Gene Expression

97 575 28.04 20 .. : .. .. .. . .: , 2000. 000 ., .ISBN5-02-001890-2 , . . , , , , . , . . , , , , - - . , , .-97-- 123Patrushev L.I.Gene Expression. Moscow: Nauka, 2000. 000 p., il.1ISBN 5-02-001890-2This monograph consisting of two parts presents a comprehensive view of the structure and functioning mechanisms of genes for prokaryotes and eukaryotes as well as the basic methods used for their studies. Its first part discusses the genome structure of prokaryotic and eukaryotic organisms, also covering the mechanisms of transcription, translation, replication, DNA repair and their regulation. The second part of the monograph deals with the principles of the techniques employed in the gene research. The book devotes particular attention to current genetic engineering tools. It embraces the key aspects of recent developments of molecular genetics studies on site-directed mutagenesis, protein engineering, antisense RNA, ribozymes and deoxyribozymes, transgenosis andgene therapy,DNA diagnostics and genotyping human genome.The book will act as authoritative references for researchers, postgraduates, and students specializing in chemistry and biology.ISBN 5-02-001890-2 "", 20002 ................................................................................... 9 ........................................................................................ 13 I. .................................................................................... 19 20 1. ....................................................................................................... 27 1.1. ........................................................................................ 31 1.2. ............................................................................................ 33 1.2.1. ........................................................................................... 34 1.2.2. ............................................................. 35 1.2.3. ................................................................................. 38 1.2.4. .................. 40 1.3. .............................................................................................. 42 1.3.1. ..............43 1.3.2. ................................................................................................... 47 1.3.3. - ..................................................... 58 2. ................................................................................................... 62 2.1. ................................................................................................. 63 2.1.1. - -........................................................... 64 2.1.2. ()............................................... 73 2.1.3. ................................................................................. 80 2.1.4. ......................................................... 110 2.2. .......................................................................................................... 123 2.2.1. ................................................................... 124 2.2.2. - .................................................................... 130 2.2.3. ...................................... 141 2.2.4. - , -II ........157 2.3. ...................................... 162 2.3.1. .......................................................... 163 2.3.2. .................................................................................................. 165 2.3.3. ................................... 167 2.3.4. .................................................................... 170 2.3.5. .............................................................172 2.4. ................................................. 174 2.4.1. ................................................................................................ 175 2.4.2. ........................................................................ 179 2.4.3. , ............................. 188 32.5. .............................................................................. 190 2.5.1. ............... 191 2.5.2. .......... 192 2.5.3. ......................................................... 202 2.5.4. ........................................................................ 203 2.5.5. .................................................................. 205 2.5.6. . ................................................................. 209 3. .................. 213 3.1. 215 3.1.1. ................................... 215 3.1.2. .............219 3.2. ... 228 3.2.1. .................................... 231 3.2.2. ............................... 250 3.2.3. ................................ 286 3.2.4. ...................................................................................................... 293 3.2.5. .............................................................................................. 305 3.2.6. ................................. 306 3.3. ......................... 317 3.3.1. , .................................................................. 317 3.3.2. .................................... 330 3.3.3. ......................................................... 338 3.4. ........................... 342 3.4.1. ........................................................ 342 3.4.2. ......................... 351 3.4.3. ...................................................... 353 3.5. , ........................ 354 3.6. ............................. 356 3.6.1. ...................................................................................................... 357 3.6.2. ........................................................................................... 359 3.6.3. - ........................................................................................... 360 3.6.4. ................................................................................... 364 3.6.5. ............................ 367 4. ................ 370 4.1. .......................................................................................... 370 4.1.1. , ............................................... 371 4.1.2. E. coli T4 .................................. 374 4.1.3. ..... 379 4.2. ...................................................................... 382 44.2.1. E. coli .......................... 384 4.2.2. ColE1 .............................................. 391 4.3. ...................................... 397 4.3.1. ............................................................ 397 4.3.2. ............................................................................400 4.3.3. .........402 4.3.4. ................... 403 5. ....................................... 406 5.1. ......................................................................................................... 407 5.1.1. .................................................................................... 409 5.1.2. SOS- ..................................................................... 423 5.1.3. ............................................................................. 427 5.1.4. ........................................................................................ 