

The heart of interrupted reprogramming is to create controllable conditions that

maintain the adult stem cell-like state but when removed, allow the cells to then

spontaneously revert to the mature cell of origin. Interrupted reprogramming was performed

on highly purified starting populations and resulted in relatively homogeneous induced cell

proliferation and returning ability upon withdrawal of reprogramming factors. Similar to the

higher levels of heterogeneity observed in the early phases of iPS induction (Lujan et al.,

2015; Treutlein et al., 2016; Zunder et al., 2015), some degree of heterogeneity has also been

observed during our iPL induction. Although the vast majority of cells are able to initiate

reprogramming, individual cells within the starting population differ in their response to

inductive factors and generate iPL colonies which are variable in size, as well as their ability

to obtain pluripotency (marked by Nanog expression). Whether this heterogeneity is

attributed to the various levels of endogenous Sox2 expression representing the normal

biology of Club cells or the variance in the pre-existing epigenetic fingerprint regulating

individual cell fate within the starting Club cell population needs further exploration.

6.2.7 Highlights of interrupted reprogramming-compared to

other approaches

We exploit recent efforts to dial back reprogramming technologies for somatic cells

to a potentially useful intermediate factor-dependent state rather than factor-independent

state of partially reprogrammed iPS and iPS cells. Harnessing the “residual epigenetic

memory” of the starting cells, carefully timed interrupted reprogramming enables generation

of large numbers of lineage-specific progenitor-like cells with restricted differentiation to a

limited and appropriate range of functional progeny. Our proof of concept in vivo studies

showed lineage-specific iPL cells hold great promise for treating a variety of diseases by

true engraftment as “induced” progenitors. Furthermore, intermittent induction cycles

resulted in second generation iPL cells with a greater expansion without loss of lineage

committement. Further studies to maximize the expansion of cells require the precise

167

regulation of expression of individual reprogramming factors, potential use of growth

factors, and/or changes to culture conditions.

Endogenous progenitor cells exist in various organs, including the lung (Kim et al.,

2005; McQualter et al., 2010; Rawlins et al., 2009b; Rock et al., 2009b). However, these

cells are rare, which limits their expansion. In our initial work with Club cells, we found the

native EpCAMlow

population containing some endogenous progenitor cells which can give

rise to colonies in 3D condition. We have performed a co-culture experiment to examine the

effect of iPL induction on the EpCAMlow

population. In this study, EpCAMlow

cells were

isolated from both GFP-Col1a14F2 and RFP mice, which lack the inducible 4F2A construct.

Cells were mixed in a 1:1 ratio and treated with doxycycline for 2 weeks. Co-cultures

resulted in 100% monochromatic colonies supporting the idea colonies are clonally derived.

Importantly, although both colors of cells were able to generate colonies, higher CFU% was

found in the inducible GFP+

group (Appendix 5), consistent with our interpretation that

interrupted reprogramming has converted additional cells to iPL cells.

Recent published work has shown that conditional reprogramming using feeder cells

and ROCK inhibitor (Y-27632) is able to maintain upper airway P63+ stem cells in their

immature, proliferative forms (Bove et al., 2014; Liu et al., 2012). Despite fundamental

differences from our approach, we have compared iPL induction of EpCAMhigh

-mature Club

cells to conditional reprogramming. We found that cell proliferation induced by iPL

induction was 12.3±1.6% fold greater than using the ROCK inhibitor in 2D CFSE assay. In

a 3D assay, the morphology of the colonies formed using the ROCK inhibitor was

significantly different from those obtained after iPL induction. Unlike iPL colonies, ROCK-

inhibitor treatment alone doesn’t contribute to the generation of luminal colonies but

resulted in few small dense cell clusters/ colonies (Appendix 6). A comparison experiment

was also performed on AEC-II population. As shown in chapter 4, the expansion induced by

Rock-inhibitor relies on endogenous proliferative capacity of the starting populations and no

improvement in self-renewal was observed in aged AEC-II cells treated with Rock-inhibitor.

In contrast, a robust increase in CFU% was seen in both young and aged AEC-II cells under

iPL induction. Thus we feel our interrupted reprogramming approach is significantly

different and quantitatively much more powerful.

168

Great effort have been placed on overcoming the low differentiation efficiency,

heterogeneous final products (Plath and Lowry, 2011; Schwartz et al., 2014) and

contamination by potentially tumorigenic undifferentiated cells (Ben-David and Benvenisty,

2011; Tapia and Schöler, 2016) in differentiation of ES and iPS cells to desired cell types.

There is no standardized approach applicable to all cell types, thus derivation of each unique

cell type from ES and iPS cells may require the development of hundreds of unique

protocols. In contrast, interrupted reprogramming was relatively straightforward to extend to

2 distinct populations of lung cells. This strategy is theoretically broadly applicable and

could be extended to other somatic cell types giving rise to numerous progenitor cell

populations with enhanced proliferation and restricted differentiation. This technology only

requires the starting population to be isolated in relative purity and current isolation of very

specific populations of adult cells is already possible using advanced flow cytometric sorting

and cell culture techniques from most organs. Nevertheless, the induction conditions may

require some optimization to satisfy specific cell type to obtain maximum expansion of iPL

cells.

169

Chapter 7

Future directions and Conclusion

As discussed above, we recognize that there are many questions surrounding iPL

cells need to be addressed in future studies. Firstly, the progenitor markers expressed by iPL

cells and epigenetic remodeling during interrupted reprogramming require further

characterization. Secondly, regarding to the rejuvenation consequence of interrupted

reprogramming, the epigenetic targets need to be explored. Thirdly, the utility of rejuvenated

progenitor-like cells to regenerate injured aged lungs needs to be examined in vivo. Finally,

for therapeutic use, the efficient application of this technique in human cells requires

evaluation.

7.1 Characterization of the progenitor cell markers expressed

by iPL cells

Some of the markers of current defined stem cell populations, which are absent in the

starting cells, have been found to be activated in iPL cells. Club-iPL cells can express basal

stem cell marker-P63, while AEC-II-iPL cells express markers of bipotent progenitor,

including Hopx, SPC and α64. Are these markers paralogous with the ones expressed in

endogenous airway stem cells? Do those corresponding proteins display similar or distinct

roles in regulating cell self-renewal and differentiation compared to the endogenous ones?

Future studies to examine the gene sequence and the protein structure will provide us

information for better understanding the mechanisms underlying the progenitor-like

functionality of lineage-specific iPL cells.

170

7.2 Epigenetic characterization of iPL induction

Epigenetic mechanisms, DNA and histone methylation in particular, are responsible

for the maintenance of cellar memory and the regulation of cell-type-specific gene

expression.

Reprogramming through forced expression of OSKM transcription factors occurs through

major epigenetic remodeling driving somatic cells from the differentiated to the pluripotent

state. The epigenetic feature of the starting somatic cells has been erased to some extent

during the conversion to adopt a pluripotent stem cell epigenome.

Interrupted reprogramming, which occurs during the early stage of reprogramming,

allows induction of a progenitor-like state yet preservation of cellular identity to

spontaneously return to their differentiated state upon factors-withdrawal. Therefore,

understanding of the contribution of epigenetic regulation to the iPL process is required.

Which parts of the somatic epigenetic memory have been erased and which have been

maintained during interrupted reprogramming? How they specifically induce de-

differentiation state without affecting cellular identity? Experiments to examine the changes

of histone modification and DNA methylation during iPL induction will be performed.

7.3 Identification of epigenetic targets resulting rejuvenation

via interrupted reprogramming

Epigenetic dysregulation is a major driver of the aging process and is proposed as a

novel biomarker of biological aging.

Despite the fundamental differences, both interrupted reprogramming and direct

conversion/reprogramming employ a short period of induction of the 4 reprogramming

factors, avoiding pluripotency. Studies have demonstrated that transient expression of the 4

reprogramming factors to open chromatin and induce cell plasticity during the early

reprogramming process, fibroblasts can be converted to other somatic cell types, such as

neural progenitors and cardiomyocytes (Efe et al., 2011; Kim et al., 2011). This is done by

applying combinations of specific transcription factors (Caiazzo et al., 2011; Pfisterer et al.,

2011; Sancho-Martinez et al., 2012) and/or microRNA (Ambasudhan et al., 2011; Leonardo

171

et al., 2012) after a transient induction of these factors. However, rejuvenation cannot be

achieved by direct reprogramming and cells derived from aged fibroblast-iPS cells still

retain age-related epigenetic memory, including the age-specific transcriptional profiles.

In contrast, reprogramming of iPS cells can erase age-related epigenetic memory.

Epigenetic remodeling during reprogramming process is the key driver of the restoration of

aging hallmarks to the youthful state, including telomere shortening, stem cell exhaustion,

mitochondrial dysfunction and cellular senescence.

Interrupted reprogramming is not only able to recapitulate the rejuvenation

consequence of iPS reprogramming, but also allows the maintenance of cellular identity to

generate large numbers of younger cells. We will determine if cells undergo progressive and

continuous rejuvenation during the reprogramming process, how aging-related epigenetic

memory has been erased and epigenome is remodeled during interrupted reprogramming. To

do this, we will compare the genome-wide transcriptional profiles of young AEC-IIs, aged

AEC-IIs and their iPL counterparts, and analyze the expression of aged-related genes,

including the ones related to DNA damage, stress response, and apoptosis. In addition, we

will employ comprehensive high-throughput array-based relative methylation (CHARM)

microarray analysis to compare the patterns of genomic DNA methylation in these cells.

7.4 Evaluation of the reparative capacity of aged AEC-II-iPL

cells in reversal of pulmonary fibrosis induced in aged mice

Aging plays a prominent role in triggering the pathogenesis of IPF. Studies have

demonstrated the age-related impaired reparative capacity in bleomycin-induced fibrosis

model (Hecker et al., 2014). Two months after bleomycin injury, young mice were able to

recover from fibrosis, whereas aged mice failed to resolve fibrotic injury showing persistent

fibrosis characterized by extensive accumulation of senescent and apoptosis-resistant

myofibroblasts in the lungs. Importantly, many of the hallmarks of aging implicated in

humans IPF, including epigenetic alterations, DNA damage, stem cell exhaustion, telomere

dysfunction and(shortened telomeres), mtDNA damage-mediated AEC apoptosis, and

activated endoplasmic reticulum (ER) stress response (Liu et al., 2013; Mossman et al.,

172

2011; Noble et al., 2012; Thannickal, 2013; Uhal and Nguyen, 2013; Weiss et al., 2010) are

mainly observed in AEC-II cells.

Thus, we will evaluate the therapeutic benefit of aged-AEC-II-iPL cells in reversal of

fibrosis in aged recipients. Four groups of cells, including young AEC-IIs, aged AEC-IIs and

their iPL counterparts will be transtracheally delivered to aged recipients at both the

inflammatory and fibrotic phases of BLM-induced injury. Previous studies of BLM model

of pulmonary fibrosis showed that aged male mice develop more prominent fibrotic disease

compared with aged female mice, and the pulmonary functional alterations can be detected

by FlexiVent measurement. We will therefore select an aged-male mouse BLM model to do

a direct comparison of all four groups of cells in improving lung function. A pilot study will

be performed to determine the in situ period for cells where a significant pulmonary

dysfunction could be detected in BLM mice compared to saline control. The therapeutic

benefit of injected cells will be examined following cell delivery. In addition to mortality,

development and severity of fibrosis will be assessed by measurements of static compliance,

leukocyte infiltration, levels of collagen deposition, and stereological quantification of

fibrotic areas in histological sections. We will also quantify proinflammatory and profibrotic

chemokine and cytokine levels in the bronchoalveolar lavage fluid. The cell retention and

differentiation will be examined by PCR and immunostaining of relevant markers.

7.5 Generation of human AEC-II-iPL cells and amelioration of

aged-related deterioration

Finally, for therapeutic use, we will examine if this technique can be efficiently

applied in human cells. Normal human lung cells will be isolated from excess tissue

remaining from both young and aged lung transplant donors and further purified by flow

cytometry to sort CD45neg

CD31neg

EpCAMpos

T1αneg

population which is enrich for AEC-II

cells. To better understand the aged-related decline in self-renewal capacity in human cells,

both young and aged AEC-II cells will be cultured in Matrigel-3D condition to access their

clonogenic capacity over passaging. For iPL induction, cells will be transfected with a

polycistronic lentiviral vectors driving dox-regulatable OSKM, and induced under a

underdetermined optimized condition allowing greater expansion of iPL cells before

173

reaching pluripotency. We will evaluate if interrupted reprogramming allows the

rejuvenation of aged AEC-II cells to a more youthful state yet preservation of AEC-II

identity and function. Specifically, to determine if cells are reset to a younger state, we will

measure the age-related deterioration in stem cell self-renewal capacity, telomerase activity,

telomere length, mitochondrial DNA and the epigenome histone methylation marks

(‘epigenetic clock’). The maintenance of AEC-II cell identity in aged-AEC-II-iPL and their

derivatives upon factors-withdrawal will be evaluated by their ability to generate alveolar-

like colonies composed of both AEC-I and AEC-II cells, and synthesis and secretion of

surfactant.

7.6 Conclusion

We developed a novel "interrupted reprogramming" strategy, to generate "induced

Progenitor-Like (iPL) cells" using carefully timed transient expression of induced

Pluripotent Stem (iPS) cell reprogramming factors. Lineage-specific iPL cells can be derived

from distinct epithelial populations and function as region-specific progenitor cells to

repopulate injured epithelium. Furthermore, interrupted reprogramming has the capacity to

rejuvenate aged AEC-II cells to a youthful state by ameliorating multiple age-associated

hallmarks, including self-renew exhaustion of stem cells, telomere attrition, accumulation of

DNA damage and epigenetic dysregulation.

Collectively, distinct from other approaches, interrupted reprogramming enables the

production of progenitor-like cells with controlled proliferation and lineage-restricted

differentiation in high purity. This would be extremely useful in a variety of regenerative

medicine practices, including cell replacement therapy, biohybrid devices, disease

modelling, and drug screening for human diseases.

174

Chapter 8 Appendix

a

b

Appendix 1. Comparison of OSKM iPL induction and N-myc induction alone in

mature Club cells (a) Light microscopy bright-field images showing the generation of

colonies in the presence of doxycycline in Matrigel-based clonogenic 3D conditions. (b)

Bulk serial passage of induced colonies during the 3 weeks of induction of OSKM and N-

myc line. Left panel represents the folds change in total cell number relative to day0 seeded

cells (10,000 cells/ well). Right panel represents the total number of colony forming units

(CFU) generated.

175

Appendix 2. The proliferative response of EpCAMhigh

and EpCAMlow

cells to the

inductive factors. Dot plots depicting CFSE expression of EpCAMhigh

cells and EpCAMlow

cells in the presence and absence of doxycycline (Dox) in a feeder-separated semi-

supportive culture system, at 5 days (top panel) and 7 days (bottom panel) post CFSE

labelling.

176

a. EpCAMhigh

population

177

b. EpCAMlow

population

178

Appendix 3. Characterization of induced colonies derived from EpCAMhigh

and

EpCAMlow

populations in 2D conditions. Light microscopy bright-field images showing

the generation of induced colonies and alkaline phosphatise staining. Confocal microscopy

images depicting induced colonies stained with nuclear stain DAPI (blue), Oct4/SSEA-1

(green) and Nanog/E-cadherin (red).

179

Appendix 4. Early induction failed to efficiently expand AEC-IIs and preserve AEC-II

phenotype (a) Experimental schema depicting the in vitro induction. (b) Bright field images

depicting the generation of colonies in the absence (ND) or presence of Dox (+D) (early

180

induction) in Matrigel-based 3D conditions. AEC-II cells treated with Dox for 4weeks

(4W+D

, 6W+D

) resulted in generation of type A (epithelial-like) and type B (mesenchymal-

like) colonies with distinct morphologies. The colony forming efficiency (c) and the fold

changes in total cell number (d) shown relative to day0 seeded cells (5,000 cells/ well).

Confocal microscopy images of 2-week Dox-treated cells (2W+D

) (e) and 2W+D

cells with

subsequent 2-week culture in Dox-free media (2W+D

+2W-D

) (f) showing nuclear stain DAPI

(blue), SPC (green) and EpCAM (red). For c and d, values are mean S.D. of three

independent biological replicates. *, p<0.05; **, p<0.001; ***, p<0.0001.

Appendix 5. Transient activation of inductive factors results an enhanced clonal

proliferation of EpCAMlow

population. Schematic graph (top panel) representing potential

outcomes of mix-culture experiment. Green, red and overlay (bottom panel) of fluorescence

from coculture of GFPpos

inducible and RFP non-inducible EpCAMlow

cells. Scale bar, 100

µm.

181

Appendix 6. Comparison of the proliferative response of EpCAMhigh

-Club cells to the

OSKM inductive factors and ROCK inhibitor treatment. (a) Dot plots depicting CFSE

expression of EpCAMhigh

cells in the presence of doxycycline and ROCK inhibitor in a

feeder-separated semi-supportive 2D culture system post CFSE labelling. (b) Bright field

images depicting the generation of colonies in the presence of doxycycline and ROCK

inhibitor in Matrigel-based 3D conditions.

182

References

Aasen, T., Raya, A., Barrero, M.J., Garreta, E., Consiglio, A., Gonzalez, F., Vassena, R.,

Bilić, J., Pekarik, V., Tiscornia, G., et al. (2008). Efficient and rapid generation of induced

pluripotent stem cells from human keratinocytes. Nat. Biotechnol. 26, 1276–1284.

Abyzov, A., Mariani, J., Palejev, D., Zhang, Y., Haney, M.S., Tomasini, L., Ferrandino,

A.F., Rosenberg Belmaker, L.A., Szekely, A., Wilson, M., et al. (2012). Somatic copy

number mosaicism in human skin revealed by induced pluripotent stem cells. Nature 492,

438–442.

