Top Banner
SCREENING SCREENING
127

Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Feb 27, 2018

Download

Documents

lyanh
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

SCREENINGSCREENING

Page 2: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Methods of prenatal diagnosisMethods of prenatal diagnosis

Invasive:Amniocentesis

Non-invasiveMaternal serum AFP Amniocentesis

Chorionic villus sampling

Maternal serum AFPMaternal serum screenUltrasonography sampling

CordocentesisFetoscopy

UltrasonographyIsolation of fetal cells /DNA from maternal Fetoscopy

Preimplatation genetic diagnosis

/DNA from maternal circulation

genetic diagnosis

Page 3: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Prenatal diagnosis ofScreening milestones

First chromosomal analyses from amniotic fluid

Prenatal diagnosis of Down syndrome

Trisomy 21 identified as

amniotic fluidRaised AF-AFP associated with open Neural tube defectsy

cause of Down Syndrome

Maternal serum marker

Neural tube defects

Triple test

Maternal serum markerfor Down syndrome

Association between maternal

Triple test introduced

Nuchal translucency introducedbetween maternal

age and Down syndrome

d

introduced

Page 4: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

UltrasoundUltrasound

90 Hydrops <17 weeksCystic hygroma

607080

Cystic hygromaA-V canalHoloprosencephalyO h l l

405060 Omphalocele

Hydrops >24 weeksCardiac defect

203040 Duodenal atresia

Bladder outlet obstructionDiaphragmatic hernia

010

p gLimb reductionHydrocephalusClubbed footAneuploidy Risk Clubbed footFacial cleft

Page 5: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Markers for fetal aneuploidies

•• Biochemical markersBiochemical markersH h i i d i (hCG)–Human chorionic gonadotropin (hCG)

–Free b‐subunit of hCG (Fb‐hCG)–Alpha‐fetoprotein (AFP)–Un‐conjugated estriol (uE3)–Pregnancy associated plasma protein A (PAPP‐A)– Inhibin‐A

•• Ultrasound markersUltrasound markers–Nuchal translucency (NT)y ( )

Page 6: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Biochemical profiles for other l idi i th 2 d t i taneuploidies in the 2nd trimester

A l idiAneuploidiesMarker T21 T18 T13 Turner

AFP LL - Inc Dec

hCG HH VV-- LL N VV--HH

uE3 LL LL N Dec

I hibi A HH N VV HHInhibin A HH - N VV--HH

Page 7: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

M. Houshmand

Page 8: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Integrated screeningstrategies (1st and 2nd trim)strategies (1st and 2nd trim) 

1st trimester:NT, PAPPNT, PAPP--AA

1st trimester: NT, PAPPNT, PAPP--AA, Fb, Fb--hCGhCG

1st trimester:NT PAPPNT PAPP AA FbFb hCGhCGMain strategies:

• F ll IntegratedNo risk estimate

,, ,,

Risk estimate CVSHigh risk

NT, PAPPNT, PAPP--AA, Fb, Fb--hCGhCG

Risk estimate CVSHRNo further screening LR

• Fully Integrated 

• Step‐wise sequential2nd trimester:

FbFb--hCG, AFP, uEhCG, AFP, uE33,, ((±± InhibinInhibin))

Low risk

2nd trimester:

Borderline risk

g

Step wise sequential

• Contingent screening

, ,, , ,, (( ))

Final risk estimate:

2nd trimester:FbFb--hCG, AFP, uEhCG, AFP, uE33,, ((±± InhibinInhibin))

FbFb--hCG, AFP, uEhCG, AFP, uE33,, ((±± InhibinInhibin))

g g Final risk estimate:All markersAll markersFinal risk estimate:

All markersAll markersFinal risk estimate:

All markersAll markers

Page 9: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Weeks Prenatal TestsUltrasound, basic prenatal tests, Iron count(anemia), infections, blood

6 - 8Ultrasound, basic prenatal tests, Iron count(anemia), infections, blood platelet, blood type, RH type, Hepatitis B (antigen, antibody), STDs (syphilis, AIDS), Rubella

8 15 Ultrasound amniocentesis Chorionic villi sampling (if needed)8 - 15 Ultrasound, amniocentesis, Chorionic villi sampling (if needed)

11 - 13 Measurement of nuchal fold thickness (3D ultrasound): Early detection of Down's Syndrome

15 - 20 Triple marker test, Genetic abnormalities (Screening for Down's Syndrome 60%, neural tube defect 80%)

20 24 L l II Ult d (3D 4D lt d) G t ti l Di b t20 - 24 Level II Ultrasound (3D, 4D ultrasound), Gestational Diabetes