429 5.1.5. .............................................................................. 432 5.1.6. ................................................ 436 5.2. ............................................................................................ 437 5.2.1. ....................... 438 5.2.2. ..................................... 439 5.2.3. .................................. 450 5.2.4. .................................... 452 5.2.5. (ADP-) ........... 454 5.3. .................................................................................. 457 5.3.1. ...................................................................................................... 459 5.3.2. ............................................................... 462 5.3.3. ................................................. 466 5.3.4. ...................................................................................................... 473 5.3.5. ............................................................ 481 6. .................................................. 487 II. ............................. 496 7. ................................................... 497 7.1. , ............... 504 7.1.1. - ................................................................ 504 7.1.2. - -................................................................................. 512 7.1.3. .......................................... 513 7.1.4. ................................................................................... 519 7.2. ......................................................................................................... 521 7.2.1. ............................................................................. 522 7.2.2. ..................................................................... 525 7.2.3. ............................................................................... 528 7.2.4. YAC, BAC PAC............................................... 530 57.2.5. () ............................. 533 7.2.6. ...................................................................................................... 536 7.2.7. ............... 551 7.3. .......................................................................................... 553 7.3.1. ..................................................................... 554 7.3.2. ............................................. 556 7.3.3. ......................................................... 558 7.4. , .............................................. 560 7.4.1. ( CHO)............................. 562 7.4.2. ( Sp2/0) ............................................ 564 7.4.3. ( MEL)................................................. 565 7.4.4. ( COS) ........................ 566 7.4.5. , ............................... 567 7.4.6. ....... 569 7.5. ..................................... 570 7.5.1. ................................................................... 571 7.5.2. ..................................................................... 574 7.5.3. ................................................................................ 576 7.6. ............................. 577 7.6.1. .................................................... 578 7.6.2. " " .................................................... 579 7.6.3. S1- ................................................................. 580 7.6.4. ............................................................................................. 581 7.7. .......................................................... 581 8. .......... 584 8.1. ......................................... 585 8.1.1. ............................................................... 585 8.1.2. ............................................................................ 587 8.1.3. - ...................................................................................................... 589 8.1.4. ............. 596 8.2. .................................................................................. 599 8.2.1. .......................................................... 599 8.2.2. - .................................................. 606 8.2.3. ................................................................................ 607 8.2.4. ............................................... 612 8.2.5. ................................................. 616 8.3. ............................................................................... 620 9. , . 627 9.1. ............................................. 627 9.1.1. ............................................ 628 9.1.2. .................................................... 630 69.1.3. .......................................................... 635 9.1.4. : ...................................... 638 9.2. ................................................................ 640 9.2.1. ...................................................................................... 640 9.2.2. ............................................................................... 642 9.2.3. ............................................... 645 9.2.4. , -........................................................................... 651 9.2.5. ................................................................................... 653 9.3. ...................................................................................................... 655 9.4. ............................................................... 658 9.4.1. -............................................. 659 9.4.2. .........662 10. .................................... 667 10.1. .... 667 10.2. ............................................................................ 670 10.3. .............................................. 671 10.3.1. .................................... 672 10.3.2. .................................................................................... 673 10.3.3. ............................................... 674 10.3.4. ....................................................................................... 677 10.4. ............................................................................. 679 10.5. ....... 681 10.5.1. ............................ 682 10.5.2. -................. 688 10.5.3. ...................................................................................................... 690 10.5.4. ..................... 694 10.5.5. ............................. 696 10.5.6. , .................................................................................. 697 11. - - .................................. 699 11.1. - .......................................................................................................... 701 11.1.1. .......................... 702 11.1.2. .................................................................... 703 11.2. - ...................................................................................... 714 11.2.1. - ................................................... 716 711.2.2. : .............................................................. 718 11.3. ......................................................... 725 11.3.1. ................................................... 725 11.3.2. ............................. 