Ahmad, T., Sundar, I.K., Lerner, C.A., Gerloff, J., Tormos, A.M., Yao, H., and Rahman, I.

(2015). Impaired mitophagy leads to cigarette smoke stress-induced cellular senescence:

implications for chronic obstructive pulmonary disease. The FASEB Journal 29, 2912–2929.

Akram, K.M., Lomas, N.J., Forsyth, N.R., and Spiteri, M.A. (2014). Alveolar epithelial cells

in idiopathic pulmonary fibrosis display upregulation of TRAIL, DR4 and DR5 expression

with simultaneous preferential over-expression of pro-apoptotic marker p53. Int J Clin Exp

Pathol 7, 552–564.

Alder, J.K., Chen, J.J.-L., Lancaster, L., Danoff, S., Su, S., Cogan, J.D., Vulto, I., Xie, M.,

Qi, X., Tuder, R.M., et al. (2008). Short telomeres are a risk factor for idiopathic pulmonary

fibrosis. Proc. Natl. Acad. Sci. U.S.A. 105, 13051–13056.

Alder, J.K., Guo, N., Kembou, F., Parry, E.M., Anderson, C.J., Gorgy, A.I., Walsh, M.F.,

Sussan, T., Biswal, S., Mitzner, W., et al. (2011). Telomere Length Is a Determinant of

Emphysema Susceptibility. American Journal of Respiratory and Critical Care Medicine

184, 904–912.

Alder, J.K., Barkauskas, C.E., Limjunyawong, N., Stanley, S.E., Kembou, F., Tuder, R.M.,

Hogan, B.L., Mitzner, W., and Armanios, M. (2015). Telomere dysfunction causes alveolar

stem cell failure. Proceedings of the National Academy of Sciences 112, 5099–5104.

Aldridge, J.R., Moseley, C.E., Boltz, D.A., Negovetich, N.J., Reynolds, C., Franks, J.,

Brown, S.A., Doherty, P.C., Webster, R.G., and Thomas, P.G. (2009). TNF/iNOS-producing

dendritic cells are the necessary evil of lethal influenza virus infection. Proc. Natl. Acad. Sci.

U.S.A. 106, 5306–5311.

Ambasudhan, R., Talantova, M., Coleman, R., Yuan, X., Zhu, S., Lipton, S.A., and Ding, S.

(2011). Direct reprogramming of adult human fibroblasts to functional neurons under

defined conditions. Cell Stem Cell 9, 113–118.

Aoi, T., Yae, K., Nakagawa, M., Ichisaka, T., Okita, K., Takahashi, K., Chiba, T., and

Yamanaka, S. (2008). Generation of pluripotent stem cells from adult mouse liver and

stomach cells. Science 321, 699–702.

183

Araya, J., Cambier, S., Markovics, J.A., Wolters, P., Jablons, D., Hill, A., Finkbeiner, W.,

Jones, K., Broaddus, V.C., Sheppard, D., et al. (2007). Squamous metaplasia amplifies

pathologic epithelial-mesenchymal interactions in COPD patients. J. Clin. Invest. 117,

3551–3562.

Armanios, M. (2012). Telomerase and idiopathic pulmonary fibrosis. Mutation

Research/Fundamental and Molecular Mechanisms of Mutagenesis 730, 52–58.

Armanios, M. (2013). Telomeres and age-related disease: how telomere biology informs

clinical paradigms. Journal of Clinical Investigation 123, 996–1002.

Armanios, M., and Blackburn, E.H. (2012). The telomere syndromes. Nature Reviews

Genetics 13, 693–704.

Armanios, M., Chen, J.-L., Chang, Y.-P.C., Brodsky, R.A., Hawkins, A., Griffin, C.A.,

Eshleman, J.R., Cohen, A.R., Chakravarti, A., Hamosh, A., et al. (2005). Haploinsufficiency

of telomerase reverse transcriptase leads to anticipation in autosomal dominant dyskeratosis

congenita. Proceedings of the National Academy of Sciences of the United States of

America 102, 15960–15964.

Armanios, M., Alder, J.K., Parry, E.M., Karim, B., Strong, M.A., and Greider, C.W. (2009).

Short Telomeres are Sufficient to Cause the Degenerative Defects Associated with Aging.

The American Journal of Human Genetics 85, 823–832.

Armanios, M.Y., Chen, J.J.-L., Cogan, J.D., Alder, J.K., Ingersoll, R.G., Markin, C.,

Lawson, W.E., Xie, M., Vulto, I., Phillips III, J.A., et al. (2007). Telomerase mutations in

families with idiopathic pulmonary fibrosis. New England Journal of Medicine 356, 1317–

1326.

Ashbaugh, D.G., Bigelow, D.B., Petty, T.L., and Levine, B.E. (1967). Acute respiratory

distress in adults. Lancet 2, 319–323.

Atkinson, J.J., Adair-Kirk, T.L., Kelley, D.G., deMello, D., and Senior, R.M. (2008). Clara

cell adhesion and migration to extracellular matrix. Respiratory Research 9, 1.

Avrahami, D., Li, C., Zhang, J., Schug, J., Avrahami, R., Rao, S., Stadler, M.B., Burger, L.,

Schübeler, D., Glaser, B., et al. (2015). Aging-Dependent Demethylation of Regulatory

Elements Correlates with Chromatin State and Improved β Cell Function. Cell Metabolism

22, 619–632.

Ayers, M.M., and Jeffery, P.K. (1988). Proliferation and differentiation in mammalian

airway epithelium. Eur. Respir. J. 1, 58–80.

Bachofen, M., and Weibel, E.R. (1982). Structural alterations of lung parenchyma in the

adult respiratory distress syndrome. Clin. Chest Med. 3, 35–56.

184

Barkauskas, C.E., Cronce, M.J., Rackley, C.R., Bowie, E.J., Keene, D.R., Stripp, B.R.,

Randell, S.H., Noble, P.W., and Hogan, B.L.M. (2013). Type 2 alveolar cells are stem cells

in adult lung. Journal of Clinical Investigation 123, 3025–3036.

Bar-Nur, O., Russ, H.A., Efrat, S., and Benvenisty, N. (2011). Epigenetic Memory and

Preferential Lineage-Specific Differentiation in Induced Pluripotent Stem Cells Derived

from Human Pancreatic Islet Beta Cells. Cell Stem Cell 9, 17–23.

Bastacky, J., Lee, C.Y., Goerke, J., Koushafar, H., Yager, D., Kenaga, L., Speed, T.P., Chen,

Y., and Clements, J.A. (1995). Alveolar lining layer is thin and continuous: low-temperature

scanning electron microscopy of rat lung. J. Appl. Physiol. 79, 1615–1628.

Batista, L.F.Z., Pech, M.F., Zhong, F.L., Nguyen, H.N., Xie, K.T., Zaug, A.J., Crary, S.M.,

Choi, J., Sebastiano, V., Cherry, A., et al. (2011). Telomere shortening and loss of self-

renewal in dyskeratosis congenita induced pluripotent stem cells. Nature 474, 399–402.

Beers, M.F., and Morrisey, E.E. (2011). The three R’s of lung health and disease: repair,

remodeling, and regeneration. J. Clin. Invest. 121, 2065–2073.

Benayoun, B.A., Pollina, E.A., and Brunet, A. (2015). Epigenetic regulation of ageing:

linking environmental inputs to genomic stability. Nature Reviews Molecular Cell Biology

16, 593–610.

Ben-David, U., and Benvenisty, N. (2011). The tumorigenicity of human embryonic and

induced pluripotent stem cells. Nat. Rev. Cancer 11, 268–277.

Bernardes de Jesus, B., Vera, E., Schneeberger, K., Tejera, A.M., Ayuso, E., Bosch, F., and

Blasco, M.A. (2012). Telomerase gene therapy in adult and old mice delays aging and

increases longevity without increasing cancer: TERT alone extends lifespan of adult/old

mice. EMBO Molecular Medicine 4, 691–704.

Berndt-Weis, M.L., Kauri, L.M., Williams, A., White, P., Douglas, G., and Yauk, C. (2009).

Global transcriptional characterization of a mouse pulmonary epithelial cell line for use in

genetic toxicology. Toxicology in Vitro 23, 816–833.

Bertoncello, I., and McQualter, J.L. (2010). Endogenous lung stem cells: what is their

potential for use in regenerative medicine? Expert Rev Respir Med 4, 349–362.

Birch, J., Anderson, R.K., Correia-Melo, C., Jurk, D., Hewitt, G., Marques, F.M., Green,

N.J., Moisey, E., Birrell, M.A., Belvisi, M.G., et al. (2015). DNA damage response at

telomeres contributes to lung ageing and chronic obstructive pulmonary disease. American

Journal of Physiology - Lung Cellular and Molecular Physiology ajplung.00293.2015.

Blackburn, E.H., Greider, C.W., and Szostak, J.W. (2006). Telomeres and telomerase: the

path from maize, Tetrahymena and yeast to human cancer and aging. Nature Medicine 12,

1133–1138.

185

Blasco, M.A. (2007). The epigenetic regulation of mammalian telomeres. Nature Reviews

Genetics 8, 299–309.

Blelloch, R., Venere, M., Yen, J., and Ramalho-Santos, M. (2007). Generation of induced

pluripotent stem cells in the absence of drug selection. Cell Stem Cell 1, 245–247.

Bock, C., Kiskinis, E., Verstappen, G., Gu, H., Boulting, G., Smith, Z.D., Ziller, M., Croft,

G.F., Amoroso, M.W., Oakley, D.H., et al. (2011). Reference Maps of human ES and iPS

cell variation enable high-throughput characterization of pluripotent cell lines. Cell 144,

439–452.

Boers, J.E., Ambergen, A.W., and Thunnissen, F.B. (1998). Number and proliferation of

basal and parabasal cells in normal human airway epithelium. American Journal of

Respiratory and Critical Care Medicine 157, 2000–2006.

Boland, M.L., Chourasia, A.H., and Macleod, K.F. (2013). Mitochondrial Dysfunction in

Cancer. Frontiers in Oncology 3.

Bonasio, R., Tu, S., and Reinberg, D. (2010). Molecular Signals of Epigenetic States.

Science 330, 612–616.

Bormann, F., Rodríguez-Paredes, M., Hagemann, S., Manchanda, H., Kristof, B., Gutekunst,

J., Raddatz, G., Haas, R., Terstegen, L., Wenck, H., et al. (2016). Reduced DNA methylation

patterning and transcriptional connectivity define human skin aging. Aging Cell 15, 563–

571.

Boucher, R.C. (2003). Regulation of airway surface liquid volume by human airway

epithelia. Pflugers Arch. 445, 495–498.

Bove, P.F., Dang, H., Cheluvaraju, C., Jones, L.C., Liu, X., O’Neal, W.K., Randell, S.H.,

Schlegel, R., and Boucher, R.C. (2014). Breaking the In Vitro Alveolar Type II Cell

Proliferation Barrier while Retaining Ion Transport Properties. American Journal of

Respiratory Cell and Molecular Biology 50, 767–776.

Brambrink, T., Foreman, R., Welstead, G.G., Lengner, C.J., Wernig, M., Suh, H., and

Jaenisch, R. (2008). Sequential expression of pluripotency markers during direct

reprogramming of mouse somatic cells. Cell Stem Cell 2, 151–159.

Bratic, A., and Larsson, N.-G. (2013). The role of mitochondria in aging. Journal of Clinical

Investigation 123, 951–957.

Brock, T.G., Lee, Y.-J., Maydanski, E., Marburger, T.L., Luo, M., Paine, R., and Peters-

Golden, M. (2005). Nuclear localization of leukotriene A4 hydrolase in type II alveolar

epithelial cells in normal and fibrotic lung. Am. J. Physiol. Lung Cell Mol. Physiol. 289,

L224–L232.

186

Brody, S.L., Yan, X.H., Wuerffel, M.K., Song, S.-K., and Shapiro, S.D. (2000). Ciliogenesis

and left–right axis defects in Forkhead factor HFH-4–null mice. American Journal of

Respiratory Cell and Molecular Biology 23, 45–51.

Brune, K., Frank, J., Schwingshackl, A., Finigan, J., and Sidhaye, V.K. (2015). Pulmonary

epithelial barrier function: some new players and mechanisms. Am. J. Physiol. Lung Cell

Mol. Physiol. 308, L731–L745.

Brunet, A., and Berger, S.L. (2014). Epigenetics of Aging and Aging-related Disease. The

Journals of Gerontology Series A: Biological Sciences and Medical Sciences 69, S17–S20.

Budinger, G.R.S., Mutlu, G.M., Urich, D., Soberanes, S., Buccellato, L.J., Hawkins, K.,

Chiarella, S.E., Radigan, K.A., Eisenbart, J., Agrawal, H., et al. (2011). Epithelial cell death

is an important contributor to oxidant-mediated acute lung injury. Am. J. Respir. Crit. Care

Med. 183, 1043–1054.

Buganim, Y., Faddah, D.A., Cheng, A.W., Itskovich, E., Markoulaki, S., Ganz, K., Klemm,

S.L., van Oudenaarden, A., and Jaenisch, R. (2012). Single-cell expression analyses during

cellular reprogramming reveal an early stochastic and a late hierarchic phase. Cell 150,

1209–1222.

Caiazzo, M., Dell’Anno, M.T., Dvoretskova, E., Lazarevic, D., Taverna, S., Leo, D.,

Sotnikova, T.D., Menegon, A., Roncaglia, P., Colciago, G., et al. (2011). Direct generation

of functional dopaminergic neurons from mouse and human fibroblasts. Nature 476, 224–

227.

Caiazzo, M., Okawa, Y., Ranga, A., Piersigilli, A., Tabata, Y., and Lutolf, M.P. (2016).

Defined three-dimensional microenvironments boost induction of pluripotency. Nature

Materials 15, 344–352.

Calado, R.T., Regal, J.A., Kleiner, D.E., Schrump, D.S., Peterson, N.R., Pons, V., Chanock,

S.J., Lansdorp, P.M., and Young, N.S. (2009). A Spectrum of Severe Familial Liver

Disorders Associate with Telomerase Mutations. PLoS ONE 4, e7926.

Cantin, A.M., Hanrahan, J.W., Bilodeau, G., Ellis, L., Dupuis, A., Liao, J., Zielenski, J., and

Durie, P. (2006). Cystic fibrosis transmembrane conductance regulator function is

suppressed in cigarette smokers. Am. J. Respir. Crit. Care Med. 173, 1139–1144.

Carey, B.W., Markoulaki, S., Beard, C., Hanna, J., and Jaenisch, R. (2009). Single-gene

transgenic mouse strains for reprogramming adult somatic cells. Nature Methods.

Carey, B.W., Markoulaki, S., Beard, C., Hanna, J., and Jaenisch, R. (2010). Single-gene

transgenic mouse strains for reprogramming adult somatic cells. Nat. Methods 7, 56–59.

Cargnoni, A., Gibelli, L., Tosini, A., Signoroni, P.B., Nassuato, C., Arienti, D., Lombardi,

G., Albertini, A., Wengler, G.S., and Parolini, O. (2009). Transplantation of allogeneic and

xenogeneic placenta-derived cells reduces bleomycin-induced lung fibrosis. Cell

Transplantation 18, 405–422.

187

Castellani, C., Cuppens, H., Macek, M., Cassiman, J.J., Kerem, E., Durie, P., Tullis, E.,

Assael, B.M., Bombieri, C., Brown, A., et al. (2008). Consensus on the use and

interpretation of cystic fibrosis mutation analysis in clinical practice. J. Cyst. Fibros. 7, 179–

196.

Cerletti, M., Jang, Y.C., Finley, L.W.S., Haigis, M.C., and Wagers, A.J. (2012). Short-Term

Calorie Restriction Enhances Skeletal Muscle Stem Cell Function. Cell Stem Cell 10, 515–

519.

Chapman, H.A., Li, X., Alexander, J.P., Brumwell, A., Lorizio, W., Tan, K., Sonnenberg,

A., Wei, Y., and Vu, T.H. (2011). Integrin α6β4 identifies an adult distal lung epithelial

population with regenerative potential in mice. Journal of Clinical Investigation 121, 2855–

2862.

Chapman, S., Liu, X., Meyers, C., Schlegel, R., and McBride, A.A. (2010). Human

keratinocytes are efficiently immortalized by a Rho kinase inhibitor. Journal of Clinical

Investigation 120, 2619–2626.

Charville, G.W., and Rando, T.A. (2011). Stem cell ageing and non-random chromosome

segregation. Philosophical Transactions of the Royal Society B: Biological Sciences 366,

85–93.

Chen, R., Zhang, K., Chen, H., Zhao, X., Wang, J., Li, L., Cong, Y., Ju, Z., Xu, D.,

Williams, B.R.G., et al. (2015). Telomerase Deficiency Causes Alveolar Stem Cell

Senescence-associated Low-grade Inflammation in Lungs. Journal of Biological Chemistry

290, 30813–30829.

Cheng, L., Hansen, N.F., Zhao, L., Du, Y., Zou, C., Donovan, F.X., Chou, B.-K., Zhou, G.,

Li, S., Dowey, S.N., et al. (2012). Low incidence of DNA sequence variation in human

induced pluripotent stem cells generated by nonintegrating plasmid expression. Cell Stem

Cell 10, 337–344.

Chilosi, M., Carloni, A., Rossi, A., and Poletti, V. (2013). Premature lung aging and cellular

senescence in the pathogenesis of idiopathic pulmonary fibrosis and COPD/emphysema.

Translational Research 162, 156–173.

Chin, M.H., Mason, M.J., Xie, W., Volinia, S., Singer, M., Peterson, C., Ambartsumyan, G.,

Aimiuwu, O., Richter, L., Zhang, J., et al. (2009). Induced pluripotent stem cells and

embryonic stem cells are distinguished by gene expression signatures. Cell Stem Cell 5,

111–123.

