Top Banner
Gene Expression DNA RNA Protein Transcription Translation What is the language of DNA?
45

Gene Expression DNA RNA Protein Transcription Translation What is the language of DNA?

Dec 31, 2015

Download

Documents

Peter Perkins

Gene Expression DNA  RNA  Protein Transcription  Translation What is the language of DNA?. DNA Double Helix- Deoxyribonucleic acid “ Genetic material of Life” “Twisted” ladder. Nucleotides - Building Blocks. Nucleotide- Base, sugar, phosphate group. Nitrogen Bases. Purine , Adenine, - PowerPoint PPT Presentation
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Gene ExpressionDNA RNA Protein

Transcription TranslationWhat is the language of DNA?

Page 2: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

DNA Double Helix- Deoxyribonucleic acid“Genetic material of Life” “Twisted” ladder

Page 3: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Nucleotides- Building Blocks

Page 4: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Nucleotide- Base, sugar, phosphate group

Page 5: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Nitrogen Bases

• Purine, • Adenine, • Guanine,

• Pyrimidine. Thymine,• Cytosine• “Y”- pyrimidine

Page 6: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Complimentary Base pairs

• Adenine - -Thymine• (A T & T) - two• Cytosine - - - Guanine

• Combine by double / triple bonds.

• (-) = Hydrogen bonds

Page 7: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

DNA Double Helix

Page 8: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

DNA ReplicationDNA replication (chromosomes replicated during S phase) is SEMI-CONSERVATIVE.

http://www.youtube.com/watch?v=AGUuX4PGlCc

Page 9: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

What is semi-conservative? MatchOriginal two strands of DNA (at left)- Which figure below represents semi- conservative copying?

A

C

B

D

Page 10: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

• Replicated DNA contains ½ one Old and ½ one New – why? Fig. 11-9 Iguana, 9-9 Manatee

• Reduce mistakes and is faster.

Replication

DNA Replication http://www.johnkyrk.com/DNAreplication.html Simple Best DNA- http://www.lewport.wnyric.org/jwanamaker/animations.htm

Page 11: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

DNA Replication

• DNA is “unzipped” by DNA Helicase (Helix is shape of DNA = spiral)

Page 12: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

DNA Replication New bases added by DNA Polymerase. 5’ to 3’,

direction. (like one end to other).

Page 13: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

DNA Replication

Give complimentary side of this sequence

• DNA below• TAC/ACC/TAG/CTT/TTGACGGGGAACCCCATT• ATG/TGG/ATC/GAAAACTGCCCCTTGGGGTAA• DNA is proofread and errors are only 1 in

every Billion nucleotides!

Page 14: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Objectives• Compare The structure of RNA with that of

DNA.

• Summarize Transcription- DNARNA

Page 15: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Gene Expression/ Central Dogma for Molecular Biology• DNA(Transcription) RNA (Translation)

Proteins

Page 16: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Decoding the Information in DNA

• Traits- eye color, hair color determined by proteins, built according to instructions coded in DNA.

• Proteins however, not built directly from DNA but from Ribonucleic acid.

• Ribonucleic acid (RNA) nucleic acid similar to DNA.

Page 17: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

DNARNA- Transcription• DNA is like a book, Chapters are

Chromosomes, Sections are Genes• DNA stays protected in nucleus• ** (Do not want to damage)**• RNA is copied from shorter sequence

of DNA, leaves nucleus• RNA is Working copy of DNA- leaves

nucleus.

Page 18: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Transcription- (Nucleus)

Page 19: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Removal of introns After Transcription- mRNA leaving is called exons = GENE

Page 20: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

3 Types of RNA

Page 21: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Ribonucleic Acid

Page 22: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Comparing DNA/RNA- 3 differences

DNA• Two strands• Deoxyribose Sugar• Thymine

A- - TC ---G

RNA• Single strand• Ribose Sugar• Uracil• NO Thymine• A-U• C-G

Page 23: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Transcription- (Nucleus)• RECALL- DNA/DNA• TAC/ACC/TAG/CTT/TTGACGGGGAACCCCATT• ATG/TGG/ATC/GAA/AACTGCCCCTTGGGGTAA

• Given DNA sequence below• What is the complimentary mRNA? Recall NO

Thymine!• TAC/ACC/TAG/CTT/TTG/ACG/GGG/AAC/CCC/ATT• AUG/UGG/AUC/GAA/AAC/UGCCCCUUGGGGUAA

Page 24: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Objectives

• Outline The major steps of translation.