727 11.3.3. ............................................................................. 730 12. ........................................................................ 733 12.1. ..................... 733 12.1.1. ........................................................... 734 12.1.2. ............................................. 739 12.1.3. .............................................. 741 12.1.4. ........................................... 743 12.2. .......................................................................................................... 744 12.3. ............................................... 745 .................................................................................................... 748 .................................................................... 753 8 . . 19501960- , , . - , . coupdeforce, , , "JournalofMolecular Biology", . , "NatureNewBiology" : , , , , , . , : , . , , : , , 1980 . 19701980- . , ( ), , , . , , 9 . , , . . , . .. , . . , , , . , , . , . -, ( ) - .. , . , . . . . , , . , , , . , , , , - . , .. , , , 10 , .. 1999 .11 , 12 - , , , . , , 1970- . , . , . , . , 25 , . - , . , , , , - . , . "" , , . , 70- XX . , ., , , -, . , , , . -13, .. - . . ( . ), , , , - . . , , - , ., , -, . , , , . . , . , . , , - , . , , - - (- ) . , 14, 2020 . . , . , . , . , . . , , , . . , . . , , , . . "" . , , .15 , "", . , . . , . . , , , . , , , ., , . . , , , , , . , , , . . .. .. . , .. , . . .. , 16 . , , , . , , - .. , . , , , , . .. , .. , .. .. ... , . .. , . , , . , , , , , , . . , . , , , , ... 1718 I. 19. , , , . . (1998 .) XX . , , . , , , . , , statusquo . , , , , . , , , , . , ( ), "" , . , , . .20 . . , . : . , , , .. , . , . , . , . - . . , , . , , . , , , ( , ). , , . , , , . , , , , , .21 , , . , , , ."Omniameamecumporto!1" . . , , , , . . , , ., . . , , , , . . , , . ( ), , . . , () . , , . , 1 (.)22 . () , , () . . . ( ). , , . , . . . , ~10141015 100 . . . , . , , . . () , , . , .. . 23. , . , . , , . , , . , , .. , , , , . : - , , . , , , . . , . . , . , , 24 ( ) () . . . , , , , , . () . , , , . . , , , , . ( , ) . , , . . . 25 . , , , , , . , . , , , . , , , , , .26 1. "" . 1920 . , . , , . . , , , , , . ("") , . , . . . , , . , , () , . , () . , , . . , -, , , 27 . -, - , , , . . I.1, . .28 I.1 , .. 1,0104 1,6106 2,0106 4,7107 2,3109 1,6109 1,4109 2,7109 3,61010 1,5109 1,2109 2,6109 3,0109 1,61010 2,71010 Lilium longiflorum 1,8101129 . 1978 . . - , (3% ). "". (. 5.3), - , , , . , . : . , , , . : (Archaebacteria), (Shizomycophyta) (Cyanophyta). , - , , , , . , . : () (Mesokaryotes), (Fungi), (Planta) (Animalia). , , , , . , , , , 30 .1.1. , . , , . () , , . , () , . ( ) . , , , , . . , . , , (>60...) , . () (). , , . , , , 31, . , . . , , in vivo., , . (, ) () . () , () , , . . , , . , , . , 1% , Sacharomycescerevisiae 20%. ( ) 1 10% ., , , . , . , 32 , , . , Amphiuma~30, , 28, (46 ). . , . , Lysandra nivescens 380382 , , .-, , .. . , , , , .1.2. , ( , ) , , . , . , . , . , , . , 33, . , , , . , , , , , , , , , .1.2.1. . -, " , , ( ) ; - -; (), "", -"2. , . -. . , , . , , . 2 - . . .: , 1972. . 15.34, ( ). , , ( ). - . . -, , , , . , , . , (), . , . , , ( ), ( ). - . - , , , - . , , , . , - .1.2.2. , , , 35 , . - , (E. coli 4,6 . ..) . , . , , , .- . , ,-. , , , , . , , (. I.1,). . , -, - I HU . , . , , - . - . . . I.1,. , , 36 , . . , , . , , , -, . , - , HU, H-NS IHF, , . "" ( ) . LP-(low proteinchromatin), . LP-, , (). , , . . : Mycoplasma genitaliumHaemophilusinfluenzae. 1997. E. coli Bacillussubtilis4,64,2 .. , .371.2.3. . Archeabacteria , . , .Methanococcusjannaschii, 1996 ., . . , , , 200 . M. jannaschii : CO2,NH3 .. M. jannaschii , 1700, 5816... - . , GC- 31%. : 1700, 1000 .. -M. jannaschii . . , M. jannaschii . M. jannaschii , , , , , . () , 38 . , . M. jannaschii , . . , , --. , -M. jannaschii , , , , -. M. jannaschii , , "" . , , , . M. jannaschii , -, -. -Pol III, , M. jannaschii. : , , , , , . M. jannaschii, , . , -, - -. , , . M. jannaschii ., , .391.2.4. , , , . , , , , . . 1920- . (1995 .) (Mycoplasmagenitalium Haemophilus influenzae) . .. .. , , ., M. genitalium H. influenzae - 1,5. , , , , . , M. genitalium, 580..., 469 , H. influenzae (~1830 ...) 1703 . , M. genitalium 240 , H. influenzae. 22 , , . 6, 40 , . 256 , , . , 256, : ; ; ; , ; , , ; , , ; ; , , ; ; , ; denovo ; ( ). , . Bacillussubtilis, . , 318..., 562 ... , M. genitalium. . . , ., , M.genitalium H. influenzae, ( 250), . 41 , , .1.3. , (), , , . , , , . - . . . , . . . , . , , 168 () 1 (). 6 , 6109 .. (. . I.1). , , , . , 42 , . , , . , .1.3.1. . , , , 1598% . , , : . , , , . () , , - . . (1977 .), , -, , (exonshuffling). , (), 43. , , , , . " " (intronlate). .. .. (1978 .) " ". - . . . , 105 , , 10104 . , 120 .., . . , (, ). , , , . .. . (1974 .) , , CsCl. , : ) ; ) ; ) ; ) ( ); ) ; ) 44 ; ) () ; ) ( ) . 550% . - ( 1 4 .. ) ( .. ) , . - VNTR (variablenumber of tandem repeats). , , . , (medium reiterated frequency repeats MERs), : SINE (shortinterspersedelements) LINE (longinterspersedelements) . SINE- 90400 .., LINE- 7 ... SINE Alu-, 300 .. Alu- ~106 4..., ~5% . , B1, . LINE- , ( , ), (long terminal repeats LTR), ( . 7.2.7). 45LINE-LINE-1-, . LINE-1- ORF-1 ORF-2, , . ORF , LINE-1 (SDR). 5- . LINE-1() A F, . 600.. A- (F) . , SINE-LINE- . . , , , 2030%. , , , . -, , . . , LINE-, ORF, -, , . 100000MaLR-23..., LTR, . , 46 . "" , . , , "" 23 , . , "" , , "", - . , , "" , , , . : , - ? , . , C, , - . "" 5.3.1.3.2. , 47 . , , . ~1:1, . , , H1, H2A, H2B, H3H4. ~220 (H1) 102 (H4) . H1 Lys, H2AH2BLys, H3 H4 Arg. ( H4) . H1 . , H1.1H1.5, H1o H1t. . , , 1, 10. , , ~4 . ~4. , , , 104. . . , . . , . . . 48 . , . . , . . . , , , . in vitro , . : 1) ; 2) , ; 3)- , . . ( ) 10 , . , , . , , 1020 . : H2a, H2b, H3 H4, H1. : , . . , (146..)B-49(10..) , 34, 2 2b. 11 , 5,5 . , , . . , , 200 (t15) .. . N- - , , (arm). - , , - , . , , (. I.2). N- H3 H4 , . S. cerevisiae , N- . .34 (3)2(4)2, 22. , , 2/2, 3/4. 50 . . (1997 .) . , 2728 .., 140, 4 .. B-: 0,250,35 ../ , , 10,2../ (- 10,5 ../). , . N- , -, . , N-3 , 4 . , 121 .. H3. N- H3H2B , , N- H2A . , . , 1015 40 .. .51 I.2 ( ) N- - 3 135 41 25 Ac-K9, P-S10, Ac-K-14, Ac-K18, Ac-K23, Ac-K27H4 102 32 P-S1, Ac-K5, Ac-K8, Ac-K12,Ac-K16, Ac-K20H2A 129 24 16 P-S1, Ac-K5, Ac-K9H2B 125 30 23 Ac-K12, Ac-K15, Ac-K20, Ac-K24, P-S32, P-S36H1 213 36 92 S-: P-S145, P-S173, P-S180: P-S16, P-T17, P-T136,P-S145, P-S173, P-S180.Ac, P; K, R, TS Lys, Arg, Thr Ser . .52 " " in vitro 1. 1, , , 30 , . , in vivo. 25~30 , (100 NaCl), . . 30 , . .. , , , "" (super-beads). . , (10 ) 6 , ~6 10 , 40 . , , . ., , . 1, 30. 1, 1, 1, 1, 5, . 1, , . 53 1 , , , . 1, , . , . , , , 1 , . , .- . , , , , 50100 ... () , . , , , ~5... (. . I.2). , , () , . , , MAR(MatrixAssociatedRegion) SAR(Scaffold Associated Region) MAR/SAR-. MAR/SAR- . , 54 , - II, , . , (10...), "" , , , (. . I.2). , MAR/SAR-, , . MAR/SAR- . - 200350 .., (dA) (dT). -: - AATAAAT/CAAA - TTA/TTT/ATTT/CAAA, MAR/SAR- , . ATATTT AATATTTT, MAR/SAR- , . MAR/SAR-, .. (1995 .): MAR/SAR- 3001000 ..; - AT-;MAR/SAR- , , ; MAR/SAR- 3112 ..., , - 55; MAR/SAR- . , ;MAR/SAR- , Z- H-, I. , MAR/SAR- . , , , , . MAR/SAR- (), , . 