Chin, M.H., Pellegrini, M., Plath, K., and Lowry, W.E. (2010). Molecular analyses of

human induced pluripotent stem cells and embryonic stem cells. Cell Stem Cell 7, 263–269.

Christodoulou, C., Longmire, T.A., Shen, S.S., Bourdon, A., Sommer, C.A., Gadue, P.,

Spira, A., Gouon-Evans, V., Murphy, G.J., Mostoslavsky, G., et al. (2011). Mouse ES and

iPS cells can form similar definitive endoderm despite differences in imprinted genes. J.

Clin. Invest. 121, 2313–2325.

188

Clancy, J.L., Patel, H.R., Hussein, S.M.I., Tonge, P.D., Cloonan, N., Corso, A.J., Li, M.,

Lee, D.-S., Shin, J.-Y., Wong, J.J.L., et al. (2014). Small RNA changes en route to distinct

cellular states of induced pluripotency. Nature Communications 5, 5522.

Cole, B.B., Smith, R.W., Jenkins, K.M., Graham, B.B., Reynolds, P.R., and Reynolds, S.D.

(2010). Tracheal Basal cells: a facultative progenitor cell pool. Am. J. Pathol. 177, 362–376.

Cronkhite, J.T., Xing, C., Raghu, G., Chin, K.M., Torres, F., Rosenblatt, R.L., and Garcia,

C.K. (2008). Telomere Shortening in Familial and Sporadic Pulmonary Fibrosis. American

Journal of Respiratory and Critical Care Medicine 178, 729–737.

Crosby, L.M., and Waters, C.M. (2010). Epithelial repair mechanisms in the lung. Am. J.

Physiol. Lung Cell Mol. Physiol. 298, L715–L731.

Crosby, L.M., Luellen, C., Zhang, Z., Tague, L.L., Sinclair, S.E., and Waters, C.M. (2011).

Balance of life and death in alveolar epithelial type II cells: proliferation, apoptosis, and the

effects of cyclic stretch on wound healing. Am. J. Physiol. Lung Cell Mol. Physiol. 301,

L536–L546.

Crystal, R.G., Randell, S.H., Engelhardt, J.F., Voynow, J., and Sunday, M.E. (2008). Airway

Epithelial Cells: Current Concepts and Challenges. Proceedings of the American Thoracic

Society 5, 772–777.

Cutz, E., Yeger, H., and Pan, J. (2007). Pulmonary Neuroendocrine Cell System in Pediatric

Lung Disease?Recent Advances. Pediatric and Developmental Pathology 10, 419–435.

Davis, P.B. (2006). Cystic fibrosis since 1938. Am. J. Respir. Crit. Care Med. 173, 475–482.

De Los Angeles, A., Ferrari, F., Xi, R., Fujiwara, Y., Benvenisty, N., Deng, H.,

Hochedlinger, K., Jaenisch, R., Lee, S., Leitch, H.G., et al. (2015). Hallmarks of

pluripotency. Nature 525, 469–478.

Desai, T.J., Brownfield, D.G., and Krasnow, M.A. (2014). Alveolar progenitor and stem

cells in lung development, renewal and cancer. Nature 507, 190–194.

De Water, R., Willems, L.N., Van Muijen, G.N., Franken, C., Fransen, J.A., Dijkman, J.H.,

and Kramps, J.A. (1986). Ultrastructural localization of bronchial antileukoprotease in

central and peripheral human airways by a gold-labeling technique using monoclonal

antibodies. Am. Rev. Respir. Dis. 133, 882–890.

Dobbs, L.G., and Gutierrez, J.A. (2001). Mechanical forces modulate alveolar epithelial

phenotypic expression. Comp. Biochem. Physiol., Part A Mol. Integr. Physiol. 129, 261–

266.

Dobbs, L.G., and Johnson, M.D. (2007). Alveolar epithelial transport in the adult lung.

Respir Physiol Neurobiol 159, 283–300.

189

Doi, A., Park, I.-H., Wen, B., Murakami, P., Aryee, M.J., Irizarry, R., Herb, B., Ladd-

Acosta, C., Rho, J., Loewer, S., et al. (2009). Differential methylation of tissue- and cancer-

specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic

stem cells and fibroblasts. Nat. Genet. 41, 1350–1353.

Du, H.-Y., Pumbo, E., Ivanovich, J., An, P., Maziarz, R.T., Reiss, U.M., Chirnomas, D.,

Shimamura, A., Vlachos, A., Lipton, J.M., et al. (2008). TERC and TERT gene mutations in

patients with bone marrow failure and the significance of telomere length measurements.

Blood 113, 309–316.

Duchesneau, P., Wong, A.P., and Waddell, T.K. (2010). Optimization of targeted cell

replacement therapy: a new approach for lung disease. Mol. Ther. 18, 1830–1836.

Duchesneau, P., Besla, R., Derouet, M.F., Guo, L., Karoubi, G., Silberberg, A., Wong, A.P.,

and Waddell, T.K. (2017). Partial Restoration of CFTR Function in cftr-Null Mice following

Targeted Cell Replacement Therapy. Molecular Therapy.

Efe, J.A., Hilcove, S., Kim, J., Zhou, H., Ouyang, K., Wang, G., Chen, J., and Ding, S.

(2011). Conversion of mouse fibroblasts into cardiomyocytes using a direct reprogramming

strategy. Nat. Cell Biol. 13, 215–222.

Egan, J.J., Stewart, J.P., Hasleton, P.S., Arrand, J.R., Carroll, K.B., and Woodcock, A.A.

(1995). Epstein-Barr virus replication within pulmonary epithelial cells in cryptogenic

fibrosing alveolitis. Thorax 50, 1234–1239.

Eisner, M.D., Anthonisen, N., Coultas, D., Kuenzli, N., Perez-Padilla, R., Postma, D.,

Romieu, I., Silverman, E.K., Balmes, J.R., and Committee on Nonsmoking COPD,

Environmental and Occupational Health Assembly (2010). An official American Thoracic

Society public policy statement: Novel risk factors and the global burden of chronic

obstructive pulmonary disease. Am. J. Respir. Crit. Care Med. 182, 693–718.

Elborn, J.S. (2016). Cystic fibrosis. Lancet 388, 2519–2531.

Eminli, S., Utikal, J., Arnold, K., Jaenisch, R., and Hochedlinger, K. (2008).

Reprogramming of neural progenitor cells into induced pluripotent stem cells in the absence

of exogenous Sox2 expression. Stem Cells 26, 2467–2474.

Epperly, M.W., Guo, H., Gretton, J.E., and Greenberger, J.S. (2003). Bone Marrow Origin

of Myofibroblasts in Irradiation Pulmonary Fibrosis. American Journal of Respiratory Cell

and Molecular Biology 29, 213–224.

Evans, C.M., and Koo, J.S. (2009). Airway mucus: the good, the bad, the sticky. Pharmacol.

Ther. 121, 332–348.

Evans, M.J., and Plopper, C.G. (1988). The Role of Basal Cells in Adhesion of Columnar

Epithelium to Airway Basement Membrane1-3. Am Rev Respir Dis 138, 481–483.

190

Evans, C.M., Williams, O.W., Tuvim, M.J., Nigam, R., Mixides, G.P., Blackburn, M.R.,

DeMayo, F.J., Burns, A.R., Smith, C., Reynolds, S.D., et al. (2004). Mucin is produced by

clara cells in the proximal airways of antigen-challenged mice. Am. J. Respir. Cell Mol.

Biol. 31, 382–394.

Evans, M.J., Van Winkle, L.S., Fanucchi, M.V., and Plopper, C.G. (2001). Cellular and

molecular characteristics of basal cells in airway epithelium. Experimental Lung Research

27, 401–415.

Faner, R., Rojas, M., MacNee, W., and Agustí, A. (2012). Abnormal Lung Aging in Chronic

Obstructive Pulmonary Disease and Idiopathic Pulmonary Fibrosis. American Journal of

Respiratory and Critical Care Medicine 186, 306–313.

Fedorov, I.A., Wilson, S.J., Davies, D.E., and Holgate, S.T. (2005). Epithelial stress and

structural remodelling in childhood asthma. Thorax 60, 389–394.

Fehrenbach, H. (2001). Alveolar epithelial type II cell: defender of the alveolus revisited.

Respiratory Research 2, 33.

Fehrenbach, H., Kasper, M., Tschernig, T., Pan, T., Schuh, D., Shannon, J.M., Müller, M.,

and Mason, R.J. (1999). Keratinocyte growth factor-induced hyperplasia of rat alveolar type

II cells in vivo is resolved by differentiation into type I cells and by apoptosis. Eur. Respir. J.

14, 534–544.

Feser, J., and Tyler, J. (2011). Chromatin structure as a mediator of aging. FEBS Letters

585, 2041–2048.

Firth, A.L., Dargitz, C.T., Qualls, S.J., Menon, T., Wright, R., Singer, O., Gage, F.H.,

Khanna, A., and Verma, I.M. (2014). Generation of multiciliated cells in functional airway

epithelia from human induced pluripotent stem cells. Proceedings of the National Academy

of Sciences 111, E1723–E1730.

Fisher, J.T., Zhang, Y., and Engelhardt, J.F. (2011). Comparative biology of cystic fibrosis

animal models. Methods Mol. Biol. 742, 311–334.

Flores, I. (2005). Effects of Telomerase and Telomere Length on Epidermal Stem Cell

Behavior. Science 309, 1253–1256.

Flores, I., and Blasco, M.A. (2010). The role of telomeres and telomerase in stem cell aging.

FEBS Letters 584, 3826–3830.

Fraga, M.F., and Esteller, M. (2007). Epigenetics and aging: the targets and the marks.

Trends in Genetics 23, 413–418.

Fulcher, M.L., and Randell, S.H. (2013). Human nasal and tracheo-bronchial respiratory

epithelial cell culture. Methods Mol. Biol. 945, 109–121.

191

Fussner, E., Djuric, U., Strauss, M., Hotta, A., Perez-Iratxeta, C., Lanner, F., Dilworth, F.J.,

Ellis, J., and Bazett-Jones, D.P. (2011). Constitutive heterochromatin reorganization during

somatic cell reprogramming. EMBO J. 30, 1778–1789.

Ganesan, S., Comstock, A.T., and Sajjan, U.S. (2013). Barrier function of airway tract

epithelium. Tissue Barriers 1, e24997.

Gangl, K., Reininger, R., Bernhard, D., Campana, R., Pree, I., Reisinger, J., Kneidinger, M.,

Kundi, M., Dolznig, H., Thurnher, D., et al. (2009). Cigarette smoke facilitates allergen

penetration across respiratory epithelium. Allergy 64, 398–405.

Gems, D., and Partridge, L. (2013). Genetics of Longevity in Model Organisms: Debates

and Paradigm Shifts. Annual Review of Physiology 75, 621–644.

Ghadiri, M., Young, P.M., and Traini, D. (2016). Cell-based therapies for the treatment of

idiopathic pulmonary fibrosis (IPF) disease. Expert Opinion on Biological Therapy 16, 375–

387.

Ghaedi, M., Calle, E.A., Mendez, J.J., Gard, A.L., Balestrini, J., Booth, A., Bove, P.F., Gui,

L., White, E.S., and Niklason, L.E. (2013). Human iPS cell–derived alveolar epithelium

repopulates lung extracellular matrix. Journal of Clinical Investigation 123, 4950–4962.

Ghosh, M., Helm, K.M., Smith, R.W., Giordanengo, M.S., Li, B., Shen, H., and Reynolds,

S.D. (2011). A single cell functions as a tissue-specific stem cell and the in vitro niche-

forming cell. Am. J. Respir. Cell Mol. Biol. 45, 459–469.

Ghosh, Z., Wilson, K.D., Wu, Y., Hu, S., Quertermous, T., and Wu, J.C. (2010). Persistent

donor cell gene expression among human induced pluripotent stem cells contributes to

differences with human embryonic stem cells. PLoS ONE 5, e8975.

Giangreco, A., Arwert, E.N., Rosewell, I.R., Snyder, J., Watt, F.M., and Stripp, B.R. (2009).

Stem cells are dispensable for lung homeostasis but restore airways after injury. Proc. Natl.

Acad. Sci. U.S.A. 106, 9286–9291.

Gifford, A.M., and Chalmers, J.D. (2014). The role of neutrophils in cystic fibrosis. Curr.

Opin. Hematol. 21, 16–22.

Gohy, S.T., Hupin, C., Fregimilicka, C., Detry, B.R., Bouzin, C., Gaide Chevronay, H.,

Lecocq, M., Weynand, B., Ladjemi, M.Z., Pierreux, C.E., et al. (2015). Imprinting of the

COPD airway epithelium for dedifferentiation and mesenchymal transition. Eur. Respir. J.

45, 1258–1272.

Gohy, S.T., Hupin, C., Pilette, C., and Ladjemi, M.Z. (2016). Chronic inflammatory airway

diseases: the central role of the epithelium revisited. Clin. Exp. Allergy 46, 529–542.

González, F., Georgieva, D., Vanoli, F., Shi, Z.-D., Stadtfeld, M., Ludwig, T., Jasin, M., and

Huangfu, D. (2013). Homologous recombination DNA repair genes play a critical role in

reprogramming to a pluripotent state. Cell Rep 3, 651–660.

192

Gotoh, S., Ito, I., Nagasaki, T., Yamamoto, Y., Konishi, S., Korogi, Y., Matsumoto, H.,

Muro, S., Hirai, T., Funato, M., et al. (2014). Generation of Alveolar Epithelial Spheroids

via Isolated Progenitor Cells from Human Pluripotent Stem Cells. Stem Cell Reports 3, 394–

403.

Grant, M.R., Mostov, K.E., Tlsty, T.D., and Hunt, C.A. (2006). Simulating properties of in

vitro epithelial cell morphogenesis. PLoS Computational Biology 2, e129.

Green, D.R., Galluzzi, L., and Kroemer, G. (2011a). Mitochondria and the Autophagy-

Inflammation-Cell Death Axis in Organismal Aging. Science 333, 1109–1112.

Green, M.D., Chen, A., Nostro, M.-C., d’Souza, S.L., Schaniel, C., Lemischka, I.R., Gouon-

Evans, V., Keller, G., and Snoeck, H.-W. (2011b). Generation of anterior foregut endoderm

from human embryonic and induced pluripotent stem cells. Nat. Biotechnol. 29, 267–272.

Gregory, T.J., Longmore, W.J., Moxley, M.A., Whitsett, J.A., Reed, C.R., Fowler, A.A.,

Hudson, L.D., Maunder, R.J., Crim, C., and Hyers, T.M. (1991). Surfactant chemical

composition and biophysical activity in acute respiratory distress syndrome. J. Clin. Invest.

88, 1976–1981.

Gribbin, J., Hubbard, R.B., Le Jeune, I., Smith, C.J.P., West, J., and Tata, L.J. (2006).

Incidence and mortality of idiopathic pulmonary fibrosis and sarcoidosis in the UK. Thorax

61, 980–985.

Gumbleton, M. (2001). Caveolae as potential macromolecule trafficking compartments

within alveolar epithelium. Adv. Drug Deliv. Rev. 49, 281–300.

Guseh, J.S., Bores, S.A., Stanger, B.Z., Zhou, Q., Anderson, W.J., Melton, D.A., and

Rajagopal, J. (2009). Notch signaling promotes airway mucous metaplasia and inhibits

alveolar development. Development 136, 1751–1759.

Gustafsson, B.I., Kidd, M., Chan, A., Malfertheiner, M.V., and Modlin, I.M. (2008).

Bronchopulmonary neuroendocrine tumors. Cancer 113, 5–21.

Hackett, B.P., and Gitlin, J.D. (1992). Cell-specific expression of a Clara cell secretory

protein-human growth hormone gene in the bronchiolar epithelium of transgenic mice. Proc.

Natl. Acad. Sci. U.S.A. 89, 9079–9083.

Hackett, T.-L., Shaheen, F., Johnson, A., Wadsworth, S., Pechkovsky, D.V., Jacoby, D.B.,

Kicic, A., Stick, S.M., and Knight, D.A. (2008). Characterization of side population cells

from human airway epithelium. Stem Cells 26, 2576–2585.

Hackett, T.-L., de Bruin, H.G., Shaheen, F., van den Berge, M., van Oosterhout, A.J.,

Postma, D.S., and Heijink, I.H. (2013). Caveolin-1 controls airway epithelial barrier

function. Implications for asthma. Am. J. Respir. Cell Mol. Biol. 49, 662–671.

193

Halliwell, B., and Whiteman, M. (2004). Measuring reactive species and oxidative damage

in vivo and in cell culture: how should you do it and what do the results mean? British

Journal of Pharmacology 142, 231–255.

Han, S., and Brunet, A. (2012). Histone methylation makes its mark on longevity. Trends in

Cell Biology 22, 42–49.

Hanna, J., Markoulaki, S., Schorderet, P., Carey, B.W., Beard, C., Wernig, M., Creyghton,

M.P., Steine, E.J., Cassady, J.P., Foreman, R., et al. (2008). Direct reprogramming of

terminally differentiated mature B lymphocytes to pluripotency. Cell 133, 250–264.

Hanna, J., Saha, K., Pando, B., van Zon, J., Lengner, C.J., Creyghton, M.P., van

Oudenaarden, A., and Jaenisch, R. (2009). Direct cell reprogramming is a stochastic process

amenable to acceleration. Nature 462, 595–601.

Hansson, J., Rafiee, M.R., Reiland, S., Polo, J.M., Gehring, J., Okawa, S., Huber, W.,

Hochedlinger, K., and Krijgsveld, J. (2012). Highly Coordinated Proteome Dynamics during

Reprogramming of Somatic Cells to Pluripotency. Cell Reports 2, 1579–1592.

