Magnetic Particles NIST Traceable Size Standards Flow Cytometry Dyed and Fluorescent Particles Plain Particles for Clinical Diagnostics and Specialty Applications Thermo Scientific Particle Technology Product Catalog and Technical Reference Guide
Magnetic Particles
NIST Traceable Size Standards
Flow Cytometry
Dyed and Fluorescent Particles
Plain Particles for Clinical Diagnostics and Specialty Applications
Thermo Scientifi c Particle TechnologyProduct Catalog and Technical Reference Guide
Seradyn and Duke Scientifi c have combined under
the Thermo Scientifi c brand to offer customers
one place for all the particles they need. We are
pleased to announce the ability to leverage our
individual strengths under this new brand name.
Engineers, physicists, chemists, bio-chemists and
other scientists use particles for molecular biology
applications, as reference standards for size
measurement, for nucleic acid isolation and cell
separation, as unique markers for biomolecules,
as fl ow tracing devices, as reactive surfaces to
transport diagnostic reagents and for a variety of
other applications.
As a trusted supplier to the scientifi c community
with more than 35 years of particle technology
experience, we are proud of our reputation as the
world leader in the design and manufacture of high
quality synthetic polymer particles.
Our experienced technical staff comes from many
scientifi c disciplines, which are integrated to
provide powerful solutions to problems and support
for you.
Thermo Scientifi c Product CategoriesMagnetic Particles• Sera-Mag® SpeedBeads™• Sera-Mag Magnetic Particles
NIST Traceable Size Standards• NIST Traceable Metrology Particles• Duke Standards™ • BCR Quartz Certifi ed Particles• Certifi ed Count Particles
Flow Cytometry Particles• Cyto-Cal™ Calibrators, Alignment Beads and Count Control• Cyto-Plex™ Carboxylate-modifi ed particles and Carboxylated Kits for Multiplex Assays
Fluorescent and Dyed Particles• Fluoro-Max™ Fluorescent• Color-Rich™ Dyed • ChromoSphere™ Dyed
Particles for Clinical Diagnosticsand Specialized Applications• Opti-Bind® • Opti-Link® • Turbi-BindTM
• Turbi-LinkTM
• Power-BindTM Streptavidin-coated• Undyed Sulfate Particles with Modifi ed Surfaces• Polymer Particle Suspensions• Spherical Polymer Particles• Spherical Glass Materials• Spherical Pollen and Spores• Metal and Mineral Particles• Filter and Smoke Detector Particles• Cleanroom Particles• Non-polymer particles
Thermo Scientifi c particles are manufactured in our
ISO regulated facilities, assuring a superior product.
Our particles feature high precision and excel-
lent reproduceability, high binding capacity while
keeping nonspecifi c binding low and maintaining
long-term stability.
Because we manufacture the particles, exten-
sive information about their characteristics and
functionallity is made available to you. We provide
concrete data, backed by years of clinical applica-
tions research, which will take the mystery out of
working with the particles.
You can learn more by logging on to www.thermo.
com/particletechnology. We are also available
by phone to answer technical questions, fulfi ll
product catalog requests and to give pricing
information.
For for size standards and fl ow cytometry particle
products, call 1-800-232-3342.
For magnetic and all other particle products,
call 1-866-737-2396.
Thermo Scientifi c Particle Technology We have particles for all your diagnostic, calibration and molecular biology needs.
Did you know...
that approximately 85% of the US blood supply
is tested by assays that utilize our particles.
1
Table of Contents
Particle Application Chart ......................................................................................... 2-3
Magnetic Particles .........................................................................................................4
Magnetic SpeedBeads...................................................................................................5
Magnetic particles .....................................................................................................6–9
Technical Supplement: Particle Reagent Optimization ....................................10–13
NIST Traceable Size Standards .................................................................................14
Calibration and Validation ......................................................................................15-23
Count Controls ........................................................................................................24-27
Technical Supplement: Working with Particles ......................................................28
Flow Cytometry..............................................................................................................29
Instrument Performance ..........................................................................................30-32
Multiplex Assay Products ........................................................................................33-34
Technical Supplement: Differences in beads for fl ow cytometry ........................35
Dyed and Fluorescent Particles ............................................................................36-37
Dyed Particles .........................................................................................................38-41
Fluorescent Particles...............................................................................................42-49
Technical Supplement: Particle sonication and mixing ................................... 50-52
Particles for Clinical Diagnostics and Specialty Applications .............................53
Particles for Clinical Diagnostics............................................................................54-59
Non-Polymer Particles ............................................................................................60-66
Cleanroom Particles .....................................................................................................67
Technical Supplement: Selecting particle surface properties .............................68
Striving to Meet Your Needs.......................................................................................69
Ordering Information ....................................................................................................69
MSDS...........................................................................................................................69
Technical Support ........................................................................................................69
Payment Information ....................................................................................................69
2
Applications MG SB CM
MG SB SA
MG SB NA MG-CM MG-SA MG-OL
NIST Size Std.
BCR Std.
Count Controls
Cyto-Cal
Cyto-Plex
Fluoro- SF GR, RD, BL
Fluoro-CM-Eu
FluorSA-E
Air sampling smoke detectors
Affi nity purifi cation
Analytical, Sedimentation, Seperation
Biotinylated PCR isolation
Biosensors
cDNA synthesis
Cell/DNA/mRNA isolation
Cell labeling
Cell sorting
Cell surface markers
Chemiluminescent assays
Chemical engineering studies
Clinical diagnostics
Contamination control/ fl ow tracing
Cycle sequencing cleanup
Dispersion studies
Filter checking and testing/ challenge
Filtration systems
Fluid mechanics
Fluorescent-based assays
Flow cell focusing
Flow cytometry
Gene expression analysis/ genotyping
Genomics
High sensitivity assays
Instrument precision monitoring
Laser particle counter calibration
Lateral fl ow assays
Light scattering
Membrane-based assays
Molecular diagnostics
Multiallurgical studies
Nephelometric assays
Northern analysis
Nucleic acid sample prep
Optical alignment
Particle counting measurement
Phagocytosis studies
Purify PCR product
Pore size determination
Proteomics
Rapid assays
RT-PCR
Size standards
Slide agglutination assays
Suspension array analysis
Time-resolved fl uorescent assays
Traceability of analytical methods
Turbidimetric assays
Applicat ion
AAAAAAAAAAAAAAAApAAppAApApApAppppppppppppppppppppplppppppplppllppplpll iippl ipl il iiil il il iiicciiciiciccccccccaaccaccacaaaaaaaataataatat i
aataat iat iitt it iioioioioooooonooononn
ro-Eu
Modifi ed Fluoro-
GR, RD, DR
Color-Rich Blue
Color-Rich Red
Color Rich
Black
Chromo Sphere RD,BLK
Opti-Bind SF
Opti-Link CM
Turbi-Bind SF
Turbi-Link CM
Modified Undyed
SF
Power-Bind SA
Particle Supsen-
sions
Polymer Materials
Smoke/ Hepa Check
SF: Sulfate CM: Carboxylate-modifi edSA: Streptavidin coatedOL: Oligo(dT)NA: NeutrAvidin coatedRD: RedBL: BlueBLK: BlackGR: GreenEu: Europium ChelateMG: MagneticSB: SpeedBeadSize Std.: Size StandardsFluoro: Fluoro-Max
AbbreviationKey
on Chart
ooooooonononononononnnn CCnn Cn CCCCCCCCChhCChCChChhhCChCChChhhhhhhhaahhahhahaaaaaaaaraaraarartaarartr ttrr tr tttttt
Thermo Scientifi c Sera-Mag Magnetic Particles
Sera-Mag Magnetic SpeedBeads Sera-Mag Magnetic SpeedBeads Carboxylate-Modifi ed
Sera-Mag Magnetic SpeedBeads NeutrAvidin
Sera-Mag Magnetic SpeedBeads Streptavidin
Sera-Mag Magnetic Particles Sera-Mag Magnetic Carboxylate-Modifi ed Particles
Sera-Mag Magnetic Oligo(dT) Particles
Sera-Mag Magnetic Streptavidin Particles
5
The Sera-Mag SpeedBeads are the newest
entry in the Sera-Mag line of magnetic
particles. These particles respond twice
as fast in a magnetic fi eld as our original
Sera-Mag magnetic particles, and are
available in carboxylate-modifi ed, NeutrAvidin
and Streptavidin coated versions. They are
especially useful in clinical immunoassays
where speed of magnetic response is impor-
tant, or for isolation from viscous solutions
in molecular biology applications.
All SpeedBeads have improved magnetic
response time, but retain the original
Sera-Mag properties including:
• Sensitivity
• Stability
• Physical integrity
• Colloidal stability
• Reproducibility
• High binding capacity
• Very slow settling rate in the absence of a
magnetic fi eld
• Unaffected in conditions such as sonica-
tion, drying, freezing and pH extremes
• Effective in a wide variety of clinical and
molecular applications
• Cost effective
• Long shelf-life
SpeedBeads Carboxylate-Modifi ed
• Double speed Sera-Mag base magnetic
particle
• Fast magnetic response time for clinical
diagnostic assays
• Excellent for a variety of nucleic acid
isolation applications
SpeedBeads Streptavidin
• Use in demanding applications that require
high binding capacity
• Much quicker isolation from viscous cell
lysates
• Universal streptavidin-biotin isolation
systems
SpeedBeads NeutrAvidin
• Broad utility for a variety of high binding
capacity needs
• Much quicker isolation from viscous cell
lysates
• Potential lower non-specifi c binding
characteristics
To order Thermo Scientifi c Sera-Mag Speed-
Beads, call the Indianapolis, IN offi ce at
1-866-737-2396 or at 1-317-610-3800.
Thermo Scientifi c Sera-Mag SpeedBeads
One of the newest additions to the Sera-Mag product line are SpeedBeads. These magnetic particles respond twice as fast in a magnetic field as ouroriginal Sera-Mag magnetic particles,and are great for clinical and moleculardiagnostics.
Sera-Mag SpeedBeads
6
World-Class TechnologyThe Sera-Mag family of magnetic particles
is based on the patented (5,648,124) nominal
1 μm magnetic carboxylate-modifi ed base
particles (MG-CM) which are made by a core-
shell process. Sera-Mag particles are used in
a wide variety of molecular biology, nucleic
acid isolation, research and clinical diagnostic
immunoassay applications. These super-
paramagnetic particles combine a fast
magnetic response time with a large surface
area and fast reaction kinetics.
Molecular Biology ApplicationsPlasmid DNA isolation
Genomic DNA isolation
mRNA and PNA isolation
Cell isolation
Cycle sequence reaction cleanup
Isolate biotinylated PCR product
RT-PCR
cDNA library construction
Genotyping
Subtractive hybridization
Northern analysis
Gene expression analysis
Clinical Diagnostics ApplicationsColorimetric assays
Heterogeneous assays
Chemiluminescent assays
Thermo Scientifi c Sera-Mag Magnetic Particles
Sera-Mag Unique Properties• Low, non-specifi c binding of serum proteins
and other interfering substances
• Non-leaching, encapsulated magnetite
• Surfactant-free, no washing or pre-cleaning
steps required
• High surface area per unit mass, high ligand
binding capacity and slow settling rate in
absence of a magnetic fi eld
• Tight size distribution provides for simulta-
neous magnetic separation rate, effi cient
coating of biological reagents, and excel-
lent lot-to-lot reproducibility
• GMP manufacturing in our ISO certifi ed
facilities
• Covalently bound ligands do not leach
• High yield
• Pure preparations
• Rapid isolation in viscous solutions
Compatibility/StabilityCompatible in pH 4 to 12
Compatible in guanidinium thiocyanate
Compatible in DMF and DMSO
Compatible in sonication environments
Compatible in PCR temperature cycling
60 month shelf-life stability
Patented Sera-Mag Magnetic Core-Shell Design
Magnetite
Carboxylate-modified sulfate core
Layer of magnetitesurface coating
Non-styrenepolymer surfaceencapsulation
Encapsulation
L
L
L
COOH C
OO
H
COOH
COOH
COOH
COOH
7
Sera-Mag Magnetic Streptavidin Particles
The Sera-Mag Magnetic Streptavidin (MG-SA)
particles contain covalently bound strepta-
vidin. Three levels of biotin-binding capacity
supplied as low (2500 to 3500 pmol/mg),
medium (3500 to 4500 pmol/mg) and high
(4500 to 5500 pmol/mg) binding capacities are
available (measured in picomoles of biotin-
fl uorescein bound per milligram of particle).
The multiple levels allow you to choose the
biotin-binding capacity needed to optimize
your application. MG-SA can be used as a
universal base particle for coating biotinylated
proteins, oligos or other ligands to the particle
surface. MG-SA have a shelf life stability of
60 months.
Sera-Mag Magnetic Carboxylate Particles
Sera-Mag Magnetic Carboxylate-Modifi ed
particles feature low non-specifi c binding of
serum proteins, high protein binding capacity,
tight size distribution, and are stable in deter-
gents and in a variety of lysis buffer system
pH 5 to 12. These particles also improve assay
accuracy, have a high surface area per unit
mass, good lot-to-lot reproductibility, are ver-
satile in process and in reagent preparation,
and are ready to use with no washing.
These particles are colloidally stable in the
absence of a magnetic fi eld. When a magnetic
force is applied, the particles are separated
rapidly and completely from suspensions.
Covalent coupling (of proteins, nucleic acids,
etc.) to carboxyl groups on the surface is
easily accomplished using our standard
coupling technology. To learn more about this
procedure, read our Recommended Adsorption
and covalent Coupling Procedures protocol
that is located on pages 10-13.
Sera-Mag Magnetic Oligo(dT) Particles
The 1 μm Sera-Mag Magnetic Oligo(dT)
(MG-OL) particles contain covalently bound
oligo(dT)14
and have excellent shelf life stabil-
ity at 48 months. The MG-OL particles are
colloidally stable in the absence of a magnetic
fi eld and will remain in suspension for extend-
ed periods of time during use. MG-OL are used
to capture or isolate mRNA from a variety of
sources. Once isolated, further applications
like RT-PCR, cDNA library construction or
subtractive hybridization can be performed.
The approximate mRNA binding-capacity is
11μg of mRNA per mg of particles (dependent
upon sample and message length).
The MG-OL particles can also be used as
a universal base particle for coupling your
unique oligo sequences. Simply synthesize
your oligo with a poly-A tail for easy attach-
ment to the oligo(dT) particles.
For technical notes, visit us at
www.thermo.com/particletechnology,
and navigate to particle technology and click
on magnetic particles.
To order Thermo Scientifi c Sera-Mag Mag-
netic particles, call the Indianapolis, IN offi ce
at 1-866-737-2396 or at 1-317-610-3800.
