The University of Manchester Faculty of Life Sciences FUNGAL BIODEGRADATION OF POLYVINYL ALCOHOL IN SOIL AND COMPOST ENVIRONMENTS A Thesis Submitted to the University of Manchester for the Degree of Doctor of Philosophy In the Faculty of Life Sciences 2013 Somayeh Mollasalehi
156
Embed
FUNGAL BIODEGRADATION OF POLYVINYL ALCOHOL IN SOIL …
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
The University of Manchester Faculty of Life Sciences
FUNGAL BIODEGRADATION OF
POLYVINYL ALCOHOL
IN SOIL AND COMPOST
ENVIRONMENTS
A Thesis Submitted to the University of Manchester for the Degree of
Doctor of Philosophy
In the Faculty of Life Sciences
2013
Somayeh Mollasalehi
List of Contents
2
LIST OF CONTENTS ............................................................................................ 2
LIST OF FIGURES ................................................................................................. 6
LIST OF TABLES ................................................................................................... 8
For over 50 years, synthetic petrochemical-based plastics have been produced in ever growing volumes globally and since their first commercial introduction; they have been continually developed with regards to quality, colour, durability, and resistance. With some exceptions, such as polyurethanes, most plastics are very stable and are not readily degraded when they enter the ground as waste, taking decades to biodegrade and therefore are major pollutants of terrestrial and marine ecosystems. During the last thirty years, extensive research has been conducted to develop biodegradable plastics as more environmentally benign alternatives to traditional plastic polymers. Polyvinyl alcohol (PVA) is a water-soluble polymer which has recently attracted interest for the manufacture of biodegradable plastic materials. PVA is widely used as a paper coating, in adhesives and films, as a finishing agent in the textile industries and in forming oxygen impermeable films. Consequently, waste-water can contain a considerable amount of PVA and can contaminate the wider environment where the rate of biodegradation is slow. Despite its growing use, relatively little is known about its degradation and in particular the role of fungi in this process. In this study, a number of fungal strains capable of degrading PVA from uncontaminated soil from eight different sites were isolated by enrichment in mineral salts medium containing PVA as a sole carbon source and subsequently identified by sequencing the ITS and 5.8S rDNA region. The most frequently isolated fungal strains were identified as Galactomyces geotrichum, Trichosporon laibachii, Fimetariella rabenhorsti and Fusarium oxysporum. G. geotrichum was shown to grow and utilise PVA as the sole carbon source with a mean doubling time of ca. 6-7 h and was similar on PVA with molecular weight ranges of 13-23 KDa, 30-50 KDa and 85-124 KDa. When solid PVA films were buried in compost, Galactomyces geotrichum was also found to be the principal colonizing fungus at 25°C, whereas at 45°C and 55°C, the principle species recovered was the thermophile Talaromyces emersonii. ESEM revealed that the surface of the PVA films were heavily covered with fungal mycelia and DGGE analysis of the surface mycelium confirmed that the fungi recovered from the surface of the PVA film constituted the majority of the colonising fungi. When PVA was added to soil at 25°C, and in compost at 25°C and 45°C, terminal restriction fragment length polymorphism (T-RFLP) revealed that the fungal community rapidly changed over two weeks with the appearance of novel species, presumably due to selection for degraders, but returned to a population that was similar to the starting population within six weeks, indicating that PVA contamination causes a temporary shift in the fungal community.
10
DECLARATION
No portion of the work referred to in the dissertation has been submitted in support
of an application for another degree or qualification of this or any other university
or other institute of learning.
11
COPYRIGHT STATEMENT
i. The author of this thesis (including any appendices and/or schedules to this
thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he has
given The University of Manchester certain rights to use such Copyright, including
for administrative purposes.
ii. Copies of this thesis, either in full or in extracts and whether in hard or
electronic copy, may be made only in accordance with the Copyright, Designs and
Patents Act 1988 (as amended) and regulations issued under it or, where
appropriate, in accordance with licensing agreements which the University has
from time to time. This page must form part of any such copies made.
iii. The ownership of certain Copyright, patents, designs, trademarks and other
intellectual property (the “Intellectual Property”) and any reproductions of
copyright works in the thesis, for example graphs and tables (“Reproductions”),
which may be described in this thesis, may not be owned by the author and may be
owned by third parties. Such Intellectual Property and Reproductions cannot and
must not be made available for use without the prior written permission of the
owner(s) of the relevant Intellectual Property and/or Reproductions.
iv. Further information on the conditions under which disclosure, publication
and commercialisation of this thesis, the Copyright and any Intellectual Property
and/or Reproductions described in it may take place is available in the University
IP Policy in any relevant Thesis restriction declarations deposited in the University
Library, The University Library’s regulations and in The University’s policy on
presentation of Theses.
12
DEDICATION
“Indeed, in the creation of the heavens and earth, and the alternation of the night
and the day, and the (great) ships which sail through the sea with that which
benefits people, and what Allah has sent down from the heavens of rain, giving life
thereby to the earth after its lifelessness and dispersing therein every (kind of)
moving creature, and (His) directing of the winds and the clouds controlled
between the heaven and the earth are signs for a people who use reason”.
Holly Quran, Chapter 2 - Verses 164
Dedicated To My Lovely Family
13
ACKNOWLEGMENTS
First and foremost, I thank almighty Allah for his kindness and blessing which
guided me through all the challenges I faced in this research.
A great thank to my supervisor, Dr. Geoff Robson for his encouragement, patience
and invaluable advice through the project.
I would like to thank Dr. Pauline Handley, Dr Anil Day, Dr. Michael Kertesz, Dr.
Ashley Houlden and Dr. Alberto Saiani for their help and kind guidance through
the research.
I especially want to thanks my dear husband, Mahdad, for all his love, friendship,
and never-ending patience and for believing me.
I am deeply indebted to my mom and dad for their continued prayers and patronage
all through my study years. Indeed, your self-sacrifice and support opened up the
path of learning to me.
I also would like to thanks my mother and father in law for their continuous
support.
My warm appreciation goes to my sisters, Maryam and Soodeh for their heartening
words and well wishes.
Special thanks to my colleagues who have been very helpful over the course
completing this research.
14
ABBREVIATIONS
CFU colony forming units DEPC diethyl pyrocarbonate DGGE denaturing gradient gel electrophoresis DH degree of hydrolysis DNA deoxyribonucleic acid dNTP deoxynucleotide triphosphate DOA dioctyl adipate DOP dioctyl phthalate EDTA ethylenediaminetetraacetic acid ESEM Environmental scanning electron microscopy HPLC high performance liquid chromatography l Litre ITS internal transcript spacer MD mean doubling time mg Milligram ml Milliliter mm Millimeter mM Millimolar MSA mineral salts agar MSM mineral salts medium Mw molecular weight OD optical density OPH oxidized poly(vinyl alcohol) hydrolase PBS phosphate-buffered saline PCR polymerase chain reaction PDA potato dextrose agar PDB potato dextrose broth PVA poly(vinyl alcohol) PVAc poly(vinyl acetate) PVADH PVA dehydrogenase PVC poly(vinyl chloride) rDNA ribosomal DNA RNA ribonucleic acid rpm revolutions per minute SDS sodium dodecyl sulfate s.d Standard deviation of the mean s.e standard error of the mean SEM scanning electron microscopy T-RFLP terminal restriction fragment length polymorphism UV Ultraviolet WHC water holding capacity
Chapter 1
15
1 CHAPTER ONE. INTRODUCTION 1.1 OVERVIEW
Currently it is estimated that over 140 million tonnes of synthetic plastics
are produced annually worldwide (Shimao, 2001, Tokiwa et al, 2009; Sivan, 2011).
A large proportion of these plastics are very stable and not easily degradable when
they enter the ground as waste. There are very few natural enzymes that can
biodegrade plastics and consequently the large volume of waste plastics entering
the environment is problematic (Shah et al., 2008) causing not only environmental
pollution but also putting pressure on diminishing landfill site capacity (Hopewell
et al, 2009). The longevity of plastics and synthetic polymers, the extent of
biodegradation and their impact on the environment is therefore of major concern.
More recently, research has focused increasingly on biodegradable synthetic
plastics and plastic blends containing biodegradable components which will have a
lower impact on the environment (Larry et al., 1992; Tadros et al., 1999; Eggins &
2001). The cohesiveness of the material is diminished when these fragments are
removed making it more vulnerable to water penetration. Catalytic elements such
as enzymes and free radicals are produced by these microorganisms which cleave
the molecules of the polymers resulting in a decrease in their molecular weight.
During this stage, oligomers, dimers and monomers are produced in the process of
depolymerisation. Microbial cells can then take up these small molecular weight
compounds and break down these products following transport across the
cytoplasmic membrane (Lucas et al., 2008). Assimilation then takes place in the
cytoplasm to generate energy and new biomass. Mineralisation then occurs when
intracellular metabolites such as CO2, N2, CH4, water and various salts are in turn
released in the environment (Lucas et al., 2008).
One group of synthetic plastics which are most susceptible to
biodegradation are polyesters, which are made of monomers polymerised through
ester linkages. Ester-linkages are generally easy to hydrolyze and are susceptible to
Chapter 1
26
specific esterases (Tokiwa & Calabia, 2004; Shimao, 2001). Several synthetic
polyesters have been demonstrated to be biodegradable. For example
polylcaprolactone is synthetic polyester that can easily be degraded by
microorganisms (Shimao, 2001; Kim & Rhee, 2003) and Barratt et al (2003) found
fungi to be the predominant micro-organisms responsible for degradation of
polyester polyurethane. Other commercially polymers used as biodegradable
plastics include polylactic acid and polyvinyl alcohol.
1.2.4 Evaluation methods of polymer degradation
1.2.4.1 Scanning electron microscopy (SEM) observations
Changes in colour, roughness of the plastic surface, formation of cracks or
holes and formation of biofilm on the surface of polymers can be used as a first
indication of microbial attack (Shah et al., 2008) and are readily observed on the
surface of plastics under scanning electron microscopy (SEM) (Ikada, 1999;
Fernandez et al., 2008; Geweely & Ouf, 2011).
1.2.4.2 Weight loss quantification
The decrease in polymer mass is extensively used in degradation
assessment and it can be verified by extraction or separation methods (Witt et al.,
2001).