Hartsock, A., and Nelson, W.J. (2008). Adherens and tight junctions: structure, function and

connections to the actin cytoskeleton. Biochim. Biophys. Acta 1778, 660–669.

Hashimoto, Y., Moki, T., Takizawa, T., Shiratsuchi, A., and Nakanishi, Y. (2007). Evidence

for phagocytosis of influenza virus-infected, apoptotic cells by neutrophils and macrophages

in mice. J. Immunol. 178, 2448–2457.

Hawkins, R.D., Hon, G.C., Lee, L.K., Ngo, Q., Lister, R., Pelizzola, M., Edsall, L.E., Kuan,

S., Luu, Y., Klugman, S., et al. (2010). Distinct epigenomic landscapes of pluripotent and

lineage-committed human cells. Cell Stem Cell 6, 479–491.

Hayflick, L. (2007). Biological Aging Is No Longer an Unsolved Problem. Annals of the

New York Academy of Sciences 1100, 1–13.

Hayflick, L., and MOORHEAD, P. (1973). The Serial Cultivation of Human Diploid. Read.

Mamm. Cell Cult 25, 66.

Hecker, L., Logsdon, N.J., Kurundkar, D., Kurundkar, A., Bernard, K., Hock, T., Meldrum,

E., Sanders, Y.Y., and Thannickal, V.J. (2014). Reversal of Persistent Fibrosis in Aging by

Targeting Nox4-Nrf2 Redox Imbalance. Science Translational Medicine 6, 231ra47–

ra231ra47.

Heijink, I.H., Brandenburg, S.M., Postma, D.S., and van Oosterhout, A.J.M. (2012).

Cigarette smoke impairs airway epithelial barrier function and cell-cell contact recovery.

Eur. Respir. J. 39, 419–428.

Held, N.M., and Houtkooper, R.H. (2015). Mitochondrial quality control pathways as

determinants of metabolic health. BioEssays 37, 867–876.

194

Herold, S., Tabar, T.S., Janssen, H., Hoegner, K., Cabanski, M., Lewe-Schlosser, P.,

Albrecht, J., Driever, F., Vadasz, I., Seeger, W., et al. (2011). Exudate macrophages

attenuate lung injury by the release of IL-1 receptor antagonist in gram-negative pneumonia.

Am. J. Respir. Crit. Care Med. 183, 1380–1390.

Herold, S., Becker, C., Ridge, K.M., and Budinger, G.R.S. (2015). Influenza virus-induced

lung injury: pathogenesis and implications for treatment. Eur. Respir. J. 45, 1463–1478.

Hiemstra, P.S., McCray, P.B., and Bals, R. (2015). The innate immune function of airway

epithelial cells in inflammatory lung disease. Eur. Respir. J. 45, 1150–1162.

Hochberg, C.H., and Sidhaye, V.K. (2017). The Respiratory Epithelium in COPD. In Lung

Epithelial Biology in the Pathogenesis of Pulmonary Disease, (Elsevier), pp. 165–184.

Hockemeyer, D., Soldner, F., Cook, E.G., Gao, Q., Mitalipova, M., and Jaenisch, R. (2008).

A drug-inducible system for direct reprogramming of human somatic cells to pluripotency.

Cell Stem Cell 3, 346–353.

Hoegger, M.J., Fischer, A.J., McMenimen, J.D., Ostedgaard, L.S., Tucker, A.J., Awadalla,

M.A., Moninger, T.O., Michalski, A.S., Hoffman, E.A., Zabner, J., et al. (2014). Impaired

mucus detachment disrupts mucociliary transport in a piglet model of cystic fibrosis.

Science 345, 818–822.

Hogan, B.L.M., Barkauskas, C.E., Chapman, H.A., Epstein, J.A., Jain, R., Hsia, C.C.W.,

Niklason, L., Calle, E., Le, A., Randell, S.H., et al. (2014). Repair and Regeneration of the

Respiratory System: Complexity, Plasticity, and Mechanisms of Lung Stem Cell Function.

Cell Stem Cell 15, 123–138.

Hogg, J.C., and Timens, W. (2009). The pathology of chronic obstructive pulmonary

disease. Annu Rev Pathol 4, 435–459.

Hong, K.U. (2003). In vivo differentiation potential of tracheal basal cells: evidence for

multipotent and unipotent subpopulations. AJP: Lung Cellular and Molecular Physiology

286, 643L – 649.

Hong, H., Takahashi, K., Ichisaka, T., Aoi, T., Kanagawa, O., Nakagawa, M., Okita, K., and

Yamanaka, S. (2009). Suppression of induced pluripotent stem cell generation by the p53-

p21 pathway. Nature 460, 1132–1135.

Hong, K.U., Reynolds, S.D., Giangreco, A., Hurley, C.M., and Stripp, B.R. (2001). Clara

cell secretory protein–expressing cells of the airway neuroepithelial body microenvironment

include a label-retaining subset and are critical for epithelial renewal after progenitor cell

depletion. American Journal of Respiratory Cell and Molecular Biology 24, 671–681.

Hong, K.U., Reynolds, S.D., Watkins, S., Fuchs, E., and Stripp, B.R. (2004). Basal cells are

a multipotent progenitor capable of renewing the bronchial epithelium. The American

Journal of Pathology 164, 577–588.

195

Horowitz, J.C., Cui, Z., Moore, T.A., Meier, T.R., Reddy, R.C., Toews, G.B., Standiford,

T.J., and Thannickal, V.J. (2006). Constitutive activation of prosurvival signaling in alveolar

mesenchymal cells isolated from patients with nonresolving acute respiratory distress

syndrome. Am. J. Physiol. Lung Cell Mol. Physiol. 290, L415–L425.

Hou, P., Li, Y., Zhang, X., Liu, C., Guan, J., Li, H., Zhao, T., Ye, J., Yang, W., Liu, K., et

al. (2013). Pluripotent Stem Cells Induced from Mouse Somatic Cells by Small-Molecule

Compounds. Science 341, 651–654.

Huang, S.X.L., Islam, M.N., O’Neill, J., Hu, Z., Yang, Y.-G., Chen, Y.-W., Mumau, M.,

Green, M.D., Vunjak-Novakovic, G., Bhattacharya, J., et al. (2013). Efficient generation of

lung and airway epithelial cells from human pluripotent stem cells. Nature Biotechnology.

Huangfu, D., Maehr, R., Guo, W., Eijkelenboom, A., Snitow, M., Chen, A.E., and Melton,

D.A. (2008). Induction of pluripotent stem cells by defined factors is greatly improved by

small-molecule compounds. Nat. Biotechnol. 26, 795–797.

Hussein, S.M.I., Puri, M.C., Tonge, P.D., Benevento, M., Corso, A.J., Clancy, J.L.,

Mosbergen, R., Li, M., Lee, D.-S., Cloonan, N., et al. (2014). Genome-wide characterization

of the routes to pluripotency. Nature 516, 198–206.

Imai, Y., Parodo, J., Kajikawa, O., de Perrot, M., Fischer, S., Edwards, V., Cutz, E., Liu, M.,

Keshavjee, S., Martin, T.R., et al. (2003). Injurious mechanical ventilation and end-organ

epithelial cell apoptosis and organ dysfunction in an experimental model of acute respiratory

distress syndrome. JAMA 289, 2104–2112.

Ingenito, E.P., Mora, R., Cullivan, M., Marzan, Y., Haley, K., Mark, L., and Sonna, L.A.

(2001). Decreased surfactant protein-B expression and surfactant dysfunction in a murine

model of acute lung injury. Am. J. Respir. Cell Mol. Biol. 25, 35–44.

Issa, J.-P. (2014). Aging and epigenetic drift: a vicious cycle. Journal of Clinical

Investigation 124, 24–29.

Ito, T., Udaka, N., Yazawa, T., Okudela, K., Hayashi, H., Sudo, T., Guillemot, F.,

Kageyama, R., and Kitamura, H. (2000). Basic helix-loop-helix transcription factors regulate

the neuroendocrine differentiation of fetal mouse pulmonary epithelium. Development 127,

3913–3921.

Ito, T., Udaka, N., Okudela, K., Yazawa, T., and Kitamura, H. (2003). Mechanisms of

neuroendocrine differentiation in pulmonary neuroendocrine cells and small cell carcinoma.

Endocrine Pathology 14, 133–139.

Jain, R., Barkauskas, C.E., Takeda, N., Bowie, E.J., Aghajanian, H., Wang, Q.,

Padmanabhan, A., Manderfield, L.J., Gupta, M., Li, D., et al. (2015). Plasticity of Hopx+

type I alveolar cells to regenerate type II cells in the lung. Nature Communications 6, 6727.

196

Jaskelioff, M., Muller, F.L., Paik, J.-H., Thomas, E., Jiang, S., Adams, A.C., Sahin, E., Kost-

Alimova, M., Protopopov, A., Cadiñanos, J., et al. (2011). Telomerase reactivation reverses

tissue degeneration in aged telomerase-deficient mice. Nature 469, 102–106.

Jeffery, P.K. (1983). Morphologic features of airway surface epithelial cells and glands. Am.

Rev. Respir. Dis. 128, S14–S20.

Jia, F., Wilson, K.D., Sun, N., Gupta, D.M., Huang, M., Li, Z., Panetta, N.J., Chen, Z.Y.,

Robbins, R.C., Kay, M.A., et al. (2010). A nonviral minicircle vector for deriving human

iPS cells. Nat. Methods 7, 197–199.

Jones, J.G., Minty, B.D., Lawler, P., Hulands, G., Crawley, J.C., and Veall, N. (1980).

Increased alveolar epithelial permeability in cigarette smokers. Lancet 1, 66–68.

José, R.J., Williams, A.E., Mercer, P.F., Sulikowski, M.G., Brown, J.S., and Chambers, R.C.

(2015). Regulation of neutrophilic inflammation by proteinase-activated receptor 1 during

bacterial pulmonary infection. J. Immunol. 194, 6024–6034.

Jung, M., and Pfeifer, G.P. (2015). Aging and DNA methylation. BMC Biology 13, 7.

Kalluri, R., and Weinberg, R.A. (2009). The basics of epithelial-mesenchymal transition. J.

Clin. Invest. 119, 1420–1428.

Kastenberg, Z.J., and Odorico, J.S. (2008). Alternative sources of pluripotency: science,

ethics, and stem cells. Transplant Rev (Orlando) 22, 215–222.

Kim, C.F.B., Jackson, E.L., Woolfenden, A.E., Lawrence, S., Babar, I., Vogel, S., Crowley,

D., Bronson, R.T., and Jacks, T. (2005). Identification of Bronchioalveolar Stem Cells in

Normal Lung and Lung Cancer. Cell 121, 823–835.

Kim, D., Kim, C.-H., Moon, J.-I., Chung, Y.-G., Chang, M.-Y., Han, B.-S., Ko, S., Yang, E.,

Cha, K.Y., Lanza, R., et al. (2009). Generation of human induced pluripotent stem cells by

direct delivery of reprogramming proteins. Cell Stem Cell 4, 472–476.

Kim, J., Efe, J.A., Zhu, S., Talantova, M., Yuan, X., Wang, S., Lipton, S.A., Zhang, K., and

Ding, S. (2011). Direct reprogramming of mouse fibroblasts to neural progenitors. Proc.

Natl. Acad. Sci. U.S.A. 108, 7838–7843.

Kim, J.B., Zaehres, H., Wu, G., Gentile, L., Ko, K., Sebastiano, V., Araúzo-Bravo, M.J.,

Ruau, D., Han, D.W., Zenke, M., et al. (2008). Pluripotent stem cells induced from adult

neural stem cells by reprogramming with two factors. Nature 454, 646–650.

Kim, K., Doi, A., Wen, B., Ng, K., Zhao, R., Cahan, P., Kim, J., Aryee, M.J., Ji, H., Ehrlich,

L.I.R., et al. (2010). Epigenetic memory in induced pluripotent stem cells. Nature 467, 285–

290.

197

Kim, S., Ahn, S.E., Lee, J.H., Lim, D.-S., Kim, K.-S., Chung, H.-M., and Lee, S.-H. (2007).

A novel culture technique for human embryonic stem cells using porous membranes. Stem

Cells 25, 2601–2609.

Kimbrel, E.A., and Lanza, R. (2015). Current status of pluripotent stem cells: moving the

first therapies to the clinic. Nature Reviews Drug Discovery 14, 681–692.

King, T.E., Pardo, A., and Selman, M. (2011). Idiopathic pulmonary fibrosis. The Lancet

378, 1949–1961.

King, T.E., Bradford, W.Z., Castro-Bernardini, S., Fagan, E.A., Glaspole, I., Glassberg,

M.K., Gorina, E., Hopkins, P.M., Kardatzke, D., Lancaster, L., et al. (2014). A Phase 3 Trial

of Pirfenidone in Patients with Idiopathic Pulmonary Fibrosis. New England Journal of

Medicine 370, 2083–2092.

Kirkwood, T.B.L. (2005). Understanding the Odd Science of Aging. Cell 120, 437–447.

Kirkwood, T.B.L., and Shanley, D.P. (2010). The connections between general and

reproductive senescence and the evolutionary basis of menopause: Kirkwood &amp;

Shanley. Annals of the New York Academy of Sciences 1204, 21–29.

Knight, D.A., and Holgate, S.T. (2003). The airway epithelium: structural and functional

properties in health and disease. Respirology 8, 432–446.

Knowles, M.R., Stutts, M.J., Spock, A., Fischer, N., Gatzy, J.T., and Boucher, R.C. (1983).

Abnormal ion permeation through cystic fibrosis respiratory epithelium. Science 221, 1067–

1070.

Koche, R.P., Smith, Z.D., Adli, M., Gu, H., Ku, M., Gnirke, A., Bernstein, B.E., and

Meissner, A. (2011). Reprogramming factor expression initiates widespread targeted

chromatin remodeling. Cell Stem Cell 8, 96–105.

Koga, H., Kaushik, S., and Cuervo, A.M. (2011). Protein homeostasis and aging: The

importance of exquisite quality control. Ageing Research Reviews 10, 205–215.

Koma, T., Yoshimatsu, K., Nagata, N., Sato, Y., Shimizu, K., Yasuda, S.P., Amada, T.,

Nishio, S., Hasegawa, H., and Arikawa, J. (2014). Neutrophil depletion suppresses

pulmonary vascular hyperpermeability and occurrence of pulmonary edema caused by

hantavirus infection in C.B-17 SCID mice. J. Virol. 88, 7178–7188.

Kosmider, B., Messier, E.M., Chu, H.W., and Mason, R.J. (2011). Human Alveolar

Epithelial Cell Injury Induced by Cigarette Smoke. PLoS ONE 6, e26059.

Kotton, D.N., and Morrisey, E.E. (2014). Lung regeneration: mechanisms, applications and

emerging stem cell populations. Nat. Med. 20, 822–832.

198

Kotton, D.N., Fabian, A.J., and Mulligan, R.C. (2005). Failure of bone marrow to

reconstitute lung epithelium. American Journal of Respiratory Cell and Molecular Biology

33, 328–334.

Kroegel, C., Bergmann, N., Heider, C., Moeser, A., Happe, J., Schlenker, Y., Bartuschka,

B., Henzgen, M., Walther, R., Reissig, A., et al. (2009). [Interferon-alpha as treatment

option in severe persistent uncontrolled bronchial asthma: an open label study].

Pneumologie 63, 307–313.

Kumamoto, M., Nishiwaki, T., Matsuo, N., Kimura, H., and Matsushima, K. (2009).

Minimally cultured bone marrow mesenchymal stem cells ameliorate fibrotic lung injury.

European Respiratory Journal 34, 740–748.

Kumar, P.A., Hu, Y., Yamamoto, Y., Hoe, N.B., Wei, T.S., Mu, D., Sun, Y., Joo, L.S.,

Dagher, R., Zielonka, E.M., et al. (2011). Distal Airway Stem Cells Yield Alveoli In Vitro

and during Lung Regeneration following H1N1 Influenza Infection. Cell 147, 525–538.

Lam, H.C., Cloonan, S.M., Bhashyam, A.R., Haspel, J.A., Singh, A., Sathirapongsasuti, J.F.,

Cervo, M., Yao, H., Chung, A.L., Mizumura, K., et al. (2013). Histone deacetylase 6-

mediated selective autophagy regulates COPD-associated cilia dysfunction. J. Clin. Invest.

123, 5212–5230.

Lama, V., Moore, B.B., Christensen, P., Toews, G.B., and Peters-Golden, M. (2002).

Prostaglandin E2 synthesis and suppression of fibroblast proliferation by alveolar epithelial

cells is cyclooxygenase-2-dependent. Am. J. Respir. Cell Mol. Biol. 27, 752–758.

de Lange, T. (2009). How telomeres solve the end-protection problem. Science 326, 948–

952.

Lapasset, L., Milhavet, O., Prieur, A., Besnard, E., Babled, A., Ait-Hamou, N., Leschik, J.,

Pellestor, F., Ramirez, J.-M., De Vos, J., et al. (2011). Rejuvenating senescent and

centenarian human cells by reprogramming through the pluripotent state. Genes &

Development 25, 2248–2253.

Lauweryns, J.M., Van Lommel, A.T., and Dom, R.J. (1985). Innervation of rabbit

intrapulmonary neuroepithelial bodies. Quantitative and qualitative ultrastructural study

after vagotomy. J. Neurol. Sci. 67, 81–92.

Lavelle, G.M., White, M.M., Browne, N., McElvaney, N.G., and Reeves, E.P. (2016).

Animal Models of Cystic Fibrosis Pathology: Phenotypic Parallels and Divergences.

Biomed Res Int 2016, 5258727.