26 - 28 Gestational diabetes screening

28 Iron count(anemia) re-test, urine test for level of protein and sugar(test repeated as needed)

Pre delivery examination and testing

M. Houshmand36 - 38

y gIron count(anemia), infections, blood platelet, syphilis, liver function, kidney function, blood coagulation test, ECG, chest X-ray, fetal movement

Page 10: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

NIPT

NON – INVASIVE  PRENATAL  TEST

Testing of cff DNA (cell free fetal DNA)

from maternal blood during pregnancy

for trisomy 21, 18 and 13 

Page 11: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Percent of Reported Chromosome Abnormalities

5

16 T21

T18

8

5 T18

T13Major fetal

535

45,X

Sex trisomy

Major fetalaneuploidies

13y

Other rare

Page 12: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Trisomy 21, 18, 13 screening

Trisomy 21 (Down syndrome)Trisomy 21 (Down syndrome)

Trisomy 18 (Edwards syndrome)

Trisomy 13 (Patau syndrome)

Page 13: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Current Diagnostic Options ‐K tKaryotype

Trimester ‐ Test Sensitivity Specificity

1st – CVS 99.25% 98.65%1 CVS 99.25% 98.65%

2nd Amniocentesis 99 4%2 99 5%

Definitive answers, but are invasive and come with risk to the 

2nd ‐ Amniocentesis 99.4%2 99.5%

,patient Most are unnecessary due to the high rate of false positives in screening**screening**

.

Page 14: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Spectrum of Prenatal Testing*p g

SCREENING DIAGNOSTICRisk scores are generated and modified based on biochemical analysis and population statistics

Results are based entirely on genetic factors

Serum Screening CVS

AmnioNIPTCombined Serum

Screens, NT, Ultra-sound

SCREENING DIAGNOSTIC

.

*Not meant to represent percentage of accuracy

Page 15: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

What Are the Goals of NIPT?

Reduce exposure of Reduce false

positivespfetus to risk positives

Testing thatEnable a

high detection

rate

Testing that can easily be offered

to all t ratepregnant

women

.

Page 16: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Two Sources of Fetal DNA in Maternal BloodBlood

F l ll• Fetal cells– 1 in a billion of total cell population

– Require isolation via mechanical and/or biochemical means

• Cell‐free DNA (cfDNA) – Maternal blood contains both maternal and fetal cfDNA

– 2–20% of total cfDNA is fetal

.

Page 17: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Fetal Cell‐free DNA in Maternal Blood

A Reliable Analyte During Pregnancy

– Released through apoptosis

• Fetal cfDNA likely arises from ycytotrophoblastic cells of placenta 

– Released into bloodstream as small DNA fragments (150‐200bp)

– Reliably detected after 7+ weeks– Reliably detected after 7+ weeks gestation

U d bl i hi h– Undetectable within hours postpartum.   

Page 18: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Which Patients Should Be Offered NIPT?

Patients Wanting Early, Accurate Test And Are At High RiskPatients Wanting Early, Accurate Test And Are At High Risk Of Aneuploidy Due To: 

Maternal age-related risksPositive results on maternal serum screeningPositive results on maternal serum screeningAbnormal ultrasound finding(s)Prior pregnancy with aneuploidyParental Robertsonian translocation involving gone of the tested chromosomes

Page 19: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

1

Page 20: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

NO  NIPT  for  sex  aneuploidies

Phenotype for sex aneuploidies is highly variableyp p g y

Mosaicism in the fetus is a problem

Mosaicism in the mother is a problem

NIPT for sex aneuploidies is less accurate

2

NIPT for sex aneuploidies is less accurate

Page 21: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

NIPT is NOT the test of choice when there NIPT is NOT the test of choice when thereis :

F l li l d• Fetal anomalies on ultrasound 

• A triplet pregnancy 

• Vanishing twin

• Known genetic anomalies that cannot be diagnosed by NIPT 

Page 22: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

NIPT  Advantages versus combi test with AC / CVSCVS

• High sensitivity (few false‐negatives)

• High specificity (few false‐positives)

• More than T21• More than T21

• Non‐invasive : no fetal risk• CVS : Risk of miscarriage : 1‐2 %• AC    : Risk of miscarriage : 0.5 %

Page 23: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

NIPTresults

1. Normal result : no specific follow up necessary, unless ultrasound examination of the fetus reveals anomalies 

2 Test failure : in < 2 % pregnancies not enough fetal2. Test failure : in < 2 % pregnancies not enough fetal DNA : NIPT repeated at no extra cost.