Sera-Mag SpeedBeads
Carboxylate-modifi edBottleSize Application
BindingCapacity Type/ Parking Area Cat. Number
Packaged in 15mL, 100 mL, 15 mL Hydrophilic High SpeedBeads, 7 EDAC/PA5 4515-2105-050250
and 1000 mL 100 mL Hydrophilic High SpeedBeads, 7 EDAC/PA5 4515-2105-050350
5% solids, 50 mg/mL 1000 mL Hydrophilic High SpeedBeads, 7 EDAC/PA5 4515-2105-050450
Magnetic articles are ~1 μm 15 mL Hydrophilic High SpeedBeads, 3 EDAC/PA5 6515-2105-050250
100 mL Hydrophilic High SpeedBeads, 3 EDAC/PA5 6515-2105-050350
1000 mL Hydrophilic High SpeedBeads, 3 EDAC/PA5 6515-2105-050450
Sera-Mag SpeedBeads
NeutrAvidin-coatedBottleSize Application
BindingCapacity Type Cat. Number
Packaged in 1 mL, 5 mL, 100 mL 1 mL Clinical/Molecular High SpeedBeads, NA coated 7815-2104-011150
1% solids, 10 mg/mL 5 mL Clinical/Molecular High SpeedBeads, NA coated 7815-2104-010150
Magnetic particles are ~1 μm 100 mL Clinical/Molecular High SpeedBeads, NA coated 7815-2104-010350
Sera-Mag SpeedBeads
Streptavidin-coatedBottleSize Application
BindingCapacity Type Cat. Number
Packaged in 1 mL, 5 mL, 1 mL Clinical/Molecular Medium SpeedBeads, Strep 6615-2104-011150
and 100 mL 5 mL Clinical/Molecular Medium SpeedBeads, Strep 6615-2104-010150
1% solids 100 mL Clinical/Molecular Medium SpeedBeads, Strep 6615-2104-010350
Sera-Mag Magnetic
Carboxylate-modifi edBottleSize Application
BindingCapacity Type/ Parking Area Cat. Number
Packaged in 15mL, 100 mL, 15 mL Clinical/Molecular High Sera-Mag, 7 EDAC/PA5 2415-2105-050250
and 1000 mL 100 mL Clinical/Molecular High Sera-Mag, 7 EDAC/PA5 2415-2105-050350
5% solids, 50 mg/mL 1000 mL Clinical/Molecular High Sera-Mag, 7 EDAC/PA5 2415-2105-050450
Magnetic particles are ~1 μm 15 mL Clinical/Molecular High Sera-Mag, 3 EDAC/PA5 4415-2105-050250
100 mL Clinical/Molecular High Sera-Mag, 3 EDAC/PA5 4415-2105-050350
1000 mL Clinical/Molecular High Sera-Mag, 3 EDAC/PA5 4415-2105-050450
Sera-Mag Magnetic
Oligo(dT)14
BottleSize Application
BindingCapacity Type Cat. Number
Packaged in 1 mL, 5 mL, 100 mL 1 mL Molecular Medium Sera-Mag, Oligo 2815-2103-011150
1% solids 5 mL Molecular Medium Sera-Mag, Oligo 2815-2103-010150
Magnetic particles are ~1 μm 100 mL Molecular Medium Sera-Mag, Oligo 2815-2103-010350
Sera-Mag Magnetic
Streptavidin-coatedBottleSize Application
BindingCapacity Type Cat. Number
Packaged in 1 mL, 5 mL, 1 mL Clinical/Molecular Low Sera-Mag, Strep 3015-2103-011150
and 100 mL 5 mL Clinical/Molecular Low Sera-Mag, Strep 3015-2103-010150
1% solids 100 mL Clinical/Molecular Low Sera-Mag, Strep 3015-2103-010350
Magnetic particles are ~1 μm 1 mL Clinical/Molecular Medium Sera-Mag, Strep 3015-2104-011150
5 mL Clinical/Molecular Medium Sera-Mag, Strep 3015-2104-010150
Level 3 = Low Binding 100 mL Clinical/Molecular Medium Sera-Mag, Strep 3015-2104-010350
Level 4 = Medium Binding 1 mL Clinical/Molecular High Sera-Mag, Strep 3015-2105-011150
Level 5 = High Binding 5 mL Clinical/Molecular High Sera-Mag, Strep 3015-2105-010150
100 mL Clinical/Molecular High Sera-Mag, Strep 3015-2105-010350
8
Cat. Number
Package Size Application Sample Pack Includes:
Sera-Mag SpeedBead
Carboxylate-modifi edS4565 2 x 15 mL
Clinical/
Molecular
4515-210-5050250
6515-2105-050250
Sera-Mag SpeedBead
NeutrAvidin-coatedS6678 2 x 1mL
Clinical/
Molecular
6615-2104-011150
7815-2104-011150
Sera-Mag Magnetic
Carboxylate-modifi edS2444 2 x 15 mL
Clinical/
Molecular
2415-2105-050250
4415-2105-050250
Sera-Mag Magnetic
Streptavidin-coatedS30345 3 x 1 mL
Clinical/
Molecular
3015-2103-011150 (low binding)
3015-2104-011150 (medium binding)
3015-2105-011150 (high binding)
Thermo Scientifi c Sera-Mag Magnetic Particle Sample Packs
The above illustration shows the three stages of making a Sera-Mag magnetic particle. The largest portion of the particle, the core, consistof a carboxylate-modifi ed particle. Above the core is the magnetite, and the last layer is the encapsulation, which seals it all together.
The following sample packs are available for the Sera-Mag magnetic particle product lines.
Differences in EDAC Levels for Sera-Mag Carboxylate-modifi ed Particles
Customers often ask us what the difference is
between the Sera-Mag Carboxylate-modifi ed
particles that have an EDAC level of seven
versus those with an EDAC level of three. The
differences in these products during produc-
tion are minimal.
The amount of cross linking may differ, yet the
charateristics i.e. PA, diameter, are the same.
Some performance feedback has indicated
that the 6515 and 4415 beads, which have
lower EDAC than the 4515 and 2415 particles,
work better with nucleic acid isolation. Also,
the 6515 and 4415 beads are more hydropho-
bic-like, where as the 4515 and 2415 particles
are hydrophyllic.
In order to decide which is ideal for your
application, we suggest purchasing both as
samples and perform an experiment to verify
if there is a difference for your application.
9
Inside a Sera-Mag Magnetic Particle
p
We give you simple particle protocols forcoupling proteins to particles (particles).We take the mystery out of working with particles by giving you concrete data,backed by years of applications researchin our own labs. These recommendedcoupling procedures are designed for:
• Optimal adsorption of proteins to particles
• Optimal covalent coupling of proteinsto particles
• Choice of two protocols for covalent coupling
• Siparticlelicity, effi ciency, and confi -dence
We offer a coparticlerehensive laboratoryreference manual entitled, Microparticle Reagent Optimization, on particle sensiti-zation and optimization.
Principle of Protein Binding
Proteins bind to sulfate (S) or carboxylate-modifi ed (Carboxylate-modifi ed) particles (magnetic and nonmagnetic) by adsorp-tion. Adsorption is mediated by hydropho-bic and ionic interactions between the protein and the surface of the particles.Adsorption of proteins to particles occursrapidly due to the microparticle surfacefree energy. Proteins may also be cova-lently attached to the surface of Carboxyl-ate-modifi ed particles. Carboxyl groups on the particles, activated by the water-soluble carbodiimide 1-ethyl-3-(3-dimeth-ylaminopropyl) carbodiimide (EDAC), reactwith free amino groups of the adsorbedprotein to form amide bonds. For mag-netic particles, we recommend followinga covalent coupling procedure. Perform-ing covalent coupling with the directEDAC procedure is universally useful.If exposure of a protein to EDAC is discov-ered to be harmful to the protein, then a pre-activation (active ester) step prior to introducing the protein is an alternativefor successful covalent coupling.
Here we give the protocols for both adsorption and covalent coupling whichhave proven useful for many of our cus-tomers. These protocols are written for 1.0 mL “optimization series” reactions. For larger reactions, all volumes may bescaled up proportionally.
Technical Supplement
Microparticle Reagent Optimization:Recommended Adsorption andCovalent Coupling Procedures
Materials and Methods
1. Particles
• Sulfate particles (Polystyrenepar-ticles): Thermo Scientifi c Polystyrene particles for immunoassays are avail-able in standard sizes ranging from0.05 μm to 2.0 μm. Larger particles are also available. These Polystyrenepar-ticles are manufactured by emulsion polymerization using an anionicsurfactant and have surface sulfate groups which arise from the polym-erization initiator. Thermo Scientifi cPolystyreneparticles are formulatedto have low free surfactant and,generally, the surfactant used does not interfere with protein binding. Forthis reason, it is recommended that Thermo Scientifi c Polystyreneparticles be used without any preliminaryclean-up.
• Carboxylate Modifi ed particles(Carboxylate-modifi ed particles),Nonmagnetic and Magnetic: ThermoScientifi c Carboxylate-modifi ed particles (nonmagnetic) are availablein sizes ranging from 0.05 μm to 1.5μm. These Carboxylate-modifi edparticles are manufactured by theco-polymerization of styrene andacrylic acid using emulsion polymer-ization methods. Carboxylate-modi-fi ed particles are available in a widerange of carboxyl densities. Titrationvalues in milliequivalents of carboxyl per gram of particles (mmoles/g, orμmoles/mg) are provided with eachlot. In addition, the calculated parkingarea (area per carboxyl group) is pro-vided with each lot. Thermo Scientifi cCarboxylate-modifi ed particles are formulated to have low free detergent.The detergent used does not gener-ally interfere with protein binding.Carboxylate-modifi ed particles maybe rigorously cleaned by ion exchangewith mixed bed resin or by tangentialfl ow fi ltration (TFF). Such cleaningremoves various ionic byproducts,including detergent, soluble polymers,and buffer salts, which may affect coupling chemistry. The need for preliminary clean-up of Carboxylate-modifi ed particles must be establishedon a case-by-case basis.
Sera-Mag particles are available ina nominal 1 μm size. Our magnetic particles are encapsulated with acarboxylated polymer surface. The amount of acid on the surface of Sera-Mag particles is typically higher than our nonmagnetic particles
Note: Parking area (PA) is a parameterthat allows coparticlearison of Carbox-ylate-modifi ed particles of differentdiameters and titration values (mEq/g). It is an area-normalized density ofcarboxyl groups, given in
Å2/COOH. If
two particles have the same PA, a par-ticular protein molecule will “park on”the same number of carboxyl groupson the surface of either particle, andhave an equivalent opportunity for covalent coupling (assuming all thecarboxyls are activated.)
2. BCA (Bicinchoninic Acid ) Protein Assay for particles: See our Techni-cal Supplement,, BCA Assay for particles, for materials & methods, which is located on our Web site atwww.thermo.com/particletechnology.
3. Reaction Buffer: MES Buffer 2-(N-morpholino)ethanesulfonic acid: Prepare10X stock buffer at 500 mM, pH 6.1. The pH will not change signifi cantlyon dilution. Store at 4°C and discardif yellowed or contaminated.
4. EDAC 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride 52μmol/mL: Just before use, weigh approximately 10 mg of EDAC on an analytical balance: for each 10.0 mgweighed add 1.0 mL deionized water.
Note: EDAC is very sensitive to mois-ture and undergoes rapid hydrolysisin aqueous solutions. EDAC shouldbe stored in a desiccator at -5°C andbrought to room teparticleerature before weighing.
5. NHS, N-hydroxysuccinimide (ActiveEster-Two-step Coupling Procedureonly): 50 mg/mL in water (verysoluble)
6. Protein StocksTypically, a protein stock in the range of 1-10 mg/mL isrecommended. Note: The protein tobe coated onto particles should becoparticleletely dissolved and not too concentrated.
10
Microparticle Reagent OptimizationTechnical Supplement
7. DI water
Appropriate labware including:
• Pipettes and Tips (10 μL – 5 mL)
• Mixing Wheel or Other Device
• Appropriate Magnetic separation device for Sera-Mag particles
• Microcentrifuge tubes
• Microcentrifuge
• Tangential fl ow fi ltration: Smaller particles may require tangential fl ow fi ltration or ultra-centrif gation forwashing.
Note: Tangential fl ow membrane devices are available from severalsuppliers such as Spectrum Labs in sizes suitable for processingparticles in milliliter to liter quanti-ties. particles as small as 0.05 μm may be reliably processed with TFFmembranes.
• Probe-type Ultrasonicator: Probe-type ultrasonicator with microtipshould be used for resuspendingpellets during washing. Sonica-tion is also helpful for redispersingcluparticleed particles in a stabiliz-ing buffer. An immersible ultrasonicprobe is the ideal tool for effi cientresuspension of Particle pellets.For 1.0 mL reactions a few seconds of sonication is suffi cient. Alter-natively, pellets may be stirred or resuspended by repeated aspiration with a fi ne pipette tip. Note: Vortex mixing and bath-type sonicators are not effective for resuspending most pellets.
Adsorption
Before You Begin:
• The optimal amount of protein to use depends on several factors:
(1) Surface area available: surfacearea per mg of Particle increases linearly with decreasing Particle diameter.
(2) Colloidal stability: proteins canhave stabilizing or destabilizing effects on particles.
(3) Immunoreactivity: the optimal
amount of bound sensitizing pro-tein must ultimately be determinedby functional assay.
• When the protein is added to theparticles, rapid mixing is critical foreven coating. When working at a 1mL scale, pipette the protein stockdirectly into the buffered particles,and using the same pipette tip, “sy-ringe” the solution (mix up and down quickly.) When working at a larger scale, have the particles in a beakerwith a stir bar, mixing well, and add the protein stock quickly into the middle of the vortex.
• Performing a protein titration or binding isotherm is a good fi rst experiment.
• For a 0.3 μm diameter Particle (nonmagnetic), a reasonable startingrange would be 10-200 μg protein/mg Particle.
• Adsorbed proteins may elute from theParticle surface if the wash/storage buffers are different from the adsorp-tion buffer.
• Many detergents will elute adsorbed proteins and should not be used with the adsorption protocol.
Procedure:
1. Calculate the amount of each copar-ticleonent needed.
Note: The Coupling Procedure MSExcel Calculation Sheet may be utilized by placing “0” in the fi elds for EDAC:COOH.
2. Prepare and check all stock coparticleo-nents required.
3. Once the amount of each coparticleo-nent is prepared, set up the bindingreaction by pipetting the following into microcentrifuge tubes in the order given:
a. 50 μL 500 mM stock MES buffer: 25mM fi nal
b. DI Water to make 1.0 mL fi nalvolume
c. 100 μL of 10.0% solids stock particles: 1.0% solids fi nal
d. Protein stock solution: (the protein should be added last and mixed very rapidly into the reaction mix-ture by syringing repeatedly withthe pipettor)
Note: Improper mixing can yield unevenlycoated particles.