Lawson, W.E., Cheng, D.-S., Degryse, A.L., Tanjore, H., Polosukhin, V.V., Xu, X.C.,

Newcomb, D.C., Jones, B.R., Roldan, J., Lane, K.B., et al. (2011). Endoplasmic reticulum

stress enhances fibrotic remodeling in the lungs. Proc. Natl. Acad. Sci. U.S.A. 108, 10562–

10567.

199

Lee, C., Mitsialis, S.A., Aslam, M., Vitali, S.H., Vergadi, E., Konstantinou, G., Sdrimas, K.,

Fernandez-Gonzalez, A., and Kourembanas, S. (2012). Exosomes Mediate the

Cytoprotective Action of Mesenchymal Stromal Cells on Hypoxia-Induced Pulmonary

Hypertension. Circulation 126, 2601–2611.

Lee, J.-H., Bhang, D.H., Beede, A., Huang, T.L., Stripp, B.R., Bloch, K.D., Wagers, A.J.,

Tseng, Y.-H., Ryeom, S., and Kim, C.F. (2014). Lung Stem Cell Differentiation in Mice

Directed by Endothelial Cells via a BMP4-NFATc1-Thrombospondin-1 Axis. Cell 156,

440–455.

Lee, J.-H., Bhang, D.H., Beede, A., Huang, T.L., Stripp, B.R., Bloch, K.D., Wagers, A.J.,

Tseng, Y.-H., Ryeom, S., and Kim, C.F. (2014c). Lung Stem Cell Differentiation in Mice

Directed by Endothelial Cells via a BMP4-NFATc1-Thrombospondin-1 Axis. Cell 156,

440–455.

Leeman, K.T., Fillmore, C.M., and Kim, C.F. (2014). Lung stem and progenitor cells in

tissue homeostasis and disease. Curr. Top. Dev. Biol. 107, 207–233.

Leonardo, T.R., Schultheisz, H.L., Loring, J.F., and Laurent, L.C. (2012). The functions of

microRNAs in pluripotency and reprogramming. Nature Cell Biology 14, 1114–1121.

Lerou, P.H., Yabuuchi, A., Huo, H., Miller, J.D., Boyer, L.F., Schlaeger, T.M., and Daley,

G.Q. (2008). Derivation and maintenance of human embryonic stem cells from poor-quality

in vitro fertilization embryos. Nat Protoc 3, 923–933.

Levenberg, S., Huang, N.F., Lavik, E., Rogers, A.B., Itskovitz-Eldor, J., and Langer, R.

(2003). Differentiation of human embryonic stem cells on three-dimensional polymer

scaffolds. Proc. Natl. Acad. Sci. U.S.A. 100, 12741–12746.

Li, R., Liang, J., Ni, S., Zhou, T., Qing, X., Li, H., He, W., Chen, J., Li, F., Zhuang, Q., et al.

(2010). A mesenchymal-to-epithelial transition initiates and is required for the nuclear

reprogramming of mouse fibroblasts. Cell Stem Cell 7, 51–63.

Liang, J., Zhang, Y., Xie, T., Liu, N., Chen, H., Geng, Y., Kurkciyan, A., Mena, J.M.,

Stripp, B.R., Jiang, D., et al. (2016). Hyaluronan and TLR4 promote surfactant-protein-C-

positive alveolar progenitor cell renewal and prevent severe pulmonary fibrosis in mice.

Nature Medicine 22, 1285–1293.

Liao, B., Bao, X., Liu, L., Feng, S., Zovoilis, A., Liu, W., Xue, Y., Cai, J., Guo, X., Qin, B.,

et al. (2011). MicroRNA cluster 302-367 enhances somatic cell reprogramming by

accelerating a mesenchymal-to-epithelial transition. J. Biol. Chem. 286, 17359–17364.

Liebler, J.M., Marconett, C.N., Juul, N., Wang, H., Liu, Y., Flodby, P., Laird-Offringa, I.A.,

Minoo, P., and Zhou, B. (2016). Combinations of differentiation markers distinguish

subpopulations of alveolar epithelial cells in adult lung. American Journal of Physiology -

Lung Cellular and Molecular Physiology 310, L114–L120.

200

Lin, C.Y., Lovén, J., Rahl, P.B., Paranal, R.M., Burge, C.B., Bradner, J.E., Lee, T.I., and

Young, R.A. (2012). Transcriptional amplification in tumor cells with elevated c-Myc. Cell

151, 56–67.

Lin, K.L., Sweeney, S., Kang, B.D., Ramsburg, E., and Gunn, M.D. (2011). CCR2-

antagonist prophylaxis reduces pulmonary immune pathology and markedly improves

survival during influenza infection. J. Immunol. 186, 508–515.

Lister, R., Pelizzola, M., Kida, Y.S., Hawkins, R.D., Nery, J.R., Hon, G., Antosiewicz-

Bourget, J., O’Malley, R., Castanon, R., Klugman, S., et al. (2011). Hotspots of aberrant

epigenomic reprogramming in human induced pluripotent stem cells. Nature 471, 68–73.

Liu, L., and Rando, T.A. (2011). Manifestations and mechanisms of stem cell aging. The

Journal of Cell Biology 193, 257–266.

Liu, G., Cheresh, P., and Kamp, D.W. (2013). Molecular Basis of Asbestos-Induced Lung

Disease. Annual Review of Pathology: Mechanisms of Disease 8, 161–187.

Liu, G.-H., Barkho, B.Z., Ruiz, S., Diep, D., Qu, J., Yang, S.-L., Panopoulos, A.D., Suzuki,

K., Kurian, L., Walsh, C., et al. (2011a). Recapitulation of premature ageing with iPSCs

from Hutchinson–Gilford progeria syndrome. Nature 472, 221–225.

Liu, L., van Groen, T., Kadish, I., Li, Y., Wang, D., James, S.R., Karpf, A.R., and

Tollefsbol, T.O. (2011b). Insufficient DNA methylation affects healthy aging and promotes

age-related health problems. Clinical Epigenetics 2, 349–360.

Liu, X., Ory, V., Chapman, S., Yuan, H., Albanese, C., Kallakury, B., Timofeeva, O.A.,

Nealon, C., Dakic, A., Simic, V., et al. (2012). ROCK Inhibitor and Feeder Cells Induce the

Conditional Reprogramming of Epithelial Cells. The American Journal of Pathology 180,

599–607.

Liu, Y., Kumar, V.S., Zhang, W., Rehman, J., and Malik, A.B. (2015). Activation of type II

cells into regenerative stem cell antigen-1(+) cells during alveolar repair. Am. J. Respir. Cell

Mol. Biol. 53, 113–124.

Loewer, S., Cabili, M.N., Guttman, M., Loh, Y.-H., Thomas, K., Park, I.H., Garber, M.,

Curran, M., Onder, T., Agarwal, S., et al. (2010). Large intergenic non-coding RNA-RoR

modulates reprogramming of human induced pluripotent stem cells. Nat. Genet. 42, 1113–

1117.

Lok, S.S., Haider, Y., Howell, D., Stewart, J.P., Hasleton, P.S., and Egan, J.J. (2002).

Murine gammaherpes virus as a cofactor in the development of pulmonary fibrosis in

bleomycin resistant mice. Eur. Respir. J. 20, 1228–1232.

Lomas, N.J., Watts, K.L., Akram, K.M., Forsyth, N.R., and Spiteri, M.A. (2012). Idiopathic

pulmonary fibrosis: immunohistochemical analysis provides fresh insights into lung tissue

remodelling with implications for novel prognostic markers. Int J Clin Exp Pathol 5, 58–71.

201

Longmire, T.A., Ikonomou, L., Hawkins, F., Christodoulou, C., Cao, Y., Jean, J.C., Kwok,

L.W., Mou, H., Rajagopal, J., Shen, S.S., et al. (2012). Efficient derivation of purified lung

and thyroid progenitors from embryonic stem cells. Cell Stem Cell 10, 398–411.

López-Otín, C., Blasco, M.A., Partridge, L., Serrano, M., and Kroemer, G. (2013). The

Hallmarks of Aging. Cell 153, 1194–1217.

Love, D., Li, F.-Q., Burke, M.C., Cyge, B., Ohmitsu, M., Cabello, J., Larson, J.E., Brody,

S.L., Cohen, J.C., and Takemaru, K.-I. (2010). Altered Lung Morphogenesis, Epithelial Cell

Differentiation and Mechanics in Mice Deficient in the Wnt/β-Catenin Antagonist Chibby.

PLoS ONE 5, e13600.

Luger, K., Mäder, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997). core

particle at 2.8 A resolution. Nature 389, 18.

Lujan, E., Zunder, E.R., Ng, Y.H., Goronzy, I.N., Nolan, G.P., and Wernig, M. (2015). Early

reprogramming regulators identified by prospective isolation and mass cytometry. Nature

521, 352–356.

Lumsden, A.B., McLean, A., and Lamb, D. (1984). Goblet and Clara cells of human distal

airways: evidence for smoking induced changes in their numbers. Thorax 39, 844–849.

Maherali, N., Sridharan, R., Xie, W., Utikal, J., Eminli, S., Arnold, K., Stadtfeld, M.,

Yachechko, R., Tchieu, J., Jaenisch, R., et al. (2007). Directly reprogrammed fibroblasts

show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell 1,

55–70.

Maherali, N., Ahfeldt, T., Rigamonti, A., Utikal, J., Cowan, C., and Hochedlinger, K.

(2008). A high-efficiency system for the generation and study of human induced pluripotent

stem cells. Cell Stem Cell 3, 340–345.

Marchetto, M.C.N., Yeo, G.W., Kainohana, O., Marsala, M., Gage, F.H., and Muotri, A.R.

(2009). Transcriptional signature and memory retention of human-induced pluripotent stem

cells. PLoS ONE 4, e7076.

Marión, R.M., and Blasco, M.A. (2010). Telomere rejuvenation during nuclear

reprogramming. Current Opinion in Genetics & Development 20, 190–196.

Marion, R.M., Strati, K., Li, H., Tejera, A., Schoeftner, S., Ortega, S., Serrano, M., and

Blasco, M.A. (2009). Telomeres Acquire Embryonic Stem Cell Characteristics in Induced

Pluripotent Stem Cells. Cell Stem Cell 4, 141–154.

Marsh, L.M., Cakarova, L., Kwapiszewska, G., von Wulffen, W., Herold, S., Seeger, W.,

and Lohmeyer, J. (2009). Surface expression of CD74 by type II alveolar epithelial cells: a

potential mechanism for macrophage migration inhibitory factor-induced epithelial repair.

AJP: Lung Cellular and Molecular Physiology 296, L442–L452.

202

Marshall, R.P., Bellingan, G., Webb, S., Puddicombe, A., Goldsack, N., McAnulty, R.J., and

Laurent, G.J. (2000). Fibroproliferation occurs early in the acute respiratory distress

syndrome and impacts on outcome. Am. J. Respir. Crit. Care Med. 162, 1783–1788.

Marson, A., Levine, S.S., Cole, M.F., Frampton, G.M., Brambrink, T., Johnstone, S.,

Guenther, M.G., Johnston, W.K., Wernig, M., Newman, J., et al. (2008). Connecting

microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells.

Cell 134, 521–533.

Martin-Belmonte, F., Yu, W., Rodr?guez-Fraticelli, A.E., Ewald, A., Werb, Z., Alonso,

M.A., and Mostov, K. (2008). Cell-Polarity Dynamics Controls the Mechanism of Lumen

Formation in Epithelial Morphogenesis. Current Biology 18, 507–513.

Masui, S., Nakatake, Y., Toyooka, Y., Shimosato, D., Yagi, R., Takahashi, K., Okochi, H.,

Okuda, A., Matoba, R., Sharov, A.A., et al. (2007). Pluripotency governed by Sox2 via

regulation of Oct3/4 expression in mouse embryonic stem cells. Nat. Cell Biol. 9, 625–635.

Matthay, M.A., Ware, L.B., and Zimmerman, G.A. (2012). The acute respiratory distress

syndrome. J. Clin. Invest. 122, 2731–2740.

McQualter, J.L., Yuen, K., Williams, B., and Bertoncello, I. (2010). Evidence of an

epithelial stem/progenitor cell hierarchy in the adult mouse lung. Proceedings of the

National Academy of Sciences 107, 1414–1419.

Meiners, S., Eickelberg, O., and Königshoff, M. (2015). Hallmarks of the ageing lung.

European Respiratory Journal 45, 807–827.

Mercer, R.R., Russell, M.L., Roggli, V.L., and Crapo, J.D. (1994). Cell number and

distribution in human and rat airways. Am. J. Respir. Cell Mol. Biol. 10, 613–624.

Metzger, R.J., Klein, O.D., Martin, G.R., and Krasnow, M.A. (2008). The branching

programme of mouse lung development. Nature 453, 745–750.

Mihai, C., Bao, S., Lai, J.-P., Ghadiali, S.N., and Knoell, D.L. (2012). PTEN inhibition

improves wound healing in lung epithelia through changes in cellular mechanics that

enhance migration. Am. J. Physiol. Lung Cell Mol. Physiol. 302, L287–L299.

Mikkelsen, T.S., Hanna, J., Zhang, X., Ku, M., Wernig, M., Schorderet, P., Bernstein, B.E.,

Jaenisch, R., Lander, E.S., and Meissner, A. (2008). Dissecting direct reprogramming

through integrative genomic analysis. Nature 454, 49–55.

Milara, J., Peiró, T., Serrano, A., and Cortijo, J. (2013). Epithelial to mesenchymal transition

is increased in patients with COPD and induced by cigarette smoke. Thorax 68, 410–420.

Miller, B.E., and Hook, G.E. (1990). Hypertrophy and hyperplasia of alveolar type II cells in

response to silica and other pulmonary toxicants. Environ. Health Perspect. 85, 15–23.

203

Miyoshi, K., Yanagi, S., Kawahara, K., Nishio, M., Tsubouchi, H., Imazu, Y., Koshida, R.,

Matsumoto, N., Taguchi, A., Yamashita, S., et al. (2013). Epithelial Pten controls acute lung

injury and fibrosis by regulating alveolar epithelial cell integrity. Am. J. Respir. Crit. Care

Med. 187, 262–275.

Molenda, N., Urbanova, K., Weiser, N., Kusche-Vihrog, K., Günzel, D., and Schillers, H.

(2014). Paracellular transport through healthy and cystic fibrosis bronchial epithelial cell

lines--do we have a proper model? PLoS ONE 9, e100621.

Molina, S.A., Stauffer, B., Moriarty, H.K., Kim, A.H., McCarty, N.A., and Koval, M.

(2015). Junctional abnormalities in human airway epithelial cells expressing F508del CFTR.

Am. J. Physiol. Lung Cell Mol. Physiol. 309, L475–L487.

Molofsky, A.V., Slutsky, S.G., Joseph, N.M., He, S., Pardal, R., Krishnamurthy, J.,

Sharpless, N.E., and Morrison, S.J. (2006). Increasing p16INK4a expression decreases

forebrain progenitors and neurogenesis during ageing. Nature 443, 448–452.

Montgomery, M.K., and Turner, N. (2014). Mitochondrial dysfunction and insulin

resistance: an update. Endocrine Connections 4, R1–R15.

Moodley, Y., Atienza, D., Manuelpillai, U., Samuel, C.S., Tchongue, J., Ilancheran, S.,

Boyd, R., and Trounson, A. (2009). Human Umbilical Cord Mesenchymal Stem Cells

Reduce Fibrosis of Bleomycin-Induced Lung Injury. The American Journal of Pathology

175, 303–313.

Mori, M., Mahoney, J.E., Stupnikov, M.R., Paez-Cortez, J.R., Szymaniak, A.D., Varelas, X.,

Herrick, D.B., Schwob, J., Zhang, H., and Cardoso, W.V. (2015). Notch3-Jagged signaling

controls the pool of undifferentiated airway progenitors. Development 142, 258–267.

Moss, M., Bucher, B., Moore, F.A., Moore, E.E., and Parsons, P.E. (1996). The role of

chronic alcohol abuse in the development of acute respiratory distress syndrome in adults.

JAMA 275, 50–54.

Mossman, B.T., Lippmann, M., Hesterberg, T.W., Kelsey, K.T., Barchowsky, A., and

Bonner, J.C. (2011). Pulmonary Endpoints (Lung Carcinomas and Asbestosis) Following

Inhalation Exposure to Asbestos. Journal of Toxicology and Environmental Health, Part B

14, 76–121.

Mou, H., Zhao, R., Sherwood, R., Ahfeldt, T., Lapey, A., Wain, J., Sicilian, L., Izvolsky, K.,

Lau, F.H., Musunuru, K., et al. (2012). Generation of Multipotent Lung and Airway

Progenitors from Mouse ESCs and Patient-Specific Cystic Fibrosis iPSCs. Cell Stem Cell

10, 385–397.

Mutze, K., Vierkotten, S., Milosevic, J., Eickelberg, O., and Königshoff, M. (2015). Enolase

1 (ENO1) and protein disulfide-isomerase associated 3 (PDIA3) regulate Wnt/β-catenin-

driven trans-differentiation of murine alveolar epithelial cells. Dis Model Mech 8, 877–890.

204

Nagy, A., and Nagy, K. (2010). The mysteries of induced pluripotency: where will they

lead? Nat. Methods 7, 22–24.

Nagy, A., Gócza, E., Diaz, E.M., Prideaux, V.R., Iványi, E., Markkula, M., and Rossant, J.

(1990). Embryonic stem cells alone are able to support fetal development in the mouse.

Development 110, 815–821.

Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W., and Roder, J.C. (1993). Derivation

of completely cell culture-derived mice from early-passage embryonic stem cells.

Proceedings of the National Academy of Sciences 90, 8424–8428.