3. Abnormal NIPT result : confirmation by amniocentesis or chorionic biopsy

Page 24: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Screening OptionsTest When Done Detection Rates

1st trimester 10-14 weeks T21 -- 83%(NT + 2 serum) T18 – 80%Ultrasound 18-20 weeks T21 -- 60%; T18 -- 85%

NTD -- 70-98%

Quadruple screen 15-21 weeks T21 -- 75-80%; T18 --(4 serum analytes) 60%

NTD -- 80-90%*Integrated screen 10 14 weeks T21 92%*Integrated screen(1st trimester screen + quadruple screen)

10-14 weeks15-21 weeks

T21 -- 92%T18 -- 90%NTD -- 80%q p ) NTD 80%

Maternal serum >7 weeks T21 - >99%Other aneuploidy?

Page 25: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Dosage of chromosome 21(RNA‐SNP allelic ratio method)( )

• Quantitative analysis of SNPs in PLAC4mRNA

Trisomy 21 pregnancyEuploid pregnancy

TTT

C CC

T : CT : C T   :   C2  :   1

T   :   C1   :   1 Allele Ratio

Page 26: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

What’s New in Newborn Screening

Page 27: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Purpose of Newborn Screening

• Program to screen for congenital and heritableProgram to screen for congenital and heritable disorders

• These disorders may cause severe mental• These disorders may cause severe mental retardation, illness, or death if not treated early in lifein life

• If treated, infants may live relatively normal lives• Results in savings in medical costs over time

Page 28: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Results from Lab

• Normal Screen • Abnormal results• Normal Screen Results

• Abnormal results–Results are 

t d t C–Results are sent to submitter when all 

reported to Case Management as 

il bltest are final soon as available for that disorder 

Page 29: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Tandem Mass Spectrometer ( S/ S)(MS/MS)

• Molecules are sorted & weighed by mass• Molecules are sorted & weighed by mass• Compounds analyzed are amino acids & acylcarnitines–Amino acids: building blocks for proteinsg p–Acylcarnitine= Carnitine (vehicle) +fatty acid

• Identified by size of fatty acid: short medium long• Identified by size of fatty acid: short, medium, long and designated by initials & numbers

Page 30: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Specimen Collection to Treatment

Page 31: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Mass Spectrometry-based Di tiDiagnostics

• MALDI‐TOF MS:matrix‐assisted laserMALDI TOF MS:matrix assisted laser desorption/ionization‐time of flight mass spectrometryspectrometry

• SELDI ‐TOF MS: surface‐enhanced laser desorption/ionization time of flight massdesorption/ionization‐ time of flight mass spectrometry

Page 32: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 33: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 34: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 35: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

M. Houshmand

Sansom, Molecular Medicine Today, March 1999

Page 36: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

M. Houshmand

Page 37: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Organic Acid Metabolism Disorders

• IVA ‐ Isovaleric acidemiaGA I Gl i id i I• GA I – Glutaric acidemia type I

• HMG – 3‐OH 3‐CH3 glutaric aciduria• MCD – Multiple carboxylase deficiency• MUT – Methylmalonic acidemia (mutase def)• 3MCC – 3‐Methylcrotonyl‐CoA carboxylase deficiency

• Cbl A,B – Methylmalonic acidemia• PROP – Propionic acidemia

M. Houshmand

p• BKT – Beta‐ketothiolase deficiency

Page 38: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Fatty Acid Oxidation Disorders

• MCAD – Medium‐chain acyl‐CoAMCAD  Medium chain acyl CoA dehydrogenase deficiency

• VLCAD – Very long‐chain acyl‐CoAVLCAD  Very long chain acyl CoA dehydrogenase deficiency

• LCHAD – Long‐chain L‐3‐OH acyl‐CoALCHAD  Long chain L 3 OH acyl CoA dehydrogenase deficiency

• TFP – Trifunctional protein deficiencyTFP  Trifunctional protein deficiency• CUD – Carnitine uptake defect

Page 39: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Amino Acid Metabolism  Disorders

• PKU – PhenylketonuriaPKU  Phenylketonuria• MSUD – Maple syrup urine disease

C i i• HCY – Homocystinuria• CIT – Citrullinemia• ASA – Argininosuccinic acidemia• TYR I – Tyrosinemia type ITYR I  Tyrosinemia type I

Page 40: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Hemoglobinopathies

• SCA – Sickle cell anemiaSCA        Sickle cell anemia• Hb S/Th – Hb S/ Beta‐thalassemia

b S/C b S/C di• Hb S/C    – Hb S/C disease

Page 41: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Others

• HYPOTH – Congenital hypothyroidismHYPOTH  Congenital hypothyroidism• BIOT – Biotinidase deficiencyC C i l d l h l i• CAH – Congenital adrenal hyperplasia

• GALT – Galactosemia• HEAR – Hearing deficiency

Page 42: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

New Screen will not require additional blood spotsadditional blood spots

Page 43: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

The Heel Test

M. Houshmand

Page 44: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

44

Page 45: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

M. Houshmand

Page 46: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

M. Houshmand

Page 47: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

What makesWhat makes a good spot?