1.2.4.3 Clear zone formation
This method is mostly applied to monitor degradation of a particular
polymer and to assess degradation potential of a variety of microorganisms. In this
method, polymer suspension is dispersed within the agar medium which is
inoculated with microorganisms. When the potential polymer degrading
Chapter 1
27
microorganisms produce extracellular enzymes degradation of the polymer
suspension in the medium produces a clear halo around the colonies and is widely
used as an indicator of the microorganisms ability to depolymerise the polymer
(Augusta et al., 1993; Lee et al., 2005; Tokiwa et al., 2009).
1.2.4.4 O2 consumption /CO2 evolution
The consumption of oxygen or the creation of carbon dioxide is one of the
methods applied to assess biodegradation under laboratory conditions with the rate
of oxygen consumption or carbon dioxide evolution being proportional to the rate
of degradation (Bellina et al., 2000).
1.2.4.5 Culture independent methods
As the majority of microorganisms cannot be cultivated readily on
laboratory media (Hawksworth, 1991; Osborn et al., 2000), culture independent
techniques such as temperature gradient gel electrophoresis (TGGE), denaturing
gradient gel electrophoresis (DGGE) and terminal restriction fragment length
polymorphism (TRFLP) can be used to enable an estimate of both community
diversity and dynamics within complex microbial ecosystems during polymer
degradation (Myers et al., 1985; Muyzer et al. 1997; Muyzer and Smalla, 1998;
Andoh, et al., 2009 and Elliott et al., 2012).
1.3 POLYVINYL ALCOHOL AND PVA-BASED COMPUNDS
1.3.1 Introduction
Polyvinyl alcohol (PVA) is a water-soluble polymer which has recently
attracted interest for the manufacture of environment-friendly plastic materials
Chapter 1
28
(Solaro et al., 2000). PVA is widely used as a paper coating, in adhesives and
films, as a finishing agent in the textile industries and in forming oxygen
impermeable films (Larking et al., 1999). Waste-water can contain a considerable
amount of PVA and could contaminate the environment as it is believed that PVA
biodegrades quite slowly (Lee & Kim, 2003). Efforts have been made to isolate
PVA-degrading microorganisms with the most commonly isolated being
Pseudomonas spp (Lee & Kim, 2003) although a limited number of bacteria have
also been isolated from various sources such as activated sludge from waste-water
treatment plants. The biodegradation of PVA blends with natural polymers has also
been investigated. It was found that the hydrophobic property of gelatine seemed to
have affected the biodegradation tendency of the PVA blend (Corti et al., 2002a).
The degree of PVA polymerization has also been shown to affect the degree of
biodegradation and highly polymerised PVA samples were more difficult and took
longer to degrade due to a combined action of extracellular and intracellular
enzymes (Chen et al., 2007).
1.3.2 Structure and properties
In 1924, Hermann and Haehnel first produced PVA by hydrolyzing polyvinyl
acetate in ethanol with potassium hydroxide. The end product of this hydrolysis,
which is carried out through an ester exchange with methanol in the presence of
anhydrous sodium methylate or aqueous sodium hydroxide, yields PVA which is
an odourless, translucent, and white or cream coloured granular powder. It is water-
soluble but only slightly soluble in ethanol and insoluble in other organic solvents.
A solution of 5% PVA has a pH of 5.0-6.0 and its molecular weight typically
Chapter 1
29
ranges from 14,000 to 50,000 Da.
1.3.3 Manufacture and use of PVA
PVA is produced using vinyl acetate as its monomer in a polymerization
process followed by partial hydrolysis in which the ester group in polyvinyl acetate
is partially replaced with the hydroxyl group and in the presence of an aqueous
solution of sodium hydroxide becomes fully hydrolysed (Fig 1.2). PVA is then
precipitated, washed and dried subsequent to the gradual addition of the aqueous
saponification agent.
Figure 1-2.Hydrolysis of PVAc to PVA. Following polymerisation of polyvinyl acetate, the acetate group is removed by hydrolysis under alkaline conditions in methanol.
Most of the industrial processes are now based on pure ester interchange and the
reaction is carried out in an anhydrous alcohol solution with a maximum of a few
percent of water, with catalytic quantities of an alkali (Finch, 1973). For the
production of PVA on an industrial scale only polyvinyl acetate is important. When
the hydrolysis of polyvinyl acetate takes place in a low-boiling aliphatic alcohol for
example methanol, it proceeds in a manner similar to the hydrolysis of
monomolecular esters according to the following reaction scheme:
3) Hydrolysis of the ester formed in (1) R-OAC + NaOH (or acid) → ROH +
CH3COONa (or CH3∙COOH)
The viscosity of the PVA formed by hydrolysis is determined by the degree of
polymerization and by the branching of the polyvinyl acetate used (Finch, 1973).
PVA is one of the key water-soluble polymer produced in the world and is also
produced during the production cycles of petrochemical industries (Chen et al.,
2007). Major water-soluble polymeric materials are summarised in Table 1.2.
Class Type Acronym
Poly(carboxylate)s Poly(malic acid) Poly(met
acrylic acid) Poly(aspartic
acid)
PMLA
PMA
PAsA
Poly(acrylics) Poly(acrylic acid) Poly(acryl
amide)
PAA
PAAm
Poly(ether)s Poly(ethylene glycol)
Poly(propylene glycol)
PEG
PPG
Poly(glutamic acid) PGIA
Poly(hydroxylate)s Poly(vinyl alcohol) PVA
Table 1-2.Major water-soluble polymeric materials of potential environmental concern (Chiellini et al., 2003).
Chapter 1
31
Commercially available PVA is produced via different degrees of
methanolysis, yielding different grades of PVA with varying levels of hydrolysis
with a range of 70 to 99% (Chiellinni et al., 2003). PVA fibres can be utilized as a
reinforcing material for buildings and as a brake pneumatic hose in agricultural
machinery due to its high tensile strength. Partially hydrolysed PVA is quite
commonly used as a moisture barrier for food supplement tablets and for foods that
need to be protected from moisture. In manufacturing plastic materials which are
environment-friendly, water-soluble PVA has drawn interest (Corti et al., 2002a)
because it can be used widely as coating for paper, in adhesives, and films. PVA is
a very good barrier for fragrances, flavourings, oils and fats (Lee & Kim, 2003).
PVA degradation is slow in the natural environment and its water solubility makes
it persistent in waste water discharged from textile and dyeing factories, which can
lead to pollution and accumulation in the environment (Larking et al., 1999; Chen
et al., 2007). The molecular weight (MW) and degree of hydrolysis (DH) of PVA
also have an impact on its characteristics and its degradation. Previous studies have
reported that the rate of PVA degradation by mixed microbial cultures was affected
by the degree of hydrolysis of the polymers .The biodegradation rate was faster in
samples with a higher DH rather than samples with a low DH (Corti et al., 2002b;
Chen et al., 2007). However, molecular weight differences had no significant effect
on the rate of biodegradation of PVA samples (Chen et al., 2007).
1.3.4 Degradation of PVA and PVA-based compounds
PVA’s water solubility and biodegradability have given it the potential to be
a suitable replacement for traditional non-degradable plastics made from fossil
Chapter 1
32
fuels (Solaro et al., 2000; Corti et al., 2002a; Chiellini et al., 2003). As PVA
demonstrates excellent compatibility with some natural polymers (Jecu et al.,
2010), it is extensively utilized in the preparation of blends and composites
containing natural renewable polymers such as starch, lignin (Pseja et al., 2006;
Fernandes et al., 2006) and collagen (Sarti & Scandola, 1995).When blended with
natural polymers, PVA improves the mechanical properties and performance of
biopolymers due to its hydrophilic character and rheological properties (Jayasekara
et al., 2004). PVA-based materials are obtained by blending PVA with natural
polymers of vegetable, animal and marine origin such as cellulose, lignin, starch,
silk, and gelatin (Chiellinni et al., 2003). PVA based materials and PVA blends
with natural biopolymers may facilitate the PVA biodegradation process improving
its elimination from the environment (Jecu et al., 2010).
1.3.4.1 Degradation of PVA
PVA is categorized as either partially or fully hydrolysed and is
commercially manufactured from polyvinyl acetate in a continuous process
(Chiellinni et al., 2003). Among vinyl polymers, PVA is the most readily
biodegradable and it can be completely mineralized by microorganisms (Shimao,
2001).
In the past 40 years several studies have identified both single
microorganisms (Suzuki et al., 1973) and symbiotic or mixed cultures (Corti et al.,
2002b) with the ability to degrade PVA, which were isolated from soil and sludge
samples (Sakazawa et al., 1981; Corti et al., 2002b; Du et al., 2007; Chen et al.,
2007). Most of these isolated strains are bacteria such as Pseudomonas sp (Mori et
Chapter 1
33
al., 1997; Watanabe et al., 1976; Hatanaka et al., 1995), Alcaligenes faecalis
(Matsumara et al., 1994), Bacillus megaterium (Mori et al., 1996) although a
Penicillium sp and Flammulina velutipes were previously reported to degrade PVA
(Qian et al., 2004; Tsujiyama et al., 2011). Only a limited number of these strains
can degrade PVA in pure culture (Chiellini et al., 1999). The first report of
complete PVA degradation was by a bacterial strain, Pseudomonas O-3 ,which
used PVA as the only source of carbon and energy (Suzuki et al., 1973). However,
in many cases, PVA degradation requires the cooperative function of two strains,
for example, Pseudomonas sp. VM15C and its symbiont Pseudomonas sp. VM15A
(Sakazawa et al., 1981; Shimao et al., 1982; 1986), Bacillus megaterium and
bacterial strain PN19 (Mori et al., 1996), and Sphingomonas sp. SA3 and SA2
(Kim et al., 2003). Sakazawa et al (1981) isolated 30 symbiotic PVA utilizing
cultures from around 1000 sludge, soil and waste samples from factories
(Sakazawa et al., 1981). In addition, a mixed microbial culture was isolated from
paper mill sewage sludge which was capable of complete PVA biodegradation.
