Top Banner
Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of Pediatrics, Emory University School of Medicine Newborn Screening Molecular Workshop June 28-30, 2011 T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID National Center for Environmental Health · Division of Laboratory Sciences Newborn Screening and Molecular Biology Branch
16

Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

Dec 18, 2015

Download

Documents

Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

Francis K. Lee, M.Sc, Ph.D.Senior Service Fellow (Research Microbiologist)

Newborn Screening Translation Research Initiative, CDCEmeritus Professor of Pediatrics, Emory University School of Medicine

Newborn Screening Molecular WorkshopJune 28-30, 2011

T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID

National Center for Environmental Health · Division of Laboratory SciencesNewborn Screening and Molecular Biology Branch

Page 2: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

Severe Combined Immunodeficiency (SCID) is characterized by the

absence of both humoral and cellular immunity At least 15 different genes known to cause SCID when mutated

All have profound defects in T lymphocyte differentiation and function

Maternal antibodies wane during first months of life - affected

infants develop infections (common / opportunistic pathogens) Recurrent infections, chronic diarrhea, sepsis, FTT

Death usually before 1 year of age

Overview of SCID – the Condition

SCID has been called “Bubble Boy Disease”

Treatment and prevention of infections can

prolong life but are not curative

Best hope for SCID patients is Hematopoietic

Stem Cell Transplant before the onset of

infections

Page 3: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

SCID classification

X-linked SCID: Mutation in the γ chain common to IL-2, IL-4, IL-7, IL-9, IL-17 & IL-21 receptors

Autosomal Recessive SCID:

Adenosine Deaminase deficiency (20q13.11)

Jak3 tyrosine kinase deficiency (19p13.1)

RAG 1 or 2 defect (11p13)

IL-7R deficiency ( chain) (5p13)

Purine Nucleoside Phosphorylase deficiency (14q13)MHC II deficiency (16p13, 1q21, 13q)CD3 and CD3 mutations (11q23)CD45 deficiency

ZAP-70 deficiency- (2q12)

Artemis (10p)

Page 4: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

Mutations in IL2R gamma chain

NHIGRI, NIH: Genbank accession number L19546

Page 5: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

Common Feature: ABSENT/NON-FUNCTIONAL T CELLS

TRECs: Reduced in All Forms of SCID

IL2R T- B+ NK-JAK3 T- B+ NK-IL7R T- B+ NK+CD45 T- B+ NK+RAG1 T- B- NK+RAG2 T- B- NK+ARTEMIS T- B- NK+ADA T- B- NK-Reticular Dysgenesis T- B+ NK+SCID, multiple bowel atresias T- B+/- NK+SCID, congenital abnormalities T- B+/- NK+Severe DiGeorge Syndrome T- B+/- NK+CD3 Deficiency T+/- B+ NK+CD8 Deficiency T+ B+ NK+Severe Ataxia Telangiectasia T+/- B+/- NK+

Unknown geneticDefect ~5-25%

Page 6: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

Prevalence of the disease 1:100,000 or greaterSCID: 1:50,000-1:100,000

Can the disorder be detected by routine physical exam?SCID: Baby appears normal at birth.

Does the disease cause serious medical complications?SCID: 100% fatal within the first year of life

Is there a cheap, sensitive and specific screening test?SCID: Real time PCR to enumerate T cell receptor excision circles

Is there a confirmatory test?SCID: Lymphocyte subpopulation analysis

Does early detection improve outcome?SCID: Early HSCT decreases mortality from SCID

SCID Meets NBS Criteria

Page 7: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

Optimal Test to Screen for severe

T cell lymphopenia (SCID) Must detect low/absent T cells Use existing NBS screening cards Inexpensive, sensitive and specific

Low rate of false positive tests

Little need for retesting

• Real Time PCR (RT-PCR): enumeration of T cell receptor excision circles (TREC - surrogate marker for recently produced T cells) using DNA extracted from newborn blood spots collected routinely on all newborns