3.2.4. - , MAR/SAR- . , . .. .. (1998 .) , SAR-, , , , . , MAR/SAR- , , , , .56 . . , (high mobility group HMG). . HMG- ~10 , . : 14/17, 1/2 I/Y.HMG 14/17 1012 , . N- , - . HMG 14/17, . HMG- H1 .In vivo~10% HMG 14/17. HMG1/2 2530. , , , . ,() ., HMG 1/2 in vitro, , . HMG I/Y - , 1. , 1 in vivo (. 2.1 4.1). HMG- , 57 . , , , . -, .1.3.3. - , , , , . , - (). - III. - I, , . , - II , ATP- (. I.3). - Tyr, . 5'- 3'- . . - ITyr , - II , ., , - I IA IB, , , 58, . - IA , , , - III.- IA , , Mg2+ 5'- . - IAII, . , - IB, , 3'-. - IB ( ). - IB/III (camptothecin), . I, . .- II . , ( , ). - II - I.- II , . - II , 59 .- II , . , . - II . - . , - II , MAR/SAR- . II , . , in vivo , : , , MAR/SAR-. - II , . , - II , , , . () , -, . , , . 60 , . , -, . . , , . , ( MAR/SAR) , . , . , , -, , ( . 5.3). , ( ) .61 2. , , , . . : , , . . , , () ( messenger RNA, mRNA), . , . , , (), . (), , , , . , . "" , , , , .. , 62 . , - : , , . . , ( ). . .2.1. , , (ATP, GTP, CTP UTP) 3'5'- . , , - -, , . , - . 63 .2.1.1. - - - . , , - , SP6 T7. - , . -, , . , . , - - . , , - in vivo , .- E. coli. - E. coli. . :- ( 165 ), - (155 ), - (35 ) - ( 70 (70)). , (enzyme), (-) E. coli, , (. ). -, - , - , , -64, . , 70-, 70. - 70 () E. coli. , , glnnif 54 ( 54 ) 70E54. -, . - - . - , - , - . , , . , , , , - - , . (, ), , , , . . . ( ) . . , , , 65 -, -. -. - I (), 18S 28S ; - II , - III (), 5S. , (120220 ) 513 (10100 ) . -. - - , , , . , - -, , - II, , - I III. -, , -, , , -.- I (Pol I). , - : , . . 66 in vitro . . I.4, , (RPA194 RPA116) Pol I , '- - - E. coli. - I , 11 . Pol I 194 116 , ( 14 ), 1560 . Pol I 53, PAF53(polymeraseassociatedfactor 53), Pol I , -, RPA49 . Pol I RPA49RPA35.5(Pol I*) poly[d(A-T)], . , (. ). Pol I , , , , Pol I , . Pol I . TIF-IB (Pol I-specifictranscriptioninitiationfactorB), , D, Pol I (). hSL1, rSL1 X. laevis Rib 1. TIF-IB/SL1 Pol I . TIF-IB/SL1 , TBP, - . 67( . 2.1.3.) 110, 63 48 TBP- TAFI, TBP, , . TAFI48 TIF-IB/SL1 UBF (. ), TAFI63 TAFI110 . TAFI TAFII, Pol II. , TBP TAFI TBP TAFII(), . TAFI48 TBP - , TATA- Pol II-, ,, Pol II., Pol I, UBF(upstream bindingfactor) .UBF , - HMG- (highmobilitygroupdomain) 80 . - , HMG- -, L, - L. UBF UBF1 UBF2 97 95 , . UBF1 HMG-, N- C- . , HMG- UBF , UBF ( ). , HMG- , UBF. , Pol I TIF-IB/SL1, . - 68 UBF Ser . , HMG-, . UBF, . CPBF (corepromoterbindingfactor), , (. 2.1.2.). CPBF, Pol I, USF1 USF2 44 39 . USF1USF2 Pol I, USF1/USF2invitro. , CPBF Pol I in vivo.TIF-IA Pol I, . , , . TIF-IA . TIF-IA 70. TIF-IA 7080. , , . , TIF-IC Pol I. , . , . TIF-IC TFIIF (RAP30/74) Pol II (. ).69- II (Pol II).Pol II 10 , - . (GTFs generaltranscriptionfactors). Pol II . . . , -. , , Pol II 14, . I.3.70 I.3 - II Pol II - , , TFIIB Pol II TBP , TFIIF Pol II, Pol II, SRB/TFIIH - ATP, - , CTD-SRB2, SRB5 , , TBP, SRB/GAL11/SPT13 , , SRB/, SUG1 SRB/, SRB4, SRB6, SRB7, SRB8, SRB9, SRB10, SRB11 SRB/, CTD- Pol II71 , , , SRB- (suppressorof RNA polymerase B). Pol II . SRB- , - CTD- Pol II (- - II). SRB. , SRB- - in vivo. SRB- CTD- Pol II, , , - . Pol II GAL4VP16, Pol II. , Pol II , -. , , CTD- , Pol II, SRB-, TFIIF, GAL11/SPT13, SUG110, - . . Pol II - ( . 3.2.2). - , , . , - , , - . , - , . , T-, 72 , --, , T7.- , -, , -, - , -, . , , , - , . , , - ., (. ) - , T7, . , .. , -, . , -, , -, ( ) , , , .2.1.2. () - in vivo , , . , , , . , . "" "" 73"", . , , , . , . , , - , . . () , , -, , . . 1964 . . , . . lac- E. coli. , -, . , :1) ; 2) -, -, ; 3) , , . , ( ) . , - , 74 . -(E70) . I.4,. : -35, 30 35, 10, 7 10 ( "" , , +1). 70, 4.2 2.4. . 17.. . , , , UP- - , 52 P1 rrnB, . - -. TG- ( 15 14), .1035, , , . , , in vivo, 43(USRupstreamregion), 1 +20 ( DSR downstreamregion). -, (. ). . , , . 75 3.1.. , - () . - E. - II., - II, . , , (. . I.4,). : TATA-, 2530 ( TATAa/tAa/t), (Inr), ( PyPyA+1NT/APyPy). , , Py , N . , (). TATA- - . - II . . - , ( 50 ), ( ), 7660 ... , . - II . I.5. . CA, +1. , , TATA-. 1015 .., . , , , (). . , , "" .- III. , , - III, (. . I.4,). 1- 5S , (internal control region ICR). ICR, TFIIIA, +50 +64. TFIIIAICR TFIIIA TFIIIC, (. 2.1.33.2). , 12, , . . A 77B. +10 +20, B 3060 .. 3- . TFIIIC, . , , TFIIIC, 25 +75. . , U6- , , . - 30 PSE (proximal sequence element) 60. -, , PSE . - II -. , PSE, . PSE- , SNAPPTF. -(TBP). , TFIIIB, - . PSE-, , PSE- - TFIIIB. , U6- , - III, U2-, - II, - U2-. , - U6 Pol III-Pol II-. -, , , -78 II III , .- I., , , , , , . ( ). , , , / . , , . , . - I (CPE core promoter element), 75 50, 30+1(. . I.4, ). TBP- SL1 ( ), , , (TBP associatedfactor TAF), - I. (. 2.1.3) TBP , - I TATA-. , TAFI63TAFI110, SL1, - . (. 7.6.4) , SL1 - I. SL1 - UBF, UCE(upstreamcontrolelement), 90 150. SL1 UBF - I . 79 , Pol I, , . CPE , . UCE - I. , , UCE , UBF . , - II TFIIB. BRF - III. - I . , CPBF, , 1, E1BF (enhancer 1-bindingfactor), Pol I. .2.1.3. 4 : 1) - ; 2); 3); 4). , , , , . -, . , . 80- , , - . - . , ; . , . I.6. - . - II , , . , , . , , , - . - ( ) . ,. , in vivo, in vitro, .-. - . , - , , . - , . , - -81 E. coli, - - . , -E. coli (, -) ~50.. - 35- . . , - . - E. coli , - II . - II. () . , Pol II , . , , . (. I.4). , , . . , .82 I.4 (GTF) - II (GTF) () TFIIA 37 ()19 ()13 () , TBP TATA-, TAF , TFIIB 35 Pol II/TFIIF , , -TFIID 38 (TBP)250 (TAFII250)150 (TAFII150)135 (TAFII135)95 (TAFII95)80 (TAFII80)55 (TAFII55)31 (TAFII31)28 (TAFII28)20 (TAFII20) -, - , HMG- 3- H4 H3 H2B83 1.4 ()(GTF) () TFIIE 5634 Pol II ( RAP), Zn- , , TFIIH TFIIF 58 (RAP74)26 (RAP30) , in vivo - - E. coli, TFIIH 89 (ERCC3)80 (ERCC2)62 (p62)44 (hSSL1)40 (cdk7)37 ( H)34 (p34)32 (MAT-1)35-, ; 53-, ; Zn- , - Pol II (CTD-), cdk7- (CAK) Zn- , hSSL1 Zn- ; CAKTFII I 120 INR- (), TBP84 , , . , , ( TAF- (TAB-associatedfactors)) , , . 3.2.2. TATA- TFIID(transcriptionfactor II D), , TATA- (TBP), (. . I.7,). TBP - I III, . TBP TATA- , . TATA-TFIID TFIIA TFIIB. TFIIB - II . - II TFIIE, TFIIF, TFIIH TFIIJ, (. . I.7,). , , , . , .. , . TFIIB, TFIIETFIIF70- - E. coli. - .85 -, . , -E. coli , - - - . 10 +3 . , ( 78 ) , , ( -). . , - E. coli - , , . -. . - E. coli( - I III), - II - ( 52 ) CTD (carboxyterminaldomain), . , -CTD Ser Thr. , invitro CTD, 86 TFIIH. , cdk7, . , in vivoCTD-- II , , . " "(promoterclearance(escape))(. . I.7,). , , - II, ATP- . , , , . , () TFIIH (. . I.4, 5.2.2). . . - . - E. coli: -, , - . - , . , , , , - ( CTD- - II). ().87.- : , . . - , . , ( , 2000 ... 17 ), , . , - . , -, , +4 . , - . - , , . - , (walking). , . - . - , . , - , , - -. 88 in vitro 200400 /. - 50100 /, - II in vitro 510 /. - in vivo 2030 /. , -, -. 10-310-5. , , , - 35- 53- . - 3-, (. ). , . , . , , . . , , - - (. . I.8). , -, . , , , . , , (transcription bubble), -. , () , . , , 89 - .- , 3-- . , . , , 212 .. , . , , -, . - , , -. . , . - E. coli , , , () .. . - , (pause), (arrest), . - , . , , , 90 . , -, , , -, . . , - , . - , . , , ., . , - . , ; , . -, , 90%. , 100%. - 7 , . , -, , , . 91 - , . -, - I, II III . , , ( . 3.2). , -, . , . - in vitro . , , . , , , - . , . in vivo. , , , , , . -, . 92, . , ., , . , . - , . , , . , , , . , , . , IMP GMP, , , , . , , . , -, . 3'- ., . , . , , 17 , . , - . -. - E. coli 93 - . , ., . , , , . , , - . , GMPIMP, , . , , . , . ., , . , - I II - , . - , , - . . - II . , . - , , . , - . 94 . , . , , , . , -, - , . - - . , , . , , - . Z- . , , . , - E. coli . 