None of the isolated strains could degrade PVA in pure culture (Corti et al., 2002b;
Chen et al., 2007). The requirement for the presence of two strains for PVA
degradation is due to the production of pyrroloquinoline quinine (PQQ) by one
symbiont which is required by the other (Shimao, 2001). PQQ has been reported as
a bacterial growth factor (Shimao, 2001). For example: in the symbionts of
Pseudomonas sp. VM15C and VM15A , VM15C can degrade PVA, but it cannot
grow alone in the presence of PVA as a sole carbon source and it requires PQQ for
PVA degradation produced by VM15A (Shimao et al., 1982). Another enzyme that
Chapter 1
34
initiates PVA degradation and utilizes molecular oxygen and generates hydrogen
peroxide during the reaction is the PQQ independent PVA oxidase (Sakai et al.,
1985). A further PVA degrading symbiotic relationship was also found for
symbiotic strains Sphingomonas sp. OT3 and Rhodococcus erythropolis OT3. In
addition to PQQ, Sphingomonas sp. OT3 requires an active catalyst to grow well on
PVA medium (Vaclavkova et al., 2007). PQQ is thought to act as a cofactor for
PQQ-dependent PVA dehydrogenase (PVADH), an enzyme shown to catalyze the
initial oxidation step in PVA degradation (Fig 1.3) in some microorganisms
(Shimao et al., 1982; 1986).
Figure 1-3.Biodegradation pathway of PVA as mediated by a PVA dehydrogenase PQQ-dependent in symbiotic bacterial culture (Chiellinni et al., 2003; Shimao et al., 1986).
Further research identified an isolate from soil samples of a textile factory
which can use PVA as a sole source of carbon and which did not require an
additional partner during the PVA degradation process (Chiellini et al., 2003; Du et
Chapter 1
35
al., 2007) and was identified as a Janthinobacterium sp, WSH04-01. This strain
was found to be capable of degrading 80% of the PVA present in cotton fabrics in
3h (Du et al., 2007).
The first step in degradation is the cleavage of the carbon–carbon polymer
backbone of PVA by extracellular enzymes (Chiellini et al., 1999) followed by
cellular uptake of the lower molecular weight PVA fragments with additional
metabolism with the final steps of PVA degradation occurring inside the cells
(Corti et al., 2002b). Several enzymatic systems have been identified that catalyse
the cleavage of the carbon-carbon polymer backbone of PVA. Cleavage of the
polymer backbone is catalysed either by an oxidase or a dehydrogenase, followed
by a hydrolase or aldolase reaction (Shimao, 2001). Watanabe et al (1976) purified
and studied the properties of a PVA-degrading enzyme produced by a strain of
Pseudomonas. Chandra and Rustgi (1998) studied the microbial degradation of
PVA and its degradation using secondary alcohol peroxidases which had been
isolated from a Pseudomonas strain isolated from soil. They found that the initial
stage of biodegradation involved the enzymatic oxidation of secondary alcohol
groups in PVA to ketone groups. Shimao et al (1982) investigated the production
of PVA oxidase by a symbiotic mixed culture (Shimao et al., 1982; Matsumura et
al., 1994; Shimao, 2001). PVA dehydrogenase from Pseudomonas sp. 113P3 was
purified and characterized by Hatanaka et al (1995). Degradation was confirmed by
both iodometric methods and gel permeation chromatography (Tokiwa et al.,
2000). A comparison of PVA-degradation rates among various microorganisms are
listed in Table 1.3.
Chapter 1
36
1.3.4.2 Biodegradation of PVA under different environmental conditions
The first studies on biodegradation of PVA were carried out in the presence
of domestic or non-acclimated activated sludge (Chiellini et al., 2003). Different
conditions were selected to test degradability of PVA, including composting
conditions, soil environment, aqueous environments (aerobic) and sewage sludge
(Porter and Snider, 1976; Chiellini et al., 2003). It was found that the efficient
biological removal of the polymer was only achieved after long term exposure to
PVA under conventional wastewater treatment conditions (Solaro et al., 2000).
Chapter 1
37
Table 1-3.A comparison of PVA-degradation rates among various microorganisms.
1.3.4.2.1 Influence of pH on PVA biodegradation
pH has been shown to have an important effect on the ability of microbes to
degrade PVA. Zhang (2009) showed the maximum rate of biodegradation by a
mixed bacterial consortium of Curtobacterium sp. and Bacillus sp. was obtained
when the initial pH was 8.0. This might be due to high degradation activity of
secreted enzymes by the mixed bacterial culture in alkaline solutions (Zhang,
GTAAAAGTCGTAACAAGG-3'), amplifies the ITS1- region of the fungal rDNA
gene as previously described (Cosgrove et al., 2007, 2010). PCR reactions
contained 10 µM of primers GM2 and JB206c, 1.5 mM MgCl2, 0.2 mM of each of
the four dNTPs, 5 μl of 10 x NH4 reaction buffer and 0.1 mg/ml bovine serum
albumin per 50 μl PCR reaction. Amplification was carried out in 94°C for 5 min
for initial denaturation; 20 ‘touchdown’ cycles of 94 °C for 30 s, annealing for 30 s
at 59°C to 49.5°C with annealing temperature being reduced by 0.5°C per cycle,
extension at 72°C for 45 s; 30 cycles of denaturation at 95°C for 30 s, annealing at
49°C for 30 s and extension at 72°C for 45 s; and final extension at 72°C for 5 min.
PCR products were separated by DGGE using a D-Code universal mutation
detection system (Biorad, U.K.). DGGE gels measuring 16 cm x 16 cm x 1 mm
contained 10% (v/v) bis-acrylamide in 1 x TAE (40 mM Tris base, 20 mM glacial
Chapter 2
66
acetic acid, 1 mM EDTA). A perpendicular gel with a denaturant gradient of 25-
55% was used. For all gels, 500 µg of PCR product was used per lane; gels were
run in 1 X TAE buffer at a constant temperature of 65oC for 16.5 h at 42 volts. Gels
were stained with SybrGold (Molecular Probes, Netherlands) for 1 h, washed for
10 min in 1 x TAE buffer and photographed under ultraviolet light.
Chapter 2
67
2.3 RESULTS
2.3.1 Selection and identification of the dominant fungal PVA degrading
strains from soils
In order to isolate putative PVA degrading fungi from soils, soils from
different locations were used to inoculate minimal liquid medium containing PVA
as the sole carbon source (Table 2.1). After incubation at 25°C for one week, 2 ml
of each culture was used to inoculate a second flask of PVA medium to further
enrich for putative PVA degrading fungi. A total of eight different soils, two
commercial and six environmental, were used as the source of inoculum (Table
2.1.). Culture medium from the second enrichment flasks was serially diluted and
plated onto PVA agar medium and viable counts (colony forming units) determined
on these plates for seven consecutive days at 25°C (Fig 2.1). The number of colony
forming units (CFU) detected increased up to day four but then remained stable.
The total CFU following enrichment was similar regardless of the soil inoculum
used and ranged from 1.7 X 106 to 7.9 X 106 ml-1. To investigate if incubation
temperature affected species enrichment on PVA medium, PVA broth was
inoculated with commercial top soil and incubated at 25°C, 37°C, and 50°C (to
isolate thermophiles) for one week and again used to inoculate a second PVA
medium broth. Culture medium from the second flask was serially diluted after one
week and plated onto PVA agar medium and incubated over seven days at the same
temperature to determine CFU (Fig 2.2). In order to determine the efficiency of the
enrichment procedure on PVA medium, culture broth from the second flask was
also plated onto PDA medium (general fungal growth medium) and the total CFU’s
compared to the total CFU’s obtained on PVA medium. The number of CFU’s on
Chapter 2
68
both media increased up to day four and then remained constant. The number of
CFU’s recovered from 25°C and 37°C on PVA medium were not significantly
different, however, CFU’s from 50°C was significantly lower (P<0.05). When the
CFU’s on PVA medium were compared to PDA medium, the CFU’s were found to
be ca. 10% lower on PVA medium, indicating that growth on PVA medium was
highly selective for PVA degrading fungi.
When culture broths were plated onto PVA media, fungal colony
morphologies were similar due to lack of pigmentation and sporulation and
therefore difficult to distinguish on this medium. In order to establish if individual
colonies had the same or different morphologies, individual colonies were
transferred onto potato dextrose agar (PDA) plates and incubated for 5 days. On
this medium, pigmentation, sporulation and colony phenotypes enabled different
morphotypes to be distinguished. A total of 27 different morphotypes were
observed from all the enrichment cultures and at least three representatives of each
morphotype were isolated and the ITS rDNA amplified using the ITS-1 ITS-4
primer set (Webb et al, 2000) to enable identification by comparison with the
NCBI database. Amplified rDNA sequence lengths ranged from 308-551 bp for the
5.8S rDNA and ITS regions and identities against the NCBI database ranged from
98 – 100 % (Table 2.1, Fig 2.3). In many instances, the morphological differences
were small and sequencing data indicated that they were the same species. For
example, isolates C11, C21, C31, C51 and C61 differed slightly in their
morphology but were all identified as Galactomyces geotrichum with identical ITS
Chapter 2
69
sequences. In total twelve different fungal species were isolated as putative PVA
degraders (Appendix Fig A2.4).
Chapter 2
70
Figure 2-1.Changes in viable counts of putative PVA degrading fungi recovered from PVA broth cultures (13-23 MW, DH: 98%) inoculated with different environmental soils over 7 days at 25°C. PVA broth was inoculated with different soil inoculum and incubated at 25°C for one week and used to inoculate a second PVA broth culture and incubated a further week. Following the second incubation, PVA broth cultures were serially diluted and plated onto PVA agar and incubated at 25°C. Total colony forming units were counted over seven successive days. Results represent the means of triplicate samples ± standard error of the mean (SEM). Soil sample details (source) are shown in Table 2.1
Figure 2-2.Changes in viable counts of putative PVA degrading fungi from PVA broth (13-23 MW, DH: 98%) inoculated with top soil (sample 2) at 25°C, 37°C and 50°C over 7 days. Results are the means of triplicate samples ± standard error of the mean (SEM).