Nakagawa, M., Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T., Okita, K.,

Mochiduki, Y., Takizawa, N., and Yamanaka, S. (2008). Generation of induced pluripotent

stem cells without Myc from mouse and human fibroblasts. Nat. Biotechnol. 26, 101–106.

Nakajima, Y., Kawanami, O., Jin, E., Ghazizadeh, M., Honda, M., Asano, G., Horiba, K.,

and Ferrans, V.J. (1998). Immunohistochemical and ultrastructural studies of basal cells,

Clara cells and bronchiolar cuboidal cells in normal human airways. Pathology International

48, 944–953.

Nakamura, T., Sato, E., Fujiwara, N., Kawagoe, Y., Maeda, S., and Yamagishi, S. (2011).

Increased levels of soluble receptor for advanced glycation end products (sRAGE) and high

mobility group box 1 (HMGB1) are associated with death in patients with acute respiratory

distress syndrome. Clin. Biochem. 44, 601–604.

Narasaraju, T.A., Chen, H., Weng, T., Bhaskaran, M., Jin, N., Chen, J., Chen, Z., Chinoy,

M.R., and Liu, L. (2006). Expression profile of IGF system during lung injury and recovery

in rats exposed to hyperoxia: a possible role of IGF-1 in alveolar epithelial cell proliferation

and differentiation. J. Cell. Biochem. 97, 984–998.

National Heart, Lung, and Blood Institute Acute Respiratory Distress Syndrome (ARDS)

Clinical Trials Network, Wiedemann, H.P., Wheeler, A.P., Bernard, G.R., Thompson, B.T.,

Hayden, D., deBoisblanc, B., Connors, A.F., Hite, R.D., and Harabin, A.L. (2006).

Comparison of two fluid-management strategies in acute lung injury. N. Engl. J. Med. 354,

2564–2575.

Navarro, S., and Driscoll, B. (2017). Regeneration of the Aging Lung: A Mini-Review.

Gerontology 63, 270–280.

Noble, P.W., Barkauskas, C.E., and Jiang, D. (2012). Pulmonary fibrosis: patterns and

perpetrators. Journal of Clinical Investigation 122, 2756–2762.

Nunnari, J., and Suomalainen, A. (2012). Mitochondria: In Sickness and in Health. Cell 148,

1145–1159.

Ocampo, A., Reddy, P., and Belmonte, J.C.I. (2016a). Anti-Aging Strategies Based on

Cellular Reprogramming. Trends in Molecular Medicine 22, 725–738.

205

Ocampo, A., Reddy, P., Martinez-Redondo, P., Platero-Luengo, A., Hatanaka, F., Hishida,

T., Li, M., Lam, D., Kurita, M., Beyret, E., et al. (2016b). In Vivo Amelioration of Age-

Associated Hallmarks by Partial Reprogramming. Cell 167, 1719–1733.e12.

Odorico, J.S., Kaufman, D.S., and Thomson, J.A. (2001). Multilineage differentiation from

human embryonic stem cell lines. Stem Cells 19, 193–204.

Ohta, H., Chiba, S., Ebina, M., Furuse, M., and Nukiwa, T. (2012). Altered expression of

tight junction molecules in alveolar septa in lung injury and fibrosis. Am. J. Physiol. Lung

Cell Mol. Physiol. 302, L193–L205.

Okita, K., Nakagawa, M., Hyenjong, H., Ichisaka, T., and Yamanaka, S. (2008). Generation

of mouse induced pluripotent stem cells without viral vectors. Science 322, 949–953.

Okubo, T. (2005). Nmyc plays an essential role during lung development as a dosage-

sensitive regulator of progenitor cell proliferation and differentiation. Development 132,

1363–1374.

Olivera, W., Ridge, K., Wood, L.D., and Sznajder, J.I. (1994). Active sodium transport and

alveolar epithelial Na-K-ATPase increase during subacute hyperoxia in rats. Am. J. Physiol.

266, L577–L584.

Olsen, C.O., Isakson, B.E., Seedorf, G.J., Lubman, R.L., and Boitano, S. (2005).

Extracellular matrix-driven alveolar epithelial cell differentiation in vitro. Exp. Lung Res.

31, 461–482.

Olson, A.L., Swigris, J.J., Lezotte, D.C., Norris, J.M., Wilson, C.G., and Brown, K.K.

(2007). Mortality from Pulmonary Fibrosis Increased in the United States from 1992 to

2003. American Journal of Respiratory and Critical Care Medicine 176, 277–284.

Ordoñez, C.L., Khashayar, R., Wong, H.H., Ferrando, R., Wu, R., Hyde, D.M., Hotchkiss,

J.A., Zhang, Y., Novikov, A., Dolganov, G., et al. (2001). Mild and moderate asthma is

associated with airway goblet cell hyperplasia and abnormalities in mucin gene expression.

Am. J. Respir. Crit. Care Med. 163, 517–523.

Ortiz, L.A., Gambelli, F., McBride, C., Gaupp, D., Baddoo, M., Kaminski, N., and Phinney,

D.G. (2003). Mesenchymal stem cell engraftment in lung is enhanced in response to

bleomycin exposure and ameliorates its fibrotic effects. Proceedings of the National

Academy of Sciences 100, 8407–8411.

O’Sullivan, R.J., and Karlseder, J. (2012). The great unravelling: chromatin as a modulator

of the aging process. Trends in Biochemical Sciences 37, 466–476.

Pal, S., and Tyler, J.K. (2016). Epigenetics and aging. Science Advances 2, e1600584–

e1600584.

206

Pardo, A., Gibson, K., Cisneros, J., Richards, T.J., Yang, Y., Becerril, C., Yousem, S.,

Herrera, I., Ruiz, V., Selman, M., et al. (2005). Up-regulation and profibrotic role of

osteopontin in human idiopathic pulmonary fibrosis. PLoS Med. 2, e251.

Pardo-Saganta, A., Law, B.M., Gonzalez-Celeiro, M., Vinarsky, V., and Rajagopal, J.

(2013). Ciliated cells of pseudostratified airway epithelium do not become mucous cells

after ovalbumin challenge. American Journal of Respiratory Cell and Molecular Biology 48,

364–373.

Pardo-Saganta, A., Law, B.M., Tata, P.R., Villoria, J., Saez, B., Mou, H., Zhao, R., and

Rajagopal, J. (2015). Injury induces direct lineage segregation of functionally distinct airway

basal stem/progenitor cell subpopulations. Cell Stem Cell 16, 184–197.

Pereira, C.F., Piccolo, F.M., Tsubouchi, T., Sauer, S., Ryan, N.K., Bruno, L., Landeira, D.,

Santos, J., Banito, A., Gil, J., et al. (2010). ESCs require PRC2 to direct the successful

reprogramming of differentiated cells toward pluripotency. Cell Stem Cell 6, 547–556.

Perl, A.-K.T., Kist, R., Shan, Z., Scherer, G., and Whitsett, J.A. (2005). Normal lung

development and function after Sox9 inactivation in the respiratory epithelium. Genesis 41,

23–32.

Petecchia, L., Sabatini, F., Varesio, L., Camoirano, A., Usai, C., Pezzolo, A., and Rossi,

G.A. (2009). Bronchial airway epithelial cell damage following exposure to cigarette smoke

includes disassembly of tight junction components mediated by the extracellular signal-

regulated kinase 1/2 pathway. Chest 135, 1502–1512.

Peterson, M.W., Walter, M.E., and Nygaard, S.D. (1995). Effect of neutrophil mediators on

epithelial permeability. Am. J. Respir. Cell Mol. Biol. 13, 719–727.

Petkova, D.K., Clelland, C.A., Ronan, J.E., Lewis, S., and Knox, A.J. (2003). Reduced

expression of cyclooxygenase (COX) in idiopathic pulmonary fibrosis and sarcoidosis.

Histopathology 43, 381–386.

Pfisterer, U., Kirkeby, A., Torper, O., Wood, J., Nelander, J., Dufour, A., Björklund, A.,

Lindvall, O., Jakobsson, J., and Parmar, M. (2011a). Direct conversion of human fibroblasts

to dopaminergic neurons. Proc. Natl. Acad. Sci. U.S.A. 108, 10343–10348.

Pfisterer, U., Kirkeby, A., Torper, O., Wood, J., Nelander, J., Dufour, A., Björklund, A.,

Lindvall, O., Jakobsson, J., and Parmar, M. (2011b). Direct conversion of human fibroblasts

to dopaminergic neurons. Proc. Natl. Acad. Sci. U.S.A. 108, 10343–10348.

Plath, K., and Lowry, W.E. (2011). Progress in understanding reprogramming to the induced

pluripotent state. Nat. Rev. Genet. 12, 253–265.

Pollina, E.A., and Brunet, A. (2011). Epigenetic regulation of aging stem cells. Oncogene

30, 3105–3126.

207

Polo, J.M., Liu, S., Figueroa, M.E., Kulalert, W., Eminli, S., Tan, K.Y., Apostolou, E.,

Stadtfeld, M., Li, Y., Shioda, T., et al. (2010). Cell type of origin influences the molecular

and functional properties of mouse induced pluripotent stem cells. Nat. Biotechnol. 28, 848–

855.

Polo, J.M., Anderssen, E., Walsh, R.M., Schwarz, B.A., Nefzger, C.M., Lim, S.M., Borkent,

M., Apostolou, E., Alaei, S., Cloutier, J., et al. (2012). A molecular roadmap of

reprogramming somatic cells into iPS cells. Cell 151, 1617–1632.

Powers, E.T., Morimoto, R.I., Dillin, A., Kelly, J.W., and Balch, W.E. (2009). Biological

and Chemical Approaches to Diseases of Proteostasis Deficiency. Annual Review of

Biochemistry 78, 959–991.

Prigione, A., Hossini, A.M., Lichtner, B., Serin, A., Fauler, B., Megges, M., Lurz, R.,

Lehrach, H., Makrantonaki, E., Zouboulis, C.C., et al. (2011). Mitochondrial-Associated

Cell Death Mechanisms Are Reset to an Embryonic-Like State in Aged Donor-Derived iPS

Cells Harboring Chromosomal Aberrations. PLoS ONE 6, e27352.

Puchelle, E., Zahm, J.-M., Tournier, J.-M., and Coraux, C. (2006). Airway epithelial repair,

regeneration, and remodeling after injury in chronic obstructive pulmonary disease.

Proceedings of the American Thoracic Society 3, 726–733.

Puddicombe, S.M., Torres-Lozano, C., Richter, A., Bucchieri, F., Lordan, J.L., Howarth,

P.H., Vrugt, B., Albers, R., Djukanovic, R., Holgate, S.T., et al. (2003). Increased

expression of p21(waf) cyclin-dependent kinase inhibitor in asthmatic bronchial epithelium.

Am. J. Respir. Cell Mol. Biol. 28, 61–68.

Que, J., Luo, X., Schwartz, R.J., and Hogan, B.L.M. (2009). Multiple roles for Sox2 in the

developing and adult mouse trachea. Development 136, 1899–1907.

Quinton, P.M. (1983). Chloride impermeability in cystic fibrosis. Nature 301, 421–422.

Raddatz, G., Hagemann, S., Aran, D., Söhle, J., Kulkarni, P.P., Kaderali, L., Hellman, A.,

Winnefeld, M., and Lyko, F. (2013). Aging is associated with highly defined epigenetic

changes in the human epidermis. Epigenetics & Chromatin 6, 36.

Raghu, G., Weycker, D., Edelsberg, J., Bradford, W.Z., and Oster, G. (2006). Incidence and

prevalence of idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 174, 810–816.

Rahl, P.B., Lin, C.Y., Seila, A.C., Flynn, R.A., McCuine, S., Burge, C.B., Sharp, P.A., and

Young, R.A. (2010). c-Myc regulates transcriptional pause release. Cell 141, 432–445.

Rai, P., Parrish, M., Tay, I.J.J., Li, N., Ackerman, S., He, F., Kwang, J., Chow, V.T., and

Engelward, B.P. (2015). Streptococcus pneumoniae secretes hydrogen peroxide leading to

DNA damage and apoptosis in lung cells. Proc. Natl. Acad. Sci. U.S.A. 112, E3421–E3430.

Raiser, D.M., and Kim, C.F. (2009). Commentary: Sca-1 and Cells of the Lung: A matter of

Different Sorts. Stem Cells 27, 606–611.

208

Randell, S.H. (2006). Airway Epithelial Stem Cells and the Pathophysiology of Chronic

Obstructive Pulmonary Disease. Proceedings of the American Thoracic Society 3, 718–725.

Rando, T.A. (2006). Stem cells, ageing and the quest for immortality. Nature 441, 1080–

1086.

Rando, O.J., and Chang, H.Y. (2009). Genome-Wide Views of Chromatin Structure. Annual

Review of Biochemistry 78, 245–271.

Rando, T.A., and Chang, H.Y. (2012). Aging, Rejuvenation, and Epigenetic

Reprogramming: Resetting the Aging Clock. Cell 148, 46–57.

Rao, R. (2008). Oxidative stress-induced disruption of epithelial and endothelial tight

junctions. Front. Biosci. 13, 7210–7226.

Rawlins, E.L., and Hogan, B.L.M. (2006). Epithelial stem cells of the lung: privileged few

or opportunities for many? Development 133, 2455–2465.

Rawlins, E.L., Okubo, T., Xue, Y., Brass, D.M., Auten, R.L., Hasegawa, H., Wang, F., and

Hogan, B.L.M. (2009). The role of Scgb1a1+ Clara cells in the long-term maintenance and

repair of lung airway, but not alveolar, epithelium. Cell Stem Cell 4, 525–534.

Reinert, T., Baldotto, C.S. da R., Nunes, F.A.P., and Scheliga, A.A. de S. (2013).

Bleomycin-Induced Lung Injury. Journal of Cancer Research 2013, 1–9.

Rera, M., Clark, R.I., and Walker, D.W. (2012). Intestinal barrier dysfunction links

metabolic and inflammatory markers of aging to death in Drosophila. Proceedings of the

National Academy of Sciences 109, 21528–21533.

Reynolds, S.D., and Malkinson, A.M. (2010). Clara cell: Progenitor for the bronchiolar

epithelium. The International Journal of Biochemistry & Cell Biology 42, 1–4.

Reynolds, S.D., Hong, K.U., Giangreco, A., Mango, G.W., Guron, C., Morimoto, Y., and

Stripp, B.R. (2000a). Conditional clara cell ablation reveals a self-renewing progenitor

function of pulmonary neuroendocrine cells. American Journal of Physiology-Lung Cellular

and Molecular Physiology 278, L1256–L1263.

Reynolds, S.D., Giangreco, A., Power, J.H., and Stripp, B.R. (2000b). Neuroepithelial

bodies of pulmonary airways serve as a reservoir of progenitor cells capable of epithelial

regeneration. The American Journal of Pathology 156, 269–278.

Reynolds, S.D., Reynolds, P.R., Pryhuber, G.S., Finder, J.D., and Stripp, B.R. (2002).

Secretoglobins SCGB3A1 and SCGB3A2 Define Secretory Cell Subsets in Mouse and

Human Airways. American Journal of Respiratory and Critical Care Medicine 166, 1498–

1509.

Reynolds, S.D., Rios, C., Wesolowska-Andersen, A., Zhuang, Y., Pinter, M., Happoldt, C.,

Hill, C.L., Lallier, S.W., Cosgrove, G.P., Solomon, G.M., et al. (2016). Airway Progenitor

209

Clone Formation Is Enhanced by Y-27632-Dependent Changes in the Transcriptome. Am. J.

Respir. Cell Mol. Biol. 55, 323–336.

Richeldi, L., du Bois, R.M., Raghu, G., Azuma, A., Brown, K.K., Costabel, U., Cottin, V.,

Flaherty, K.R., Hansell, D.M., Inoue, Y., et al. (2014). Efficacy and Safety of Nintedanib in

Idiopathic Pulmonary Fibrosis. New England Journal of Medicine 370, 2071–2082.

Rieger, M.E., Zhou, B., Solomon, N., Sunohara, M., Li, C., Nguyen, C., Liu, Y., Pan, J.,

Minoo, P., Crandall, E.D., et al. (2016). p300/β-Catenin Interactions Regulate Adult

Progenitor Cell Differentiation Downstream of WNT5a/Protein Kinase C (PKC). J. Biol.

Chem. 291, 6569–6582.

Rock, J.R., and Hogan, B.L.M. (2011). Epithelial Progenitor Cells in Lung Development,

Maintenance, Repair, and Disease. Annual Review of Cell and Developmental Biology 27,

493–512.

Rock, J.R., Onaitis, M.W., Rawlins, E.L., Lu, Y., Clark, C.P., Xue, Y., Randell, S.H., and

Hogan, B.L.M. (2009). Basal cells as stem cells of the mouse trachea and human airway

epithelium. Proc. Natl. Acad. Sci. U.S.A. 106, 12771–12775.

Rock, J.R., Randell, S.H., and Hogan, B.L.M. (2010). Airway basal stem cells: a perspective

on their roles in epithelial homeostasis and remodeling. Disease Models & Mechanisms 3,

545–556.

Rogers, D.F. (2005). The role of airway secretions in COPD: pathophysiology,

epidemiology and pharmacotherapeutic options. COPD 2, 341–353.

Rogers, C.S., Stoltz, D.A., Meyerholz, D.K., Ostedgaard, L.S., Rokhlina, T., Taft, P.J.,

Rogan, M.P., Pezzulo, A.A., Karp, P.H., Itani, O.A., et al. (2008). Disruption of the CFTR

gene produces a model of cystic fibrosis in newborn pigs. Science 321, 1837–1841.

Rohlfs, E.M., Zhou, Z., Heim, R.A., Nagan, N., Rosenblum, L.S., Flynn, K., Scholl, T.,

Akmaev, V.R., Sirko-Osadsa, D.A., Allitto, B.A., et al. (2011). Cystic fibrosis carrier testing

in an ethnically diverse US population. Clin. Chem. 57, 841–848.