Page 8: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

The T cell Receptor Excision Circle (TREC) assay differs from other molecular assays used in NBS:

Phenotype assay: TREC is a molecular marker for T cell production in thymus

Quantitative assay: require higher level of precision

results influence d by• DNA extraction efficiency• PCR efficiency

Overview of TREC Assay for SCID

Page 9: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

T cell receptor excision circles (TREC) are by-products of the

rearrangement of T cell receptor (TCR) genes during

thymocyte maturation in the thymus

TRECs are episomal DNA and do not replicate during mitosis

Peripheral blood TREC levels reflect T lymphocyte production

in the thymus

TREC Assay: Real Time PCR

Variations in TREC Assay procedures can be based on:

Primers and Probes

DNA extraction procedures

Overview of TREC Assay for SCID (cont.)

Page 10: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

Alpha chain V segments

Delta chain V/D/J segments

Alpha chain J segments

Alpha chain constant region

TCR–Delta deletion in rearrangement of T cell receptor gene

Vα1

Vα2

Vαn δRecVδ1Vδ/

Dδ/Jδ

ψЈα Jα2Jα1 Jα3 Jαn Cα

δRec-ΨJα Coding joint

Signal joint

δRec-ΨJα TREC

≈≈≈ ≈

↓Vα–Јα–Cα

rearrangement↓TCR alpha chain transcription, translation , expression

≈≈

≈ ≈≈≈

Chromosomal 14TCR α/δ chain loci

Episomal DNA (δRec-ΨJα TREC)

Chromosomal 14TCR α chain locus

Chromosomal 14TCR α/δ chain loci

Page 11: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

GTGTCCTCACCCGTGAAA GTCCACGGATACGTAGTGGCAC

5’

3’

≈δRec

ΨЈα

5’ -------AAAGGTGCCCACTCCTGTGCACGGTGATGCATAGGCACCTG-------3’

Orientation of δRec and ΨЈα sequences in genomic DNA

Orientation of δRec and ΨЈα sequences in TREC DNA

Signal Joint

Forward Primer Direction → ← Reverse Primer Direction

Page 12: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

DBS DNA

Extraction

TREC sequence

Amplification

Amplicons Quantificati

on

DBS DNA Extraction

Real time PCR

DBS In SituPCR

Amplicons Quantificatio

n

DBSIn Situ Real time PCR

Classical Conventional PECDC

Technical Approaches to TREC Assays

Page 13: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

TREC Measurement: qPCR

NBS Card

Dried blood spots (DBS)

3 mm punch

96 well plate

Extract

DNA*

Enumerate

TRECs by real-time

qPCR

0

1

2

3

4

5

0 10 20 30 40 50

Flu

ore

scen

ce (

dR

n)

Cycles

Cord Bloods TREC Amplification Plots

Page 14: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

In Situ Real Time PCR Assay for TREC

Punch one 2.0 mm discs from DBS specimen into PCR tubes

Wash with 125 µl of DNA purification solution S1(shake for 15 minutes at room temp)

Wash with 125 µl of DNA elution solution S2(shake for 5 minutes at room temp)

Page 15: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

In Situ Real Time PCR Assay for TREC (cont.)

0.00 0.50 1.00 1.50 2.00 2.50 3.0026

28

30

32

34

36

38

f(x) = − 3.14088301371599 x + 36.606966827678R² = 0.963610371552069

TREC-HeLa DBS calibrators

log10(cell#/μl blood)

CT#

Discard S2 wash bufferAdd 15 μl of qPCR mastermix (contains complete mix of primers & probe)

Run qPCR in Stratagene MX3000p:45 deg for 5 min, 95 deg for 20 min 45 cycles of [ 95 deg x 15 sec + 60 deg x 1 min ]

0

1

2

3

4

5

0 10 20 30 40 50

Flu

ore

scen

ce (

dR

n)

Cycles

Cord Bloods TREC Amplification Plots

Page 16: Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of.

Quality Assurance

Use of TREC Reference Materials

National Center for Environmental HealthNewborn Screen and Molecular Biology Branch