0.0E+00
5.0E+07
1.0E+08
1.5E+08
2.0E+08
2.5E+08
1 2 3 4 5 6 7
Via
ble
Cou
nts (
cfu/
ml)
Time (days)
25°C PDA
37°C PDA
50 C PDA
25°C PVA
37°C PVA
50 C PVA
72
Table 2-1.Fungal of PVA degraders recovered from eight soil samples by PVA broth enrichment. The percentage homologies to the top hit sequenced strains in the NCBI database are shown.
Soil sample GPS coordinates
Isolate code
Temp (°C)
Strain (alternaive name/anamorph)
Accession number & Percentage homology to closest match
Sample 1. Ashton, Manchester (Urban soil, pH 4.5).
Figure 2-3.Phylogenetic analysis of the isolated fungal strains and closest matching strains from the NCBI database. Strains isolated and identified in this study are marked with star * or **.
Chapter 2
74
2.3.2 Growth kinetics of putative isolated PVA fungal degraders
In order to investigate to what extent the isolated fungal strains were able to
utilize PVA, six putative degraders were grown in minimal medium containing
PVA as the sole carbon source and growth measured periodically over time by
recording the optical density at a wavelength 520 nm (Fig 2.4). For all strains,
negative controls consisting of minimal medium without PVA did not produce an
OD over 0.05 indicating no growth in the absence of PVA (data not shown). All of
the strains grew on PVA as a sole carbon source though at different rates and with
different final optical densities. The specific growth rates and mean doubling times
for each strain is shown in Table 2.2 on PVA and glucose for comparison. For all
strains, growth on glucose was quicker than growth on PVA. The fastest growing
strain on PVA was Galactomyces geotrichum with a specific growth rate of 0.10 h-1
(doubling time 6.9 h), and the slowest Trichosporon laibachii with a specific
growth rate of 0.06 h-1 (doubling time 11.6 h).
2.3.3 Influence of PVA polymer length on the growth of G. geotrichum
As PVA is manufactured with a range of different polymer lengths, G.
geotrichum was grown on minimal containing PVA as the sole carbon source with
molecular weights in the range 13-23 KD, 30-50 KD, 85-124 KD (98 to 99%
hydrolysis) to determine if polymer length influenced fungal growth and rate of
utilization of PVA. The specific growth rate on all three molecular weight ranges
was not significantly different (P<0.05) and PVA concentration in the broth
decreased during exponential growth at similar rates (Fig 2.5). But, PVA with
Chapter 2
75
molecular weight 85-124 KD had longer lag phase than PVA with molecular
weights 13-23 KD, 30-50 KD. Also, when molecular weight of the PVA increased
the final OD decreased indicating that PVA of higher molecular weights were
utilised and converted to biomass lower than PVA of lower molecular weight.
Although, PVA with different polymer lengths were utilised with of G. geotrichum
and polymer length was not limiting factor for PVA degradation (Fig 2.5).
2.3.4 Analysis of fungal community diversity in soils by denaturing gradient
gel electrophoresis (DGGE)
As culture enrichment on PVA broth led to the isolation of only a small
number of fungal species, some of which (e.g. G. geotrichum) were isolated from
more than one soil, it suggested that either PVA degradation was limited to only a
small number of species, or that the fungal communities of the soils were similar
with low diversity. Denaturing gradient gel electrophoresis (DGGE) was used to
compare the diversity and community profile of the eight soils used in this study
(Fig 2.6). In all samples, the profiles clearly indicated that the species composition
was highly divergent and that each soil contained different dominant species.
Chapter 2
76
Figure 2-4.The growth of Galactomyces geotrichum, Trichosporon laibachii, Fimetariella rabenhorstii, Fusarium oxysporum, Coniochaeta ligniaria and Fusarium equiseti in 2 % (w/v) PVA (13-23 KD, 98 % DH) liquid minimal medium at 25°C. Data represents the mean of three replicates ± SEM.
Table 2-2.Comparison of the specific growth rate, mean doubling time and yields of selected PVA degraders grown on PVA or glucose as the sole carbon source. Strains were grown in liquid minimal medium containing 2 % (w/v) PVA (MW 13-23 KD) or 1 % (w/v) glucose at 25°C for up to 50 h. Specific growth rates and doubling times were calculated from the growth curves and yields from dry weights after 50 h. Data represents the means of three replicates ± SEM.
Chapter 2
78
Figure 2-5.The growth curves of G. geotrichum in 2 % (w/v) PVA (13-23 KD; 30-50 KD; 85-124 KD) minimal salts medium. G. geotrichum was grown in shake flask culture at 25°C for 50 h and the optical density (upper) and PVA concentration (lower) determined periodically by colorimetric method. Data represents the mean of three replicates ± SEM.
Figure 2-6.Fungal community profile of studied soils using DGGE. The diversity of the soils used for enriching PVA degraders were analysed by DGGE to determine the diversity and similarities of the fungal communities. Lane A=Atras Edifield (sample 8), lane B=Malham Cove (sample 7), lane C=IdealRange top soil (sample 2), lane D=The Compost Shop (compost), lane E=Holme moss (sample 6), lane F=Whitworth park (site 4), lane G=Ashton, Manchester (sample 1), lane H=Stopford garden (sample 3), lane I=Huddersfield (sample 5).
Chapter 2
80
2.4 DISCUSSION
Previously, PVA degrading bacteria have been isolated from PVA
contaminated soils, waste water and activated sludge (Solaro et al., 2000; Lee &
Kim, 2003; Chen et al., 2007; Zhang, 2009) and the enzymes involved in the
process of biodegradation have been identified (Chiellini et al., 2003). Relatively
few studies have been conducted on fungal species with Geotrichum sp (Mori et
stationary phase OD up to a concentration of 4% (w/v) suggesting that at higher
concentrations, a nutrient in the medium other than carbon was limiting.
Figure A2.3. Influence of initial PVA concentration on final OD at stationary phase of G. geotrichum. G.geotrichum was grown in 50 ml PVA liquid culture medium at 25°C on a rotary shaker at 200 rpm until stationary phase (no further increase in OD) and the final OD determined. Data represents the mean of in different range of concentrations and data represent the mean of three replicates ± SEM.
Fungal morphotypes isolated from soils on PVA agar
Fungi growing on PVA media which were isolated from PVA enrichment
broth cultures inoculated using different soils were difficult to distinguish
morphologically on this media. Individual colonies were therefore transferred onto
potato dextrose agar and grouped into different morphotypes based on
morphological similarity prior to ITS sequencing. Different morphotypes were
Figure A2.4. Morphological characteristics of dominant fungal strains isolated from PVA enrichment cultures growing on PDA agar plates. A (Galactomyces geotrichum), B (Trichosporon laibachii), C (Candida tropicalis), D (Fusarium equiseti), E (Trichoderma viride), F (Issatchenkia orientalis), G (Talaromyces emersonii), H (Umbelopsis isabellina), I (Aspergillus fumigatus), J (Coniochaeta ligniaria), K (Fimetariella rabenhorstii), L (Fusarium oxysporum).
Chapter 2
93
REFERENCES
Finley, J. H. (1961). Spectrophotometric Determination of polyvinyl alcohol in paper coatings. Analytical Chemistry 33, 1925-1927.
Tebelev, L.G., Mikulskii, G. F., Korchagina,Ye.P. & Glikman, S.A. (1965).
Spectrophotometric analysis of the reaction of iodine with solutions of polyvinyl
alcohol. Polymer Science 7, 132-138.
Pritchard, J. G., Akintola. & D. A (1972). Complexation of polyvinyl alcohol with iodine: Analytical precision and mechanism. Talanta 19, 877-888.
Min, L., Zhang, D., Du, G. & Chen, J. (2012). Enhancement of PVA-Degrading enzyme production by the application of pH control. Journal of Microbiology and Biotechnology 22,220-225.
Chapter 3
94
3 CHAPTER THREE
FUNGAL BIODETERIORATION OF
POLYVINYL ALCOHOL FILMS
Somayeh Mollasalehi1, Pauline S. Handley1, Geoffrey D. Robson1# 1Faculty of Life Sciences, University of Manchester, Michael Smith Building, Manchester M13 9PT, UK # Corresponding author Geoffrey Robson Faculty of Life Sciences Michael Smith building University of Manchester Manchester M13 9PT, UK Phone: 01612755048 Email: [email protected]
Chapter 3
95
ABSTRACT
Polyvinyl alcohol (PVA) is a biodegradable water soluble polymer that
has a broad number of industrial applications. While mainly used as a coating for
paper and as a sizing agent in the textile industry, PVA can be fabricated into
films that are used as biodegradable bags for agricultural mulch and also
increasingly in the domestic market for the collection of food waste. As a
consequence, PVA is now entering commercial composting processes. However,
relatively little research has been conducted on the microbiological degradation
of PVA films in composts and in particular, in relation to fungi. In this study,
solid PVA films were buried in compost for up to 12 weeks and the colonisation
by fungi investigated at 25°C, 37°C, 45°C, 50°C and 55°C. Galactomyces
geotrichum was the principal colonizing fungus which was recovered at 25°C
followed by Talaromyces emersonii which was recovered at 45°C and 55°C.
Other fungal colonizers were Acremonium atrogriseum, Phialophora intermedia,
PVA solid coupons were recovered from compost 21 day after burial and
were subjected to ESEM (School of Chemistry, University of Manchester).
Growth of fungal mycelia appeared as chains of branching on surface of PVA
sheet. Also, PVA sample had been broken and partly disappeared after twelve
weeks in 45°C and 55°C.
Chapter 3
101
3.3 RESULTS
3.3.1 Physical changes to the PVA sheets during burial in compost
In order to investigate the impact of compost burial on the physical
changes to PVA solid coupons, PVA samples were buried in compost and
incubated at 25°C, 37°C, 45°C, 50°C and 55°C for a period of 21 days. Physical
changes to the coupons were observed every three days and compared with two
controls (coupons incubated in water-saturated sterile vermiculite or in sterile
distilled water alone). Fungal colonization on the surface of PVA coupons were
observed after 3 days and fungal accumulation increased over the 21 day
incubation period (Fig 3.1 B). No physical damage was observed on PVA
samples buried at 25°C and 37° C. However, PVA coupons appeared opaque,
shrunken and partly disintegrated after incubation at higher temperatures (45°C,
50°C and 55°C) after 15 days incubation (Fig 3.1 C). Control coupons incubated
in saturated sterile vermiculite and in sterile distilled water showed no physical
changes or microbial growth during the period of experiment (Fig 3.1 A). PVA
coupons after 21 days of incubation were subjected to ESEM and extensive
growth of fungal mycelia appeared as chains of branching hyphae on the surface
of the PVA coupons (Fig 3.1. D and E).
