Top Banner
GENE TECHNOLOGY Chapter 8
56

GENE TECHNOLOGY Chapter 8. Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal.

Jan 11, 2016

Download

Documents

Barnard Cross
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

GENE TECHNOLOGY

Chapter 8

Page 2: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Overview

DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal Cloning Applications of Gene Technology

Medical Environmental Agricultural

Ethical Issues

Page 3: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Overview: The DNA Toolbox

Sequencing of the human genome was completed by 2007

DNA sequencing has depended on advances in technology, starting with making recombinant DNA

In recombinant DNA, nucleotide sequences from two different sources, often two species, are combined in vitro into the same DNA molecule

Page 4: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Methods for making recombinant DNA are central to genetic engineering, the direct manipulation of genes for practical purposes

DNA technology has revolutionized biotechnology, the manipulation of organisms or their genetic components to make useful products

An example of DNA technology is the microarray, a measurement of gene expression of thousands of different genes

Page 5: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-1

Page 6: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

DNA cloning yields multiple copies of a gene or other DNA segment To work directly with specific genes, scientists

prepare gene-sized pieces of DNA in identical copies, a process called DNA cloning

Page 7: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

DNA Cloning and Its Applications: A Preview

Most methods for cloning pieces of DNA in the laboratory share general features, such as the use of bacteria and their plasmids

Plasmids are small circular extra-chromosomal DNA molecules that replicate separately (autonomously) from the bacterial chromosome

Cloned genes are useful for making copies of a particular gene and producing a protein product

Page 8: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Gene cloning involves using bacteria to make multiple copies of a gene

Foreign DNA is inserted into a plasmid, and the recombinant plasmid is inserted into a bacterial cell

Reproduction in the bacterial cell results in cloning of the plasmid including the foreign DNA

This results in the production of multiple copies of a single gene

Page 9: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-2a

DNA of chromosome

Cell containing geneof interest

Gene inserted intoplasmid

Plasmid put intobacterial cell

RecombinantDNA (plasmid)

Recombinantbacterium

Bacterialchromosome

Bacterium

Gene ofinterest

Plasmid

2

1

2

Page 10: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-2b

Host cell grown in cultureto form a clone of cellscontaining the “cloned”gene of interest

Gene ofInterest

Protein expressedby gene of interest

Basic research andvarious applications

Copies of gene Protein harvested

Basicresearchon gene

Basicresearchon protein

4

Recombinantbacterium

Gene for pest resistance inserted into plants

Gene used to alter bacteria for cleaning up toxic waste

Protein dissolvesblood clots in heartattack therapy

Human growth hor-mone treats stuntedgrowth

3

Page 11: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-2

DNA of chromosome

Cell containing geneof interest

Gene inserted intoplasmid

Plasmid put intobacterial cell

RecombinantDNA (plasmid)

Recombinantbacterium

Bacterialchromosome

Bacterium

Gene ofinterest

Host cell grown in cultureto form a clone of cellscontaining the “cloned”gene of interest

Plasmid

Gene ofInterest

Protein expressedby gene of interest

Basic research andvarious applications

Copies of gene Protein harvested

Basicresearchon gene

Basicresearchon protein

Gene for pest resistance inserted into plants

Gene used to alter bacteria for cleaning up toxic waste

Protein dissolvesblood clots in heartattack therapy

Human growth hor-mone treats stuntedgrowth

2

4

1

3

Page 12: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Using Restriction Enzymes to Make Recombinant DNA Bacterial restriction enzymes cut DNA

molecules at specific DNA sequences called restriction sites

A restriction enzyme usually makes many cuts, yielding restriction fragments

The most useful restriction enzymes cut DNA in a staggered way, producing fragments with “sticky ends” that bond with complementary sticky ends of other fragments

DNA ligase is an enzyme that seals the bonds between restriction fragments

Page 13: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-3-1Restriction site

DNA

Sticky end

Restriction enzymecuts sugar-phosphatebackbones.

53

35

1

Page 14: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-3-2Restriction site

DNA

Sticky end

Restriction enzymecuts sugar-phosphatebackbones.

53

35

1

DNA fragment addedfrom another moleculecut by same enzyme.Base pairing occurs.

