From DNA to Protein. Knowledge of Nucleic Acid Chemistry Is Essential to the Understanding of DNA Structure.

From DNA to Protein

Knowledge of Nucleic Acid Chemistry Is Essential to the Understanding of DNA Structure

Nucleotides are linked by a phosphodiester bond between the phosphate group at the C-5' position and the OH

group on the C-3' position

Figure 10-12b Copyright © 2006 Pearson Prentice Hall, Inc.

• DNA and RNA both contain A, C, and G, but only DNA contains T and only RNA contains U.

• RNA contains ribose as its sugar; DNA contains deoxyribose

The Genetic Material Must Exhibit Four Characteristics

• For a molecule to serve as the genetic material, it must be able to replicate, store information, express information, and allow variation by mutation.

An example of regulation of cellular functions by Gene expression

Molecular hybridization between DNA fragments

*

Electrophoretic separation of a mixture of DNA fragments

Polymerase Chain Reaction (PCR)

Micro-array technique allow study of all the genes (within a genome)in a single experiment

- Each spot represent a single gene- RNA from two conditions (+/- O2) are isolated-RNA (red and green-representing two conditions) hybridized to slide- Images merged. Ex: green=no O2 Red= plus O2- Green spot: only expressed in no O2 Red spot: expressed only in plus O2 Yellow: Expressed in both condition

http://www.bio.davidson.edu/courses/genomics/chip/chip.html

Transposons in Plants: Jumping Genes

Control of Flowering by Histone Modification

Map-Based Cloning of Mutated Genes

T-DNA Insertional Mutagenesis

Tilling: Targeted Induced Local Lesions in Genomes

RNA Interference: Targeted Gene Expression Knockdown

Plant CellPlant Cell

• rigid wall surrounding the plasma membrane.• complex structure• protecting the cell and to regulating the life cycle of the plant organism.

Cell wallCell wall

PLANTS IN MOTION

Movies at Indiana

Red arrow shows this molecules in the cell wall1. Cellulose Microfibrils2. Pectin3. Middle Lamella4. Cross-linking Glycan5. Plasma Membrane

The result of RNA Interference is mostly manifested by1. Elimination of all cellular RNA biosynthesis2. Down regulation of all RNA mediated signaling pathway3. No gene expression from a specific gene4. Degradation of the DNA of a particular gene5. Degradation of the mRNA and the protein of a specific gene

In the movie, successful cloning of a DNA fragment in a cloning siteis proved by1. Inactivation of LacZ gene (Blue colony)2. Inactivation of LacZ gene (White colony)3. Activation of LacZ gene (Blue colony)4. Activation of LacZ gene (White colony)

In the movie, the purple tomato is created with 1. Less amount of anthocyanin –a plant pigment2. More amount of anthocyanin- a plant organell3. More amount of b-carotene- a plant pigment4. More amount of anthocyanin- a plant pigment

In the movie, Amish Farmers have adopted Bt corns. These GMO corns resist corn disease caused by1. European corn borer2. Asian corn borer3. European corn beetles4. North American corn wasp

In the movie, Ugandan banana suffers from a disease causing1. Low yield due to plants inability to move its resources within the plant2. No yield due to complete shut down of the photosynthesis3. Delayed fruit production due to infection by a pathogen4. Low yield due to reduced capacity for photosynthesis

During PCR reaction, the main reason primers are needed is because1. The primers will bind to DNA template and help amplify DNA2. DNA polymerase needs double stranded template to amplify DNA3. DNA polymerase can degrade the double stranded DNA at the primer site4. The primers will facilitate the incorporation of dNTPs

All these organelles but this one are only found in a plant cell1. Chloroplast2. Cell wall3. Vacuole4. Plasmodesmata5. Rough Endoplasmic reticulum

Tonoplast refers to1. Cell wall outside of the plasma membrane2. Plasma membrane outside the cytoplasm3. Membrane surrounding the vacuole4. Chloroplastic membrane5. Mitochondrial membrane

During PCR primer synthesis, the template has the following DNA sequence: 5’ ATGGCCCCTCAGTCCACCCCGACTTAGCTAG 3’3’ TACCGGGGAGTCAGGTGGGGCTGAATCGATC 5’Identify the correct 5 bp FORWARD primer1. ATACG2. GCTAG3. TACCG4. ATGGC