3.3.2 Viable counts of PVA colonizing fungi on PVA and PDA plates
To enumerate fungal colonization on the surface of the PVA coupons
during compost burial at different temperatures, fungal biomass was recovered
from the surface of the coupons after 3, 6, 9, 12, 15, 18 and 21 days, serially
diluted and the colony forming units determined after incubation on PVA agar
Chapter 3
102
(putative PVA degraders) and on PDA agar (total fungi) (Figure 3.2.). Total
fungal CFU (on PDA agar) increased at all temperatures from day 3 to day 12
and remained constant thereafter. The highest fungal CFU’s fom the coupon
surface were observed at 25°C and 37°C (ca. 2X107 CFU/cm2) with the lowest
fungal CFU’s observed at the higher temperatures ranging from ca. 7X106/cm2 at
45°C to ca. 2X106/cm2 at 55°C. CFU counts on PVA media were consistently
lower at all temperatures compared to PDA media. At 25°C to 45°C, CFU’s
recovered were constant after 9 days ranging from 0.9 X106 to 1.7X106
CFU/cm2. CFU counts at 55°C were lower with a maximum of 1.1X105
CFU/cm2. After 21 days incubation, the percentage of recovered CFU’s on PVA
medium compared to PDA medium varied depending on the incubation
temperature (25°C = 6.8%, 37°C = 0.8%, 45°C = 15.4%, 50°C = 21.6% and
55°C = 3.4%). Colonies growing on PVA agar plates appeared morphologically
similar to each other in colour due to lack of sporulation and it was not possible
to distinguish between different morphotypes on this medium. Therefore,
colonies from PVA plates were individually transferred onto PDA agar and after
incubating for up to 5 days and were then grouped into different morphotypes
depending on their colony phenotypes (Appendix Fig A3.1). Representative
isolates of different colony morphotype were then subjected to ITS sequencing
for comparison with the sequence database at NCBI.
Chapter 3
103
Figure 3-1.The effect of compost burial on PVA coupons. (A) PVA coupons before burial in compost, (B) PVA coupon after 9 days burial in compost at 50°C, (C) PVA coupon 60 days after burial in compost at 50°C. (D) ESEM micrograph (bar = 500 µm) of fungal mycelia 21 day after burial at 50°C, (E) ESEM micrograph (bar = 50 µm) of fungal mycelia 21 day after burial at 50°C.
D E
A B C
Chapter 3
104
Figure 3-2.Changes in fungal colony forming units (CFU/cm2) recovered from surface of compost buried PVA coupons. PVA coupons were buried in compost and incubated at 25°C, 37°C, 45°C, 50°C and 55°C over 21 days. Biomass was removed from the surface and colony forming units (CFU) enumerated on PVA medium for PVA degraders (PVA as sole carbon source) and on PDA medium for total fungal counts (general fungal growth medium). Results are the means of triplicate samples ± standard error of the mean (SEM) and expressed as CFU recovered per cm2 of the PVA surface.
1.0E+02
1.0E+03
1.0E+04
1.0E+05
1.0E+06
1.0E+07
1.0E+08
3 6 9 12 15 18 21
Fung
al C
FU (C
FU/c
m2 )
Time (days)
25°C PVA
37°C PVA
45°C PVA
50°C PVA
55°C PVA
25°C PDA
37 °C PDA
45 °C PDA
50 °C PDA
55 °C PDA
Chapter 3
105
3.3.3 Identification of fungal isolates from the surface of compost buried
PVA coupons
A total of fifteen distinct fungal morphotypes were recovered from the
surface of PVA coupons buried in compost at 25°C, 37°C, 45°C, 50 °C and 55°C
and ITS rDNA amplified using the ITS-1 and ITS-4 primer set to enable
identification by comparison with the NCBI data base. Amplified rDNA
sequence lengths ranged from 308-551 bp for the 5.8S rDNA and ITS regions
and identities against the NCBI database ranged from 98 – 100 % (Table 3.1). At
25°C, four species were identified, Acremonium atrogriseum, Phialophora
intermedia, Pichia manshurica, and Galactomyces geotrichum. Seven similar
morphotypes were recovered but on sequencing were all found to be
Galactomyces geotrichum. At 37°C, only Candida tropicalis was recovered,
while at 45°C, two species, Talaromyces emersonii and Geosmithia
cylindrospora were identified. At 50°C, one species, Aspergillus fumigatus was
recovered and at 55°C only Talaromyces emersonii was recovered. Strains
identified in this study were subjected to phylogenetic analysis to verify strain
identity (Fig 3.3).
Chapter 3
106
Isolate code Temperature Strain name EMBL accession number
Table 3-1.Putative identities of the fungal PVA degraders recovered from the surface of PVA buried in compost. Fungi recovered on PVA media from the surface of PVA sheets buried in compost and incubated at various temperatures were transferred onto PDA plates and grouped into different morphotypes. The ITS region of the rDNA from a representative of each morphotype was sequenced and the sequence used to interrogate the NCBI database.
Chapter 3
107
Figure 3-3.Phylogenetic analysis of the ITS rDNA sequences of fungal species isolated from the surface of PVA with the closest matching strains from the NCBI database. Strains isolated and identified in this study are marked with star *.
Chapter 3
108
3.3.4 Analysis of the dominant fungal species colonising the surface of
PVA coupons following burial in compost.
In order to compare the fungal community growing on the surface of
PVA coupons with the community in the surrounding compost, DNA from the
surface of the coupons and from the surrounding compost after 21 days
incubation at temperatures between 25°C and 55°C was extracted and subjected
to DGGE analysis following PCR amplification of the ITS region of the rDNA
(Fig 3.4). Compared to the initial community in the compost prior to incubation,
the number of DGGE bands decreased as incubation temperature increased to
55°C. Similarly, the fungal community profiles on the surface of PVA coupons
were similar to the profile in the surrounding compost, except that the intensity
of some bands had changed. No new DGGE bands were detected on the surface
of PVA compared to the surrounding compost. This suggests that dominant
organisms colonising the PVA surface were those already present in the compost
community although the relative abundance changed on the surface compared to
the surrounding compost.
To investigate this further, PVA degrading organisms isolated by
cultivation from the PVA surface were individually subjected to DGGE analysis
on the same gel as the initial total compost community (Fig 3.5). With the
possible exception of Galactomyces geotrichum (lane B), none of the single PVA
degrading isolate co- migrated with the dominant bands from the initial compost
community suggesting that the majority of PVA degrading fungal strains
recovered from the surface of PVA on PVA medium were not dominant
members of the compost community.
Chapter 3
109
Figure 3-4.A comparison of the fungal community profile of compost and on the surface of PVA coupons after 21 days incubation at different temperatures by DGGE. Total community DNA from compost and from the surface of PVA buried in compost were used to amplify the ITS region of the rDNA and amplicons subjected to DGGE. Initial compost community (Lane A); compost community after 21 days incubation at 25°C, 37°C, 45°C and 55°C (Lanes B to E respectively). Fungal community profile from the surface of PVA after 21 days incubation buried in compost at 25°C, 37°C, 45°C and 55°C (Lanes F to I respectively).
Chapter 3
110
Figure 3-5.A comparison of the fungal community profile of compost with isolated fungal species recovered on PVA medium from the surface of PVA coupons buried in compost by DGGE. Total community DNA from compost and DNA from individual strains recovered by cultivation from the surface of PVA were used to amplify the ITS region of the rDNA and amplicons subjected to DGGE. Lane A, initial compost; Lane B Galactomyces geotrichum (isolated at 25°C); Lane C, Talaromyces emersonii (isolated at 45°C); Lane D, Candida tropicalis (isolated at 37°C); Lane E, Geosmithia cylindrospora (isolated at 50°C); lane F, Aspergillus fumigatus (isolated at 50°C).
Chapter 3
111
3.4 DISCUSSION
The treatment of solid waste under composting conditions is increasingly
used for the treatment and recycling of organic waste materials (Shah et al.,
2008). As larger volumes of biodegradable polymers are finding applications in
industrial and domestic settings, these materials are increasingly entering
composting waste streams; however, other than monitoring the degradation of
these materials, there has been relatively little research on the microorganisms
that colonise these polymers. Previous studies in soils, waste waters and sewage
sludge has identified a small number of bacterial species including Pseudomonas
sp (Watanabe et al., 1976; Hatanaka et al., 1995), Alcaligenes faecalis
(Matsumara et al., 1994) and Bacillus megaterium (Mori et al., 1996a) that are
capable of degrading PVA, although many require a symbiotic partner in co-
culture (Corti et al., 2002; Chen et al., 2007). However, few studies have
investigated microbial degradation of biodegradable polymers in composting
systems. One study in compost isolated the thermophilic actinomycete
Thermomonospora fusca which was thought to play an important role in the
initial degradation of aliphatic-aromatic copolyesters (Kleeberg et al., 1998).
In this study, PVA sheets were buried in mature compost and incubated
at temperatures between 25°C and 55°C for 21 days. Examination of the surface
of the sheets by light microscopy and ESEM revealed rapid and extensive growth
of fungal colonies on the surface of PVA at all temperatures, suggesting fungi
potentially play an important role in biodegradation of PVA. This was verified
by an increase in CFU’s recovered from the surface of the PVA sheets on media
Chapter 3
112
containing PVA as the sole carbon source. While fungal growth was clearly
visible on the surface of the PVA coupons, discolouration and partial
disintegration was only seen at elevated temperatures suggesting a combination
of higher temperature and fungal activity may have been responsible as control
coupons incubated at equivalent temperatures in sterile water were unaffected.