• Relate Codons to the sequence of amino acids that results after translation.

• Discuss The evolutionary significance of the genetic code.

Page 25: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Translation: Assembling Proteins

Section 1 From Genes to ProteinsChapter 10

Page 26: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Translation-(Cytoplasm) RNA Proteins

• RNA Code is read • CODON – “Code on” mRNA- messenger

RNA• CODON = 3 Bases ON- results in Amino

Acid• Chain of Amino Acids makes protein

(polypeptide)

Page 27: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Translation RNA Protein

• UGUUAUAUCGAAAACUGCCCCUUGGGGUAA• Read every 3 bases= CODON• UGU/UAU/AUC/GAA/AAC/UGC/CCC/UUG/GGG/UAA

Page 28: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Codon- sheet• Why read every 3 bases? • Codon combinations must cover 20 different

AA- Amino Acids • 41 = 4• 42 = 16• 43 = 64 CHECK!• Results in 64 combinations• Start sequence AUG.• End sequence UAA, UAG, UGA.

Page 29: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Codes in mRNA

Page 30: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Translation RNA Protein

• UGUUAUAUCGAAAACUGCCCCUUGGGGUAA• Read every 3 bases= CODON• UGU/UAU/AUC/GAA/AAC/UGC/CCC/UUG/GGG/UAA

Page 31: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Amino Acids

• Amino acids can be• Polar/Non Polar• Hydrophobic/Hydrophilic • Acidic/Basic• Depending on sequence this will make a

shape = GENE

Page 32: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Translation: Forming the First Peptide Bond

Section 1 From Genes to ProteinsChapter 10

Page 33: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

tRNA

• tRNA- Transfer RNA, “transfers” the Amino Acid to the ribosome to make protein

• tRNA is complimentary to mRNA, “lock & key” fit. Every codon has only one Anticodon.

• AUG/CAA- Codon• UAC/GUU- Anticodon- specific AA• Met-Glu- Amino acids

Page 34: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Translation: Assembling Proteins

Section 1 From Genes to ProteinsChapter 10

Page 35: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Video showing transcription/translation

• https://www.youtube.com/watch?v=erOP76_qLWA

Page 36: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?
Page 37: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Mutations

Page 38: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Major Types of Mutations

Page 39: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Mutation- Change in sequence of the DNA- deoxyribonucleic acid

• A. Chromosomal- whole, parts added or deleted, sections translocated to other chromosomes.

• B. Gene- –1. Point–2. Frameshift.

Somatic-affects individual- EX. skin cancer.Genetic- affects sperm or egg affects

offspring.

Page 40: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Gene mutations1. Point mutation- affects onenucleotide fig. 11-7 p. 230 Iguana

• p. 219 Manatee • Ex. • TAC GTT CCA, change TAC GTA CCA, • If this makes different codon

(language of genetics), = new amino acid

Page 41: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Point mutation analogy

• The dog ran out the box• Point mutation Change D and C.• The Cog ran out the box.

Page 42: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Frame shift mutationB. Frame shift mutation- removal of a

base(s) or insertion of a segment, results in different “reading” of gene. CODON= 3 bases.

• TAC GTT CCA- original sequence. T(AC G)TT CCA remove first (T) ACG TTC CA…. TA)C GTT CCAinsert T TTA CGT TCC A

Page 43: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Frame shift mutation analogy

• The dog ran out the box• TTh edo gra nou tth ebo x. ADDITION of a T• Heg ogr ano uth heb ox DELETION of a T

Page 44: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

Genetic Code- Evolutionary significance

• The code AUG/CCC/, whether in human or oak tree, or mosquito, etc.. makes same amino acids….Met--Pro

• This shows relatedness of all living organisms.

Page 45: Gene Expression DNA   RNA  Protein Transcription  Translation What is the language of DNA?

How can a glow in the dark gene from Jellyfish work in a pig?

• DNA is a code like words if it fits and makes sense, then it can be used.

• The dog ran down the street.

• The cat ate a bird.

• The dog ate a bird. Still makes “sense”.