7-- 15. 24 , . - , . -, , 3- , : 3-- , 3- . , .- , - - E. coli, 3-. 5- , 3- . - 95-, , . , , 5- , - 5'-. E. coli GreA GreB, TFIIS . , , 3- , 1 17 . . , , . , , , , . , , , 5- , , . , -, , 3- 5-, . , , . , . , , : . -. , GreATFIIS, , . 96 - . , , , - 3- 5- . 3- -, . - 3- . - , 3- - 35- - I E. coli. - . , - , ( ) . 3- , , , . - , . , , GreAGreB -. . , -, . in vivo, - , -, 97 (transcriptionalslippage), (), (U) (). 1020 . Mn2+ Mg2+ . , , , . . - , . - 32. - . , - E. coli (A) (U) , dT dA, 10 . in vivo, . , - , , , ()- 5'- , ( pyrBI codBA). , , , 98. , E. coli . . 1992 . . , . , - . --, 10(. . I.8). I , II . , . , - : , . , 12- -, -, 10 . , , 3040 . , - II I - I , (. . I.8,,1). . - - I 3--. 99 , - I (. . I.8,,1). - I , - II . - - II , - I . - I, ., , , . , . , . - , . , , . , , - , : , , , (. . I.8,,2), . 3- (. . I.8,,3). 3- , , . -, - II , - , 100, 10, in vivo. . - II. , : (general) . , , , . - II . I.5. P-TEFb (positivetranscriptelongationfactorb) SII, - II . P-TEFb, 101 I.5 - II , P-TEFb 124, 43 , DRBSII (TFIIS) 38 , TFIIF 30, 70 (SIII), A, B 110 18 15 ELL 80 . DRB 5,6--1--D-102 Drosophila, DRB. . DRB , , , - II . P-TEFb , . P-TEFb, - II, . , - II . SII, , - II , . -, DRB- . SII 3- , , - II . -, , - - II . , SII , 6- , , , , GTP UTP. , , - II . , 103. : TFIIF, (SIII) ELL, , -, . , , . . , , TFIIF - II 3-OH- , . , TFIIF 3-OH- . TFIIF , - II , . . (SIII) , A, B C ~150, 18 15 . (SIII) A-, A-. C, B, , (SIII). (SIII) , (-) vonHippelLindau(VHL), . VHLBC, 104 . , , BC. ELL(elevennineteenlysine-richleukemia) , 19 (19p13.1), MLL(mixedlineage leukemia) 11 (11q23) . , MLL . "", , ELL, N- MLL. ELL , , 11, , .. - - . , , . , ( ) . - , .., - E. coli , GC-, , , A, . (A)- . , - GC- , 105-. - , 3- (U)- (dA)- . -, -. - - . : , , , , , . , E. coli , - , . 46 - , . , :-. , , - (rut sites, . rut , ), , - . - - . , - .E. coli , . , Trp (. . I.9). Trp -, , , 180 .. . , . Trp -, , 106, , , Trp. , . , , , , , . , 2/3, 1/2 3/4 . . 3/4 , - . (U). 3/4 . , , Trp.Trp , 1, 1/2, 2/3. , - . , , 2/3, 3/4, . . , - - I, II III. N-TEF , - II, ATP. Reb-1 , - I 107, . Reb-1- 3- in vivo. TTF-1, -, - I . L-, , - III, . Pol I. 565 .. 28S . 3'- 21 .. 18- , Sal- (AGGTCGACCAGA/TT/ANTCCG), . , , . 11 .. (GGGTCGACCAG), 5'- . , , , . , TTF-I Sal- Pol I. , , , C- -80, - c-Myb. N- TTF-I , - , . TTF-I Rib-1 108 . Pol I. , TTF-I . , Pol I, ( - E. coli - ). Pol I, PTRF (polymerase andtranscriptreleasefactor), Pol I, TTF-I. TTF-I . , To, 170 .. . To TTF-I , . . 2.1.4. - , , , . , , 3- , - II (. ). - . , , . MTTERM in vivo -, . , 109 MTTERM - , H- L- . .2.1.4. -, . . in vivo . , invitro. , , , , . , . , . . , , , . ,, , , , . , , - , 110. : . , . , , : 1) ; 2) , , ; 3) . , . , "" . . , . H3 H4 CAF-I (chromatinassemblyfactorI), 150, 60 50 . H3 H4 , 150 , WD- ( W D Trp Asn). H2A H2B, . in vitro , H3/H4 , . ,, H2A/H2B, ( GAL4, USF Sp1). , 111 H1, . in vivo , . (. 3.2.4). , Ura3 , - Ppr1, G2/M . . , . , ., , . , GAGA-, TATA- . . , . , , . , . , , . , 3.2.2, 112 - , , . , - . . . , - , , . , TFIID, , , ( . 3.2.2). , . (HAThistoneacetyltransferase) . LysN-, (. . I.2). . , , in vitro , . , 113 -. , , . . HAT A HAT B. HAT A. . HAT B , , . . HAT A , HAT B , , H3 H4 Lys. , HAT1, -, , HAT A. HAT ATetrahymena GCN5, (Gcn5), , . , , . Gcn5 Ada2 Ada3, Gal4V16 Gen4. Gcn5Ada2Ada3 -, . - . Gcn5Ada 114. -, , . -, , . , , . , , , - . , - , , , , . Gcn5Ada. . HAT (histone deacetylase Hd), , . , . - HdA (350 ) HdB (600 ). HdA , HdB 10 . HdA , 75 71 HDA1HDA3. HdB Rpd3, , , , . 115HdARpd3-; , , , . HdAHdB H3 H4 in vivo. , , , . , . : white, . . , (Lys-12H4). , , , - . , - , . . , , . , . , . Swi/Snf 116 , . NURF (nucleosome remodeling117 I.6 Swi/Snf NURF ,Swi/Snf Swi1Swi2 (Snf2)Swi3Snf3Snf5Snf6p78p68p50p47p252000 - NURF 215 140 55 38 500 , 118factor) (. I.6)., ATP . , ATP. , ., Swi/Snf , . SWI SNF, , , . Swi/Snf, , , , . , . I.6, , (p78p25) . Swi/Snf invitroATP- - . H3 H4, , Swi/Snf in vivo.Swi/Snf - II, . , SWI/SNF . Swi/Snf , , , CTD- - II - , - Swi/Snf, . NURF GAGA, hsp70.In vivo 119 200300 , TATA- GAGA HSF (heat shock factor ). , GAGA- ATP. GAGA ATP, NURF. HSP70GAGA. NURF , , , . ATPNURF, , ATP Swi2. 140 ATP , Swi2, . , . ATP- , , . , . , Swi/Snf - II, . , , . , -, . / , , 120, . ., , . - , SP6 T7, invitro, , - . , in vitro - II III, in vivo. , , . , - . -, . . , . , . ., , - , , . -. . 121 , . , , . . . , , - II, . , , , , . , 70 , . , , , . , , , . , , POL II , YY1, NMP-1, . , . , , , . -, . , , , 122. , . , , .2.2. . , , -, , . , () ( ), .. . - . , . , - , , . 5- , 5- "" . , . 3- , ()-. . 123 - , , , . .2.2.1. , .. (. I.10,). . T-37, in vivo III, . , . III E. coli, 5S, 16S 23S . 30S 16S 23S . , , . P. , . , (. 9). , 124, - . 3- . . ()- E. coli, () -, 1962 ., ()- 1975 . . , , , . ()- . , , 1416 (80200 ), 140% (100%). ()- 2.2.3. ()- . ()- (. . I.10,). 3- , - . , 3- (). , - , . 3-, () . ()- , 5- . ()+- , 125 , , 3-OH-. , -, .()-. ()- (ATP:-), 3-OH- : + nATP ()n + nPPi E. coli ()-. ()- I pcnB, . 52 , , , -, CCA- . pcnB E. coli. pcnB , E. coli . f310, 36,3 , . , ()-. . 25 , . . , 126 , , , . . 4.2.2 ColE1. , , ColE1 pBR322, , ( I), - ( II), , . I . I 5- ( I5) ()- pcnB. I5 , (12 ), I5 ( >10 ). ()- I5 . ()-- I53- , . ()-, , I5 3- . ()+- I5 , III. , I5, . . . , pcnB, ()-, lpp, trxA, ompA, rpsO pnp, rnb rne, . , 1273- , - (. . I.10). II ()- (. . I.10,). , , , ()-, II. , . 3- 3-, , . , : 3- "" . ()+- , , II . . I.10 , . , , , . 3- ATP ATP- -, DnaK, , . .(. 2.2.3), ()- ()- PAB, , . 128 S1, ()- 3106 1. , , . , S1 30S , . . - . . E. coli IV (. . I.10,). , , . ()- HeLa 55 , 3555 , ()- . ()- 60 . invitro()- 600 , 2023 . . 3- ()- , ()+-. , (75%), G (24%), C U ( 5%), , () 7. ()- (Pisumsativum) , 43 , ()- , -129 105 .2.2.2. - , (editing). , , , , , . : Crithidia fasciculata, Leishmania tarentolae Tripanosoma brucei. () 2050 ( ), , . , (), . (U), , U, , . "" U (. I.7), (), , (AUG), , . (UAG UAA), 3- poly(A)-. 130. , , . , , -, -(guideRNAs,gRNA), . g , 5- . 3- 15 U, 3- .131 I.7 AAUUUAUGUUGUCUUU P. polycephalum AUCUCUAAGGGUUUAACCGG ( ) AUUAAAAAGGGGCACAC

CAGU AA AAAAAAAAAAAA

- UUUU UC AUUGUGGUUU AC |PheTyr AAUAAUA U G GCGAAACAU , UUUAUGC G G CAAGGA