4. Mix tubes at room teparticleerature on a mixing wheel or other device forone hour.
Note: Gentle, constant mixing is ipar-ticleortant for microparticle reactions.
5. Remove unbound protein: pellet particles by centrifugation and decant the supernatant.
6. Perform two washes with your buffer(this may be the MES buffer). Pellet particles by centrifugation and decant the supernatant. Resuspend pelletsbetween washes using ultrasonica-tion.
7. Resuspend fi nal pellet to desired % solids with the same buffer. Forexaparticlele: If the target % solidsis 1.0%, then one would add 0.97 mLof the same buffer, given that some liquid remains after pellet formation.
8. Perform the Thermo Scientifi c BCA As-say for particles as an analytical tool to assess the amount of protein bound on the particles.
Covalent Coupling
Before You Begin:
• To determine the optimal amount of EDAC Concentration (EDAC:COOH) inone step covalent coupling, an EDACtitration (holding the protein constant)is performed.
Note: The Coupling Procedure MSExcel Calculation Sheet may be utilized by placing ranges of concen-trations in the “EDAC:COOH” fi eldsand a constant value for the “Proteinadded” fi elds. It is recommended thatapproximately a 0.5 to 2.5 fold molarexcess over microparticle carboxyl concentration be used. For Sera-Mag particles, the following ratios ofEDAC:COOH – 0, 0.5, 1, 2.5, 5 and 10
11
12
are suggested for optimization.
• For Active Ester (two step coupling)the concentration of EDAC:COOH maybe varied, however the recommendedmolar ratio is 2.5 to 1 and for NHS:COOH the molar ratio is 20 to 1.
• Once an optimal EDAC concentrationis determined, the optimal amount ofprotein to be added for meeting theapplication performance criteria isto be determined. To determine the optimal protein amount to be added,perform a protein titration holdingthe determined EDAC concentration fi xed.
Note: The Coupling Procedure MS Ex-cel Calculation Sheet may be utilizedby placing ranges of concentrations in the “Protein added” fi eld and thedetermined optimal EDAC:COOHconcentration in the “EDAC:COOH”fi elds.
• The optimal amount of protein to use depends on several factors:
(1) Surface area available: surfacearea per mg of Particle increases linearly with decreasing Particle diameter.
(2) Colloidal stability: proteins canhave stabilizing or destabilizing ef-fects on particles.
(3) Immunoreactivity: the optimalamount of bound sensitizing protein must ultimately be determined by functional assay.
Performing a protein titration or bind-ing isotherm is a good fi rst experi-ment. For a 0.3 μm diameter Particle (nonmagnetic), a reasonable startingrange would be 10-200 μg protein/mg Particle. For Sera-Mag particles, wewould suggest starting with protein concentrations of 0, 25, 50, 75, 100 and 150 or 200 (μg/mg of particle.)
• When the protein is added to theparticles, rapid mixing is critical foreven coating. When working at a 1mL scale, pipette the protein stockdirectly into the buffered particles,
and using the same pipette tip,“syringe” the solution (mix up anddown quickly.) When working at a larger scale, have the particles in a beaker with a stir bar, mixing well,and add the protein stock quickly into the middle of the vortex.
• For optimization scale, it is con-venient to run coupling reactionsin microcentrifuge tubes. Withconventional microcentrifuges suchas Eppendorf, coated particles of 0.150 μm or greater diameter arepelleted in 10-30 minutes. For smallerparticles (<0.150 μm diameter), lon-ger centrifugation times are neededand the pellets are more diffi cult toresuspend.
• Smaller particles may require tangen-tial fl ow fi ltration or ultracentrifuga-tion for washing.
• Colloidal stability problems increase with decreasing Particle diameter.Lowering the percent solids in the coupling step to 0.5% instead of 1% will help prevent cluparticleing during coupling.
• The particles may cluparticle duringcoupling due to the electrostatic effect of the positively charged EDACmolecules, the effect of the proteinitself, or consuparticletion of nega-tive charge by amide bond formation.Washing into fresh buffer to remove EDAC and unbound protein, followed by sonication, generally reverses thecluparticleing. Long term colloidal stability of coated particles requires development of the right storage buffer.
• The selection of storage buffer andpH is critical in achieving optimum microparticle performance. Zwitter-ionic buffers, such as MOPSO, block-ing proteins, such as bovine serumalbumin (BSA), and fi sh skin gelatin (FSG), higher pH, detergents and sodium salicylate have all proven to be useful for stabilizing microparticlepreparations while permitting specifi c agglutination reactions to occur.
• Blocking proteins with high negative charge, such as BSA and FSG, may be used to add colloidal stability, as well as block the surface against non-specifi c saparticlele adsorption. FSGworks especially well with antibody-coated particles.
One Step Coupling Procedure:
1. Calculate the amount of EDACrequired.
Note: The Coupling Procedure MSExcel Calculation Sheet may be utilizedto perform the calculations.
Given Equations:
(Particle acid content) meq/g is equiva-lent to μmole/mg
Note: 1 mL of 1% Particle contains 10mg Particle
(Acid content, μmol/mg) (10 mgparticles) (desired ratio) = μmol EDAC required (μmol EDAC required)/(52 μmol/mL) = mL EDAC stock per mL ofreaction
2. Set up binding reaction by pipettinginto microcentrifuge tubes in the order given:
a. 500 mM stock MES buffer: 25 mM fi nal
b. Water to make 1.0 mL fi nal volume
c. 10.0% solids stock particles: 1.0%solids fi nal
d. Protein stock solution (add last)
3. Mix the tubes for approximately 15minutes on a mixing wheel at roomteparticleerature.
Note: Gentle, constant mixing is iparti-cleortant for microparticle reactions.
4. Prepare the EDAC solution immedi-ately before use and mix the calculated volume rapidly into the reaction by syringing repeatedly with the pipettor.
5. Mix tubes at room teparticleerature ona mixing wheel or other device for one
Microparticle Reagent OptimizationTechnical Supplement
13
hour. particles may cluparticle duringthis time, but this is not unusual orharmful.
6. Remove unbound protein: pellet par-ticles by centrifugation for Carboxyl-ate-modifi ed Particle, or magnet for Sera-Mag Particle, and decant the supernatant.
7. Perform two washes with your buffer.(This may be the MES buffer or a higher pH buffer of your choice.) Pelletparticles by use of a centrifuge for Carboxylate-modifi ed Particle, or mag-net for Sera-Mag Particle, and decantthe supernatant. Resuspend pellets between washes by ultrasonication.
8. Resuspend fi nal pellet to desired %solids with buffer that does not contain blocking proteins. (This may be the MES buffer or a higher pH buffer of your choice. For example: If the target % solids is 1.0%, then one wouldadd 0.97 mL of the same buffer, given that some liquid remains after pellet formation.
9. Perform the Thermo Scientifi c BCA Assay for particles as an analytical tool to assess the amount of protein boundon the particles.
10. For long term colloidal stability, a sta-bilizing storage buffer will be needed.After performing the protein analysis,coated particles can be pelleted andresuspended in a variety of storage buffers, and the colloidal stability and reactivity optimized.
Note: Covalently bound protein will not elute when subjected todetergent washes or buffer changes;thus, covalently coupled reagents arecompatible with a wider variety ofbuffer additives than reagents wherethe proteins are only adsorbed to the particles.
Active Ester Two Step Coupling Procedure:
Step One: Preactivation
1. Pipette into microcentrifuge tubes in the order given:
a. 100 μL of 500 mM MES buffer:50mM fi nal
b. Water to make 1.0 mL fi nal volume
c. 100 μL of 10.0% solids stock par-ticles: 1.0% solids fi nal
d. 230 μL NHS solution: 100 mM fi nal
e. EDAC solution, calculated amount
2. Mix tubes at room temperature on amixing wheel or other device for 30minutes.
Note: Gentle, constant mixing is impor-tant for microparticle reactions.
3. Pellet particles by centrifugation for Carboxylate-modifi ed particles, or magnet for Sera-Mag particles anddecant the supernatant.
4. Resuspend particles with 1 mL 50 mMMES buffer, pH 6.1. Pellet particles by centrifugation for Carboxylate-modi-fi ed particles, or magnet for Sera-Magparticles, and decant the supernatant.
5. Resuspend the pellet by adding the following and sonicating:
a. 100 μL 500 mM MES buffer: 50mM fi nal
b. Water to make 1.0 mL fi nal volume
Step Two: Protein Coupling
6. Add the protein stock solution.
7. Mix tubes at room temperature on amixing wheel or other device for 1hour.
Note: Gentle, constant mixing is impor-tant for microparticle reactions.
8. Remove unbound protein: pellet par-ticles by centrifugation for Carboxyl-ate-modifi ed particles or magnet forSera-Mag particles and decant the supernatant.
9. Perform two washes with your 50mMbuffer. (This may be the MES buffer or a higher pH buffer of your choice.)Pellet microparticle by centrifugation for Carboxylate-modifi ed particles or magnet for Sera-Mag particles anddecant the supernatant. Resuspend pellets between washes by ultrasoni-cation.
10. Resuspend fi nal pellet to desired% solids with buffer that does notcontain blocking proteins. (This may be the MES buffer or a higher pHbuffer of your choice.) For example: If the target % solids is 1.0%, then onewould add 0.97 mL of the same buffer,given that some liquid remains after pellet formation.
11. Perform the Thermo Scientifi c BCA Assay for particles as an analyticaltool to assess the amount of protein bound on the particles.
12. For long-term colloidal stability, a sta-bilizing storage buffer will be needed.After performing the protein analysis,coated particles can be centrifuged and resuspended in a variety of stor-age buffers, and the colloidal stabilityand reactivity optimized. Note:Covalently bound protein will notelute when subjected to detergent washes or buffer changes; thus,covalently coupled reagents are compatible with a wider variety ofbuffer additives than reagents where the proteins are merely adsorbed tothe particles.
View our technical notes at www.thermo.com/particletechnology.
Microparticle Reagent OptimizationTechnical Supplement
Thermo Scientifi c NIST Traceable Size Standards
Calibration and Validation Duke Standards™ - 2000 Series Uniform Polymers
Nanosphere™ Size Standards - 3000 Series
Duke Standards - 4000 Series Monosized Polymer Particles
Duke Standards - 8000 Series Silica Particles
Duke Standards - 9000 Series Glass Particles
Chromosphere - T™ Certifi ed Size Standards
DRI-CAL™ Particle Size Standards
SURF-CAL™ Particle Size Standards
BCR Quartz Reference Particles
Count Controls Duke Standards - 3K-4K Series Particle Counter
COUNT-CAL™ Count Precision Standards
PHARM-TROL™ Count Precision Standards
Validex™ - Count Precision Standards
EZY-CAL™ Count Precision Standards
The Standard of Particle Technology Providing the world with size standards for over 30 years
Thermo Scientifi c NIST traceable particles are
designed and synthesized to be used in the devel-
opment, standardization and validation of most
particle counting and sizing instruments. When
these instruments are called on to solve real-world
analytical problems, customers depend on Thermo
Scientifi c particles for reference standards to
validate their results.
By using Thermo Scientifi c NIST Traceable
particles, you will now have third party
traceability to national and international
agencies through an unbroken chain of
measurements with specifi ed uncertainties.
For Size Standards products, call our Fremont, CA
offi ce at 1-800-232-3342 or at 1-510-979-5000.
Did you know...
that pharmaceutical companies depend on NIST traceable particles for particle con-
tamination monitoring.
Validate your product performance, enhance your product development
15
These polymer spheres meet the need for NIST
traceable size standards that have slightly wider
distributions than our monodisperse 3000/4000 se-
ries size standards. These products are suitable for
laser diffraction and other methods for analyzing
wide size range materials. The wider distribution
provides light scatter across a range of detectors
resulting in a more repeatable measurement.
The material is composed of sulfate cross-linked
with divinylbenzene. This gives the particle good
durability and chemical stability.
CatalogNumber
NominalDiameter
Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
Aqueous Suspensions, Calibrated by Optical Microscopy
2005A 5 μm 5.0 μm ± 0.3 μm 0.6 μm (12%)
2006A 6 μm 6.1 μm ± 0.3 μm 0.6 μm (9.8%)
2007A 7 μm 7.0 μm ± 0.2 μm 0.4 μm (5.7%)
2008A 8 μm 7.7 μm ± 0.3 μm 0.6 μm (7.8%)
2009A 9 μm 9.0 μm ± 0.3 μm 0.9 μm (10%)
2010A 10 μm 9.7 μm ± 0.3 μm 0.9 μm (9.3%)
2011A 11 μm 10.9 μm ± 0.3 μm 1.0 μm (9.2%)
2014A 14 μm 14.3 μm ± 0.4 μm 1.4 μm (9.8%)
2015A 15 μm 14.6 μm ± 0.4 μm 1.1 μm (7.5%)
2020A 20 μm 20.9 μm ± 0.6 μm 1.4 μm (6.7%)
2025A 25 μm 26.4 μm ± 0.8 μm 1.9 μm (7.2%)
2030A 30 μm 30.2 μm ± 0.6 μm 2.2 μm (7.3%)
2040A 40 μm 39.6 μm ± 0.8 μm 3.6 μm (9.1%)
Your trusted partner in particle science
Product SpecificationsParticle Composition: Polystyrene divinylbenzene (PSDVB)
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
Package In: 15 mL, 1% solids
This graph shows a comparison between our 4205A and 2005A products. Both products have anominal diameter of 5 micrometer, but the 2005A product shows more of a distribution of particles while our 4205A product has a very narrow distribution. The 2000 series standard often gives morerepeatable results on some types of laser diffreaction instruments.
Thermo Scientifi c Duke Standards 2000 Series Uniform Polymers
16
A New Standard
Thermo Scientifi c Certifi ed Particle Size Standards are traceable to the Standard Meter through the National Institute of Standards and Technology (NIST). This feature enables laboratories to demonstrate the traceability of their analytical methods as required by ISO, ANSI/NCSL Z540, GMP/GLP and other standards and regulations. The products are also used to develop and test new analytical instruments for particle size characterization of materials.
Each package of standards contains a Certifi cate of Calibration and Traceability to NIST which includes a description of the calibration method and its uncertainty. Also included is a table of chemical and physical properties and a Material Safety Data Sheet (MSDS) with handling and disposal instructions.
17
Nanosphere Size Standards are highly uniform
sulfate particles calibrated in billionths of a meter
(nanometers) with NIST traceable methodology.
One nanometer is 0.001 micrometer (μm) or 10
Angstroms.
Nanosphere Size Standards are ideal for the cali-
bration of electron and atomic force microscopes.
They are also used in light scattering studies and
colloidal systems research. The 20 to 900 nm
range of diameters is convenient for checking the
sizes of bacterial, viral, ribosomal and sub-cellular
components.