Rojas, M., Levine, M., and Alvarez, D. (2015). Regenerative medicine in the treatment of

idiopathic pulmonary fibrosis: current position. Stem Cells and Cloning: Advances and

Applications 61.

Rose, M.C., and Voynow, J.A. (2006). Respiratory tract mucin genes and mucin

glycoproteins in health and disease. Physiol. Rev. 86, 245–278.

Rubins, J.B., and Janoff, E.N. (1998). Pneumolysin: a multifunctional pneumococcal

virulence factor. J. Lab. Clin. Med. 131, 21–27.

Ruiz, S., Panopoulos, A.D., Herrerías, A., Bissig, K.-D., Lutz, M., Berggren, W.T., Verma,

I.M., and Izpisua Belmonte, J.C. (2011). A high proliferation rate is required for cell

210

reprogramming and maintenance of human embryonic stem cell identity. Curr. Biol. 21, 45–

52.

Sahin, E., Colla, S., Liesa, M., Moslehi, J., Müller, F.L., Guo, M., Cooper, M., Kotton, D.,

Fabian, A.J., Walkey, C., et al. (2011). Telomere dysfunction induces metabolic and

mitochondrial compromise. Nature 470, 359–365.

Samavarchi-Tehrani, P., Golipour, A., David, L., Sung, H., Beyer, T.A., Datti, A., Woltjen,

K., Nagy, A., and Wrana, J.L. (2010). Functional Genomics Reveals a BMP-Driven

Mesenchymal-to-Epithelial Transition in the Initiation of Somatic Cell Reprogramming. Cell

Stem Cell 7, 64–77.

Sancho-Martinez, I., and Izpisua Belmonte, J.C. (2013). Stem cells: Surf the waves of

reprogramming. Nature 493, 310–311.

Sancho-Martinez, I., Baek, S.H., and Belmonte, J.C.I. (2012). Lineage conversion

methodologies meet the reprogramming toolbox. Nature Cell Biology 14, 892–899.

Scholte, B.J., Davidson, D.J., Wilke, M., and De Jonge, H.R. (2004). Animal models of

cystic fibrosis. J. Cyst. Fibros. 3 Suppl 2, 183–190.

Schumacker, P.T., Gillespie, M.N., Nakahira, K., Choi, A.M.K., Crouser, E.D., Piantadosi,

C.A., and Bhattacharya, J. (2014). Mitochondria in lung biology and pathology: more than

just a powerhouse. AJP: Lung Cellular and Molecular Physiology 306, L962–L974.

Schwartz, R.E., Fleming, H.E., Khetani, S.R., and Bhatia, S.N. (2014). Pluripotent stem cell-

derived hepatocyte-like cells. Biotechnology Advances 32, 504–513.

Schwiebert, E.M., Benos, D.J., Egan, M.E., Stutts, M.J., and Guggino, W.B. (1999). CFTR

is a conductance regulator as well as a chloride channel. Physiol. Rev. 79, S145–S166.

Selman, M., and Pardo, A. (2003). The epithelial/fibroblastic pathway in the pathogenesis of

idiopathic pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 29, S93–S97.

Selman, M., and Pardo, A. (2014). Revealing the Pathogenic and Aging-related Mechanisms

of the Enigmatic Idiopathic Pulmonary Fibrosis. An Integral Model. American Journal of

Respiratory and Critical Care Medicine 189, 1161–1172.

Serrano-Mollar, A., Nacher, M., Gay-Jordi, G., Closa, D., Xaubet, A., and Bulbena, O.

(2007). Intratracheal Transplantation of Alveolar Type II Cells Reverses Bleomycin-induced

Lung Fibrosis. American Journal of Respiratory and Critical Care Medicine 176, 1261–

1268.

Serrano-Mollar, A., Gay-Jordi, G., Guillamat-Prats, R., Closa, D., Hernandez-Gonzalez, F.,

Marin, P., Burgos, F., Martorell, J., Sánchez, M., Arguis, P., et al. (2016). Safety and

tolerability of alveolar type II cell transplantation in idiopathic pulmonary fibrosis. CHEST

Journal 150, 533–543.

211

Shah, V.S., Meyerholz, D.K., Tang, X.X., Reznikov, L., Abou Alaiwa, M., Ernst, S.E.,

Karp, P.H., Wohlford-Lenane, C.L., Heilmann, K.P., Leidinger, M.R., et al. (2016). Airway

acidification initiates host defense abnormalities in cystic fibrosis mice. Science 351, 503–

507.

Shakiba, N., White, C.A., Lipsitz, Y.Y., Yachie-Kinoshita, A., Tonge, P.D., Hussein, S.M.I.,

Puri, M.C., Elbaz, J., Morrissey-Scoot, J., Li, M., et al. (2015). CD24 tracks divergent

pluripotent states in mouse and human cells. Nature Communications 6, 7329.

Shan, L., Aster, J.C., Sklar, J., and Sunday, M.E. (2006). Notch-1 regulates pulmonary

neuroendocrine cell differentiation in cell lines and in transgenic mice. AJP: Lung Cellular

and Molecular Physiology 292, L500–L509.

Sharpless, N.E., and DePinho, R.A. (2007). How stem cells age and why this makes us grow

old. Nature Reviews Molecular Cell Biology 8, 703–713.

Shaykhiev, R., Zuo, W.-L., Chao, I., Fukui, T., Witover, B., Brekman, A., and Crystal, R.G.

(2013). EGF shifts human airway basal cell fate toward a smoking-associated airway

epithelial phenotype. Proc. Natl. Acad. Sci. U.S.A. 110, 12102–12107.

Shi, Y., Desponts, C., Do, J.T., Hahm, H.S., Schöler, H.R., and Ding, S. (2008). Induction of

pluripotent stem cells from mouse embryonic fibroblasts by Oct4 and Klf4 with small-

molecule compounds. Cell Stem Cell 3, 568–574.

Shi, Y., Inoue, H., Wu, J.C., and Yamanaka, S. (2016). Induced pluripotent stem cell

technology: a decade of progress. Nature Reviews Drug Discovery 16, 115–130.

Shipony, Z., Mukamel, Z., Cohen, N.M., Landan, G., Chomsky, E., Zeliger, S.R., Fried,

Y.C., Ainbinder, E., Friedman, N., and Tanay, A. (2014). Dynamic and static maintenance

of epigenetic memory in pluripotent and somatic cells. Nature 513, 115–119.

Silva, J., Barrandon, O., Nichols, J., Kawaguchi, J., Theunissen, T.W., and Smith, A. (2008).

Promotion of reprogramming to ground state pluripotency by signal inhibition. PLoS Biol.

6, e253.

Silva, J., Nichols, J., Theunissen, T.W., Guo, G., van Oosten, A.L., Barrandon, O., Wray, J.,

Yamanaka, S., Chambers, I., and Smith, A. (2009). Nanog is the gateway to the pluripotent

ground state. Cell 138, 722–737.

Singovski, G., Bernal, C., Kuciak, M., Siegl-Cachedenier, I., Conod, A., and Ruiz i Altaba,

A. (2016). In vivo epigenetic reprogramming of primary human colon cancer cells enhances

metastases. Journal of Molecular Cell Biology 8, 157–173.

Sinha, A., Nightingale, J., West, K.P., Berlanga-Acosta, J., and Playford, R.J. (2003).

Epidermal growth factor enemas with oral mesalamine for mild-to-moderate left-sided

ulcerative colitis or proctitis. N. Engl. J. Med. 349, 350–357.

212

Slutsky, A.S., and Ranieri, V.M. (2013). Ventilator-induced lung injury. N. Engl. J. Med.

369, 2126–2136.

Smith, A. (2006). A glossary for stem-cell biology. Nature 441, 1060–1060.

Smith, Z.D., Nachman, I., Regev, A., and Meissner, A. (2010). Dynamic single-cell imaging

of direct reprogramming reveals an early specifying event. Nat. Biotechnol. 28, 521–526.

Sohal, S.S., Reid, D., Soltani, A., Ward, C., Weston, S., Muller, H.K., Wood-Baker, R., and

Walters, E.H. (2010). Reticular basement membrane fragmentation and potential epithelial

mesenchymal transition is exaggerated in the airways of smokers with chronic obstructive

pulmonary disease. Respirology 15, 930–938.

Sokocevic, D., Bonenfant, N.R., Wagner, D.E., Borg, Z.D., Lathrop, M.J., Lam, Y.W.,

Deng, B., DeSarno, M.J., Ashikaga, T., Loi, R., et al. (2013). The effect of age and

emphysematous and fibrotic injury on the re-cellularization of de-cellularized lungs.

Biomaterials 34, 3256–3269.

Soldner, F., Hockemeyer, D., Beard, C., Gao, Q., Bell, G.W., Cook, E.G., Hargus, G., Blak,

A., Cooper, O., Mitalipova, M., et al. (2009). Parkinson’s disease patient-derived induced

pluripotent stem cells free of viral reprogramming factors. Cell 136, 964–977.

Song, H., Yao, E., Lin, C., Gacayan, R., Chen, M.-H., and Chuang, P.-T. (2012). Functional

characterization of pulmonary neuroendocrine cells in lung development, injury, and

tumorigenesis. Proc. Natl. Acad. Sci. U.S.A. 109, 17531–17536.

Sousa-Victor, P., Gutarra, S., García-Prat, L., Rodriguez-Ubreva, J., Ortet, L., Ruiz-Bonilla,

V., Jardí, M., Ballestar, E., González, S., Serrano, A.L., et al. (2014). Geriatric muscle stem

cells switch reversible quiescence into senescence. Nature 506, 316–321.

Spina, D. (1998). Epithelium smooth muscle regulation and interactions. American Journal

of Respiratory and Critical Care Medicine 158, S141–S145.

Spragg, R.G., Bernard, G.R., Checkley, W., Curtis, J.R., Gajic, O., Guyatt, G., Hall, J.,

Israel, E., Jain, M., Needham, D.M., et al. (2010). Beyond mortality: future clinical research

in acute lung injury. Am. J. Respir. Crit. Care Med. 181, 1121–1127.

Sridharan, R., Tchieu, J., Mason, M.J., Yachechko, R., Kuoy, E., Horvath, S., Zhou, Q., and

Plath, K. (2009). Role of the murine reprogramming factors in the induction of pluripotency.

Cell 136, 364–377.

Stadtfeld, M., Brennand, K., and Hochedlinger, K. (2008a). Reprogramming of pancreatic

beta cells into induced pluripotent stem cells. Curr. Biol. 18, 890–894.

Stadtfeld, M., Nagaya, M., Utikal, J., Weir, G., and Hochedlinger, K. (2008b). Induced

pluripotent stem cells generated without viral integration. Science 322, 945–949.

213

Stadtfeld, M., Maherali, N., Breault, D.T., and Hochedlinger, K. (2008c). Defining

molecular cornerstones during fibroblast to iPS cell reprogramming in mouse. Cell Stem

Cell 2, 230–240.

Stadtfeld, M., Apostolou, E., Akutsu, H., Fukuda, A., Follett, P., Natesan, S., Kono, T.,

Shioda, T., and Hochedlinger, K. (2010). Aberrant silencing of imprinted genes on

chromosome 12qF1 in mouse induced pluripotent stem cells. Nature 465, 175–181.

Stripp, B.R., Maxson, K., Mera, R., and Singh, G. (1995). Plasticity of airway cell

proliferation and gene expression after acute naphthalene injury. Am. J. Physiol. 269, L791–

L799.

Suhr, S.T., Chang, E.A., Tjong, J., Alcasid, N., Perkins, G.A., Goissis, M.D., Ellisman,

M.H., Perez, G.I., and Cibelli, J.B. (2010). Mitochondrial Rejuvenation After Induced

Pluripotency. PLoS ONE 5, e14095.

Suprynowicz, F.A., Upadhyay, G., Krawczyk, E., Kramer, S.C., Hebert, J.D., Liu, X., Yuan,

H., Cheluvaraju, C., Clapp, P.W., Boucher, R.C., et al. (2012). Conditionally reprogrammed

cells represent a stem-like state of adult epithelial cells. Proceedings of the National

Academy of Sciences 109, 20035–20040.

Sweerus, K., Lachowicz-Scroggins, M., Gordon, E., LaFemina, M., Huang, X., Parikh, M.,

Kanegai, C., Fahy, J.V., and Frank, J.A. (2017). Claudin-18 deficiency is associated with

airway epithelial barrier dysfunction and asthma. J. Allergy Clin. Immunol. 139, 72–81.e1.

Swindle, E.J., Collins, J.E., and Davies, D.E. (2009). Breakdown in epithelial barrier

function in patients with asthma: identification of novel therapeutic approaches. J. Allergy

Clin. Immunol. 124, 23–34; quiz 35–36.

Taggart, C., Coakley, R.J., Greally, P., Canny, G., O’Neill, S.J., and McElvaney, N.G.

(2000). Increased elastase release by CF neutrophils is mediated by tumor necrosis factor-

alpha and interleukin-8. Am. J. Physiol. Lung Cell Mol. Physiol. 278, L33–L41.

Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse

embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676.

Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and

Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by

defined factors. Cell 131, 861–872.

Talens, R.P., Christensen, K., Putter, H., Willemsen, G., Christiansen, L., Kremer, D.,

Suchiman, H.E.D., Slagboom, P.E., Boomsma, D.I., and Heijmans, B.T. (2012). Epigenetic

variation during the adult lifespan: cross-sectional and longitudinal data on monozygotic

twin pairs: Talens_Increasing epigenetic variation. Aging Cell 11, 694–703.

Tang, Y.-W., Johnson, J.E., Browning, P.J., Cruz-Gervis, R.A., Davis, A., Graham, B.S.,

Brigham, K.L., Oates, J.A., Loyd, J.E., and Stecenko, A.A. (2003). Herpesvirus DNA is

214

consistently detected in lungs of patients with idiopathic pulmonary fibrosis. J. Clin.

Microbiol. 41, 2633–2640.

Tapia, N., and Schöler, H.R. (2016). Molecular Obstacles to Clinical Translation of iPSCs.

Cell Stem Cell 19, 298–309.

Tashiro, J., Elliot, S.J., Gerth, D.J., Xia, X., Pereira-Simon, S., Choi, R., Catanuto, P.,

Shahzeidi, S., Toonkel, R.L., Shah, R.H., et al. (2015). Therapeutic benefits of young, but

not old, adipose-derived mesenchymal stem cells in a chronic mouse model of bleomycin-

induced pulmonary fibrosis. Translational Research 166, 554–567.

Tata, P.R., Mou, H., Pardo-Saganta, A., Zhao, R., Prabhu, M., Law, B.M., Vinarsky, V.,

Cho, J.L., Breton, S., Sahay, A., et al. (2013). Dedifferentiation of committed epithelial cells

into stem cells in vivo. Nature 503, 218–223.

Taylor, P.R., Bonfield, T.L., Chmiel, J.F., and Pearlman, E. (2016). Neutrophils from

F508del cystic fibrosis patients produce IL-17A and express IL-23 - dependent IL-17RC.

Clin. Immunol. 170, 53–60.

Teisanu, R.M., Chen, H., Matsumoto, K., McQualter, J.L., Potts, E., Foster, W.M.,

Bertoncello, I., and Stripp, B.R. (2011). Functional Analysis of Two Distinct Bronchiolar

Progenitors during Lung Injury and Repair. American Journal of Respiratory Cell and

Molecular Biology 44, 794–803.

Thannickal, V.J. (2013). Mechanistic links between aging and lung fibrosis. Biogerontology

14, 609–615.

Theunissen, T.W., van Oosten, A.L., Castelo-Branco, G., Hall, J., Smith, A., and Silva,

J.C.R. (2011). Nanog overcomes reprogramming barriers and induces pluripotency in

minimal conditions. Curr. Biol. 21, 65–71.

Thompson, A.B., Robbins, R.A., Romberger, D.J., Sisson, J.H., Spurzem, J.R., Teschler, H.,

and Rennard, S.I. (1995). Immunological functions of the pulmonary epithelium. European

Respiratory Journal 8, 127–149.

Tomás-Loba, A., Flores, I., Fernández-Marcos, P.J., Cayuela, M.L., Maraver, A., Tejera, A.,

Borrás, C., Matheu, A., Klatt, P., Flores, J.M., et al. (2008). Telomerase Reverse

Transcriptase Delays Aging in Cancer-Resistant Mice. Cell 135, 609–622.

Tonge, P.D., Corso, A.J., Monetti, C., Hussein, S.M.I., Puri, M.C., Michael, I.P., Li, M.,

Lee, D.-S., Mar, J.C., Cloonan, N., et al. (2014). Divergent reprogramming routes lead to

alternative stem-cell states. Nature 516, 192–197.

Toonkel, R.L., Hare, J.M., Matthay, M.A., and Glassberg, M.K. (2013). Mesenchymal Stem

Cells and Idiopathic Pulmonary Fibrosis. Potential for Clinical Testing. American Journal of

Respiratory and Critical Care Medicine 188, 133–140.

215

Treutlein, B., Brownfield, D.G., Wu, A.R., Neff, N.F., Mantalas, G.L., Espinoza, F.H.,

Desai, T.J., Krasnow, M.A., and Quake, S.R. (2014). Reconstructing lineage hierarchies of

the distal lung epithelium using single-cell RNA-seq. Nature 509, 371–375.

Treutlein, B., Lee, Q.Y., Camp, J.G., Mall, M., Koh, W., Shariati, S.A.M., Sim, S., Neff,

N.F., Skotheim, J.M., Wernig, M., et al. (2016). Dissecting direct reprogramming from

fibroblast to neuron using single-cell RNA-seq. Nature 534, 391–395.