Arg GAUAU AA UUUGAUCAGUAUA -132 5- g , , . , g . , , , . () g U. - . , , , , . P. polycephalum (. . I.7). , . . , . P, , , - , (G) , , . UAA UGA, , . . . , U. 133: UC. , , . , . , , . , , , . , rpl2 psbL AG, ATG. , U. , , . , , , , . , , (AG), , , GG., , ( 1), 100%, , 9095%- 30- , . , , 134 40 80%. , , . , , . , , - ., , , , . - . . I.8 , . B (APOB) , . APOB, APOB-(. I.11,). POB 29 , 43 ... , ApoB100 512 , 14 (..). 26 AA, UAA. , , ( ) , 135 I.8 , - / APOB- CU (CAAGluUAASTOP) AMPA KAAI (CAGGluCGGArg) , 1UA (CUCLeuCCCPro) ? -UA (TTCPheTACTyr) 1CU (CGAArgUGASTOP) AspCU UC GlyCU (GlyAsp) AI (UAGSTOPUGGTrp) G 136 .. APOB48 (241 ), 2152 N- APOB100. , - APOB100, . APOB- - . , , . , , APOB-, , (1) 28 . , 12, . , , : , . , , , in vivoin vitro. , , . , 55 , 25 , in vitro25%-. , .137U * * ** ** * * * 1 GAUA AAUUUGAUAGUAUAUUAAAG 2 aAaA AAUaUGAUuaAUuUguuua 1 GAUA AAUUUGAUAGUAUAUUAAAG 1 GAUA AAUUUGAUAGUAUAUUAAAG 1 GAUA AAUUUGAUAGUAUAUUAAAG 1 GAUA AAUUUGAUAGUAUAUUAgAG 1 GAUA AAUUUGAUAGUAUAUUAAAG , , . , (mooringsequence). - , in vitro. APOB- . . , - , , APOB-. , 11- , , , , . , in vitro C 3- in vivo., , APOB-, APOBEC1-- (. . I.11,). , -. , 138 66 44 , , , AUX240 (240 ), , . APOBEC1-, - , . , (. . I.11,). , 1 PO-, 5- . ., - : . / . , g, , . - , . , , , . . , G, -, - . , 139APOB-, , , , , in situ (.. ). g. , , , . ? ? , ?, , , . , . , , . 5.3.1, . , . , , Metazoa. , -, . , , , 140 - . , , , . , . , , - . " ", , .2.2.3. . . , 5- - -, , , . , -, 3- , 3- . , , , . -. 141 3.3.. 5- , - . 2030 . , . , eIF-4E - - . , , -, . - II. , . , , , ATP, GTP, . , 5- : ppp(A/G)pNpNpN... GMP, 5-55- . :G(5)ppp + ppp(5)(A/G)pNpNpN... G(5)ppp(5)(A/G)pNpNpN... + pp + p, -, . GTP ( -), 142 GMP. GMP 5-, -. - . - . N7 . . (-7)-, S-7-(. I.12). -, , 0- . 2- 5-(AG), , -. 2--. 1- . , ATP, 2---N6- NH2- . , 2-OH . - (. . I.12). 1- , . 2-- , 2- . , , 2- , 1015% .143 - , , (U-). - 2 7: m2,2,7G(5')ppp(5')N. U- U-- , , U- .. , , 3- , -. 3'- . 3- , , , 3- ()- AMP:5 GpppG__________AAUAAA__________UUUUU___ 3 5 GpppG__________AAUAAA__OHP____UUUUU___ 3 5 GpppG__________AAUAAA__AAAAAAAAAAAAAAA 3: , . U-, - II. U1, 3'- , , , TPI (3'-terminalprocessing inhibitor).144 3- (. I.13). , , , ,()-. AAUAAA 15 . , U GU. 3- A, , . , , AAUAAA, , . AAUAAA CPSF (cleavageandpolyadenylationspecificityfactor), . CPSF 160, 100, 70 30 . , -, . AAUAAA. GU- CSTF (cleavagestimulatingfactor), (77, 6450 ). GU- -. CPSF CSTF . . . : CFI CFII (cleavage factors). , . , 145 3- invitro, ()- , . , , -, , . I.13. ATP, -. , . , . 3- . CPSF, : CSTF, CFI CFII.(A)- 80 43, -. , . - , Ser Thr , in vitro. , .- , . - (A)-. ()- , X, -, , . 3- , ()- AMP ATP , - -146. (A)- CPSF, (A)-PAB II (poly(A)-bindingprotein II), , , . ()- ()- . . I.14. () 3- 25/, ()- 250 . , AMP ()-. , ()- PAB II (. . I.14). PAB II () ()-. () 3- , . , ., , . , . I.9.. (1997 .) . , , , , . 147 -, CCA 3- , . - ()- E. coli, - Sulfolobus shibatae, , ()- . , . , , . I.9, , .148 I.9 E. coli ()-, 80200 1460 , %100 250 AAUAAA 3-OH- : 3- "" , 3- "", PABP, 40S S1, , 30S , ColE1149. - , . , 1977 . , ( . splice ) . -. , , ()- (), U1U6 . - , . . , , , . (self-splicing). , , , . , .5- 3- 5 1 ] GUAUGU__...__UACUAAC__...__(Py)nAG 2 ] 3-------------------------------------------- , . -. , - , 5- 3-. 150(Py)n 3'- . , 3-, (branchpoint). 5- , "" (lariat) (. ). , -, . I, II III, , , . I, II III. , - , ( . 9.2). , . , : | |ROH + ROPOR ROPOR + ROH, I, II III . . I.15,, IIII . I . Tetrahymena thermophila. I.10 .151 I.10 I GTPOH+[ 1]upAGpa[ 2]5- [ 1]uOHGpAGpa[ 2][ 1]upa[ 2]+GpAGGTPOH+[ 1]upAGpa[ 2] [ 1]uOHGpAGpa[ 2] 2 [ 1]upa[ 2]+GpAG152 , , . . I II , (maturase, .mature ), in vivo. I 2-OH- GTP 5- (. . I.10) ( GTP ). 5- 1. . 3-OH-1 3- , . . . "" 3-OH- , 2. 3-OH- 1 , G, 1 . II III (. . I.15,). . 2-OH- , , , 5- , 1 . 5- 25- , . 3- OH- 1 3- . 5-. . 153 , . -. - , , II III , . , , . . - ATP , . , . , , , . OH- 5- . II III , . -. () - : 3- 5- . -, , , . - 5- U1, U1-- 5- , U2AF65, U2AF35, 3- . .154 , , SR-, Ser Arg, 70-(70 ), U1--, U2AF35 . , SR-, " ". 5- , 3- . U1-, 5- , U2AF 3- , " ". - . . , , ( 137 ..), , 100 ... , , , , . , () , , . , , , . , -, . , , . , 155- , , , (. I.16,). U1- U2- , , 3- U2AF SC35, , 5- ASF/SF2. , . , , . , , -, (. . I.16,). . , , , , : , ; () ; , -, . 51, 32, 116%. , , . . , 1600 , 3,5% 300 1% 400 . , , 50 , . , in vitro , 40050 . . , 67 .., , , . 156 .2.2.4. - , - II in vivo . (). - , . , , , , . , , , , ()- PABP 50. 3.4. , , - . - (CBC). - , () , , . - -CBC (cap-bindingcomplex). CBC CBP80 ( 80 ) CBP20 (20 ). N- CBC NLS (nuclearlocalizationsignal), CBC (. ). 157 CBC - , - . CBC . CBC -. 15 , - m7G - . , - - . , CBC CBP80. , CBC -., - - . . I.16 , . - , . 5'- (. . I.16,,2). - 3'- , , (. . I.16,,3). -, , CBC. , 3'-, 5'- , CBC ( ) ( ). 5'- CBC-(. .I.16,,4). ( , , .) , 158 , 5'- , - . , CBC U1- 5'- , , , , . 3'- -. , -, 3'- . , - ()- - m7GpppG , CBC. , -CBC , 3'- , , . 5'- 3'- (3540 ..) . , ()- - 5'- . , , , 3'- -, , . CBC - II . - II, , : U-. -, . - . in situ , , CBC 159 , Chironomus tentans. (3540 ...) , , -, 200 . , CBC . , , . , CBC CBP80 (NLS). ( 60 ) (90 ). NLS, , , , , NPC (nuclearporecomplex). NPC . , NLS, , . , GTP Ran, GTP, , . . , NPC. NLS . , NLS , CBC, . - CBC, , NPC . NPC CBC - . , GTP Ran GDP - 1601, GTP Ran(Ran GAP1), GTP. NLS-CBC, CBC-. , . U - , . - eIF-4E (. 2.5.1). CBC - . - . . - (.. )5'-. CBC - , , , , -. - - I, II III. , , - I III, 5'- m7G-, . . , , , , , . , .1612.3. , . , , , . -, - , . -, , , . (" ") , , , . , . , . , , , . , . ( ) . .1622.3.1. 1.3 - , . , . , , 3.2.4. , , . , -, , . , . , . , . , -, . , . , . (. , 1885 .) 163, . , SchizosaccharomycespombeG2 . , S. cerevisiae , , Sir3 Sir4 (silentinformationregulators), , , , . . , . , .. (1993 .), . , , neu 50% , . ,, , . , , , , . , , (. ). . (1993 .), , , , , , . , . 164 , - .2.3.2. - (nucleolus) . , . , , . , , , . , 250 44 ... , . . : (1), (2) (3) . , , -I, UBFI. , , . , , , . 165 28S18S , , . 1520 . , -, , . - , . , "" , , - I . , . , .. , . , . ~200 . : , ~20% . , , , , . , . . 166" " (cellularaging). , , , Cdc 14, . , RENT (regulator of nucleolar silencing and telophase exit), , , , .2.3.3. , . , , , , , . . , -, , . 320 . -, . , . "" "" , . 167 , . , , , , , . , ,. , - . -. , . , 2050 , . , . , , 4% . , , . , , - . , (NPC). NPC , , . , , (), - . , 168, -, . . , , . - - Chironomus tentans, . , - . -, , , , , , . , , 5- . - , . , -. , . , , . (genegatingmodel), . (1985 .), ( ) , . . , , .169 , , , . , , , . , in vitro 1 /. in vivo, 50 /. , , .2.3.4. - , . , . (coiledbodies). , , . , , U3. , U7-, (p80). . : G1. . 170. U7-, 3- -. , , -. PML. (PML) t(15;17) (15 17), PML-. PML, Zn2+- "RING", , . U1- 80 , , . PML . , , . PML- . , , PML. , . , PML . WT1. WT1 - , , . , , , , , . - 171"" (. 2.2.2) N-, Pro/Gln. WT1 GC-, . . WT1 , , .2.3.5. . , -, , (- , ),, -, . , , , . , . (. 4). , . , , , . , . , , , , , . , , : 1) ; 2) ; 3) 172. , , - II. , () () , . (), 4. . . , , , , . , . (. , .. , 1996 .), . , , . , , ( . 5.3). : , , , .. 173 .2.4. , , . , , , .. , , , . . , ( ), . , . , , . , . - . , , , , . - . .1742.4.1. 2,5 , , . . 80S , 70S. : 30S 50S, 40S 60S. 70S 5560 , 80S 7585. , .E. coli.50 . 5 , 61 , 1020. E. coli. 21 350 . 30S 16S , 1542(). 850 1450 . 34 , 23S(2904) 5S (120). , , , . . 23S CCA- , . 30S 50S , , 175 .. , : - , . , , . -. -, . 70S . 50S 3 , T. thermophilus 720 . , , 10 , , . "": , . , . (). 176 . - , . , . , , . , , , . , . , . , . . , 2-, , 510 . , , . , (Mg2+ Ca2+). Mg2+ , 177 . , . . I.17 E. coli , , . . , .. . , , . in vitro ., , . , , (2H 3). , , , , . , . 93. , , . 178 . , . , , 16S , . . . , . . I.18 70S E. coli, . () , .2.4.2. 1960- ., . E. coli, ., , : , . 70S 80S N- . , 179 . , . , . 5- , 3- . N- . E. coli. . 30S , , , ( , AUG) . 30S IF1, IF2IF3. GTP, IF2 (. . I.19). , 30S GTP, ( E. coli, , (fMet)-fMet). . Met Met-fMet, E. coli NH2- Met. 30S , . I.19 ( , , , ). , GTP, fMet-fMet 30S AUG- ( B). (C), . C ( ) 180 , . IF1IF3 50S , ( D). GTP GDP IF2 ( E). -fMet AUG- (P) , (A) . .. , , 70S , , , , . C- , . EF-Tu, GTP A- (. . I.20, 1). A- . , , A-. GTP EF-TuGDP ( 2) NH2- , A- - ( 3). . GDP GTP EF-TuGDP EF-Ts.181 , A-, E- ( . exit ). -. - A- P- . (4) . EF-G, GTP. , GTP . EF-G . A- . A- ( 1), -fMet E-, . 20 . 