Galactomyces geotrichum was the principal colonizing fungus recovered from
the surface of PVA coupons incubated at 25°C ,while only thermophilic fungi
were recovered at 45°C, 50 °C and 55°C with Talaromyces emersonii the
principle organism recovered. Geotrichum species are common yeast-like fungi
found in a variety of environments (Pimenta et al., 2005) and are exploited
industrially for lipase applications in detergents and for biodegradation of waste
water textile dyes (Jadhav et al., 2008; Phillips and Pretorius, 1991; Waghmode
et al., 2012). Previously, G. geotrichum were found to be the most frequently
recovered strain in a number of different soils (Mollasalehi et al, unpublished)
and was found to completely degrade PVA as a sole carbon source for growth
and a related Geotrichum sp was also reported to be capable of degrading
polyvinyl alcohol oligomers (Mori et al., 1996b). As G. geotrichum was the
major isolate recovered at 25 °C, it suggests that in temperate environments, it is
the major organism selected when PVA is present and may therefore potentially
also be useful in the removal of PVA from contaminated environments. PVA
coupons incubated at 45°C and 55°C were degraded more rapidly compared to
lower temperatures, whereas PVA sheets buried in sterile saturated vermiculite
did not undergo any discernible physical changes. However, the fungal CFU’s
Chapter 3
113
recovered from the surface of the PVA sheet at 25° and 37° C was higher than
that recovered at 45°, 50° and 55°C. DGGE profiles of compost and the surface
of the PVA coupons after 21 days incubation revealed that the majority of the
fungi detected on the surface were also dominant in the compost, suggesting that
many fungi colonise PVA regardless of whether they are capable degrading it.
This was also demonstrated by CFU’s recovered from the PVA surface on PVA
medium compared to PDA medium which were always lower (between 0.8% at
37°C and 21.6% at 50°C). In addition, with the exception of G. geotrichum,
organisms recovered from the PVA surface on PVA medium were not visible in
the compost community, suggesting they formed a minor component on the total
fungal biomass on the PVA surface.
This study demonstrates that PVA entering the composting stream is
susceptible to fungal degradation at all temperatures of the composting process
and that while colonisation of the PVA surface by the dominant fungal species
present in the compost occurs, selection for a small number of minor species
capable of degrading PVA from within the fungal community plays an important
role in the degradation of this polymer.
Chapter 3
114
3.5 REFERENCES
Barratt, S. R., Ennos, A. R., Greenhalgh, M., Robson, G. D. & Handley, P.
S. (2003). Fungi are the predominant micro-organisms responsible for
degradation of soil-buried polyester polyurethane over a range of soil water
holding capacities. Journal of Applied Microbiology 95, 78-85.
De Bertoldi, M., Vallini, G. & Pera, A. (1983). The biology of composting: A
review. Waste Management and Research 1, 157-176.
Chai, W. L., Chow, J. D., Chen, C. C., Chuang, F. S. & Lu, W. C. (2009).
Evaluation of the biodegradability of polyvinyl alcohol/ starch blends: A
methodological comparison of environmentally friendly materials. Journal of
Polymers and the Environment 17, 71-82.
Chen, J., Zhang, Y., Du, G.C., Hua, Z. Z. & Zhu, Y. (2007). Biodegradation
of polyvinyl alcohol by a mixed microbial culture. Enzyme and Microbial
Technology 40, 1686- 1691.
Chiellini, E., Corti, A., D’Antone, S. & Solaro, R. (2003). Biodegradation of
polyvinyl alcohol based materials. Progress in Polymer Science 28, 963-1014.
Corti, A., Solaro, R. & Chiellini, E (2002). Biodegradation of polyvinyl alcohol
in selected mixed microbial culture and relevant culture filtrate. Polymer
Degradation and Stability 75, 447-458.
Cosgrove, L., McGeechan, P. L., Robson, G. D. & Handley, P. S. (2007).
Fungal communities associated with degradation of polyester polyurethane in
Watanabe, Y., Hamada, N., Morita, M. & Tsujisaka, Y. (1976). Purification
and properties of a polyvinyl alcohol-degrading enzyme produced by a strain of
Pseudomonas. Biochemistry and Biophysics 174, 575-581.
Webb, J. S., Nixon, M., Eastwood, I. M., Greenhalgh, M., Robson, G. D. &
Handley, P. S. (2000). Fungal colonization and biodeterioration of plasticized
polyvinyl chloride. Applied and Environmental Microbiology 66, 3194-3200.
Chapter 3
118
APPENDIX 3.1
Fungal morphotypes isolated from compost on PVA agar
Fungi growing on PVA sheets transferred onto potato dextrose agar and
grouped into different morphotypes based on morphological similarity prior to
ITS sequencing. Different morphotypes were distinguished and are shown in
Figure A3.1
A B
C D
Chapter 3
119
E F
G
Figure A3.1. Morphological characteristic of dominant fungal strains isolated from studied soils on PDA agar plates. A is (Galactomyces geotrichum), B (Phialophora intermedia), C (Acremonium atrogriseum), D (Pichia manshurica), E (Candida tropicalis), F (Talaromyces emersonii), G (Aspergillus fumigatus).
Chapter 4
120
4 CHAPTER FOUR
IMPACT OF THE WATER SOLUBLE POLYMER POLYVINYL ALCOHOL ON
SOIL AND COMPOST FUNGAL COMMUNITIES
Somayeh Mollasalehi1, Pauline S. Handley1, Geoffrey D. Robson1# 1Faculty of Life Sciences, University of Manchester, Michael Smith Building, Manchester M13 9PT, UK # Corresponding author Geoffrey Robson Faculty of Life Sciences Michael Smith building University of Manchester Manchester M13 9PT, UK Phone: 01612755048 Email: [email protected]
Chapter 4
121
ABSTRACT
The water soluble biodegradable polymer polyvinyl alcohol (PVA) is
widely industrially used in paper coating and textile sizing as well a variety of
other applications. While some individual microbes and consortia capable of
degrading PVA have been characterised in the laboratory, there have been few
studies that have examined its impact on naturally occurring microbial
communities. In this study, terminal restriction fragment length polymorphism
(TRFLP) was used to monitor changes in the fungal community profile in soil
and compost over a six week period following the addition of PVA at 25°C and
45°C. In soil at 25°C, the community changed in the presence compared to the
absence of PVA with the greatest shift in the community occurring after four
weeks before returning to a profile similar to that seen in the absence of PVA
after 6 weeks. In compost, the response to the presence of PVA was more
complex. At both 25°C and 45°C, in the absence of PVA, the community shifted
over 6 weeks, with greatest change visible after 2 weeks. In the presence of
PVA, an increase in the number of TRFs was also observed but was lower than
that seen in the absence of PVA. Overall, this study has shown that PVA causes
a significant shift in the fungal community with a number of T-RF’s detected
only in the presence of PVA. However, these were minor components of the
community and the presence of PVA did not cause a major shift in the dominant
species. The greatest change was found after four weeks of incubation, however
after six weeks the communities in the presence of PVA were more similar to
that found in the absence of PVA suggesting that exposure to PVA causes a
temporary shift in the fungal community.
Chapter 4
122
4.1 INTRODUCTION
Polyvinyl alcohol is a water soluble biodegradable synthetic polymer
which is used extensively in industrial applications such as the adhesive, textile
and paper coating industries and in the production of biodegradable products
including laundry bags and agricultural mulching films (Chiellini et al, 2003;
Shimao, 2001; Tokiwa et al., 2001). A number of bacterial strains have been
reported to cause biodegradation of this polymer (Corti et al.2002; Kim et al.
2003; Mori et al. 1996; Shimao et al. 1984; Suzuki et al. 1973; Tokiwa et al.
2001; Vaclavkova et al. 2007), but few studies have focused on fungi or on the
impact of this polymer on microbial communities in natural environments (Corti
et al. 2002; Jecu et al. 2010; Qian et al. 2004; Tsujiyama et al. 2011). While a
limited number of bacterial strains have been reported to be capable of degrading
PVA, the majority of research has demonstrated that PVA is degraded more
effectively by mixed consortia (Chen et al. 2007; Sakazawa et al. 1981) .This has
since been shown to be due to the production of growth factor(s) by a symbiotic
partner(s) essential for the degradation of PVA by the PVA degrading strain
(Hashimoto & Fujita, 1985; Mori et al. 1996; Shimao, 2001; Vaclavkova et al.
2007). A number of enzymes have been identified that are responsible for the
degradation of PVA in which the carbon-carbon polymer backbone is first
cleaved by the action of either a dehydrogenase or an oxidase, followed by the
action of an aldolase or hydrolase (Shimao, 2001; Amange & Minge, 2012).
Based on these studies, PVA is widely regarded as a biodegradable polymer.
However, in reality the number of microbes capable of degrading PVA appears
to be limited and PVA degradation in the environment does not occur easily
Chapter 4
123
requiring an acclimatation period during which PVA degraders are selected
(Porter & Snider, 1976; Chiellini et al 1999; Chiellini et al, 2003). Moreover, no
studies have been conducted to assess the overall impact of PVA on naturally
occurring microbial communities.
Previously, we reported on the isolation of a limited number of fungal
isolates from a diverse number of soil types through serial enrichment that were
capable of degrading PVA (Mollasalehi et al, unpublished, Chapter 2). In this
study, we used Terminal Fragment Lemgth Polymorphism (TRFLP) to study the
impact of PVA on the fungal community profile in soil and compost; non-culture
based techniques that have been widely used to evaluate changes and
composition of microbial communities within environmental samples. Such
approaches are valuable as the majority of microorganisms cannot be cultivated
on laboratory media (Hawksworth, 1991; Osborn et al., 2000) and the method
enable an estimate of both community diversity and dynamics within complex
microbial ecosystems independent of conventional cultivation (Andronov et al.,
2009; Anderson and Cairney, 2004; Edwards and Zak, 2010; Ge and Zhang,
2011; Krummins et al, 2009; Liu et al, 1997; Muyzer et al. 1997; Muyzer and
Smalla, 1998; Schutte et al., 2008).
In this study, we report that PVA causes a marked shift in the fungal
community population within two weeks. But, after six weeks the community
profile begins to approach that of the initial population suggesting that transient
PVA contamination in soils and compost may not have a lasting effect on the
indigenous fungal community.