Nanospheres are packaged as aqueous suspen-
sions in 15 milliliter (mL) dropper-tipped bottles.
The concentrations are optimized for ease of
dispersion and colloidal stability. The spheres have
a density of 1.05 g/cm3 and an index of refraction of
1.59 @ 589 nm (25 °C)
CatalogNumber
NominalDiameter
Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
Aqueous Suspensions, Calibrated by Photon Correlation Spectroscopy (PCS)
3020A 20 nm 21 nm ± 1.5 nm Not determined
3030A 30 nm 33 nm ± 1.4 nm Not determined
3040A 40 nm 40 nm ± 1.8 nm Not determined
Aqueous Suspensions, Calibrated by Transmission Electron Microscopy (TEM)
3050A 50 nm 46 nm ± 2.0 nm 7.2 nm (15.7%)
3060A 60 nm 59 nm ± 2.5 nm 9.9 nm (16.8%)
3070A 70 nm 73 nm ± 2.6 nm 5.7 nm (7.8%)
3080A 80 nm 81 nm ± 2.7 nm 5.8 nm (7.2%)
3090A 90 nm 92 nm ± 3.7 nm 7.0 nm (7.6%)
3100A 100 nm 97 nm ± 3 nm 4.5 nm (4.6%)
3125A 125 nm 125 nm ± 4 nm 5.4 nm (4.3%)
3150A 150 nm 151 nm ± 4 nm 5.1 nm (3.4%)
3200A 200 nm 200 nm ± 6 nm 3.4 nm (1.7%)
3220A 220 nm 220 nm ± 6 nm 4.6 nm (2.1%)
3240A 240 nm 240 nm ± 6 nm 3.7 nm (1.5%)
3269A 270 nm 269 nm ± 6 nm 4.2 nm (1.6%)
3300A 300 nm 300 nm ± 6 nm 5.1 nm (1.7%)
3350A 350 nm 350 nm ± 7 nm 4.7 nm (1.3%)
3400A 400 nm 400 nm ± 5 nm 7.3 nm (1.8%)
3450A 450 nm 453 nm ± 4 nm 6.3 nm (1.4%)
3495A 500 nm 491 nm ± 4 nm 6.3 nm (1.3%)
3500A 500 nm 498 nm ± 5 nm 7.9 nm (1.6%)
3560A 560 nm 565 nm ± 6 nm 8.6 nm (1.5%)
3600A 600 nm 596 nm ± 6 nm 7.7 nm (1.3%)
3700A 700 nm 707 nm ± 6 nm 8.5 nm (1.2%)
3800A 800 nm 799 nm ± 9 nm 8.3 nm (1.0%)
3900A 900 nm 903 nm ± 9 nm 9.3 nm (1.0%)
Thermo Scientific Nanosphere Size Standards 3000 Series
Product SpecificationsParticle Composition: Polystyrene
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
Packaged in: 15 mL, 1% solids
Due to minor variations between batches, size ranges may change slightly frombatch to batch. Please see our Web site for additional product and ordering infor-mation or to contact customer service.
CatalogNumber
NominalDiameter
Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
SolidsContent
Aqueous Suspensions, Calibrated by Optical Microscopy
4009A 1.0 μm 0.994 μm ± 0.021 μm 0.010 μm (1.0%) 1.0%
4010A 1.0 μm 1.020 μm ± 0.022 μm 0.011 μm (1.1%) 1.0%
4011A 1.1 μm 1.101 μm ± 0.023 μm 0.012 μm (1.1%) 1.0%
4013A 1.3 μm 1.361 μm ± 0.024 μm 0.021 μm (1.5%) 1.0%
4016A 1.6 μm 1.587 μm ± 0.025 μm 0.021 μm (1.3%) 1.0%
4018A 1.8 μm 1.745 μm ± 0.025 μm 0.019 μm (1.1%) 1.0%
4202A 2.0 μm 1.998 μm ± 0.022 μm 0.020 μm (1.0%) 0.4%
4025A 2.5 μm 2.504 μm ± 0.025 μm 0.025 μm (1.0%) 0.5%
4203A 3.0 μm 3.005 μm ± 0.027 μm 0.03 μm (1.1%) 0.5%
4204A 4.0 μm 4.000 μm ± 0.033 μm 0.04 μm (1.0%) 0.4%
4205A 5.0 μm 5.003 μm ± 0.040 μm 0.05 μm (1.0%) 0.3%
4206A 6.0 μm 5.990 μm ± 0.045 μm 0.07 μm (1.2%) 0.3%
4207A 7.0 μm 7.028 μm ± 0.055 μm 0.07 μm (1.0%) 0.3%
4208A 8.0 μm 7.979 μm ± 0.055 μm 0.09 μm (1.1%) 0.3%
4209A 9.0 μm 8.956 μm ± 0.056 μm 0.09 μm (1.0%) 0.3%
4210A 10 μm 10.00 μm ± 0.05 μm 0.09 μm (0.9%) 0.2%
4212A 12 μm 12.01 μm ± 0.07 μm 0.12 μm (1.0%) 0.2%
4215A 15 μm 15.02 μm ± 0.08 μm 0.15 μm (1.0%) 0.3%
4220A 20 μm 20.00 μm ± 0.10 μm 0.20 μm (1.0%) 0.3%
4225A 25 μm 25.09 μm ± 0.12 μm 0.38 μm (1.5%) 0.5%
4230A 30 μm 30.10 μm ± 0.22 μm 0.45 μm (1.5%) 0.6%
4240A 40 μm 39.82 μm ± 0.32 μm 0.44 μm (1.1%) 0.7%
4250A 50 μm 50.2 μm ± 0.7 μm 0.5 μm (1.0%) 1.4%
4260A 60 μm 59.1 μm ± 0.9 μm 0.9 μm (1.5%) 1.2%
4270A 70 μm 72.3 μm ± 0.9 μm 0.9 μm (1.2%) 2.0%
4280A 80 μm 79.4 μm ± 1.0 μm 0.9 μm (1.1%) 1.8%
4310A 100 μm 100 μm ± 1.5 μm 1.5 μm (1.5%) 2.1%
4311A 115 μm 113 μm ± 1.6 μm 1.6 μm (1.4%) 2.6%
4314A 140 μm 138 μm ± 2.0 μm 2.5 μm (1.8%) 4.0%
4316A 160 μm 158 μm ± 2.2 μm 3.5 μm (2.2%) 4.8%
Uniform Dry Spheres, Calibrated by Optical Microscopy - PSDVB
4320A 200 μm 201 μm ± 4.0 μm 7.8 μm (3.9%) 2.2 x 105 #/g
4324A 240 μm 235 μm ± 4.8 μm 7.3 μm (3.1%) 1.4 x 105 #/g
4328A 280 μm 279 μm ± 5.6 μm 13.5 μm (4.8%) 8.3 x 104 #/g
4330A 300 μm 300 μm ± 6.0 μm 11.9 μm (4.0%) 6.7 x 104 #/g
4340A 400 μm 398 μm ± 8.0 μm 13.5 μm (3.4%) 2.9 x 104 #/g
4350A 500 μm 494 μm ± 10 μm 25.2 μm (5.1%) 1.5 x 104 #/g
4355A 550 μm 552 μm ± 11 μm 27.0 μm (4.9%) 1.1 x 104 #/g
4365A 650 μm 644 μm ± 13 μm 24.8 μm (3.9%) 6.8 x 103 #/g
Uniform Dry Spheres, Calibrated by Optical Microscopy - PMMA
4375A 750 μm 773 μm ± 15 μm 33.3 μm (4.3%) 3.5 x 103 #/g
4400A 1000 μm 1007 μm ± 20 μm 48.3 μm (4.8%) 1.8 x 103 #/g
Thermo Scientific Duke Standards - 4000 Series Monosized Polymer Particles
The mean diameters of these products have been
calibrated with our NIST traceable microscopy
methods. Their size distribution and uniformity
were measured by electrical resistance analysis or
optical microscopy.
The 4000 Series products from 1 to 160 μm are
made from polystyrene. They are packaged as
aqueous suspensions in 15 mL dropper-tipped
bottles at an optimum concentration for dispersion,
handling and dilution.
18
Product SpecificationsParticle Composition: Polystyrene
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Trace amount of surfactant
Product SpecificationsParticle Composition: PSDVB and PMMA
Particle Density: 1.05 g/cm3 (PSDVB)1.19 g/cm3 (PMMA)
Index of Refraction: 1.59 @ 589 nm (25°C)1.49 @ 589 nm (25°C)
Additives: Trace amount of surfactant
Products with diameters of > 200 μm are packagedas dry spheres. They are made from polystyrenecrosslinked with divi-nylbenzene (PSDVB) except for the two largest products, which are made from polymethylmethacrylate.
This series is designed for applications requiring
monodisperse inorganic spheres. Like glass, silica
has a much higher density than sulfate and the
opaque spheres provide more contrast than polymer
particles in optical and electron beams. They are
Cat.Number
NominalDiameter
Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
8050 0.5 μm 0.49 μm ± 0.02 μm 0.02 μm (4.1%)
8070 0.7 μm 0.73 μm ± 0.02 μm 0.03 μm (4.1%)
8100 1.0 μm 0.99 μm ± 0.02 μm 0.02 μm (2.0%)
8150 1.6 μm 1.57 μm ± 0.02 μm 0.04 μm (2.5%)
Thermo Scientific Duke Standards - 8000 Series Silica Particles
Product SpecificationsParticle Composition: Amorphous Silica
Particle Density: 1.8 to 2.2 g/cm3
Index of Refraction: 1.40 to 1.46 @ 589 nm (25°C)
Additives: None
Packaged in: 15 mL, 2% solids
calibrated and certifi ed with NIST traceable mean
diameters and are suitable for a wide variety of
particle measurement applications. The particles
are packaged in pure, deionized water without any
surfactants.
This series is available as uniform spheres of
borosilicate or soda lime glass in a range of
discrete sizes from 2 micron to 2000 micron. They
are calibrated and certifi ed with NIST traceable
mean diameters and are suitable for a wide variety
Cat.No.
NominalDiameter
Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
CountPer Gram
Uniform Borosilicate Glass Dry Spheres - Calibrated by Optical Microscopy
9002 2 μm 2.0 μm ± 0.5μm 0.7 μm (35%) 9.5 x 1010
9005 5 μm 5.1 μm ± 0.5 μm 0.6 μm (12%) 5.8 x 109
9008 8 μm 8.0 μm ± 0.8 μm 1.0 μm (13%) 1.5 x 109
9010 10 μm 9.6 μm ± 1.0 μm 1.5 μm (16%) 8.5 x 108
9015 15 μm 15.9 μm ± 1.1 μm 1.8 μm (11%) 1.9 x 108
9020 20 μm 17.3 μm ± 1.4 μm 2.0 μm (12%) 1.5 x 108
Uniform Soda Lime Glass Dry Spheres - Calibrated by Optical Microscopy
9030 30 μm 30.1 μm ± 2.1 μm 2.3 μm (7.6%) 2.9 x 107
9040 40 μm 40.6 μm ± 2.8 μm 2.2 μm (5.4%) 1.1 x 107
9050 50 μm 49.9 μm ± 3.0 μm 2.2 μm (4.4%) 6.3 x 106
9060 60 μm 60.0 μm ± 3.6 μm 2.3 μm (3.8%) 3.6 x 106
9070 70 μm 71.0 μm ± 3.4 μm 2.9 μm (4.1%) 2.2 x 106
9080 80 μm 79.1 μm ± 4.0 μm 2.8 μm (3.5%) 1.6 x 106
9090 90 μm 90.3 μm ± 4.5 μm 3.9 μm (4.3%) 1.1 x 106
9100 100 μm 97.6 μm ± 4.9 μm 3.6 μm (3.7%) 8.3 x 105
9110 110 μm 111 μm ± 5.5 μm 4.2 μm (3.8%) 5.8 x 105
9120 120 μm 120 μm ± 6.0 μm 5.2 μm (4.3%) 4.5 x 105
9140 140 μm 139 μm ± 7.0 μm 2.9 μm (2.1%) 2.9 x 105
9170 170 μm 167 μm ± 8.4 μm 6.3 μm (3.8%) 1.6 x 105
9200 200 μm 196 μm ± 5..9 μm 5.7 μm (2.9%) 1.0 x 105
9230 230 μm 231 μm ± 6.9 μm 9.0 μm (3.9%) 6.2 x 104
9280 280 μm 279 μm ± 8.4 μm 9.3 μm (3.3%) 3.5 x 104
9330 330 μm 324 μm ± 10 μm 16.0 μm (4.9%) 2.2 x 104
9400 400 μm 391 μm ± 12 μm 10.1 μm (2.6%) 1.3 x 104
9480 480 μm 480 μm ± 14 μm 17.8 μm (3.7%) 7.1 x 103
9550 550 μm 553 μm ± 17 μm 29.0 μm (5.2%) 4600
9650 650 μm 655 μm ± 20 μm 29.0 μm (4.4%) 2800
9750 750 μm 749 μm ± 22 μm 19.4 μm (2.6%) 1825
9950 950 μm 940 μm ± 28 μm 39.7 μm (4.2%) 950
91000 1000 μm 1106 μm ± 33 μm 28.6 μm (2.6%) 560
92000 2000 μm 2007 μm ± 40 μm 50.9 μm (2.5%) 95
Thermo Scientific Duke Standards - 9000 Series Glass Particles
Product SpecificationsParticle Composition: Borosilicate Glass
Particle Density: 2.5 - 2.55 g/cm3
Index of Refraction: 1.56 @ 589 nm (25°C)
Additives: None
Packaged in: 1g, dry
of particle measurement applications. They also
have a better tolerance to chemicals and solvents
in addition to higher mechanical and thermal stabil-
ity. The spheres have been processed to remove
non-spherical and broken particles.
Product SpecificationsParticle Composition: Soda Lime Glass
Particle Density: 2.4 - 2.6 g/cm3
Index of Refraction: 1.50 - 1.52 @ 589 nm (25°C)
Additives: None
Packaged in: 1g, dry
Mechanical/ Electrical/ Thermal Properties
Units: Glass Glass
Young’s Modulus [106 psi] 10.5 10.0
Hardness [Moh] 6.5 6-7
Dielectric Constant: [22°C, 106 Hz] 5.8 6.9
Softening Point [°C] 846 700
The following properties are typical values for bulk borosilicate and soda lime glass. These valueshave not been measured and are not assay valuesfor a specifi c batch of particles. The data is for information only and should not be used as calibra-tion values.