200 10 . . , A- P- , P- E-. A E , , A- E- , .EF-G. , IV EF-G EF-Tu. EF-G , 182EF-Tu , - . - EF-G . , IVEF-G A-, . , . . , A- () , - P- . RF1 RF2 . RF3, EF-G, EF-Tu, - . , - . , . , E. coli -. , . , -(RF) EF-G GTP , . RF4 ( RRF ribosome-recyclingfactor) . , -, P- E- () RF- A-. . IF3. , , 183 -, . . , , . E. coli . , , , , . () , ., E. coli, , . - , (, AUGA). , SD-, ( ). . , , . , . E. coli UUG , . IF3, 184 . , , (RF). R17, - 7 , , RF4 , , N- 7 . , - RF4 , - , .. . , (hybridstates model) A- P- 30S A-, P- E- . - - EF-TuGTP A/E. A- 30S , CCA-, EF-Tu, E- , , . GTP EF-Tu, CCA- - A- , A/A-, - A- . -, , P- , E- . - A/P-: A-30S , 185CCA- P- . P/E-: P- , CCA- E- . EF-G GTP- , , 30S . - P/P-, P-, E- E- . , . -, , . -, : , 30S . -, , , , . , . , , , S21 L11. , , . (displacementmodel). , , . . 186 . , , , . , , EF-Tu- GTP . GTP (cognate) (noncognate) , 104. EF-TuGDP , - -. -, GTP . , , , A-. , "" . A-vice versa. , P- A-: ram- P- , "" . , , A- P- , . 10Sa , . , 3- , . , , , 187 10Sa , E. coli ssrA, . , Ala3-, , . 10Sa , Ala, G3:U70, Ala. : Ala . 10Sa , , ANDENYALAA C- , UAA- 10Sa . C- , , .2.4.3. , . I.21 , . , . , , . , 7500 , . 4500 . , () . .188. 3- . , - A- . , -. C- - ,- . , .. 50S . -, . , . , -, . A- 50S , -, A-, . . . - P- . . , . , EF2(EF-G), , , GTP- . EF2(EF-G) GTP - GTP. -, 189. .. 30S , - 30S , . , - 30S . . ( ) 30S , . -, , A-. . - . . , .2.5. , . , , , , . , . ( . 7.4). 190 , . , . , , , S. cerevisiae.2.5.1. , , , , . , - 3'- (), , , , - . , , , . , . , - (), , 5'- (5'UTR 5'untranslated region), . , ()-, 3'- (3'UTR). . 5'UTR, , "-" (uORF upstreamopenreadingframe), (. ). 5'UTR 191, - . 5'UTR ( ) .3'UTR()- . , , 3'- ()- .2.5.2. , , , . () 5'- AUG-, 5'UTR. AUG-, 5'- -. , , , , . . , , . -, . , 5'- 3'- , 11 , 25 (. I.11). I.11 S. cerevisiae eIF1 Met- 40S 192 AUG- ( )eIF1A 40S60S , Met- ( )eIF2 , , eIF2B , , , , eIF2eIF3 , , , , , , , Met- 40S 40S60S eIF4A , - eIF4B , eIF4E - eIF4G G1(p150), G2(p130) eIF3, eIF4E Pab 1peIF4H eIF4B eIF4FeIF5 eIF5A , eIF6 40S60S , , , , . - . 5'--, - (CBC). CBC , . 2.2.4, CBC , . eIF2 Met-. eIF2 Met-in vitro. . 193GTP eIF2 Met- Met-eIF2GTP. , eIF2BGDPGTP eIF2GDP. . , 40S 40S-. , , . - . eIF4E - . eIF4E eIF4G eIF4F. , eIF4E eIF4G -. eIF4F, , eIF4A, eIF4G . eIF4F ATP- - , eIF4B. (1998 .) eIF4HeIF4FeIF4B, . eIF4F: p20, eIF4G eIF4E, ()- Pab 1p, eIF4G1. p20 4E-BP . eIF4G eIF3, eIF4E eIF4A. , eIF4G -, eIF4F. eIF4E ( ) 3.4.1.194, , -, eIF4G eIF3. , , , . 40S Met-eIF2GTP, Met., , 40S, Met-eIF2GTP eIF3 eIF4G. , , eIF4F, eIF4GeIF4E, -,eIF4A, - . , eIF1A. 5'UTR AUG-. 3'- ()- . , N- eIF4G , ()- Pab1p. 3'- ()- 60S , pab1. , , 3'- ()- -. , . . , AUG-, -, . 195 5'UTR (, SD-), TIR (translation initiation region), 3'- 16S . . , 5'UTR . . , - 5'UTR, "" AUG-. , . - SD- AUG- Met-, . . , ATP -, 5'UTR. , eIF4A, , eIF4B. , -, , 5'UTR, . AUG- eIF2. , . , eIF5 . 196, AUG IF3. eIF5, in vivo UUG. , eIF2 eIF5 - eIF2 eIF5. 40S 60S eIF5, . , GTP., eIF2GDP, , eIF1A eIF3. - , .. . AUG-. , AUG-, . A 3 AUG ( A AUG- +1), . , A- , AUG, , , GC. 5'UTR , GC- . AUG A, , , . , -, :AACAATGGC. 197 3 G +4. +5+6. , , . , , (leakyscanning). 3.4.1 (. . I.40,) . , AUG- , 5'UTR. , 5'- AUG . 5'3'. 5'UTR AUG, , (uAUG, uORF) . . , uAUG 5'-1520. AUG- . , , , , . . , AUG. , AUG. CUG AUC ACG. -AUG- . 198 eIF2 . AUU . 10% AUG, . , , . , , . , . , N- , , . . 5'UTR 40S . 5'- . , 30 / , - 5'- 52 . 5'UTR, , -. , , 5'- , 85%, 50 /., , AUG-, . , , 199 . , , 14, AUG-, , AUG. . , 35S (CaMV), , , (. . I.40,). , . , , . , . , , , in trans, .. , . , , . , , . , , . . , , , , .. . , 5'UTR . , , , . . , , .200 , 3.4. , : , ., , . , , , . AUG-. - IRES- (internal ribosome entry site). AUG- , TIR, IRES- , .. . , AUG- , - . , eIFGN- , eIF4E- . C- eIF3 eIF4A. () - - - , IRES- .2012.5.3. , , . , , . . eEF1A, EF1A(EF-Tu). , GTP -, -. eEF1B eEF2 EF1B(EF-Ts) EF2(EF-G) . eEF1B, , GDP GTP eEF1AGDP. eEF2, , - P- E-. (. 3.4). eEF1A eEF2 . , , . , , , , , . , . , , 202, . , -, . , E. coli, . . (. 3.6.1), , . eEF-3 . eEF3, . 116 , ATP . eEF1A-GTP - , - . ATP, . , , , . , eEF3 .2.5.4. , , -. . , RRF/RF4. . , -, 203 , - (RF), eRF1 eRF3. eRF1 (UAA, UAGUGA) . eRF3 GTP, eEF1A, , GTP, .. . C- . : UAA(53%) > UGA(27%) > UAG(20%). , UAA 87%. , . - lacZ : G>U>A>C (UGA), G>A>U>C (UAA) A>U>C>G (UAG). - . - eRF- . , , , - . E. coli: , . UGA UCC(Ser), UUCUUU(Phe), UUA AAG(Lys). 204-, P- , - RF- A-. - E. coli .2.5.5. , , , ATP. (), . , - ( Rickettsia prowazekii), -. , -, ( ) 13 , 22 . . ( 16569 ..), . - , . --, . , . . 205, , . , N- , . . , . . TGA Trp, . , AGR( R=A G) , Ser, , , Arg. , . , 32 , . , 22 13 . U(wobble) , .. , , , . , . , , . , 104), , . , Y. , VNTR-.1985. .. , , , . . , , , -, . 1520 , 3,5 ..., 719, . . II.36 . -, , . , , , , . -, , . , , , , , . -, :( , ) . , () . , . - : (x), . , . (.. ), , . , x , , . , , 33.6 33.15, , 720x, . -, .-, , ,. , , , . , , . -, , . , , (.. , ), . . , . : -, ( ) , . , MS1 (D1S7) , 99% , (0,05 ) , , (. II.37,). D1S80 (84%) (. . II.37,). 721. ., , . , , 90%, . . (). , 75% , 99,6% . , . . . - , , . , , , , , . -, , , , , (. . II.37,,). . -, , 90% AluKpnI, , , Alu. , KpnI . , . , . .12.1.3. , . , .. , 741 (. II.39). . () .. , FISH. , , . 10 ... in situ , , FISH, 25 ... , in situ, , 100 ... . , , . , .. () () . , , . , , 742 .12.1.4. , (top-downmapping) (bottom-upmapping). (. II.40,) . ( NotI) , . , , . . ( , 110 ...). (. . II.40,) (101000..), . (BAC) (YAC), 7.2.4. (contiguous) , (contig). in situ(FISH) . , , . - .743 , , . , (linking). , , , . , , , . , . , , , .12.2. ( ) . , , , . , , .1977. . . , . 744. , in vitro , . , . , . . , Y- 50 ..., 0,1 ... , 3.12.3. . , . ~200 1000 . . . , 31999 22 .745 . . , , , , . GDB(GenomeDataBase), . (, ). , , . . (OnlineMendelianInheritanceinManDatabase), . , : GenBankGenomeSequenceDataBase(GSDB) ,EuropeanMolecular BiologyLaboratory(EMBL)NucleotideSequenceDatabase, DNADataBankofJapan(DDBJ). 1996 200 ... , , , . (Hugene) , . Protein Identification Resource (). ? , , . 746 , . - . . , 5.3, , 90% , , () , . , .747 . , , . . . , , , , , .. 1990- . , . , C. elegans, . . , ( ) . . 10 000 (""). ( ) , 748-. (.. , 1998 .), , , . , , . . , , . , , , -, . , , . , , , - , -, .. . (), ( ), (). , , , , .749 . . . , - . , . - . , ( ) . , . , , - . . , , , . , , . , . 750 , . .: .-, , , . ? - , , - . . . , -, . . . . . . . . - . , , . ( ) . , 751 - . : , 752 Barbieri M. The organic codes. The basic mechanism of macroevolution. // Biology Forum. 1998. Vol. 91. P. 481514. 1 .. . .: , 1989. 254 . .., .. // . . 1978. .12. . 12051230. ..- // . 1995. .29. . 965982. .. . : , 1993. 564 . . // . .. . .: . . 1990. 352 .Adams C.R., Kamakaka R.T. Chromatin assembly: Biochemical identities and genetic redundancy // Curr. Opinion Genet. Develop. 1999. Vol. 9. 185190.Debrauwere H., Gendrel C.G., Lechat S., Dutreix M.Differences and similarities betweenvarioustandemrepeat sequences: Minisatellitesandmicrosatellites// Biochemie. 1997. Vol. 79. P. 577586.Gregory T.R., Hebert P.D.N. The modulation of DNA content: Proximate causes and ultimate consequences // Genome Res. 1999. Vol. 9. P. 317324.Gruss C.,Knippers R.Structure of replicatingchromatin// Progr. Nucl.AcidsRes. Mol. Biol. 1996. Vol. 52. P. 337365.Hart C.M., Laemmli U.K. Facilitation of chromatin dynamics by SARs // Curr. Opinion Genet. Develop. 