Chapter 4
124
4.2 MATERIALS AND METHODS
4.2.1 PVA amended soil and compost
Commercial organic compost (The compost shop, UK) and top soil (Ideal
Range, UK) were stored at room temperature until required. 50 ml of 10% (w/v)
PVA (MW 13-23 KD, DH 98%) was mixed thoroughly with 250 g of compost or
soil and incubated in a plastic box at 25°C (soil) and 25° and 45°C (compost).
Controls contained soil or compost plus 50 ml sterile distilled water without
PVA .The water content of soils and composts were evaluated weekly by
weighing and sterile water was added to maintain a constant weight over the
duration of the experiment. Water holding capacity (WHC) of the compost and
soil were determined at the beginning and periodically according to Barratt et al
(2003).
4.2.2 DNA extraction from soil and compost
Genomic DNA from soil and compost were extracted every two weeks
using a PowerSoil DNA isolation Kit (MoBio laboratories, UK) and purified
using a QIAquick purification kit (Qiagen, UK) according to the manufacturer’s
instructions. Genomic DNA was stored at -20°C until required.
4.2.3 Terminal restriction fragment length polymorphism (T-RFLP)
Extracted genomic DNA from soil and compost were amplified with
fluorescently labelled primers, ITS4-HEX (hex-
TCCTCCGCTTATTGATATGC) and ITS5-FAM (fam-
GGAAGTAAAAGTCGTAACAAGG) at a concentration of 50 pmol/µl. PCR
reagent concentrations were 50 mM MgCl2, 10 mM of dNTPs, 5 μl of 10 x
Chapter 4
125
reaction buffer supplied in BIOTAQ DNA polymerase kit, and 5 U/µl of
BIOTAQ DNA Polymerase, 10mg/ml of 100 x BSA per 50 μl PCR reaction.
Amplification was carried out for 35 cycles of denaturation at 94 °C for 1 min,
annealing at 54 °C for 1 min, and extension at 72 °C for 1 min. Amplified PCR
products were purified (Qiaquick PCR purification kit, Qiagen, UK) and digested
with 10 U/µl Hhal (Fermentas, UK, 10U/µl) for 2 h at room temperature and
subjected to capillary electrophoresis in house enabling the digested dye labelled
PCR digested fragments (T-RF’S) to be separated according to molecular
weight.
4.2.4 Analysis of terminal restriction fragments (T-RF’s)
The position and the peak areas of the T-RFs were analysed using
PeakScanner v1.0 (Applied Biosystems, USA) and T-Align (Smith et al 2005).
Light peak smoothing and a peak threshold of 30 fluorescence units were used
for the analysis. Fragments which were less than 50 bp and greater than 500 bp
were excluded from the analysis. Shannon Index diversity (H) and evenness (e)
were used as species diversity indicators and were calculated for each sample as
described by Tiquia (2005). Binary similarity matrices were subjected to
principal component analysis (PCA) using MVSP multivariate analysis software
(Kovach Computing Services, Anglesey, UK).
Chapter 4
126
4.3 RESULTS
4.3.1 Influence of PVA on the soil and compost fungal community
As PVA is a water soluble polymer, the influence of the addition of
PVA to the fungal community in soil at 25 °C and in compost at 25°C and 45°C
was investigated by Terminal Restriction Fragment Length Polymorphism
(TRFLP) analysis. TRFLP is a non-culture-based technique enabling a
fingerprint of the number of species and their relative abundance to be
quantified. Soil and compost, amended with PVA or water, was incubated in
containers at 25°C (soil) or 25°C and 45°C (compost) and triplicate samples
removed for analysis prior to amendment (0 days, initial) and after 14, 28 and 42
days incubation. Following genomic DNA extraction, triplicate samples were
pooled and TRFLP was performed to enable community profile changes to be
quantified. The ITS4-ITS5 region of the fungal rDNA was amplified by PCR
with the forward primer labelled with a fluorescent HEX dye to enable
subsequent detection. PCR amplicons were digested overnight with Hha1 and
digested amplicons separated by molecular weight by capillary electrophoresis.
Electropherograms showing the distribution and normalized peak heights of the
T-RF’s from the soil and compost fungal communities in the presence and
absence of PVA are shown in Figures 4.1, 4.2 and 4.3. In soil at 25°C, the
profiles after 0, 2, 4 and 6 weeks in the absence of PVA were broadly similar and
the number of TRF’s ranged between 61 and 94 (Table 4.1). Following PVA
addition, the electropherograms indicated that the community profile changed
with a number of new peaks visible after four weeks (Fig 4.1) which was
reflected by an increase in the number of TRF’s which rose to 116 before
Chapter 4
127
decreasing to 90 after 6 weeks (Table 4.1). However, the most abundant peaks
remained unchanged indicating that PVA caused selection for a small number of
additional fungi that peaked in week 4 for but had begun to disappear by week 6.
PCA analysis confirmed that in the absence of PVA, the soil community changed
little over six weeks whereas a marked shift was seen in response to PVA with
the greatest difference in week 4 (Fig 4.4) before returning to a profile similar to
that seen in the absence of PVA. This was also reflected in an increase in the
Shannon index and Eveness in the presence of PVA at week four which indicates
an increase in diversity in the fungal community (Table 4.1). The number of
unique T-RF’s (T-RF’s only seen in the presence of PVA) rose from 7 after 2
weeks incubation to 76 after 4 weeks and declined to 17 after 6 weeks (Table
4.1).
Compost had initially a much lower number of detectable T-RF’s (27)
compared to soil (87) and the community profile was very different. In the
absence of PVA at 25°C the number of TRF’s rose significantly to 251 in week
two before falling in weeks 4 and 6 to 161 and 123 respectively and this increase
and subsequent decrease were clearly seen in the electropherograms (Fig 4.2,
Table 4.2). In the presence of PVA, the number of TRF’s also initially increased
in week 2 but not as much as in the absence of PVA suggesting the presence of
PVA repressed the increase in species diversity (157) before also falling in
weeks 4 and 6 to reach a final level similar to week that seen in the absence of
PVA (98). While some dominant peaks were retained in both the presence and
absence of PVA, a number of new peaks were visible in the presence of PVA.
Chapter 4
128
However, while the number of unique peaks in soil in the presence of PVA rose
to a maximum of 76 (Table 4.1), in compost at 25°C the number of unique peaks
seen only in the presence of PVA at 2, 4 and 6 weeks was 7, 6 and 4 (Table 4.2).
Consequently, the largest change in the population was seen after two weeks in
the absence of PVA as reflected in the Shannon index and Eveness (Table 4.2).
PCA analysis of the electropherograms confirmed that the community initially
changed the most after 2 weeks before returning close to the original profile by
week 6, and that the profile in the presence of PVA was different to that seen in
the absence of PVA (Fig 5.5). The number of unique T-RF’s (T-RF’s only seen
in the presence of PVA) rose from 7 after 2 weeks incubation to 76 after 4 weeks
and declined to 17 after 6 weeks (Table 4.2).
When the compost was incubated at 45°C, temperature had a marked
effect on the community profile in both the presence and absence of PVA (Fig
4.3). In the absence of PVA, the number of TRF’s increased from 27 to 150 after
2 weeks, remained similar at 159 after 4 weeks, before falling to 58 after 6 weeks
(Table 4.2). In the presence of PVA, the number of TRF’s also increased after 2
weeks though only to 89 compared to 150 in the absence of PVA. After 4 weeks,
the number of T-RF’s rose to 147 in the presence of PVA, similar to the numbers
seen in the absence of PVA (159) before falling to 113 after 6 weeks, higher than
that seen in the absence of PVA (58)(Table 4.2). Thus initially in compost at
45°C, PVA also depressed the increase in community diversity after 2 weeks as
seen at 25°C. While the total numbers of T-RF’s was similar after 4 weeks in the
presence and absence of PVA, the number of unique T-RF’s only seen in the
Chapter 4
129
presence of PVA was highest (32) compared to weeks two and six (12 and 7
respectively, Table 4.2). This was confirmed in the PCA analysis which
demonstrated the greatest differences in the structure of the fungal community
was seen in the presence of PVA after 4 weeks (Fig 4.5) and also in the Shannon
index (Table 4.2).
Chapter 4
130
Figure 4-1.Effect of PVA on the fungal community profile of soil by TRFLP analysis. Commercial top soil was amended with either sterile water (blue) or PVA (red) and incubated in containers for 42 days at 25°C. Total genomic DNA was extracted from triplicate samples from the initial (green) soil prior to incubation and after 14, 28 and 42 days, pooled and the ITS4/ITS5 rDNA amplified by PCR. Following digestion with Hhal, HEX labelled amlicons were seperated by capillary electrophoresis and individual amplicon peaks normalised against the total. Amplicons less than 35 bp were excluded from the anlaysis.
Soil initial
- PVA 14 d
+ PVA 14 d
- PVA 28 d
+ PVA 28 d
- PVA 42 d
+ PVA 42 d
0
10
20
30
40
35.0
241
.955
.55
62.6
471
.31
79.7
593
.91
102.
0410
9.59
116.
6412
3.65
131.
71 139
146.
6915
4.41
163.
2717
2.87
184.
6319
1.83
198.
8520
6.09
214.
9922
4.85
243.
1726
4.91
284.
3929
8.38
321.
5733
5.05
355.
2239
1.8
415.
62
Amplicon size (T-RF, bp)
Nor
mal
ized
fluo
resc
ence
in
tens
ity
Chapter 4
131
Figure 4-2.Effect of PVA on the fungal community profile of compost by TRFLP analysis. Commercial compost was amended with either sterile water (blue) or PVA (red) and incubated in containers for 42 days at 25°C. Total genomic DNA was extracted from triplicate samples from the initial (green) compost prior to incubation and after 14, 28 and 42 days, pooled and the ITS4/ITS5 rDNA amplified by PCR. Following digestion with Hhal, HEX labelled amlicons were seperated by capillary electrophoresis and individual amplicon peaks normalised against the total. Amplicons less than 35 bp were excluded from the anlaysis.
Compost …- PVA 14 d
+ PVA 14 d- PVA 28 d
+ PVA 28 d- PVA 42 d
+ PVA 42 d
05
101520253035404550
3556
.49
72.4
192
.85
107.
4612
2.73
137.
9215
5.32
168.
5618
2.44
196.
6821
1.24
229.
6324
6.36
263.
0428
0.31
301.
2232
2.48
346.