Typical CompositionSiO
252.5% 60 - 72.5%
Na2O 0.3% 13.7 - 17%
CaO 22.5% 9.8 - 18%
MgO 1.2% 1 - 3%
Al2O
314.5% 0.4 - 4%
FeO/ Fe2O
30.2% 0 - 0.2%
K2O 0.2% 0 - 0.1%
B2O
38.6% 0.0%
19
CatalogNumber
NominalDiameter
Color Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
ApproximateCount per
Gram
Dry Dyed Particles, Calibrated by Optical Microscopy
RD050T 50 μm Red 49.1 μm ± 1.5 μm 3.8 μm (7.8%) 1.6 x 107
BK050T 50 μm Black 49.3 μm ± 1.5 μm 4.1 μm (8.4%) 1.5 x 107
RD100T 100 μm Red 96.0 μm ± 3.2 μm 7.5 μm (7.8%) 2.0 x 106
BK100T 100 μm Black 94.8 μm ± 2.8 μm 7.1 μm (7.5%) 2.1 x 106
RD150T 150 μm Red 149 μm ± 3.6 μm 9.0 μm (6.0%) 5.5 x 105
BK150T 150 μm Black 148 μm ± 4.1 μm 11 μm (7.1%) 5.6 x 105
RD200T 200 μm Red 202 μm ± 3.8 μm 9.5 μm (4.7%) 2.2 x 105
BK200T 200 μm Black 200 μm ± 4.0 μm 11 μm (5.5%) 2.3 x 105
RD300T 300 μm Red 301 μm ± 4.0 μm 10 μm (3.3%) 6.6 x 104
BK300T 300 μm Black 301 μm ± 4.2 μm 10 μm (3.3%) 6.6 x 104
RD400T 400 μm Red 402 μm ± 6.1 μm 18 μm (4.5%) 2.8 x 104
BK400T 400 μm Black 402 μm ± 6.1 μm 18 μm (4.5%) 2.8 x 104
RD500T 500 μm Red 500 μm ± 9.7 μm 24 μm (4.8%) 1.4 x 104
BK500T 500 μm Black 502 μm ± 9.8 μm 24 μm (4.8%) 1.4 x 104
Thermo Scientific ChromoSphere-T Certified Size Standards
Product SpecificationsParticle Composition: Polystyrene Divinylbenzene (PS-DVB)
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: None
Packaged in: 1 g, dry
ChromoSphere-T polymer particles are internally
dyed with deeply colored red or black dyes. The
intense colors result in very high contrast and vis-
ibility relative to most background materials. They
are available as dry powders and can easily be
suspended in aqueous media if desired. The mean
diameters of ChromoSphere-T Certifi ed Size Stan-
dards are traceable to the standard meter through
the National Institute of Standards and Technology
(NIST) and are calibrated by optical microscopy.
ChromoSphere-T Size Standards were developed
for use as reference or calibration materials in
applications where a high visual contrast is desired.
The product line consists of a large assortment
of uniform particle sizes between 50 and 500
microns in either red or black color. The particles
are made from cross-linked polystyrene divinyl-
benzene (PS-DVB) copolymer and should be stored
at room temperature. They can be dispersed in
aqueous media with the aid of a small amount of
surfactant or in lower alcohols, such as methanol or
ethanol. Some dye extraction will result when the
particles are suspended in pure alcohols, but will
be minimal. Other organic solvents, such as ethers
or chlorinated hydrocarbons, should be avoided be-
cause they will swell the particles and completely
extract the dye.
Rinse Water Wash Studies/Particulate Decontamination Studies
Colored and fl uorescent particles can be used to evaluate the cleaning capability of vial washers.
Some Helpful Tips
• The naked eye can resolve down to about 50 μm
See: ChromoSphere Polymer Particles (Dry) on page 40
• Need even higher contrast? Fluorescent particles really stand out on a dark background.
See: FluorescentPolymer Particles (Aqueous) and FluorescentPolymer Particles on page 45
Important Considerations
• What is the smallest particle contaminant you are looking for?
Choose a test particle which is the same size or smaller. 20
21
These products are provided for calibrating particle
sizing and counting instrumentation that require dry
particles.
DRI-CAL Particle Size Standards are conveniently
packaged in dropper-tipped vials in 1 gram quanti-
ties, enabling the user to dispense the particles
directly into the sampling chamber. They are not
suitable for dispersion in liquid media.
Each package of standards contains a Certifi -
cate of Calibration and Traceability to NIST
which includes a description of the calibration
method and its uncertainty, and a table of
chemical and physical properties. A Material
Safety Data Sheet with handling and disposal
instructions is also included. Packages are
lot-numbered for technical service and support
after the sale.
To order Thermo Scientifi c DRI-CAL
products, call our Fremont, CA offi ce at
1-800-232-3342 or at 1-510-979-5000.
CatalogNumber
NominalDiameter
Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
Approx. Count per Gram
Uniform PSDVB Dry Spheres - Calibrated by Optical Microscopy
DC-05 5 μm 5.0 μm ± 0.4 μm 0.5 μm (10%) 1.4 x 1010
DC-06 6 μm 6.0 μm ± 0.4 μm 0.9 μm (15%) 8.4 x 1010
DC-07 7 μm 6.9 μm ± 0.4 μm 0.7 μm (10%) 5.5 x 109
DC-08 8 μm 7.5 μm ± 0.5 μm 0.8 nm (11%) 4.3 x 109
DC-10 10 μm 10.0 μm ± 0.5 μm 1.0 nm (10%) 1.8 x 109
DC-15 15 μm 16.2 μm ± 0.8 μm 1.8 nm (11%) 4.3 x 108
DC-20 20 μm 20.8 μm ± 0.7 μm 1.9 nm (9.5%) 2.3 x 108
DC-25 25 μm 25.6 μm ± 1.5 μm 3.3 nm (13%) 1.1 x 108
DC-50 50 μm 50.7 μm ± 2.0 μm 4.4 nm (8.7%) 1.4 x 107
DC-70 70 μm 68.2 μm ± 3.0 μm 3.7 nm (5.4%) 5.7 x 106
DC100 100 μm 97 μm ± 4 μm 5.6 nm (5.8%) 2.0 x 106
Thermo Scientific DRI-CAL Particle Size Standards
Product SpecificationsParticle Composition: Polystyrene Divinylbenzene (PSDVB)
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Trace flow agent may be present
Packaged in: 1 g, dry
SURF-CAL is designed to simplify the job of prepar-
ing calibration wafers in your facility. Available
particle sizes correspond to the calibration point
sizes required by instrument manufacturers.
Along with the Semiconductor Industry, we have
established specifi c particle sizes to be used when
calibrating Scanning Surface Inspection Systems.
Working with instrument manufacturers the
SURF-CAL product line was created to meet SEMI
standard guidelines. Available are sizes considered
to be critical sizing nodes as defi ned by the
International Technology Roadmap for Semiconduc-
tors (ITRS)1.
By depositing SURF-CAL NIST traceable sulfate
latex spheres (PSL) on specially selected wafers,
you can perform periodic calibration checks and
compare your scanner with scanners at other
locations. You can also assess the performance of
your SSIS at critical stages in the manufacturing
process.
All products are suspended in deionized, fi ltered
water in 50 mL bottles at a concentration of 3
x108 particles per mL. Products, PD1100 and
smaller are also available at 1010 particles per
mL for applications using the aid of a Differential
Mobility Analyzer (DMA) or other size exclusionary
techniques.
Measurement Methodology
To assure direct traceability to NIST, the certifi ed
diameters of these products were transferred by
transmission electron or optical microscopy from
NIST standard reference materials2. The uncertainty
was calculated per the NIST Technical Note 1297,
1994 Edition “Guidelines for Evaluating and
Expressing the Uncertainty of NIST Measurement
Catalog Number(Particles per mL)
Certifi ed PeakDiameter
ExpandedUncertainty
Size Distribution
3 x 108 1010 (of peak diameter) Std. Dev. CV% FWHM%
PD-047 PD-047B 0.047 μm 0.002 μm 0.004 μm 7.5% 17.4%
PD-064 PD-064B 0.064 μm 0.002 μm 0.003 μm 5.4% 10.9%
PD-070 PD-070B 0.072 μm 0.002 μm 0.005 μm 7.2% 16.2%
PD-080 PD-080B 0.080 μm 0.005 μm 0.006 μm 7.0% 12.8%
PD-083 PD-083B 0.083 μm 0.002 μm 0.004 μm 4.2% 9.6%
PD-090 PD-090B 0.089 μm 0.004 μm 0.005 μm 5.7% 9.6%
PD-092 PD-092B 0.092 μm 0.004 μm 0.004 μm 4.6% 9.1%
PD-100 PD-100B 0.100 μm 0.005 μm 0.003 μm 2.6% 5.2%
PD-110 PD-110B 0.114 μm 0.005 μm 0.004 μm 3.3% 6.3%
PD-125 PD-125B 0.126 μm 0.006 μm 0.003 μm 2.4% 4.8%
PD-155 PD-155B 0.155 μm 0.003 μm 0.003 μm 1.6% 3.7%
PD-180 PD-180B 0.184 μm 0.003 μm 0.004 μm 2.2% 3.9%
PD-200 PD-200B 0.202 μm 0.007 μm 0.004 μm 1.8% 4.0%
PD-204 PD-204B 0.204 μm 0.008 μm 0.004 μm 1.8% 3.7%
PD-215 PD-215B 0.220 μm 0.007 μm 0.003 μm 1.6% 3.3%
PD-305 PD-305B 0.304 μm 0.005 μm 0.004 μm 1.4% 3.4%
PD-365 PD-365B 0.360 μm 0.013 μm 0.005 μm 1.3% 2.8%
PD-500 PD-500B 0.494 μm 0.010 μm 0.006 μm 1.1% 2.5%
PD-800 PD-800B 0.809 μm 0.014 μm 0.006 μm 0.8% 1.8%
PD-802 PD-802B 0.802 μm 0.011 μm 0.009 μm 1.1% 2.4%
PD1100 PD1100B 1.112 μm 0.018 μm 0.011 μm 1.0% 2.5%
PD1600 1.57 μm 0.02 μm 0.016 μm 1.0% 2.2%
PD2000 2.01 μm 0.04 μm 0.019 μm 1.0% 3.3%
PD2500 2.50 μm 0.05 μm 0.025 μm 1.0% 2.9%
PD3000 3.04 μm 0.06 μm 0.026 μm 0.9% 2.7%
Thermo Scientific SURF-CAL Particle Size Standards
Product SpecificationsParticle Composition: Polystyrene
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: None
Packaged in:L 50 mL
22
Results”3. The uncertainty listed is the expanded
uncertainty with a coverage factor of two (K=2). The
peak diameter was calculated using approximately
the ± 2s range of the particle size distribution. The
size distribution was calculated as the standard
deviation of the whole peak. The Coeffi cient of
Variation is one standard deviation expressed as
a percentage of the peak diameter. The FWHM
distribution was calculated as the distribution at
half of the peak height expressed as a percentage
of the peak diameter.
1. “The National Technology Roadmap for Semiconductors”, SemiconductorIndustry Association (1999)
2. S.D. Duke and E.B. Layendecker, “Internal Standard Methodfor Size Calibration of Sub-MicronSpherical Particles by Electron Microscopy”, Fine Particle Society (1988)
3. Barry N. Taylor and Chris E. Kuyatt, “Guidelines for Evaluating and Expressing the Uncertainty of NIST Measurement Results”. NIST Technical Note 1297, 1994 edition, September 1994.
23
Quartz Reference Particles from The Institute for
Reference Materials and Measurement (IRMM) are
non-spherical, certifi ed materials used for evaluat-
ing particle size analysis instruments or sieves
requiring samples with a wide size distribution.
They are also useful for evaluating laser diffraction
spectrometers and electrical resistance analyzers.
The reference particles were prepared, charac-
terized and certifi ed under the sponsorship of
the Community Bureau of Reference (BCR) the
standards bureau of the European Common Market.
They were analyzed by laboratories in Germany,
Italy and the United Kingdom.
NOTE: This material has been certifi ed by BCR,
the former reference materials program of the Eu-
ropean Commission. The product certifi cates have
been revised under the responsibility if IRMM.
Product Detail
Mined in Frechen, Germany, the quartz is mostly
silicon dioxide with trace amounts of iron (Fe),
titanium (Ti), sodium (Na) and calcium (Ca). The
chemical composition was characterized using
hydrofl uoric acid dissolution, the resulting residue
was analyzed. Sodium and calcium content were
determined by fl ame photometry. Iron and titanium
content were determined using spectrophotometric
techniques.
BCR 66, 67, 69 and 70 were calibrated by gravimet-
ric sedimentation and BCR 68 and 130 by a sieving
technique by the BCR. The samples were also ana-
lyzed by TEM, electrical sensing zone, sieving and
several sedimentation methods. A continuum of
the weight distribution is provided for each sample.
The density was determined by pyknometer and is
approximately 2.6 g/cm3.
Results and methods are summarized in two
detailed reports:
Certifi cation Report on Reference Materials of
Defi ned Particle Size, for BCR 66 through 70.
Certifi cation Report on Reference Materials of
Defi ned Particle Size, for BCR 130.
Both reports are included with the kit.*
Each individual bottle of quartz reference particles
is accompanied by a Certifi cate of Measurement,
which outlines measurement methods, chemical
analysis data and instructions for use.
*The appropriate report will be included with orders of six or more
kits (any combination) at no charge.
To order Thermo Scientifi c BCR-Quartz
Reference particles, call our Fremont, CA offi ce
at 1-800-232-3342 or at 1-510-979-5000.
Catalog Number Size Range Density QuantityBCR 66 0.35 - 3.5 μm 2.62 g/cm2 10 grams
BCR 70 1.2 - 20 μm 2.64 g/cm2 10 grams
BCR 67 2.4 - 32 μm 2.65 g/cm2 10 grams
BCR 69 14 - 90 μm 2.65 g/cm2 10 grams
BCR 130 50 - 220 μm 2.64 g/cm2 50 grams
BCR 68 160 - 630 μm 2.65 g/cm2 100 grams
BCR RPT1 Certification Report BCR 66 - BDR 70
BDR RPT2 Certification Report BCR 130
BCR Kit Quartz Reference Particle Kit - Contains 1 vial of each product and both reports
Thermo Scientific BCR Quartz Reference Particles
Product SpecificationsParticle Composition: Quartz
Particle Density: 2.6 g/cm3
Index of Refraction: Unknown
Additives: None
Packaged as: Dry particles
24
Thermo Scientifi c Count Control particles are used for
the count validation of most particle counting instru-
ments. When these instruments are called on to solve
real-world analytical problems, customers call on
Thermo Scientifi c brand particles for reference
standards to validate their results.
Did you know...Thermo Scientifi c Count Controls have rapidly become an indespensible technology for optimizing
drinking water quality.
Thermo Scientifi c Count Controls
Validate Performance
This series of NIST traceable size standards provide an accurate and convenient method for calibrating or checking the performance of laser particle counters used in cleanrooms and other contamination monitoring applications.