M. Houshmand

Page 48: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Looking into the future Looking into the future

Page 49: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 50: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 51: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Carrier Status DNACarrier Status DNA•Screens patients for more than 70 recessive genetic didiseases•Supported by rigorous science using clinically-

l t ll lid t d k drelevant, well-validated markers and assays•Enables physicians to offer calculated guidance on

d t t l h lthpre- and postnatal health

Page 52: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Ashkenazi Jewish Conditions

ACOG-Recommended Conditions*Beta-thalassemia

Ashkenazi Jewish ConditionsBloom syndromeCanavan diseaseBeta thalassemia

Canavan diseaseCystic fibrosisF ili l d t i

Cystic fibrosisFactor XI deficiencyFamilial dysautonomiaFamilial dysautonomia

Sickle cell diseaseTay-Sachs disease

yFanconi anemiaGaucher diseaseGlycogen storage diseaseAlpha-thalassemia

Fragile X syndromeSpinal muscular atrophy (SMA)

Glycogen storage disease, type 1AMaple syrup urine diseaseSpinal muscular atrophy (SMA) Mucolipidosis IVNiemann-Pick diseaseTay-Sachs diseaseyTyrosinemia

Page 53: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Additional Conditions3-Methylcrotonyl-CoA carboxylase deficiencyAcrodermatitis enteropathica

Dubin-Johnson syndromeFamilial Mediterranean feverGalactokinase deficiencyAlpha-1 antitrypsin deficiency

Amyotrophic lateral sclerosisArgininosuccinate lyase deficiencyA t i l l d l d t I

Galactokinase deficiencyGalactosemiaGlutaric acidemia, type 1GM1-gangliosidosisAutoimmune polyglandular syndrome, type I

Bartter syndrome, type 4ABeta-ketothiolase deficiencyBiotinidase deficiency

g gHemochromatosisHemoglobin CHemoglobin EBiotinidase deficiency

Carnitine deficiency, primary systemicCerebrotendinous xanthomatosisCitrullinemia, type I

HMG-CoA lyase deficiencyHomocystinuria, cblE typeHomocystinuria, classicH l dCitrullinemia, type I

Crigler-Najjar syndromeDiabetes, permanent neonatalDihydropyrimidine dehydrogenase deficiency

Hurler syndromeMethylmalonic acidemiaMucolipidosis IIMucolipidosis IIIy py y g y

Ehlers-Danlos syndrome, hypermobilityHearing loss, DFNB1 and DFNB9 nonsyndromicHearing loss, DFNB59 nonsyndromic

Mucolipidosis IIIMultiple carboxylase deficiency

Page 54: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

PhenylketonuriaPolycystic kidney diseasePompe diseasePompe diseasePrekallikrein deficiencyPropionic acidemiaProthrombin deficiencyyRh-null syndromeRickets, pseudovitamin D-deficiencySandhoff diseaseSick sinus syndromeSpherocytosis, hereditaryTay-Sachs pseudodeficiency

h b i i l k iThrombocytopenia, congenital amegakaryocyticLipoprotein lipase deficiency, familialMedium-chain acyl-CoA dehydrogenase deficiencyEhlers Danlos syndrome dermatosparaxisEhlers-Danlos syndrome, dermatosparaxisEhlers-Danlos syndrome, kyphoscolioticNephrotic syndrome, steroid-resistantShort-chain acyl-CoA dehydrogenase deficiencyShort chain acyl CoA dehydrogenase deficiencyVery long-chain acyl-CoA dehydrogenase deficiencyVon Willebrand disease, type 2 NormandyVon Willebrand disease, type 3

Page 55: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 56: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 57: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 58: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 59: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Cardiac DNA provides information that allows the pphysician to:•Better monitor a patient’s specific health condition.

•Prescribe a more optimal medication and dosage for a patient.

•Suggest early lifestyle and diet interventions to help combat or prevent certain health conditions.

Page 60: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Cardiac DNA Insight analyzes a patient’s uniqueCardiac DNA Insight analyzes a patient s unique genetic markers, which influence a broad range of heart-related conditions, including ApoE, HDL andheart related conditions, including ApoE, HDL and LDL cholesterol levels, and risks for hypertension and myocardial infarction. This simple saliva or blood-myocardial infarction. This simple saliva or bloodbased test is supported by scientifically validated genetic testing technologies using clinically relevantgenetic testing technologies using clinically relevant markers and assays.