2

One possible combination

Page 15: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-3-3Restriction site

DNA

Sticky end

Restriction enzymecuts sugar-phosphatebackbones.

53

35

1

One possible combination

Recombinant DNA molecule

DNA ligaseseals strands.

3

DNA fragment addedfrom another moleculecut by same enzyme.Base pairing occurs.

2

Page 16: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-UN5

Page 17: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-UN6

Page 18: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Animation

Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

Page 19: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Cloning a Eukaryotic Gene in a Bacterial Plasmid

In gene cloning, the original plasmid is called a cloning vector

A cloning vector is a DNA molecule that can carry foreign DNA into a host cell and replicate there

Page 20: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Producing Clones of Cells Carrying Recombinant Plasmids

Several steps are required to clone the hummingbird β-globin gene in a bacterial plasmid

Page 21: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-4-1

Bacterial cell

Bacterial plasmid

lacZ gene

Hummingbird cell

Gene of interest

Hummingbird DNA fragments

Restrictionsite

Stickyends

ampR gene

TECHNIQUE

Page 22: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-4-2

Bacterial cell

Bacterial plasmid

lacZ gene

Hummingbird cell

Gene of interest

Hummingbird DNA fragments

Restrictionsite

Stickyends

ampR gene

TECHNIQUE

Recombinant plasmids

Nonrecombinant plasmid

Page 23: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-4-3

Bacterial cell

Bacterial plasmid

lacZ gene

Hummingbird cell

Gene of interest

Hummingbird DNA fragments

Restrictionsite

Stickyends

ampR gene

TECHNIQUE

Recombinant plasmids

Nonrecombinant plasmid

Bacteria carryingplasmids

Page 24: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-4-4

Bacterial cell

Bacterial plasmid

lacZ gene

Hummingbird cell

Gene of interest

Hummingbird DNA fragments

Restrictionsite

Stickyends

ampR gene

TECHNIQUE

Recombinant plasmids

Nonrecombinant plasmid

Bacteria carryingplasmids

RESULTS

Colony carrying non-recombinant plasmidwith intact lacZ gene

One of manybacterialclones

Colony carrying recombinant plasmid with disrupted lacZ gene

Page 25: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-UN4

G

Aardvark DNA

Plasmid

53

3TCCATGAATTCTAAAGCGCTTATGAATTCACGGC5AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG

ACTT

AAAG

T TC

Page 26: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-UN7

Page 27: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

1. The hummingbird genomic DNA and a bacterial plasmid are isolated

2. Both are digested with the same restriction enzyme

3. The fragments are mixed, and DNA ligase is added to bond the fragment sticky ends

4. Some recombinant plasmids now contain hummingbird DNA

5. The DNA mixture is added to bacteria that have been genetically engineered to accept it

6. The bacteria are plated on a type of agar that selects for the bacteria with recombinant plasmids

7. This results in the cloning of many hummingbird DNA fragments, including the β-globin gene

Page 28: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Animation

Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

Page 29: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Animation

Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

Page 30: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Storing Cloned Genes in DNA Libraries

A genomic library that is made using bacteria is the collection of recombinant vector clones produced by cloning DNA fragments from an entire genome

A genomic library that is made using bacteriophages is stored as a collection of phage clones

Page 31: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-5a

Bacterial clones

Recombinantplasmids

Recombinantphage DNA

or

Foreign genomecut up withrestrictionenzyme

(a) Plasmid library (b) Phage library

Phageclones

Page 32: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

A bacterial artificial chromosome (BAC) is a large plasmid that has been trimmed down and can carry a large DNA insert

BACs are another type of vector used in DNA library construction

Page 33: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-5b

(c) A library of bacterial artificial chromosome (BAC) clones

Large plasmidLarge insertwith many genes

BACclone

Page 34: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

A complementary DNA (cDNA) library is made by cloning DNA made in vitro by reverse transcription of all the mRNA produced by a particular cell

A cDNA library represents only part of the genome—only the subset of genes transcribed into mRNA in the original cells

Page 35: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-5

Bacterial clones

Recombinantplasmids

Recombinantphage DNA

or

Foreign genomecut up withrestrictionenzyme

(a) Plasmid library (b) Phage library (c) A library of bacterial artificial chromosome (BAC) clones