These particle size standards provide third party traceability of calibration procedures to national and international agencies through an unbroken chain of measurements with specifi ed uncertainties. The products are also used to develop and test new analytical instruments for particle size characterization of materials.
They are available as uniform spheres in a range of discrete sizes from 100 nanometers (nm) to 100 micrometers (μm or microns). The spherical diameters are calibrated with linear dimensions transferred from NIST Standard Reference Materials (SRM). Spheres are used instead of irregularly shaped particles to minimize the response of analytical systems to shape effects.
Each package of standards contains a Certifi cate of Calibration and Traceability to NIST which includes a description of the calibration method and its uncertainty, a specifi ed count and a table of chemical and physical properties. A Material Safety Data Sheet (MSDS) with disposal instructions is also included. Packages are lot numbered for convenient technical service and support after the purchase.
25
This series of NIST traceable size standards
provides an accurate and convenient method for
calibrating or checking the performance of laser
particle counters used in cleanrooms and other con-
tamination monitoring applications. The products
are suspensions of monodisperse sulfate spheres
for use in airborne or liquid particle dispersion
systems. The particle diameters are traceable to
the standard meter through the National Institute of
Standards and Technology (NIST).
The particles are prepared as low residue aqueous
suspensions for minimal background interference.
This product line is precisely diluted for immediate
use in laser particle counters with minimal time-
consuming adjustments of concentration.
To order Thermo Scientifi c Duke Standards,
call our Fremont, CA offi ce at 1-800-232-3342
or at 1-510-979-5000.
CatalogNumber
NominalDiameter
Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
Approximate#/mL
Aqueous Suspensions, Calibrated by Transmission Electron Microscopy (TEM)
3K-100 0.1 μm 0.102 μm ± 0.003 μm 0.0076 μm (7.5%) 109
3K-150 0.15 μm 0.151 μm ± 0.004 μm 0.0051 μm (3.4%) 109
3K-200 0.2 μm 0.200 μm ± 0.006 μm 0.0034 μm (1.7%) 109
3K-220 0.22 μm 0.220 μm ± 0.006 μm 0.0046 μm (2.1%) 109
3K-269 0.27 μm 0.269 μm ± 0.006 μm 0.0042 μm (1.6%) 109
3K-300 0.3 μm 0.300 μm ± 0.006 μm 0.0051 μm (1.7%) 109
3K-350 0.35 μm 0.350 μm ± 0.007 μm 0.0047 μm (1.6%) 109
3K-400 0.4 μm 0.400 μm ± 0.005 μm 0.0073 μm (1.8%) 109
3K-500 0.5 μm 0.499 μm ± 0.005 μm 0.0065 μm (1.3%) 109
3K-600 0.6 μm 0.596 μm ± 0.006 μm 0.0077 μm (1.3%) 109
3K-700 0.7 μm 0.707 μm ± 0.006 μm 0.0085 μm (1.2%) 109
3K-800 0.8 μm 0.799 μm ± 0.009 μm 0.0083 μm (1.0%) 109
3K-900 0.9 μm 0.903 μm ± 0.009 μm 0.0093 μm (1.0%) 109
Aqueous Suspensions, Calibrated by Optical Microscopy
3K-990 1.0 μm 0.994 μm ± 0.021 μm 0.010 μm (1.0%) 109
3K1000 1.0 μm 1.020 μm ± 0.022 μm 0.011 μm (1.1%) 109
3K1600 1.6 μm 1.587 μm ± 0.025 μm 0.021 μm (1.3%) 109
4K-02 2.0 μm 1.998 μm ± 0.022 μm 0.020 μm (1.0%) 5 x 108
4K-03 3.0 μm 3.005 μm ± 0.027 μm 0.03 μm (1.1%) 5 x 107
4K-04 4.0 μm 4.000 μm ± 0.033 μm 0.04 μm (1.0%) 5 x 107
4K-05 5.0 μm 5.003 μm ± 0.040 μm 0.05 μm (1.0%) 107
4K-06 6.0 μm 5.990 μm ± 0.045 μm 0.07 μm (1.2%) 107
4K-07 7.0 μm 7.028 μm ± 0.055 μm 0.07 μm (1.0%) 107
4K-10 10 μm 10.00 μm ± 0.05 μm 0.09 μm (0.9%) 106
4K-15 15 μm 15.02 μm ± 0.08 μm 0.15 μm (1.0%) 106
4K-20 20 μm 20.00 μm ± 0.10 μm 0.20 μm (1.0%) 3 x105
4K-25 25 μm 25.09 μm ± 0.12 μm 0.38 μm (1.5%) 3 x105
4K-30 30 μm 30.10 μm ± 0.22 μm 0.45 μm (1.5%) 3 x105
4K-40 40 μm 39.82 μm ± 0.32 μm 0.44 μm (1.1%) 8 x104
4K-50 50 μm 50.2 μm ± 0.7 μm 0.5 μm (1.0%) 8 x104
4K-60 60 μm 59.1 μm ± 0.9 μm 0.9 μm (1.5%) 8 x104
4K-70 70 μm 72.3 μm ± 0.9 μm 0.9 μm (1.2%) 8 x104
4K-80 80 μm 79.4 μm ± 1.0 μm 0.9 μm (1.1%) 3 x104
4K100 100 μm 100 μm ± 1.5 μm 1.5 μm (1.5%) 3 x104
Thermo Scientific Duke Standards 3K/4K Series - Particle Counter Size Standards
Product SpecificationsParticle Composition: Polystyrene
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
Packaged in: 15 mL
26
Application Specifi c Count Control Products
CatalogNumber
NominalDiameter
Certifi ed MeanDiameter
Quantity
Aqueous Suspensions, Calibrated by Optical Microscopy
CS-PK 15 μm 15.02 μm ± 0.08 μm 6 bottles
CS-BX 15 μm 15.02 μm ± 0.08 μm 20 bottles
Thermo Scientific PHARM-TROL - Count Precision Standards
Product SpecificationsParticle Composition: Polystyrene
Concentration 3800 particles / mL ± 15%
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
Packaged in: 25 mL
PHARM-TROL is a product containing NIST trace-
able size standards with a measured particle count.
The product was developed for manufactures of
parenteral drugs and ophthalmic solutions seeking
interim verifi cation of USP <788> and <789> (Par-
ticulate Matter in Injections and Particulate Matter
in Ophthalmic Solutions). The particle diameters
are traceable to the standard meter through NIST.
PHARM-TROL is prepared with the same exacting
procedures as the USP Count Reference Standard
and provides process control data for particle
counting consistency and verifi cation of size
calibration.
The ready-to-use precision standard is designed for
regular use in liquid particle counters. This docu-
ments the reproducibility of the particle counter
by permitting a continuous record of its perfor-
CatalogNumber
NominalDiameter
Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
Aqueous Suspensions, Calibrated by Optical Microscopy
CRS-05 5 μm 5.0 μm ± 0.1 μm 0.1 μm (2%)
CRS-10 10 μm 10.2 μm ± 0.1 μm 0.1 μm (2%)
Thermo Scientific Validex Count Precision Standards
Product SpecificationsParticle Composition: Polystyrene
Concentration 1000 particles / mL ± 15%
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
Packaged in: 500 mL
Particle counting in the drinking water industry has
rapidly become an indispensable technology for
optimizing water quality. The majority of particle
counters used in the drinking water industry
operate on the principle of single particle light
obscuration.
Validex contains NIST traceable polymer particles
packaged in ultrapure water at concentrations
ideal for use in validating the performance of liquid
particle counters. The composition of the suspen-
sion has been optimized to promote dispersion
of the particles. Each bottle contains 500 mL of
suspension at a nominal concentration of 1000
particles per mL. A stir bar is included in the bottle
to aid dispersion.
Thermo Scientifi c PHARM-TROL Count Precision StandardsExcellent for:• USP <788> and <789> interum verifi cation
• Liquid particle counting and calibration
Benefi ts:• Certifi ed concentration
• Ultraclean diluent
• No dilution required
• Sample directly from bottle to avoid
contamination
Thermo Scientifi c Validex Count Precision StandardsExcellent for:• Instrument calibration and verifi cation in
the drinking water industry
• Low level liquid particle counting and
calibration
Benefi ts:• Certifi ed concentration
• Ultraclean diluent
• No dilution required
• Sample directly from bottle to avoid
contamination
• Larger volume for appropriate testing
mance using a particle suspension with a known
concentration. The data provides documentation
for internal or customer quality audits.
27
CatalogNumber
NominalDiameter
Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
Quantity
Aqueous Suspensions, Calibrated by Optical Microscopy
CC02-PK 2 μm 1.998 μm ± 0.022 μm 0.020 μm (1.0%) 6 Bottles
CC05-PK 5 μm 5.010 μm ± 0.035 μm 0.05 μm (1.1%) 6 Bottles
CC10-PK 10 μm 10.00 μm ± 0.05 μm 0.09 μm (0.9%) 6 Bottles
CC15-PK 15 μm 15.02 μm ± 0.08 μm 0.15 μm (1.0%) 6 Bottles
CC20-PK 20 μm 20.00 μm ± 0.10 μm 0.020 μm (1.0%) 6 Bottles
CC25-PK 25 μm 25.09 μm ± 0.12 μm 0.038 μm (1.5%) 6 Bottles
CC30-PK 30 μm 30.10 μm ± 0.22 μm 0.045 μm (1.5%) 6 Bottles
CC50-PK 50 μm 49.7 μm ± 0.7 μm 0.8 μm (1.6%) 6 Bottles
CC70-PK 70 μm 72.3 μm ± 0.9 μm 0.9 μm (1.2%) 6 Bottles
Thermo Scientific COUNT-CAL Count Precision Standards
Product SpecificationsParticle Composition: Polystyrene
Concentration 3000 particles / mL ± 10%
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
Packaged in: 6 x 25 mL packs
COUNT-CAL is a cost effective and convenient
product for validating liquid particle counters.
Packaged in single-use bottles and intended to
be sampled directly from the bottle, it eliminates
the need for serial dilutions and extensive sample
handling, thereby minimizing contamination. It
was developed for manufactures of parenteral
drugs and ophthalmic solutions seeking interim
verifi cation of USP <788> and <789> (Particulate
Matter in Injections and Particulate Matter in
Ophthalmic Solutions).
The particles are suspended in an ultraclean
diluent and the concentration is optimized for use
in light obscuration particle counters and other low
concentration counting applications. The particle
diameters are traceable to the Standards Meter
through NIST.
To order Thermo Scientifi c COUNT-CAL
products, call our Fremont, CA offi ce at
1-800-232-3342 or at 1-510-979-5000.
CatalogNumber
NominalDiameter
Certifi ed MeanDiameter
Size DistributionStd. Dev & CV
Aqueous Suspensions, Calibrated by Optical Microscopy
6002 2 μm 1.998 μm ± 0.022 μm 0.020 μm (1.0%)
6005 5 μm 5.010 μm ± 0.035 μm 0.05 μm (1.1%)
6010 10 μm 10.00 μm ± 0.05 μm 0.09 μm (0.9%)
6015 15 μm 15.02 μm ± 0.08 μm 0.15 μm (1.0%)
6020 20 μm 20.00 μm ± 0.10 μm 0.020 μm (1.0%)
6025 25 μm 25.09 μm ± 0.12 μm 0.038 μm (1.5%)
6030 30 μm 30.10 μm ± 0.22 μm 0.045 μm (1.5%)
6050 50 μm 49.7 μm ± 0.7 μm 0.8 μm (1.6%)
6070 70 μm 72.3 μm ± 0.9 μm 0.9 μm (1.2%)
Thermo Scientific EZY-CAL Count Precision Standards
Product SpecificationsParticle Composition: Polystyrene
Concentration 2000 particles / mL ± 10%
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
Packaged in: 100 mL
EZY-CAL is a series of ready-to-use size standards
for validating optical particle counters. A magnetic
stir bar is included in each bottle for clean, con-
venient and direct sampling by instruments. The
aqueous suspension medium contains a combina-
tion of dispersing agents, which help to keep the
particles from clumping or sticking to fl ow surfaces
in the particle counter. The particle diameters are
traceable to the standard meter through NIST.
This series of size standards is provided for setting
or checking the calibration of channel thresholds
or for checking the count precision of liquid borne
particle counters.
PARTICLE HANDLING TIPS
Listed below are helpful tips when usingour particles. These are general guide-lines and should be used accordingly.Please read the literature that accom-panies your product for special handlingnotes (if any). If you have a critical ap-plication or are looking for a product thatcan be used without additional process-ing, please contact our technical service department.
Note: For most applications, it is impera-tive to ensure the cleanliness ofdiluents, sampling implements, and any other component that willmake contact with the particles.
RESUSPENSION
Polymer particles ≥ 0.5 μm in suspension will sediment out over time. To resuspend the particles, simply invert the bottle sev-eral times avoiding rigorous agitation asbubbles formed may result in statistical artifacts. Sonication after resuspension is recommended to de-gas and break uptemporary agglomerates. For applications that require the particles to be suspendedfor an extended period of time, a clean magnetic stir bar may be used.
DILUTION
Most particle suspensions are suitable for dilution and do not require additional sur-factant/dispersant, however, the diluted suspensions should be used immediatelyas the stability may be affected.
1. Calculate the quantity of particlesneeded based on desired fi nal concen-tration and quantity.
2. Resuspend the original particlesuspension.
3. Sample immediately into clean container.
4. Add fi ltered deionized water to desiredamount.
SUSPENDING DRY PARTICLES
This procedure outlines the steps neces-sary to put a dry powder into suspension.
Working with Particles
1. Wet the dry particles with a1% surfactant solution (anionic or non-ionic, i.e., Tween 20 or Triton X100) or an alcohol such asmethanol or ethanol.
2. Add fi ltered water to the desired amount. (Alternatively, let the resin settle and pour off the sus-pension into another clean bottle.)
DRYING A SUSPENSION
Drying a suspension to achieve a dry powder is not recommended. The par-ticles may form permanent aggregates and may be aerosolized creating aninhalation hazard.
DISSOLVING POLYSTYRENE PARTICLES
In general, aromatic hydrocarbons willdissolve polystyrene. Some commonlyused solvents for this application are:
Benzene
Methyl Ethyl Ketone (MEK)
Toluene
Note: *MEK and toluene will dissolve polystyrene divinylbenzene(PSDVB) over time.
REMOVING/REDUCING ADDITIVESBY ION EXCHANGE OR DIALYSIS
These procedures are used to achieve low or surfactant-free suspensions for applications such asaerosol and biotechnology applica-tions. However, removing the surfac-tant from a suspension may compro-mise the stability of the product and should be performed immediatelyprior to use. Please contact us if youare looking for a low or surfactant-free product.