Page 61: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Heart Disease/Atrial FibrillationAtrial fibrillationBeta-blockers, LVEF responseCaffeine metabolismCoronary artery diseaseMyocardial infarctionSimvastatin-induced myopathyVerapamil and QTc interval

Page 62: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Peripheral Arterial Disease/Venous ThrombosisCl id l b li (Pl i )Clopidogrel metabolism (Plavix)Estrogen supplementation (risk of venous thrombosis)P i h l i l diPeripheral arterial diseaseVenous thrombosisW f iWarfarin

Page 63: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

HypertensionBeta blockersBeta-blockersHypertensionMetoprolol metabolismMetoprolol metabolismPerindopril (ACE inhibitor-therapeutic benefit)Verapamil vs atenolol (benefit of)Verapamil vs. atenolol (benefit of)

Page 64: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Cardiovascular HealthApoE and cardiovascular diseaseApoE and cardiovascular diseaseGenetic risk for decreased folateGenetic risk for decreased HDL cholesterolGenetic risk for decreased HDL cholesterolGenetic risk for elevated LDL cholesterolGenetic risk for elevated triglyceridesGenetic risk for elevated triglyceridesSickle cell anemia

Page 65: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Mental Health DNA analyzes a patient’s DNA to identify genetic variants that affect the metabolism and efficacy of psychiatric medications. Genetic research suggests that categorizing individuals based on genotypes will make the pharmacologic treatment of psychiatric illnesses more predictable and effective. Mental Health DNA can help a physician predict a patient’s response to more than 40 common antidepressants, mood stabilizers and antipsychotic medications. The report provides outcomes in a clear color-coded chart.

Page 66: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

This test can enable a physician to choose an appropriate medication with less trial and error as well as minimizing a patient’s risk of adverse side effects. Mental Health DNA Insight is supported by scientifically validated genetic testing technologies using clinically relevant markers and assays.

Page 67: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

AntidepressantsAmitryptylineBuspirone

Mood StabilizersCarbamazepineGabapentin

AntipsychoticsAripiprazoleAsenapinep

CitalopramClomipramineDesipramine

pLamotrigineOxcarbazepineTopiramate

ChlorpromazineClozapineFluphenazineH l id lDoxepin

DuloxetineEscitalopramFl ti

Valproic acid HaloperidolIloperidoneLoxapineLurasidoneFluoxetine

FluvoxamineMirtazapineNortriptyline

LurasidoneOlanzapinePaliperidonePerphenazineNortriptyline

ParoxetineSertralineTrazodone

PerphenazineQuetiapineRisperidoneThioridazineTrazodone

TrimipramineVenlafaxine

ThiothixeneTrifluoperazineZiprasidoneZuclopenthixol

Page 68: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 69: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Healthy Weight DNA may help with:Weight managementDisease preventionMaximizing energyImprovement to overall health

Understanding a person’s genetic propensity to specific diets, eating behaviors, nutritional needs,specific diets, eating behaviors, nutritional needs, exercise activity and health conditions is important to true, long-term success in weight management.to true, long term success in weight management.

Page 70: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Eating BehaviorsEating disinhibitionFood desire

Weight and DietGenetic risk for decreased adiponectinGenetic risk for decreased omega 6 andFood desire

Satiety – feeling fullSnacking

h

Genetic risk for decreased omega-6 and omega-3Matching diet type

Sweet toothHealth ConditionsDiabetes, type 2

MetabolismObesityResponse to monounsaturated fats, yp

OsteoarthritisVenous thrombosisMedication Response

pResponse to polyunsaturated fatsWeight loss – regain

M t b li H lth F tMedication ResponseClopidogrel metabolism (Plavix)Simvastatin-induced myopathyW f i

Metabolic Health FactorsGenetic risk for decreased HDL cholesterol

WarfarinExercise ResponseEndurance training

Genetic risk for elevated LDL cholesterolGenetic risk for elevated triglycerides

HDL (good) cholesterol response to exerciseInsulin sensitivity response to exercise

Genetic risk for elevated triglycerides

Page 71: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Nutritional NeedsGenetic risk for decreased vitamin AGenetic risk due to decreased vitamin B2Genetic risk for decreased vitamin B6Genetic risk for decreased vitamin B6Genetic risk for decreased vitamin B12Genetic risk for decreased vitamin CG ti i k f d d it i DGenetic risk for decreased vitamin DGenetic risk for increased vitamin EGenetic risk for decreased folate

Page 72: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 73: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 74: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Looking into the futureLooking into the future

Page 75: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Immunculus (Immunologic ( gHomunculus) and prognosticand prognostic

medicine

Page 76: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Would you like to know the future of your health

Is it possible ?