8638
0.26
411.
7645
1.98
Nor
mal
ized
fluo
resc
ence
in
tens
ity
Amplicon size (T-RF, bp)
Chapter 4
132
Figure 4-3.Effect of PVA on the fungal community profile of compost by TRFLP analysis. Commercial compost was amended with either sterile water (blue) or PVA (red) and incubated in containers for 42 days at 45°C. Total genomic DNA was extracted from triplicate samples from the initial (green) compost prior to incubation and after 14, 28 and 42 days, pooled and the ITS4/ITS5 rDNA amplified by PCR. Following digestion with Hhal, HEX labelled amlicons were seperated by capillary electrophoresis and individual amplicon peaks normalised against the total. Amplicons less than 35 bp were excluded from the anlaysis.
Compost initial
- PVA 14 d
+ PVA 14 d
- PVA 28 d
+ PVA 28 d
- PVA 42 d
+ PVA 42 d
0
10
20
30
40
50
3554
.52
67.0
183
.25
98.8
711
0.64
122.
7313
5.88
150.
8116
5.24
176.
0418
8.48
200.
821
1.24
224.
8424
5.11
263.
0429
3.72
321.
5433
8.79
378.
7241
6.36
497.
42
Amplicon size (T-RF, bp)
Chapter 4
133
Figure 4-4. Principal Component Analysis (PCA) of T-RFLP data derived from amplified 18S rDNA from soil in the presence and absence of PVA and unpolluted soil. Soil was incubated at 25°C and TRFLP’s analysed after 0, 2, 4 and 6 weeks. 20.774% and 38.041% represented the percentage of the total variance of each axis. PCA of variability was calculated by the presence/absence of TRFLP peaks by using binary analysis.
Chapter 4
134
Samples Week Total
TRFs
PVA
unique
TRF’s
Shannon
index (H’)
Evenness
Soil initial 0 94 NA 2.57 0.57
Soil +2 61 NA 2.74 0.67
Soil +PVA +2 63 6 2.34 0.71
Soil +4 88 NA 2.73 0.56
Soil +PVA +4 157 76 3.60 0.58
Soil +6 82 NA 2.57 0.61
Soil +PVA +6 90 17 2.64 0.59
Table 4-1.Influence of PVA on the total number of TRF’s, Shannon index (H’) and evenness (E) of fungal communities in soil assessed by TRFLP following incubation 25°C over a six week period.
Chapter 4
135
Figure 4-5.Principal Component Analysis (PCA) of T-RFLP data derived from amplified 18S rDNA from compost in the presence and absence of PVA. Compost was incubated at 25°C and 45°C and TRFLP’s analysed after 0, 2, 4 and 6 weeks. 40.430% and 18.863% represented the percentage of the total variance of each axis. PCA of variability was calculated by the presence/absence of TRFLP peaks using binary analysis.
PCA case scores
25+PVA
45+PVA
25-PVA
45-PVA
Initial
17.078 %
26.826 %
2th
4th
6th
2th
4th
6th
2th
4th 6th
2th
4th
6th
Initial
-0.5
-1.0
-1.5
-2.0
-2.5
0.5
1.0
1.5
2.0
2.5
-0.5-1.0-1.5-2.0-2.5 0.5 1.0 1.5 2.0 2.5
Chapter 4
136
Samples Week Total TRFs
PVA
unique
TRF’s
Shannon
index (H’) Evenness
Compost initial 0 27 NA 1.48 0.45
25° Compost +2 251 NA 4.36 0.79
25° Compost
PVA +2 157 7 3.65 0.72
25° Compost +4 161 NA 3.07 0.60
25° Compost
PVA +4 132 6 3.43 0.70
25° Compost +6 123 NA 3.06 0.64
25° Compost
PVA +6 98 4 3.07 0.67
45° Compost +2 150 NA 3.06 0.61
45° Compost
PVA +2 89 12 2.92 0.65
45° Compost +4 159 NA 3.17 0.63
45° Compost
PVA +4 147 32 3.56 0.71
45° Compost +6 58 NA 2.70 0.66
45° Compost
PVA +6 113 7 2.86 0.61
Table 4-2. Influence of PVA on the total number of TRF’s, diversity index (H’) and evenness (E) of fungal communities in compost at 25°C and 45°C assessed by TRFLP following incubation over a six week period.
Chapter 4
137
4.4 DISCUSSION
Conventional culture techniques are not sufficient to accurately profile
microbial communities in the environment because only a small portion of
microorganisms can be cultured in the laboratory (Bridge & Spooner, 2001).
Non-culture based molecular techniques such as DGGE and TRFLP are
commonly utilized methods for more accurately profiling of microbial
communities although issues surrounding efficiency of DNA extraction and
PCR bias also impact on accuracy (Anderson & Cairney, 2004; Clement et al,
1998; Denaro et al, 2005; Kirk et al., 2004; LaMontagne et al, 2002; Peters et
al, 2000; Suzuki & Giovannoni, 1996).
In this study, we aimed to evaluate the effect of polyvinyl alcohol (PVA)
on fungal communities in soil at 25°C and in compost at 25°C and 45°C using
TRFLP. TRFLP is known to be far more sensitive than DGGE and able to
detect microbes at a lower abundance (Kennedy and Clipson, 2003). Previously,
it was demonstrated that degradation of PVA appears to be limited to a
relatively small number of fungi in soils (Mollasalehi et al, Chapter 2), as has
also been demonstrated for bacteria. However, this study involved isolation of
culturable fungi and therefore more fungal species may have been present that
were unable to be recovered (Hawksworth, 2004). TRFLP analysis revealed that
the soil fungal community in the absence of PVA at 25°C remained largely
unchanged over the 6 week period. However, in the presence of PVA, the
number of TRFs almost doubled after 4 weeks compared to the absence of PVA
but then declined to levels equivalent to the absence of PVA after 6 weeks. This
Chapter 4
138
was reflected in the number of new TRF’s only found in the presence of PVA
which rose from 6 after 2 weeks to 76 after 4 weeks before declining to 17 after
6 weeks. The appearance of numerous TRF’s after 4 weeks in the presence of
PVA was clearly visible on the electropherograms and PCA analysis revealed a
clear separation of the population in the presence of PVA after 4 weeks while
the population after 6 weeks more closely resembled the population seen in the
absence of PVA. The data strongly suggest the selection of a number of
additional species specifically in the presence of PVA but at low levels and that
these declined by week 6 suggesting most of the PVA had been degraded and
the population was returning to that found in the absence of PVA. In compost
the situation was more complex as the population shifted considerably on
incubation at either 25°C or 45°C in the absence of PVA. At 25°C, there was an
initial proliferation of fungi in compost after week two which then decreased
and remained relatively stable. An increase in fungi in compost at mesophilic
temperatures has been observed previously and probably reflects the shift in
temperature from the outdoor environment to 25°C enabling remaining readily
utilizable substrates to be consumed (Tiquia, 2005). TRFLP analysis revealed
that the presence of PVA appeared to select for a small number of additional
fungi in the community in both soil and compost and that these appeared to be
transient, presumably positively selected when PVA was present, but unable to
be maintained once the PVA had been utilized. While the community profiles in
the presence of PVA differed compared to those in absence of PVA, the most
abundant members of the community were not affected and were largely
Chapter 4
139
maintained in the presence of PVA. However, in compost at both 25°C and
45°C, the initial rise in the number of T-RF’s and thus species detected after 2
weeks, was much lower in the presence of PVA suggesting that PVA entering
composting waste may have an adverse effect on the diversity of the fungal
community. The presence of PVA caused only a temporary appearance of
specific fungal members in the profiles and largely returned to the profile
observed in the absence of PVA. However, the profile at 45°C in compost
appeared to cause a longer lasting shift in the profile. At 45°C, only
thermophilic fungi are capable of actively growing and the number of species is
restricted compared to mesophiles (Salar & Aneja, 2007), although, the number
of detected TRFs at 45°C remained high. However, as TRFP does not
distinguish between viable and non viable biomass, it may reflect that many of
the mesophiles originally present were still present in the compost even if they
were not viable or growing. Thus it is possible that PVA degradation may have
occurred at a lower rate and that by week 6, sufficient PVA may still have been
present to maintain positive selection for degraders.
Shifts in the microbial population following addition of a variety of
contaminants are well documented, particularly for heavy metals and organic
compounds including pesticides (Colores et al. 2000; Liu et al. 2012; Ge and
Zhang, 2011; Gremion et al. 2004; Hamamura et al. 2006; Heilmann et al.
1995). Where these contaminants are toxic, selection of particular microbes is
accompanied by decreases in the overall diversity, whereas non-toxic or
environmental perturbations generally alter the microbial composition but do
Chapter 4
140
not necessarily decrease diversity (Cruz et al, 2009; Esperschütz et al, 2007;
Girvin et al, 2004; Li et al, 2008; Wu et al, 2012; Zhong et al, 2009). PVA is a
non-toxic polymer and so unlikely to have a significant effect on the indigenous
community if it is also not utilized by the majority of the organisms present.
Previously, it has been reported that only a relatively small number of
fungal species appeared capable of degrading PVA in a number of different
soils containing different fungal communities. In this study, only a small
number of unique TRFs were transiently detected following addition of PVA
suggesting positive selection for a small number of species capable of degrading
PVA while the majority appeared largely unaffected. Thus, it appears that
contamination with PVA causes transient selection for degraders but that the
community returns largely to its original state prior to PVA exposure. The
exception was in compost at 45°C, but this may have been due to a slower rate
of degradation due to the more limited number of thermophilic compared to
mesoophilic species. Nonetheless, this study suggests that PVA does not cause
major or permanent changes to soil or compost fungal communities and that
PVA entering soil or into composting systems is degraded and while causing
numerous small changes in the population, these changes are transient and once
PVA is not degraded, the population returns to an equilibrium similar to that
seen in the absence of PVA.
Chapter 4
141
4.5 REFERENCES
Amange, M. & Minge, O. (2012). Biodegradation of Poly (vinyl acetate) and
related polymers. Advances in Polymer Science 245, 137-172.
Anderson, I. C. & Cairney, J. W. G. (2004). Diversity and ecology of soil
fungal communities: increased understanding through the application of