ION EXCHANGE
This procedure is recommended for removing ionic surfactants from the sus-pension and surface of the particles:
1. Obtain mixed bed ion-exchange resin(i.e., Bio-Rad AG501-X8).
2. For a 15 mL bottle of particles at 1%solids use 3 to 4 grams of resin.
3. Wash the resin thoroughly to removepotential contaminants.
a. Wash resin with approximately 200mL deionized water fi ve times.
b. Allow the resin to settle, and pouroff the water.
4. Add the particle suspension to theresin in a small bottle. Add extra water if needed.
5. Roll the mixture for 4 to 6 hours andfi lter through washed glass wool to remove the resin.
DIALYSIS
This procedure is recommended forremoving surfactants from the suspension(but not from the particle surface.)
1. Wash the dialysis tubing (i.e.,Spectrapor 12,000-14,000 molecu-lar weight cut-off) thoroughly withdeionized water and place it in a container of deionized water, sub-merged.
2. Keep refrigerated for storage.
3. When ready to use, cut off the desired length of tubing.
4. Place a clamp on one end or tie it off.
5. Fill about half full with the particlesuspension.
6. Clamp or tie the top end and placein the container of deionized water with at least 10 to 20 times the volume of the latex.
7. Roll or stir the contents of the con-tainer.
8. Allow to dialyze for at least 4 hours.
9. Repeat dialysis three times with fresh water.
View our technical notes at www.thermo.com/particletechnology.
28
Technical Supplement
Thermo Scientifi c Flow Cytometry Products
Flow Cytometry Instrument Performance Cyto-Cal Multifl uor fl uorescence Intensity Calibrator
Cyto-Cal Alignment Beads
Cyto-Cal Count Control
Cyto-Cal Low Intensity Calibrator
Flow Cytometry Multiplex Assay Products Cyto-Plex Carboxylated Particles
30
Flow CytometryFlow cytometry is a technique for counting, examining, and sorting microscopic particles suspended in a fl uid stream. It allows simultaneous multiparametric analysis of the physical and/or chemical characteristics of single cells fl owing through an optical and/or electronic detection apparatus.
Modern fl ow cytometers are able to analyze several thousand particles every second and can actively separate and isolate particles having specifi ed properties. A fl ow cytometer is similar to a microscope, except that instead of producing an image of the cell, fl ow cytometry offers automated quantifi cation of set parameters.
Thermo Scientifi c Flow cytometry beads provide a third party supplier of controls. We have created an open platform of products to provide data for different instruments and laboratories without bias to any particular instrument brand.
Thermo Scientifi c Flow Cytometry Instrument Performance
Through optical measurements, fl ow cytom-
eters distinguish cells on the basis of size and
shape in addition to the presence of many
different molecules inside and on the surface
of the cells. The appeal of fl ow cytometry
arises from the fl exibility and sensitivity of
fl uorescence technology combined with the
technique’s high speed and powerful data
integration capabilities.
By being a third party supplier of controls we
have created an open platform of products
to provide data for different instruments and
laboratories without bias to any particular
instrument brand.
To order Thermo Scientifi c Flow Cytometry
products, call our Fremont, CA offi ce at
1-800-232-3342 or at 1-510-979-5000.
Did you know...hospitals depend on calibration particles for monitoring CD4 counts in
blood samples of AIDS patients and did you know that clinical instru-
ment manufactures use particles to perform the primary calibration and
set-up of commercially available fl ow cytometers.
31
CatalogNumber
Description Quantity
Aqueous Suspensions, Calibrated by Optical Microscopy
FC3M Cyto-Cal Multifl uor 3 mL (50 tests)
Thermo Scientific Cyto-Cal Multifluor Fluorescence Intensity Calibrator
Product SpecificationsParticle Composition: Polystyrene particles containing encapsulated dyes
Dyes Firefli™ Fluorescent Green (488/510 nm), Orange (488/575 nm) and Red (488,633, 635/700 nm)
Concentration 1.5 x 107 particles / mL
Particle Density: 1.05 g/cm3
Additives: 0.05% tween-20 dispersant / Surfactant with 2mMSoidum Azide Preservative
Packaged in: 3 mL
The Cyto-Cal Multifl uor Fluorescence Intensity Cali-
brator is designed to simultaneously monitor fl ow
cytometer stability as well as provide a check of
instrument sensitivity and performance. Although
the product can provide relative fl uorescence esti-
mations of labeled cells (MEFL), it is not designed
for quantitation of fl uorochromes on cells.
The calibrator is a uniform mixture of 3 μm particles
with three dyes in seven different fl uorescent inten-
sities. Due to the high uniformity of the particles,
singlet gating is not required. The calibrator con-
sists of a single vial of fl uorescent beads precisely
stained with fl uorescent dyes that have optimized
intensity and broad emission in multiple channels
(FITC, PE, PE-Cy5, PE-Texas Red, APC, APC-Cy7).
Each intensity level has an MEFL (mean equivalent
fl uorochrome)* value for estimation of relative
fl uorescence intensities of labeled cells.
*MEFL is also referred to as Molecules of Equivalent Soluble Fluorochrome
(MESF). The MEFL values provided are not traceable to a standard reference
material.
CatalogNumber
Description Quantity
Aqueous Suspensions, Calibrated by Optical Microscopy
FA3O 488 nm alignment beads 3 mL (50 tests)
FA3R 633 nm alignment beads 3 mL (50 tests)
Thermo Scientific Cyto-Cal Alignment Beads
Superior bead size and uniform dye intensity
provide exceptional accuracy when performing the
alignment of the fl ow cytometer optics to give a
high level of confi dence in the instrument results.
Cyto-Cal Alignment Beads provide a superior
method for optical alignment and fl ow cell focusing
of fl ow cytometers. The 3 μm particles are of the
highest quality in size and fl uorescence uniformity
to permit the best possible optimization of each
parameter being measured. Cyto-Cal Alignment
beads are internally dyed with chemically stable
dyes and therefore have excellent signal stability.
The Cyto-Cal 488 Alignment beads are excited by
the 488nm spectral line of the argon laser and have
broad emission, allowing then to be used to align
the FL1 (FITC), FL2 (PE) and FL3 (PE-Cy5) channels
simultaneously.
The Cyto-Cal Multifl uorescence Intensity Calibrator contains particles with dyes that excite and emit at the spectral ranges commonly used in fl ow cytometry.
Product SpecificationsParticle Composition: Polystyrene particles containing encapsulated dyes
Dyes Firefli Fluorescent Orange (488/575 nm) or Red(488,633, 635/700 nm)
Concentration 5 x 106 particles / mL
Particle Density: 1.05 g/cm3
Additives: 0.05% tween-20 dispersant / Surfactant with 2mMSoidum Azide Preservative
Packaged in: 3 mL
CatalogNumber
Description Quantity
Aqueous Suspensions, Calibrated by Optical Microscopy
FL6 Cyto-Cal Low Intensity Calibrator 3 mL (50 tests)
Thermo Scientific Cyto-Cal Low Intensity Calibrator
Product SpecificationsParticle Composition: Polystyrene particles containing encapsulated dyes
Dyes Firefli Fluorescent Green (488/510 nm), Orange(488/575 nm) and Red (488,633, 635/700 nm)
Concentration 4 x 106 particles / mL
Particle Density: 1.05 g/cm3
Additives: 0.05% tween-20 dispersant / Surfactant with 2mM Soidum Azide Preservative
Packaged in: 3 mL
In many fl ow cytometry applications, it is critical
to be able to separate dimly labeled cells from
unlabeled (autofl uorescent) cells. Cyto-Cal Low In-
tensity Calibrator enables simultaneous monitoring
of FL1 (FITC), FL2 (PE), FL3 (PE-Cy5) and FL4 (APC)
channels for adequate fl uorescence sensitivity and
discrimination.
The calibrator contains an equal mixture of 6 mi-
crometer (μm) undyed particles and particles dimly
labeled with green, orange and red fl uorescent
dyes which are designed to imitate a mixture of
unlabeled and dim labeled cells. The dyes are
incorporated within the polymer matrix (hard-dyed)
for long term stability using a proprietary Firefl i
process.
CatalogNumber
Description Quantity
Aqueous Suspensions, Calibrated by Optical Microscopy
FC7 Cyto-Cal Count Control 10 mL
Thermo Scientific Cyto-Cal Count Control
The Cyto-Cal Count Control is designed for absolute
cell counting on fl ow cytometers.
This product contains uniform 7 μm particles
containing two encapsulated dyes. The single vial
contains fl uorescent beads which are precisely
stained with fl uorescent dyes that have optimized
intensity and broad emission in multiple channels
(FITC, PE, PE-Cy5).
The hydrophilic bead surface eliminates particle
doublets ensuring an accurate count, verifi ed by
analytical procedures, providing confi dence in
absolute counting on fl ow cytometers.
Product SpecificationsParticle Composition: Polystyrene particles containing encapsulated dyes
Dyes Firefli Fluorescent Green (488/510 nm) and Red (570/600 nm)
Concentration 1,000,000 particles / mL ± 5%
Particle Density: 1.05 g/cm3
Additives: 0.05% tween-20 dispersant / Surfactant with 2mM Soidum Azide Preservative
Packaged in: 10 mL
32
Suspension array analysis is a powerful
technique enabling the simultaneous detec-
tion and quantitation of multiple analytes with
a single sample. Using color coded particles
with the appropriate dyes, these tests can
now be carried out using commonly available
fl ow cytometers.
Did you know...Multiplex bead assays are more sensitive than traditional immunoassays, have a high through-
put capacity and can replace any available ELISA assay saving the user both time and money.
Thermo Scientifi c Flow Cytometry Multiplex Assay Products
Open Platform Particles for Suspension Array Analysis
33
Cyto-Plex Carboxylated Particles provide different
sizes and levels of fl uorescent intensities for analy-
sis of multiple analytes. The Cyto-Plex particles
consist of a highly uniform polystyrene carboxyl-
ate-modifi ed particle with fl uorescent intensities
which are completely separated from each other.
The use of a single diameter particle for all dye
levels saves time by only requiring the development
and optimization of one bead chemistry. Multiple
diameters can be combined to increase the number
of analytes measured in one test. High-density
binding sites and low non-specifi c binding enable
coupling with a wide variety of antibodies, nucleic
acids and other biomolecules.
Cyto-Plex Carboxylated Particles have a maximum
emission at 700 nm and can be excited with either
488 nm or 633 nm lasers. Emission can be col-
lected in either the PE-Cy5 or APC channels. Since
there is little or no emission in the FITC and PE
channels, probes utilizing either of these dyes can
be effectively used as reporters.
Catalog Number IntensityLevel
Surface Functionality
Aqueous Suspensions, Calibrated by Optical Microscopy
1 mL 5 mL
FM4CR01 FM4CR01B Level 1 (low) Carboxylate-modified
FM4CR02 FM4CR02B Level 2 Carboxylate-modified
FM4CR03 FM4CR03B Level 3 Carboxylate-modified
FM4CR04 FM4CR04B Level 4 Carboxylate-modified
FM4CR05 FM4CR05B Level 5 Carboxylate-modified
FM4CR06 FM4CR06B Level 6 Carboxylate-modified
FM4CR07 FM4CR07B Level 7 Carboxylate-modified
FM4CR08 FM4CR08B Level 8 Carboxylate-modified
FM4CR09 FM4CR09B Level 9 Carboxylate-modified
FM4CR10 FM4CR10B Level 10 Carboxylate-modified
FM4CR11 FM4CR11B Level 11 Carboxylate-modified
FM4CR12 FM4CR12B Level 12 (high) Carboxylate-modified
Thermo Scientific Cyto-Plex Carboxylated Particles
Product SpecificationsParticle Composition: Polystyrene particles containing encapsulated dyes
Dyes Firefli Fluorescent Red
Concentration 0.5% solids
Particle Density: 1.05 g/cm3
Additives: 0.05% tween-20 dispersant / Surfactant with 2mM Soidum Azide Preservative
Packaged in: 15 mL
4 μm mean diameter
C.V. < 2%
Concentration approximately1.4 x 108 particles/mL
Catalog Number IntensityLevel
Surface Functionality
Aqueous Suspensions, Calibrated by Optical Microscopy
1 mL 5 mL
FM5CR01 FM5CR01B Level 1 (low) Carboxylate-modified
FM5CR02 FM5CR02B Level 2 Carboxylate-modified
FM5CR03 FM5CR03B Level 3 Carboxylate-modified
FM5CR04 FM5CR04B Level 4 Carboxylate-modified
FM5CR05 FM5CR05B Level 5 Carboxylate-modified
FM5CR06 FM5CR06B Level 6 Carboxylate-modified
FM5CR07 FM5CR07B Level 7 Carboxylate-modified
FM5CR08 FM5CR08B Level 8 Carboxylate-modified
FM5CR09 FM5CR09B Level 9 Carboxylate-modified
FM5CR10 FM5CR10B Level 10 Carboxylate-modified
FM5CR11 FM5CR11B Level 11 Carboxylate-modified
FM5CR12 FM5CR12B Level 12 (high) Carboxylate-modified
5 μm mean diameter
C.V. < 2%
Concentration approximately7.3 x 107 particles/mL
3434
Differences in beads for fl ow cytometry QC and quantitation
Particle or bead standards are used in a variety of applications in fl ow cytometry and their selection for specifi c applica-tions based on physical characteristics has been discussed in the literature.
Instrument Quality Control
Instrument quality control, which includes verifi cation of the sensitivity and perfor-mance of the fl uorescence detectors and PMTs, should be monitored frequently to ensure instrument consistency over time and to detect changes in performance that may compromise data. The idealproduct for this application would feature dyes that are thermally and photolyticallystable for at least one year.
Thermo Scientifi c Cyto-Cal Multifl uorparticles are hard-dyed polymer beads that utilize the Thermo Scientifi c Firefl iprocess to incorporate the dye throughoutthe polymer matrix. These beads arestable for at least two years. The com-bination of a stable dye in a hard-dyed bead creates an ideal reference particlefor those seeking long-term, inter/intralab instrument performance monitoring.These beads will test and defi ne the con-dition of the optics and fl ow stream andensure the ability of the instrument to re-solve different cell populations. The dyes in Cyto-Cal Multifl uor beads have similar optical properties, but are not spectrallyequivalent, to the common dyes used in fl ow cytometry. Therefore, Cyto-Cal beadsshould not be used to obtain absolute
35
quantitation of fl uorophores on cells.
Quantitation of Fluorescent Labeled Cells
Fluorescence quantitation is used to determine the amount of fl uorphorebound per cell and ultimately the amount of antibody bound per cell. This requiresspectrally equivalent particle standardsthat feature distinct populations of beads with the same dyes that are used to labelthe cells. These Surface-dyed particles simulate dye attachment to the cell mem-brane. Users are then able to estimate the number of dye molecules boundper cell by comparing against a bead ofknown Molecules of Equivalent SolubleFluorochrome (MESF) or Mean EquivalentFluorochrome (MEFL) to describe the intensity level.