Yes, certainly!by using multiple auto-Abs evaluations

Page 77: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Immune system

The maintenance of l l h t i fsystem

Each 10th

molecular homeostasis of the body by different ways

d h i

Including clearance of organism from

cell of the body (!) is lymphocyte

and mechanisms

g gwaste products of apoptotically died

cells

lymphocyteIs it main function

(anti-microbe struggle is only small part of the main homeostatic

?part of the main homeostatic function of the immune system)

Struggle against microbes

Page 78: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

The main points:The main points:Indi id al differences in apoptosis in cells of Li er Kidne s Heart orIndividual differences in apoptosis in cells of Liver, Kidneys, Heart, or other organs is minimal in health state

Therefore: Individual variability in productions of antigenic wastage is minimal

Antigen-dependent regulation of Ab production (by feedback principle)production (by feedback principle)

Therefore: Nearly the same levels of production of auto-Abs – scavengers in each healthy person

Page 79: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Abnormal elevation of apoptosis in organ (because any form of pathology) leads to quantitative(because any form of pathology) leads to quantitative deviations in contents of according auto-Abs

Preparative Isoelectrofocusing / ELISA:

An illustrative example:

Minimal individual differences in content of different “cardiotropic” auto-Abs may be seen in serum of healthy persons (black lines).

Heart pathology has accompanied by quantitative changes in pattern ofHeart pathology has accompanied by quantitative changes in pattern of auto-Abs (cardiomyopathy – red dotted line)

Page 80: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

The health state of the Body has been mirrored by the General The health state of the Body has been mirrored by the General system of autosystem of auto--Abs or Abs or ««ImmunculusImmunculus»»

Because:Because:11. . Serum level of autoSerum level of auto--Abs of any specificity Abs of any specificity

is nearly the same in each healthy personis nearly the same in each healthy person..22 Q tit ti d i ti i t t fQ tit ti d i ti i t t f22. . Quantitative deviations in contents of Quantitative deviations in contents of

some autosome auto--Abs are marker signs of Abs are marker signs of pathology (abnormal elevation of pathology (abnormal elevation of apoptosis) in according organapoptosis) in according organ

Each form of pathology: cancer and hepatic problems neurodegeneration and cardialproblems, neurodegeneration and cardial pathology etc., has been reflected by “Magic Mirror of Immunculus”

Page 81: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Stages of Pathology Development:

1. Most early eventsActivation of apoptosis which reflects by auto‐Abs

Weeks or months later

2 Biochemical (laboratory detected) and/or functional

Weeks or months later

2. Biochemical (laboratory detected) and/or functional changes in organ

3. Clinical manifestation of the disease Months or years later

Page 82: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

(March 2007) Sci. Amer. Dr.

Abner Notkins write:

During the next 10 or 20 years evalu-ation a lot of auto-Abs willa lot of auto Abs will became habitual di ti ddiagnostic procedure (for prediction of the future changes in patient’s health)patient s health)

Page 83: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Not after 10 or 20 years, but now

We used evaluation of some dozens of auto Abs for

EliEli VisceroViscero TestTest

We used evaluation of some dozens of auto-Abs for diagnostic and prognostic purposes

EliEli--VisceroViscero--TestTest((evaluation of the health state of heartevaluation of the health state of heart, , vesselsvessels, , lungslungs, , liverliver, , kidneyskidneys, , stomachstomach, , gutgut, , vesselsvessels, , lungslungs, , liverliver, , kidneyskidneys, , stomachstomach, , gutgut, , pancreaspancreas, , thyroidthyroid, , prostateprostate, , adrenalsadrenals))

ELIELI--NN--TestTest((Nervous system health stateNervous system health state))

ELIELI--PP--ComplexComplexpp((Reproductive health evaluationReproductive health evaluation))

Page 84: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

What is “Personalized Medicine”?

Page 85: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

The Goal of Personalized M di iMedicine

• The Right Dose ofTh Ri ht D f• The Right Drug for

• The Right Indication for• The Right Patient at• The Right Time.The Right Time.

Page 86: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

• Pharmacokinetics (PK): the study of the time course of substances and their 

Pharmacology

relationship with an organism or system (Journey of drugs)

Absorption– Absorption– Distribution– Metabolism

• Pharmacodynamics (PD): the study of 

– Excretion

the biochemical and physiological effects of drugs and the mechanisms of drug action and the relationshipof drug action and the relationship between drug concentration and effect (Drug effect on the body)

Every aspect may affect the final drug effect

Page 87: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Pharmacogenetics & Ph iPharmacogenomics

• Pharmacogenetics: study of individual gene-Pharmacogenetics: study of individual genedrug interactions, usually one or two genes that have dominant effect on a drug responsehave dominant effect on a drug response (SIMPLE relationship)

• Pharmacogenomics: study of genomic i fl d ft i hi hinfluence on drug response, often using high-throughput data (sequencing, SNP chip,

i t i COMPLEXexpression, proteomics - COMPLEX interactions)

Page 88: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

What Disciplines are Involved?