Tsakiri, K.D., Cronkhite, J.T., Kuan, P.J., Xing, C., Raghu, G., Weissler, J.C., Rosenblatt,

R.L., Shay, J.W., and Garcia, C.K. (2007). Adult-onset pulmonary fibrosis caused by

mutations in telomerase. Proceedings of the National Academy of Sciences 104, 7552–7557.

Tsao, P.-N., Vasconcelos, M., Izvolsky, K.I., Qian, J., Lu, J., and Cardoso, W.V. (2009).

Notch signaling controls the balance of ciliated and secretory cell fates in developing

airways. Development 136, 2297–2307.

Tsuji, T., Aoshiba, K., and Nagai, A. (2006). Alveolar Cell Senescence in Patients with

Pulmonary Emphysema. American Journal of Respiratory and Critical Care Medicine 174,

886–893.

Twigg, M.S., Brockbank, S., Lowry, P., FitzGerald, S.P., Taggart, C., and Weldon, S.

(2015). The Role of Serine Proteases and Antiproteases in the Cystic Fibrosis Lung.

Mediators Inflamm. 2015, 293053.

Uhal, B.D., and Nguyen, H. (2013). The Witschi Hypothesis revisited after 35 years: genetic

proof from SP-C BRICHOS domain mutations. AJP: Lung Cellular and Molecular

Physiology 305, L906–L911.

Utikal, J., Polo, J.M., Stadtfeld, M., Maherali, N., Kulalert, W., Walsh, R.M., Khalil, A.,

Rheinwald, J.G., and Hochedlinger, K. (2009). Immortalization eliminates a roadblock

during cellular reprogramming into iPS cells. Nature 460, 1145–1148.

Van Haute, L., De Block, G., Liebaers, I., Sermon, K., and De Rycke, M. (2009). Generation

of lung epithelial-like tissue from human embryonic stem cells. Respir. Res. 10, 105.

Van Houten, B., Woshner, V., and Santos, J.H. (2006). Role of mitochondrial DNA in toxic

responses to oxidative stress. DNA Repair 5, 145–152.

Van Lommel, A. (2001). Pulmonary neuroendocrine cells (PNEC) and neuroepithelial

bodies (NEB): chemoreceptors and regulators of lung development. Paediatr Respir Rev 2,

171–176.

Van Lommel, A., Lauweryns, J.M., and Berthoud, H.R. (1998). Pulmonary neuroepithelial

bodies are innervated by vagal afferent nerves: an investigation with in vivo anterograde DiI

tracing and confocal microscopy. Anatomy and Embryology 197, 325–330.

216

Vaughan, A.E., Brumwell, A.N., Xi, Y., Gotts, J.E., Brownfield, D.G., Treutlein, B., Tan,

K., Tan, V., Liu, F.C., Looney, M.R., et al. (2014). Lineage-negative progenitors mobilize to

regenerate lung epithelium after major injury. Nature 517, 621–625.

Vermulst, M., Wanagat, J., Kujoth, G.C., Bielas, J.H., Rabinovitch, P.S., Prolla, T.A., and

Loeb, L.A. (2008). DNA deletions and clonal mutations drive premature aging in

mitochondrial mutator mice. Nature Genetics 40, 392–394.

Vijg, J., and Campisi, J. (2008). Puzzles, promises and a cure for ageing. Nature 454, 1065–

1071.

Voltz, J.W., Card, J.W., Carey, M.A., DeGraff, L.M., Ferguson, C.D., Flake, G.P., Bonner,

J.C., Korach, K.S., and Zeldin, D.C. (2008). Male Sex Hormones Exacerbate Lung Function

Impairment after Bleomycin-Induced Pulmonary Fibrosis. American Journal of Respiratory

Cell and Molecular Biology 39, 45–52.

Waghray, M., Cui, Z., Horowitz, J.C., Subramanian, I.M., Martinez, F.J., Toews, G.B., and

Thannickal, V.J. (2005). Hydrogen peroxide is a diffusible paracrine signal for the induction

of epithelial cell death by activated myofibroblasts. FASEB J. 19, 854–856.

Wallace, D.C. (2013). A mitochondrial bioenergetic etiology of disease. Journal of Clinical

Investigation 123, 1405–1412.

Wang, J., Edeen, K., Manzer, R., Chang, Y., Wang, S., Chen, X., Funk, C.J., Cosgrove,

G.P., Fang, X., and Mason, R.J. (2007). Differentiated Human Alveolar Epithelial Cells and

Reversibility of their Phenotype In Vitro. American Journal of Respiratory Cell and

Molecular Biology 36, 661–668.

Wang, Y., Minshall, R.D., Schwartz, D.E., and Hu, G. (2011). Cyclic stretch induces

alveolar epithelial barrier dysfunction via calpain-mediated degradation of p120-catenin.

Am. J. Physiol. Lung Cell Mol. Physiol. 301, L197–L206.

Wang, Y., Wang, G.Z., Rabinovitch, P.S., and Tabas, I. (2014). Macrophage mitochondrial

oxidative stress promotes atherosclerosis and nuclear factor-κB–mediated inflammation in

macrophages. Circulation Research 114, 421–433.

Wang, Z., Zang, C., Rosenfeld, J.A., Schones, D.E., Barski, A., Cuddapah, S., Cui, K., Roh,

T.-Y., Peng, W., Zhang, M.Q., et al. (2008). Combinatorial patterns of histone acetylations

and methylations in the human genome. Nature Genetics 40, 897–903.

Wang, Z., Oron, E., Nelson, B., Razis, S., and Ivanova, N. (2012). Distinct lineage

specification roles for NANOG, OCT4, and SOX2 in human embryonic stem cells. Cell

Stem Cell 10, 440–454.

Wansleeben, C., Barkauskas, C.E., Rock, J.R., and Hogan, B.L.M. (2013). Stem cells of the

adult lung: their development and role in homeostasis, regeneration, and disease. Wiley

Interdiscip Rev Dev Biol 2, 131–148.

217

Wansleeben, C., Bowie, E., Hotten, D.F., Yu, Y.-R.A., and Hogan, B.L.M. (2014). Age-

Related Changes in the Cellular Composition and Epithelial Organization of the Mouse

Trachea. PLoS ONE 9, e93496.

Ware, L.B., and Matthay, M.A. (2001). Alveolar fluid clearance is impaired in the majority

of patients with acute lung injury and the acute respiratory distress syndrome. Am. J. Respir.

Crit. Care Med. 163, 1376–1383.

Watanabe, K., Ueno, M., Kamiya, D., Nishiyama, A., Matsumura, M., Wataya, T.,

Takahashi, J.B., Nishikawa, S., Nishikawa, S., Muguruma, K., et al. (2007). A ROCK

inhibitor permits survival of dissociated human embryonic stem cells. Nat. Biotechnol. 25,

681–686.

Waters, C.M., and Savla, U. (1999). Keratinocyte growth factor accelerates wound closure

in airway epithelium during cyclic mechanical strain. J. Cell. Physiol. 181, 424–432.

Watson, J.K., Rulands, S., Wilkinson, A.C., Wuidart, A., Ousset, M., Van Keymeulen, A.,

Göttgens, B., Blanpain, C., Simons, B.D., and Rawlins, E.L. (2015). Clonal Dynamics

Reveal Two Distinct Populations of Basal Cells in Slow-Turnover Airway Epithelium. Cell

Rep 12, 90–101.

Weidner, C.I., and Wagner, W. (2014). The epigenetic tracks of aging. Biological Chemistry

395.

Weidner, C.I., Lin, Q., Koch, C.M., Eisele, L., Beier, F., Ziegler, P., Bauerschlag, D.O.,

Jöckel, K.-H., Erbel, R., Mühleisen, T.W., et al. (2014). Aging of blood can be tracked by

DNA methylation changes at just three CpG sites. Genome Biology 15, R24.

Weiss, D.J. (2014). Concise Review: Current Status of Stem Cells and Regenerative

Medicine in Lung Biology and Diseases: Advances in Lung Regenerative Medicine. STEM

CELLS 32, 16–25.

Weiss, D.J., and Ortiz, L.A. (2013). Cell therapy trials for lung diseases: progress and

cautions. American Journal of Respiratory and Critical Care Medicine 188, 123–125.

Weiss, C.H., Budinger, G.R.S., Mutlu, G.M., and Jain, M. (2010). Proteasomal Regulation

of Pulmonary Fibrosis. Proceedings of the American Thoracic Society 7, 77–83.

Welsh, M.J., and Liedtke, C.M. (1986). Chloride and potassium channels in cystic fibrosis

airway epithelia. Nature 322, 467–470.

Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K.,

Bernstein, B.E., and Jaenisch, R. (2007). In vitro reprogramming of fibroblasts into a

pluripotent ES-cell-like state. Nature 448, 318–324.

Wernig, M., Lengner, C.J., Hanna, J., Lodato, M.A., Steine, E., Foreman, R., Staerk, J.,

Markoulaki, S., and Jaenisch, R. (2008). A drug-inducible transgenic system for direct

reprogramming of multiple somatic cell types. Nat. Biotechnol. 26, 916–924.

218

Whitsett, J.A., and Alenghat, T. (2014). Respiratory epithelial cells orchestrate pulmonary

innate immunity. Nature Immunology 16, 27–35.

Whitsett, J.A., and Alenghat, T. (2015). Respiratory epithelial cells orchestrate pulmonary

innate immunity. Nat. Immunol. 16, 27–35.

Whitsett, J.A., Wert, S.E., and Weaver, T.E. (2010). Alveolar Surfactant Homeostasis and

the Pathogenesis of Pulmonary Disease. Annual Review of Medicine 61, 105–119.

Wiener-Kronish, J.P., Albertine, K.H., and Matthay, M.A. (1991). Differential responses of

the endothelial and epithelial barriers of the lung in sheep to Escherichia coli endotoxin. J.

Clin. Invest. 88, 864–875.

Williams, O.W., Sharafkhaneh, A., Kim, V., Dickey, B.F., and Evans, C.M. (2006). Airway

mucus: From production to secretion. Am. J. Respir. Cell Mol. Biol. 34, 527–536.

Woltjen, K., Michael, I.P., Mohseni, P., Desai, R., Mileikovsky, M., Hämäläinen, R.,

Cowling, R., Wang, W., Liu, P., Gertsenstein, M., et al. (2009). piggyBac transposition

reprograms fibroblasts to induced pluripotent stem cells. Nature 458, 766–770.

Wong, A.P., Bear, C.E., Chin, S., Pasceri, P., Thompson, T.O., Huan, L.-J., Ratjen, F., Ellis,

J., and Rossant, J. (2012). Directed differentiation of human pluripotent stem cells into

mature airway epithelia expressing functional CFTR protein. Nat. Biotechnol. 30, 876–882.

Wood, S.J., Goldufsky, J.W., Bello, D., Masood, S., and Shafikhani, S.H. (2015).

Pseudomonas aeruginosa ExoT Induces Mitochondrial Apoptosis in Target Host Cells in a

Manner That Depends on Its GTPase-activating Protein (GAP) Domain Activity. J. Biol.

Chem. 290, 29063–29073.

Xiao, C., Puddicombe, S.M., Field, S., Haywood, J., Broughton-Head, V., Puxeddu, I.,

Haitchi, H.M., Vernon-Wilson, E., Sammut, D., Bedke, N., et al. (2011). Defective epithelial

barrier function in asthma. J. Allergy Clin. Immunol. 128, 549–556.e1–e12.

Xiao, H., Li, D.X., and Liu, M. (2012). Knowledge translation: airway epithelial cell

migration and respiratory diseases. Cell. Mol. Life Sci. 69, 4149–4162.

Yamaguchi, H., Calado, R.T., Ly, H., Kajigaya, S., Baerlocher, G.M., Chanock, S.J.,

Lansdorp, P.M., and Young, N.S. (2005). Mutations in TERT, the gene for telomerase

reverse transcriptase, in aplastic anemia. New England Journal of Medicine 352, 1413–1424.

Yanagi, S., Tsubouchi, H., Miura, A., Matsumoto, N., and Nakazato, M. (2015). Breakdown

of Epithelial Barrier Integrity and Overdrive Activation of Alveolar Epithelial Cells in the

Pathogenesis of Acute Respiratory Distress Syndrome and Lung Fibrosis. BioMed Research

International 2015, 1–12.

Yang, Y., Jiao, J., Gao, R., Le, R., Kou, X., Zhao, Y., Wang, H., Gao, S., and Wang, Y.

(2015). Enhanced Rejuvenation in Induced Pluripotent Stem Cell-Derived Neurons

219

Compared with Directly Converted Neurons from an Aged Mouse. Stem Cells and

Development 24, 2767–2777.

Yokohori, N., Aoshiba, K., and Nagai, A. (2004). Increased levels of cell death and

proliferation in alveolar wall cells in patients with pulmonary emphysema. CHEST Journal

125, 626–632.

Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie,

J., Jonsdottir, G.A., Ruotti, V., Stewart, R., et al. (2007). Induced pluripotent stem cell lines

derived from human somatic cells. Science 318, 1917–1920.

Yu, J., Hu, K., Smuga-Otto, K., Tian, S., Stewart, R., Slukvin, I.I., and Thomson, J.A.

(2009). Human induced pluripotent stem cells free of vector and transgene sequences.

Science 324, 797–801.

Yue, R., Xia, X., Jiang, J., Yang, D., Han, Y., Chen, X., Cai, Y., Li, L., Wang, W.E., and

Zeng, C. (2015). Mitochondrial DNA Oxidative Damage Contributes to Cardiomyocyte

Ischemia/Reperfusion-Injury in Rats: Cardioprotective Role of Lycopene:

MITOCHONDRIAL DNA OXIDATIVE DAMAGE AND I/R-INJURY. Journal of Cellular

Physiology 230, 2128–2141.

Zampieri, M., Ciccarone, F., Calabrese, R., Franceschi, C., Bürkle, A., and Caiafa, P.

(2015). Reconfiguration of DNA methylation in aging. Mechanisms of Ageing and

Development 151, 60–70.

Zane, L., Sharma, V., and Misteli, T. (2014). Common features of chromatin in aging and

cancer: cause or coincidence? Trends in Cell Biology 24, 686–694.

Zemans, R.L., Colgan, S.P., and Downey, G.P. (2009). Transepithelial migration of

neutrophils: mechanisms and implications for acute lung injury. Am. J. Respir. Cell Mol.

Biol. 40, 519–535.

Zemans, R.L., McClendon, J., Aschner, Y., Briones, N., Young, S.K., Lau, L.F., Kahn, M.,

and Downey, G.P. (2013). Role of β-catenin-regulated CCN matricellular proteins in

epithelial repair after inflammatory lung injury. Am. J. Physiol. Lung Cell Mol. Physiol.

304, L415–L427.

Zemke, A.C., Snyder, J.C., Brockway, B.L., Drake, J.A., Reynolds, S.D., Kaminski, N., and

Stripp, B.R. (2008). Molecular Staging of Epithelial Maturation Using Secretory Cell-

Specific Genes as Markers. American Journal of Respiratory Cell and Molecular Biology

40, 340–348.

Zhang, J., Nuebel, E., Daley, G.Q., Koehler, C.M., and Teitell, M.A. (2012). Metabolic

regulation in pluripotent stem cells during reprogramming and self-renewal. Cell Stem Cell

11, 589–595.

220

Zhao, Y., Yin, X., Qin, H., Zhu, F., Liu, H., Yang, W., Zhang, Q., Xiang, C., Hou, P., Song,

Z., et al. (2008). Two supporting factors greatly improve the efficiency of human iPSC

generation. Cell Stem Cell 3, 475–479.

Zheng, D., Limmon, G.V., Yin, L., Leung, N.H.N., Yu, H., Chow, V.T.K., and Chen, J.

(2012). Regeneration of alveolar type I and II cells from Scgb1a1-expressing cells following

severe pulmonary damage induced by bleomycin and influenza. PLoS ONE 7, e48451.

Zhou, H., Wu, S., Joo, J.Y., Zhu, S., Han, D.W., Lin, T., Trauger, S., Bien, G., Yao, S., Zhu,

Y., et al. (2009). Generation of induced pluripotent stem cells using recombinant proteins.

Cell Stem Cell 4, 381–384.

Zhou, L., Dey, C.R., Wert, S.E., DuVall, M.D., Frizzell, R.A., and Whitsett, J.A. (1994).

Correction of lethal intestinal defect in a mouse model of cystic fibrosis by human CFTR.

Science 266, 1705–1708.

Zhou, Q., Ye, X., Sun, R., Matsumoto, Y., Moriyama, M., Asano, Y., Ajioka, Y., and Saijo,

Y. (2014). Differentiation of Mouse Induced Pluripotent Stem Cells Into Alveolar Epithelial

Cells In Vitro for Use In Vivo. STEM CELLS Translational Medicine 3, 675–685.

Zoz, D.F., Lawson, W.E., and Blackwell, T.S. (2011). Idiopathic Pulmonary Fibrosis: A

Disorder of Epithelial Cell Dysfunction. The American Journal of the Medical Sciences 341,

435–438.

Zunder, E.R., Lujan, E., Goltsev, Y., Wernig, M., and Nolan, G.P. (2015). A Continuous

Molecular Roadmap to iPSC Reprogramming through Progression Analysis of Single-Cell

Mass Cytometry. Cell Stem Cell 16, 323–337.

Zuo, W., Zhang, T., Wu, D.Z., Guan, S.P., Liew, A.-A., Yamamoto, Y., Wang, X., Lim,

S.J., Vincent, M., Lessard, M., et al. (2014). p63+Krt5+ distal airway stem cells are essential

for lung regeneration. Nature 517, 616–620.

(1985). The definition of emphysema. Report of a National Heart, Lung, and Blood Institute,

Division of Lung Diseases workshop. Am. Rev. Respir. Dis. 132, 182–185.

221