Phageclones

Large plasmidLarge insertwith many genes

BACclone

Page 36: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-6-1

DNA innucleus

mRNAs in cytoplasm

Page 37: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-6-2

DNA innucleus

mRNAs in cytoplasm

ReversetranscriptasePoly-A tail

DNAstrand

Primer

mRNA

Page 38: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-6-3

DNA innucleus

mRNAs in cytoplasm

ReversetranscriptasePoly-A tail

DNAstrand

Primer

mRNA

DegradedmRNA

Page 39: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-6-4

DNA innucleus

mRNAs in cytoplasm

ReversetranscriptasePoly-A tail

DNAstrand

Primer

mRNA

DegradedmRNA

DNA polymerase

Page 40: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-6-5

DNA innucleus

mRNAs in cytoplasm

ReversetranscriptasePoly-A tail

DNAstrand

Primer

mRNA

DegradedmRNA

DNA polymerase

cDNA

Page 41: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Animation

Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

Page 42: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Screening a Library for Clones Carrying a Gene of Interest

A clone carrying the gene of interest can be identified with a nucleic acid probe having a sequence complementary to the gene

This process is called nucleic acid hybridization

Page 43: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

A probe can be synthesized that is complementary to the gene of interest

For example, if the desired gene is

– Then we would synthesize this probe (Why??)

G5 3… …G GC C CT TTAA A

C3 5C CG G GA AATT T

Page 44: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

The DNA probe can be used to screen a large number of clones simultaneously for the gene of interest

Once identified, the clone carrying the gene of interest can be cultured

Page 45: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-7

ProbeDNA

Radioactivelylabeled probe

molecules

Film

Nylon membrane

Multiwell platesholding libraryclones

Location ofDNA with thecomplementarysequence

Gene ofinterest

Single-strandedDNA from cell

Nylonmembrane

TECHNIQUE

Page 46: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Expressing Cloned Eukaryotic Genes

After a gene has been cloned, its protein product can be produced in larger amounts for research

Cloned genes can be expressed as protein in either bacterial or eukaryotic cells

Page 47: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Bacterial Expression Systems

Several technical difficulties hinder expression of cloned eukaryotic genes in bacterial host cells

To overcome differences in promoters and other DNA control sequences, scientists usually employ an expression vector, a cloning vector that contains a highly active prokaryotic promoter

Page 48: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Eukaryotic Cloning and Expression Systems

The use of cultured eukaryotic cells as host cells and yeast artificial chromosomes (YACs) as vectors helps avoid gene expression problems

YACs behave normally in mitosis and can carry more DNA than a plasmid

Eukaryotic hosts can provide the post-translational modifications that many proteins require

Page 49: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

One method of introducing recombinant DNA into eukaryotic cells is electroporation, applying a brief electrical pulse to create temporary holes in plasma membranes

Alternatively, scientists can inject DNA into cells using microscopically thin needles

Once inside the cell, the DNA is incorporated into the cell’s DNA by natural genetic recombination

Page 50: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) The polymerase chain reaction, PCR,

can produce many copies of a specific target segment of DNA

A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules

Page 51: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-8a

5

Genomic DNA

TECHNIQUETargetsequence

3

3 5

Page 52: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-8b

Cycle 1yields

2molecules

Denaturation

Annealing

Extension

Primers

Newnucleo-tides

3 5

3

2

5 31

Page 53: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-8c

Cycle 2yields

4molecules

Page 54: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-8d

Cycle 3yields 8

molecules;2 molecules

(in whiteboxes)

match targetsequence

Page 55: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Fig. 20-85

Genomic DNA

TECHNIQUE

Cycle 1yields

2molecules

Denaturation

Annealing

Extension

Cycle 2yields

4molecules

Cycle 3yields 8

molecules;2 molecules

(in whiteboxes)

match targetsequence

Targetsequence

Primers

Newnucleo-tides

3

3

3

3

5

5

51

2

3

Page 56: GENE TECHNOLOGY Chapter 8. Overview  DNA Cloning  Restriction Enzymes  Gel Electrophoresis and Southern Blotting  Gene Expression Detection  Organismal.

Animation

Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.