PharmacologyGenomics

Pharmacology

Pharmaco-epidemiology

Personalized/Stratified/

P di i M di i

Molecularbi l

epidemiology

Predictive Medicine

Bioinformatics

biology

BioethicsBioStatistics

Page 89: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Cancer Pharmacogenomics (PGx)

• The study of how variation in an individual’s germline and/or tumor genome are related to their metabolism and physiological response to drugs used in cancer treatment– Single Nucleotide Polymorphisms (substitutions)– Insertions and deletions– Copy number Variations– Methylation patternsMethylation patterns– Molecular biomarkers– Gene expression

Page 90: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Cancer Pharmacogenetics

GERMLINE

Cancer Pharmacogenomics

GERMLINE

SOMATIC TUMOURg

Biomarkers Predictive f D O t

SOMATIC or TUMOUR

PROTEINS IMAGINGfor Drug Outcomes

Biomarkers Predictive

PROTEINS, IMAGING

RADIATION THERAPYfor Treatment Outcomes

RADIATION THERAPY

Page 91: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Gene Mutations — Inherited or A i dAcquired

• Hereditary (germline) mutationsHereditary (germline) mutations 

– alterations in DNA inherited from a parent and pare found in the DNA of virtually all of your cells.

• Acquired (somatic) mutations 

lt ti i DNA th t d l th h t– alterations in DNA that develop throughout a person’s life

Page 92: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Pharmacogenetics: A Case St dStudy

Page 93: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Pharmacogenetics: A Case St dStudy

Page 94: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Pharmacogenetics: A Case St dStudy

Page 95: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Personalized Drugs

• Herceptin (breast cancer, target: Her2/neu)b ( l l )• Erbitux (colorectal cancer, target: EGFR)

• Tarceva (lung cancer, target: EGFR)• Strattera (attention‐deficit/hyperactivity 

disorder Metabolism: P4502D6)disorder, Metabolism: P4502D6)• 6‐MP (leukemia, Metabolism: TPMT) 

i i l (i i b d f f• Antivirals (i.e. resistance based on form of HIV)

• etc. and the list is growing rapidly ...

Page 96: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

FDA Requires Genetic Testsfor Certain Therapiesfor Certain Therapies

Page 97: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

• We are all 99 9% similar in our DNA• We are all 99.9% similar in our DNA.

• Individuals vary by only 0.1%.

• Individual variations may correla with

different responses to medicines and

magnitude of disease riskmagnitude of disease risk.

Page 98: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 99: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Potential of Pharmacogenomics

All patients with same diagnosis

1 Non-respondersand toxic

responders

2Responders and patients

Treat with alternativedrug or dose

Responders and patientsnot predisposed to toxicity

Treat withconventionaldrug or dose

Page 100: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 101: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Personalized or Predictive Medicine

Patients with same diagnosis Respond to treatment

No response to treatment

Experience adverse events

Page 102: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Human Genome has 3 billion DNA base pairsbase-pairs

…G G T A A C T G…

Polymorphic

G G C G

…G G C A A C T G...…G G C A A C T G...

Some people have a different base at a given location:This is a Single Nucleotide Polymorphism

or SNP

102

or SNP

Page 103: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

103

Page 104: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

: : دارو در بدن جذبجذب توزيعتوزيع متابوليسممتابوليسم

حذفحذف

١١فازفازااکسيداسيونکسيداسيون

ا امتابوليسممتابوليسم

احيا١١فازفازھيدروليز

ن دا ن ک گل٢٢فاز فاز

گلوکورونيداسيونسولفاسيوناستيالسيون

104. . متابوليزه ميشودمتابوليزه ميشود CYPCYPتوسط توسط % % ٨۶٨۶و از اين مقدار و از اين مقدار ١١از داروھا توسط فاز از داروھا توسط فاز % % ۵۶۵۶متابوليسم متابوليسم

متيالسيون

Page 105: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Somatic vs. GermlineMutation TestingMutation Testing

Page 106: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Detection of HER2/neu Amplication in Breast Cancer by FISH

Page 107: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

BRCA PEDIGREE

Page 108: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Sequence Analysis of BRCA1 and BRCA2C Fi d th N dl i th H t k