1998. Vol. 8. P. 519525.753vanHoldeK., Zlatanova J.Whatdeterminesthe foldingofthechromatin fiber?// Proc. Natl. Acad. Sci. USA. 1996. Vol. 93. P. 1054810555.Kornberg R.D., Lorch Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome // Cell 1999. Vol. 98. P. 285294.Mushegian A.R., Koonin E.V.Aminimal gene set for cellular life derived by comparison of complete bacterial genomes // Proc. Nat. Acad. Sci. US. 1996. Vol. 93. P. 1026810273.Olsen G.J., Woese C.R.Lessons from an Archaealgenome: What are we learning from Methanococcus jannaschii? // Trends Genet. 1996. Vol. 12. P. 377379.Poljak L., Kas E.Resolving the role of topoisomerase II in chromatin structure and function // Trends Cell Biol. 1995. Vol. 5. P. 348354.Razin S.V.Functional architecture of chromosomal DNAdomains // Crit. Rev. Eukaryotic Gene Expression. 1996. Vol. 6. P. 247269.Robinow C., Kellenberger E. The bacterial nucleoid revisited // Microbiol. Rev. 1994. Vol. 58. P. 211232.Workman J.L., Kingston R.E. Alteration of nucleosome structure as a mechanism of transcriptional regulation // Annu. Rev. Biochem. 1998. Vol. 67. PP. 545579. 2 : / . .. . .: . . 1990. 352 . .. . . .: . ., 1986. 303 .Chakraburtty K.Functional interaction of yeast elongation factor 3 with yeast ribosomes // Intern. J. Biochem. Cell Biol. 1999. Vol. 31. P. 163173.Cate J.H., Yusupov M.M., Yusupova G.Zh.et al.X-raycrystal structures of 70S ribosome functional complexes // Science. 1999. Vol. 285. P. 20952104.Edmondson D.G., Roth S.Y.Chromatin and transcription // FASEB J. 1996. Vol. 10. P. 11731182.754Frank J. The ribosome at higher resolution the donut takes shape // Curr. Opinion Struct. Biol. 1997. Vol. 7. P. 266272.Futterer J.,Hohn T.Translationinplants rules andexceptions //PlantMol.Biol. 1996. Vol. 32. P. 159189.GreenR., Noller H.F.Ribosomes andtranslation// Annu. Rev. Biochem.1997. Vol. 66. P. 679716.Gregory P.D., Hrz W.Life with nucleosomes: Chromatin remodeling in gene regulation // Curr. Opinion Cell Biol. 1998. Vol. 10. P. 339345.Hampsey M.Molecular geneticsof theRNApolymerase II general transcriptional machinery // Microbiol. Mol. Biol. Rev. 1998. Vol. 62. P. 465503.Hodges P., Scott J.Apolipoprotein B mRNA editing: A new tier for controlof gene expression // Trends Biochem. Sci. 1992. Vol. 17. P. 7781.Koleske A.J., Young R.A. The RNA polymerase holoenzyme and its implications for gene regulation // Ibid. 1995. Vol. 20. P. 113116.Lamond A.I., Earnshaw W.C. Structure and function in the nucleus // Science. 1998. Vol. 280. P. 547553.LatchmanD.S.Transcriptionfactors:Anoverview// Intern. J. Biochem. Cell. Biol. 1997. Vol. 29. P. 13051312.Lewis J.D., Izaurralde E. The role of the cap structure in RNA processing and nuclear export // Europ. J. Biochem. 1997. Vol. 247. P. 461469.McCarthy J.E.G. Posttranscriptional control of gene expression in yeast // Microbiol. Mol. Biol. Rev. 1998.Vol. 62. P. 14921553.McKendrick L., Pain V.M., Morley S.J.Translationinitiationfactor 4E// Intern. J. Biochem. Cell. Biol. 1999. Vol. 31. P. 3135.Morse R.H. Transcribed chromatin // Trends Biochem. Sci. 1993. Vol. 17. P. 2325.Orphanides G., Lagrange T., Reinberg D.The generaltranscription factors of RNA polymerase II // Gen. Develop. 1996. Vol. 10. P. 26572683.Reines D., Conaway J.W., Conaway R.C. The RNA polymerase II general elongation factors // Trends Biochem. Sci. 1996. Vol. 21. P. 351355.755Smith H.C., Sowden M.P. Base-modification mRNA editing through deamination the good, the bad and the unregulated // Trends Genet. 1996. Vol. 12. P. 418424.Sugiura M., Hirose T., Sugita M.Evolution and mechanism of translation in chloroplasts // Annu. Rev. Genet. 1998. Vol. 32. P. 437459.Taanman J.-W.Themitochondrial genome: Structure,transcription, translationand replication // Biochim. et Biophys. acta. 1999. Vol. 1410. P. 103123.Tsukiyama T., Wu C. Chromatin remodeling and transcription // Curr. Opinion Genet. Develop. 1997. Vol. 7. P. 182191.Uptain S.M., Kane C.M., Chamberlin M.J. Basic mechanisms of transcript elongation and its regulation // Annu. Rev. Biochem. 1997. Vol. 66. P. 117172.WittmannH.-G.RibosomenundProteinbiosynthese// Biol. Chem. Hoppe-Seyler. 1989. Vol. 370. P. 8799.Workman J.L., Kingston R.E. Alteration of nucleosome structure as a mechanism of transcriptional regulation // Annu. Rev. Biochem. 1998. Vol. 67. P. 545579.Yarnell W.S., Roberts J.W.Mechanismof intrinsic transcription termination and antitermination // Science. 1999. Vol. 284. P. 611615. 3 .. . : , 1993. 491 . . . .: , 1987. 544 . : / . .. . . . ., 1990. 352 .Bashirullah A.,Cooperstock R.L.,Lipshitz H.D.RNA localization in development // Annu. Rev. Biochem. 1998. Vol. 67. P. 335394.Blumenthal T.Trans-splicing and polycistronic transcription inCaenorhabditis elegans // Trends Genet. 1995. Vol. 11. P. 132136.Bock A., Forchhammer K., Heider J. et al. Selenoprotein synthesis: An expansion of 756the genetic code. // Trends Biochem. Sci. 1991. Vol. 16. P. 463467.Bochtler M., Ditzel L., Groll M. et al. The proteasome // Annu. Rev. Biophys. Biomol. Struct. 1999. Vol. 28. P. 295317.Bohley P. The fate of proteins in cells // Naturwissenschaften. 1995. Vol. 82. P. 544550.Calkoven C.F., Geert A.B. Multiple steps in the regulation of transcription-factor level and activity // Biochem. J. 1996. Vol. 317. P. 329342.Callis J. Regulation of protein degradation // The Plant Cell. 1995. Vol. 7. P. 845857.Chabot B.Directing alternative splicing: Cast and scenarios // Trends Genet. 1996. Vol. 12. P. 472478.Clark A.L., Docherty K.Negative regulation of transcription in eukaryotes // Biochem.J. 1993. Vol. 295. P. 521541.Cooper A.A., Stevens T.H.Protein splicing, self-splicing of genetically mobile elements at the protein level // Trends Biochem. Sci. 1995. Vol. 20. P. 351356.EvdokimovaV.M., OvchinnikovL.P.Translational regulationbyY-boxtranscription factor: Involvement of the major mRNA-associated protein, p50 // Intern. J. Biochem. Cell Biol. 1999. Vol. 31. P. 139149.Farabaugh P.J.Programmed translational frameshifting // Microbiol. Rev. 1996. Vol. 60. P. 104134.Futterer J., Hohn T.Translation in plants rules and exceptions // Plant Mol. Biol. 1996. Vol. 32. P. 159189.Gerasimova T.I., Corces V.G.Boundary and insulator elements in chromosomes // Curr. Opinion Genet. Develop. 1996. Vol. 6. P. 185192.Guarente L. Transcriptional coactivators in yeast and beyond // Trends Biochem. Sci. 1995. Vol. 20. P. 517521.Jentsch S.,Schlenker S.Selective proteindegradation:Ajourneys endwithinthe proteasome // Cell. 1995. Vol. 82. P. 881884.Latchman D.S. Eukaryotic transcription factors // Biochem J. 1990. Vol. 270. P. 281289.757Lyon M.F. X-chromosome inactivation // Curr. Biol. 1999. Vol. 9. P. R235R237.McCarthy J.E.G. Posttranscriptional control of gene expression in yeast // Microbiol. Mol. Biol. Rev. 1998.Vol. 62. P. 14921553.Mor A., Amiche M., Nicolas P.Enter a new post-translational modification:D-amino acids in gene-encoded peptides // Trends Biochem.Sci.1992.Vol.17. P. 481485.Morse R.H. Transcribed chromatin // Trends Biochem. Sci. 1992. Vol. 17. P. 2326.Orphanides G., Lagrange T., Reinberg D.The generaltranscription factors of RNA polymerase II // Genes Develop. 1996. Vol. 10. P.