• BRCA1: 22 coding exons, > 5,500 bp

Can Find the Needle in the Haystack

AA

g , , p

GGCTTTAAGTATCCATGGCTTTAAGTATCCATGGCTTTAAGTATCCATGGCTTTAAGTATCCAT• BRCA2: 26 coding exons, > 11,000 bp

Page 109: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

ناثر متقابل بين دارو وبدن ل ر

109

Page 110: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

در ايران CYP2C9*4فراوانی ژنوتيپ

110

Page 111: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

AzariAll l f Genotype frequencyAzari

Caspian Fars

Allele frequency Genotype frequency

Kurdp Fars

Allele frequency

Allele frequencyGenotype frequency

LureAllele frequency

Genotype frequency Genotype frequency

Allele frequencyGenotype frequency

BalochArab

Allele frequency

Allele frequency

Genotype frequency

ArabAllele frequency

Genotype frequency

111

Page 112: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

North

Genotype frequencyAllele frequency

Allele frequency

West EastCenter Genotype frequencyWest EastCenterAllele frequency

Allele frequencyGenotype frequency

G f

Allele frequency

Genotype frequency

South

Genotype frequency

112

Page 113: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

R521K Genotype Frequencies in Iran

Homozygous HomozygousAA, 7.7

Homozygous (Normal)

Homozygous (Mutant)

GA, 53.6

GG, 38.7

G t F l M l

HeterozygousGenotype Female Male

A/A 7.33 8

G/A 52 54 67G/A 52 54.67

G/G 40.67 37.33

113

Page 114: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

ConclusionConclusion

Safe

Cetuximab

Safe Effective

A/A Genotype (in R521K EGFR polymorphism)

Cetuximab

ArabsGilaki – Mazandarani groups 114

Page 115: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

ConclusionConclusion

Safe

G/G and G/A Genotypes Cetuximab

Safe not Effective

yp(in R521K EGFR polymorphism)

KurdsLuresFarsTurks 115

Page 116: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Ethnicity A/A (%) G/A (%) G/G (%)

Fars 8.3 51.5 40.2

Turk 6.5 58.44 35.06

K d 0 53 85 46 15Kurd 0 53.85 46.15

Lure 0 70.59 29.41

Arab 16.67 33.33 50

Caspian 16.67 50 33.33

R521K genotype distribution in different ethnic groups of Iranian PopulationIranian Population

The genotype A/A was not detected in Kurds and Lure groups

High frequencies of A/A genotype in Arabs and Caspian groups

116

Page 117: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

117

Page 118: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 119: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 120: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 121: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

Genetic 

Biocurator

CounselorTreating Team

Analysis TeamMP/MG

Outside Faculty 

Expert (prn)

Test RequestPatient and physician

Review by GeneticTest Consultation Service

Establish questions being posed bypatient and treating teamphysician

request genome

i

Service• Genetic Counselor• Molecular

P h l i

patient and treating team• Genetic?• Candidate variants and

sequencingfor heritable disease

Pathologist• Medical Geneticist

analysis approach• Clinical use

throughEMR

Page 122: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

The Rare Disease Primer Kit

Page 123: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

PharmacoGenetic Card

Name: SEYED MASSOUD Surname: HOUSHMAND

Date of birth: 22 JAN 62ID No: 093‐766781‐1

5‐FLUOROURACIL IRINOTECAN THIOPURINE HERCEPTIN GLEEVEC /

IMATINIBIRESSA /GEFITINIB

VARIOUS FLT3INHIBITORS

BETA2‐AGONISTS

ABACAVIR

Date of birth: 22 JAN 62

CYP2D6 CYP2C19 CYP2C9 CYP1A2 CYP2A6 CYP2B6 CYP2C8 CYP2C9 CYP2E1

CYP2J2 CYP3A4 CYP3A5 CYP3A7 CYP4B1 EPHX1 EPHX2 TPMT UGT1A1

Page 124: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

HLA Typing Card

Name: SEYED MASSOUD Surname: HOUSHMAND

Date of birth: 22 JAN 62ID No: 093‐766781‐1

HLA‐/ /

Date of birth: 22 JAN 62

HLA‐A HLA‐B HLA‐C HLA B27 HLA‐DPA1 HLA‐DPB1 DRB3/B4/B5

Page 125: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease

G ti ID C dGenetic ID Card

Name: SEYED MASSOUD Surname: HOUSHMAND

Date of birth: 22 JAN 62ID No: 093‐766781‐1

D20S1082 D6S474 D12ATA63 D22S1045 D10S1248 D1S1677 D11S4463 D4S2364 D9S1122

Date of birth: 22 JAN 62

D2S1176 D10S1435 D3S3053 D5S2500 D1S1627 D2S4529 D2S441 D17S974 D6S1017

D4S2408 D9S2157 D17S1301 D1GATA113 D18S113 D18S8853 D20S482 D14S1434AMELOGENI

D4S2408 D9S2157 D17S1301 D1GATA113 D18S113 D18S8853 D20S482 D14S1434N

Page 126: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease
Page 127: Future medical laboratories and their roles in ... · PDF filefor Down syndrome Association between maternal ... • MALDI‐TOF MS ... Fanconi anemia Gaucher disease