For years, bead calibration standardshave been recommended and used toperform both fl uorophore quantitation andto “calibrate” the response of the instru-ment (confi rm linearity/quality control).Surface-dyed beads have often been usedfor both applications, however, users need to keep in mind that all surface-dyedbeads are thermally and photolyticallyunstable and require refrigeration. Theyalso suffer from a short shelf life. Bothinstrument manufacturers and bead ven-dors have perpetuated this single-beadconcept. And while it may seem moreconvenient and economical from a user’sstandpoint, the use of stable calibratorsfor instrument QC will provide better
results and will be more economical.
We recommend the use of surface-dyed beads for fl uorophore quantitation (featur-ing the common fl ow cytometry dyes)and hard-dyed beads, such as ThermoScientifi c Cyto-Cal Multifl uor particles,for instrument quality control. See pages 30- 32 for product information.
For more technical notes, visit our Web site at www.thermo.com/parti-cletechnology.
Technical Supplement
Thermo Scientifi c Dyed and Fluorescent Particles
Dyed Particles Color-Rich Dyed Sulfate Particles
Color-Rich Dyed Carboxylate -modifi ed Particles
Color-Rich Dyed Sulfate, Carboxyl, Aldehyde-modifi ed and Carboxylate-modifi ed Particles
ChromoSphere Dyed Particles
Fluorescent Particles Fluoro-Max Fluorescent Sulfate Particles
Fluoro-Max Fluorescent Carboxylate-modifed
Fluoro-Max Fluorescent Streptavidin-coated
Fluoro-Max Green and Red Fluorescent Particles with Different Surface Coatings
37
Thermo Scientifi c Color-Rich Dyed and Fluoro-Max Fluorescent Particles
Higher intensity dyed particles provide
superior test sensitivity in qualitative and
quantitative lateral fl ow tests.
These dyed and fl uorescent particles are inter-
nally dyed using the Thermo Scientifi c Color-
Rich internal dyeing method or by utilizing the
propreitary Firefl i dyeing process. Color-Rich
dyeing methods provide exceptional color
saturation, prevent dye leaching in aqueous
media, and leave the surface free for covalent
coupling and optimal immunological reactivity.
Color-Rich Dyed and Fluoro-Max fl uorescent
particles have been specifi cally designed for
diagnostic lateral-fl ow rapid assay (membrane-
based) applications. However, these particles
can also be used in other applications such
as clinical diagnostics, immuno/histological
studies and molecular biology.
The 0.4 μm nominal diameter is the opti-
mal size for most latex-based lateral fl ow
tests. The coeffi cient of variation (CV) of the
diameter is less than 5% ensuring uniform
migration through membranes.
Available colored dyes Available fl uorescent dyes
Colored and fl uorescent activated surfaces for lateral fl ow diagnostics.
Catalog Number Color Parking AreaA2 / group
SolidsContent
Surface Modification
15 mL 100 mLDB1040PA DB1040PB Blue N/A 4% Sulfate
DR1040PA DR1040PB Red N/A 4% Sulfate
DBK1040PA DBK1040PB Black N/A 4% Sulfate
DB1040HA DB1040HB Blue 107 4% Carboxyl
DR1040HA DR1040HB Red 109 4% Carboxyl
DBK1040HA DBK1040HB Black 106 4% Carboxyl
DB1040LA DB1040LB Blue 99 4% Aldehyde-modifi ed
DR1040LA DR1040LB Red 79 4% Aldehyde-modifi ed
DBK1040LA DBK1040LB Black 129 4% Aldehyde-modifi ed
DB1040CA DB1040CB Blue 56 4% Carboxylate-modifi ed
DR1040CA DR1040CB Red 44 4% Carboxylate-modifi ed
DBK1040CA DBK1040CB Black 55 4% Carboxylate-modifi ed
Product SpecificationsParticle Composition: Polystyrene or Polystyrene with Copolymer Grafted Surface
Surface Functionalities Sulfate, Carboxyl, Aldehyde-modified, Carboxylate-modified
Dyes Colored (Blue, Red, Black)
Size 0.4 μm nominal diameter
Uniformity < 5% CV
Concentration Colored 4% solids by weight
Particle Density: 1.05 g/cm3
Additives: None
Thermo Scientifi c Color-Rich Dyed Various Surface Coatings
38
Maximum Color and BrillianceImmunologically Reactive Surfaces
Thermo Scientifi c Color-Rich Dyed Carboxylate-modifi ed and Sulfate Particles
Color-Rich Benefi ts
• Bind ligands without dye interference
• Dye-free surface for coupling
• High protein binding capacity
• Hydrophobic—readily adsorbs proteins
• Optimize assays by controlling sensitivity,
specifi city and stability
• Optimized acid content
• Fast coupling and processing reactions
• Easy one-step covalent coupling protocols
• Optimized two-step coupling protocols
• Assure reproducibility with our own
manufactured particles
• GMP manufacturing in our ISO certifi ed
facilities
ParticleDiameter
BottleSize Color Cat. Number
0.3 μm 15 mL Blue 8310-0750-020250
0.3 μm 100 mL Blue 8310-0750-020350
0.3 μm 1000 mL Blue 8310-0750-020450
0.3 μm 15 mL Blue 8310-0720-020250
0.3 μm 100 mL Blue 8310-0720-020350
0.3 μm 1000 mL Blue 8310-0720-020450
0.85 μm 15 mL Blue 9310-1870-020250
0.85 μm 100 mL Blue 9310-1870-020350
0.85 μm 1000 mL Blue 9310-1870-020450
0.3 μm 15 mL Red 8320-0720-020250
0.3 μm 100 mL Red 8320-0720-020350
0.3 μm 1000 mL Red 8320-0720-020450
Color-Rich Dyed Sulfate Available in: 15 mL, 100 mL, 1000 mL, 2.5% solids concentration
25 mg/mL
Color-Rich Dyed Carboxylate-Modified Available in: 15 mL, 100 mL, 1000 mL, 2.5% solids concentration
25 mg/mL
ParticleDiameter
BottleSize Color Cat. Number
0.3 μm 15 mL Blue 8110-0797-020250
0.3 μm 100 mL Blue 8110-0797-020350
0.3 μm 1000 mL Blue 8110-0797-020450
0.85 μm 15 mL Blue 8110-1897-020250
0.85 μm 100 mL Blue 8110-1897-020350
0.85 μm 1000 mL Blue 8110-1897-020450
39
To order Thermo Scientifi c Color-Rich
products,call our Indianapolis, IN offi ce at
1-866-737-2396 or at 1-317-610-3800.
Thermo Scientifi c ChromoSphere Dyed Particles for Specialized Applications
CatalogNumber
NominalDiameter
Color MeanDiameter
ApproximateCount per
Gram
Dry Dyed Particles, Calibrated by Optical Microscopy
RD050 50 μm Red 49 μm 1.6 x 107
BK050 50 μm Black 49 μm 1.5 x 107
RD100 100 μm Red 93 μm 2.2 x 106
BK100 100 μm Black 95 μm 2.1 x 106
RD150 150 μm Red 149 μm 5.5 x 105
BK150 150 μm Black 148 μm 5.6 x 105
RD200 200 μm Red 202 μm 2.2 x 105
BK200 200 μm Black 200 μm 2.3 x 105
RD300 300 μm Red 301 μm 6.6 x 104
BK300 300 μm Black 301 μm 6.6 x 104
RD400 400 μm Red 402 μm 2.8 x 104
BK400 400 μm Black 402 μm 2.8 x 104
RD500 500 μm Red 500 μm 1.4 x 104
BK500 500 μm Black 502 μm 1.4 x 104
Product SpecificationsParticle Composition: Polystyrene Divinylbenzene
(PS-DVB)
Particle Density: 1.06 g/cm3
Additives: None
Packaged in: 1 g, dry
ChromoSphere polymer particles are internally dyed
with deeply colored red or black dyes. The intense
colors result in very high contrast and visibility
relative to most background materials. They are
available as dry powders and can be easily be
suspended in aqueous media if desired.
The product line consists of a large assortment
of uniform particle sizes between 50 and 500
microns in either red or black color. The particles
are made from cross-linked polystyrene divinyl-
benzene (PS-DVB) copolymer and should be stored
at room temperature. They can be dispersed in
aqueous media with the aid of a small amount of
surfactant or in lower alcohols, such as methanol or
ethanol. Some dye extraction will result when the
particles are suspended in pure alcohols, but will
be minimal. Other organic solvents, such as ethers
or chlorinated hydrocarbons, should be avoided be-
cause they will swell the particles and completely
extract the dye.
40
Catalog Number Dye SolidsContent
Surface ModificationTrial Kit Fill Volume
DB1040K 4 x 5 mL Blue 4% Four surface coatings of blue particles
DR1040K 4 x 5 mL Red 4% Four surface coatings of red particles
DBK1040K 4 x 5 mL Black 4% Four surface coatings of black particles
Product SpecificationsParticle Composition: Polystyrene or Polystyrene with Copolymer Grafted Surface
Surface Functionalities Sulfate, Carboxyl, Aldehyde-modified, Carboxylate-modified
Dyes Colored (Blue, Red, Black)
Size 0.4 μm nominal diameter
Uniformity < 5% CV
Concentration Colored 4% solids by weight
Particle Density: 1.05 g/cm3
Additives: None
Thermo Scientifi c Sample Packs For Color-Rich Dyed Sulfate, Carboxyl, Carboxylate-modifi ed and Aldehyde Particles
Sulfate (hydrophobic) Particles.
Also called plain sulfate particles, the
particles are stabilized by sulfate groups.
The sulfate groups are not reactive and
therefore protein attachment is carried out by
hydrophobic adsorption methods. The particles
are available in a wide range of sizes. Many
applications are possible, including develop-
ment of rapid diagnostic tests.
Carboxylate-modifi ed (CML) Particles.
These products are prepared using a copoly-
merization process that results in negatively
charged polymer particles with a reactive
carboxylated surface. Typically, the carboxyl
group density ranges from about 10 to 125 Å2
per carboxyl group. The particles are relatively
hydrophilic and the carboxyl groups can be
activated using water soluble carbodimide
reagents and reacted with amines to form
stable covalent amide bonds. This method of
conjugation is widely used to attach antibod-
ies to the particles for use in diagnostic tests.
41
Carboxyl (hydrophobic) Particles.
These products consist of uniform surfactant-
free sulfate particles with surface carboxyl
groups for charge stabilization. The particles
are hydrophobic with carboxyl groups that are
close to the surface of the particle. Although
covalent coupling of substances to the particle
surface is possible, these particles are typi-
cally used to physically adsorb proteins.
Aldehyde-modifi ed Particles.
The aldehyde modifi ed particles are designed
for coupling of molecules containing amine
groups under very mild conditions (neutral pH)
in a one-step process. The particles contain
surface aldehyde groups with a density range
of approximately 100 to 230 Å2 per aldehyde
group. The net surface charge is negative.
These particles can be used for many of the
same applications as the carboxylate-modifi ed
products, and provide an alternate method for
attaching proteins to the particle surface.
Descriptions of the surface modifi cations
To order Thermo Scientifi c Chromosphere particles or these sample packs,call our Fremont, CA
offi ce at 1-800-232-3342 or at 1-510-979-5000.
The Fluoro-Max Fluorescent particles are
made by dyeing Opti-Link CM particles
with europium chelate and are available
in standard 0.1 μm, 0.2 μm, and 0.3 μm
diameters. They are dyed internally to prevent
dye leaching and to assure maximum surface
immunoreactivity. These particles have been
specifi cally designed for membrane or auto-
mated fl uorometric-based applications.
Excitation Emission
333 nm 613 nm
With an extremely broad Stokes shift,
Fluoro-Max europium chelate particles help
prevent nonspecifi c fl uorescence interference.
Fluoro-Max particles may be used in a variety
of applications such as clinical diagnostics,
immuno/histological studies and reserach ap-
plications. Fluoro-Max particles are available
in both carboxylate-modifi ed and streptavidin
coated.
Thermo Scientifi c Fluoro-Max Fluorescent Carboxylate-modified and Streptavidin-coated Europium Chelate Particles
Fluoro-Max Fluorescent Benefi ts
• Bind ligands without dye interference
• Dye-free surface for coupling
• High protein binding capacity
• Readily adsorbs proteins
• Optimize assays by controlling sensitivity,
specifi city and stability
• Optimized acid content
Excellent for:
Quantitative membrane-based rapid assays
Heterogeneous assays
Luminescent assays
Research applications
Phagocytosis studies
Cell surface markers
Pore size determination
ParticleDiameter
BottleSize
BindingCapacity
Type/ Parking Area/ Post Process Cat. Number
0.1 μm 1 mL HIgh Europium Chelate/PA50/0.05% Az 9347-0350-011150
0.1 μm 5 mL HIgh Europium Chelate/PA50/0.05% Az 9347-0350-010150
0.1 μm 100 mL HIgh Europium Chelate/PA50/0.05% Az 9347-0350-010350
0.2 μm 1 mL High Europium Chelate/PA20/0.05% Az 9347-0520-011150
0.2 μm 5 mL HIgh Europium Chelate/PA20/0.05% Az 9347-0520-010150
0.2 μm 100 mL HIgh Europium Chelate/PA20/0.05% Az 9347-0520-010350
0.3 μm 1 mL High Europium Chelate/PA20/0.05% Az 9347-0720-011150
0.3 μm 5 mL HIgh Europium Chelate/PA20/0.05% Az 9347-0720-010150
0.3 μm 100 mL HIgh Europium Chelate/PA20/0.05% Az 9347-0720-010350
Fluoro-Max Carboxylate-modified Packaged in 1 mL, 5 mL, 100 ml. 1% solids, 10 mg/mL
ParticleDiameter
BottleSize
BindingCapacity
Type/ Parking Area/ Post Process Cat. Number
0.3 μm 1 mL Low Europium Chelate Strep/0.05% Az 2947-0701-011150
0.3 μm 5 mL Low Europium Chelate Strep/0.05% Az 2947-0701-010150
0.3 μm 100 mL Low Europium Chelate Strep/0.05% Az 2947-0701-010350
42
Fluoro-Max Streptavidin-coated Packaged in 1 mL, 5 mL, 100 ml. 1% solids, 10 mg/mL
Thermo Scientifi c Fluoro-Max Fluorescent Green and Red Particles with Various Surface Coatings
Higher intensity dyed particles provide superior
test sensitivity in qualitative and quantitative
lateral fl ow tests.
The particles are designed for researchers who
are developing lateral fl ow diagnostic tests,
and for other investigations in diagnostics and
biotechnology, where labeling and detection of
very low concentrations is required.
The 0.4 μm nominal diameter is an excel-
lent size for most latex-based lateral fl ow
tests. The coeffi cient of variation (CV) of the
diameter is less than 5% ensuring uniform
migration through membranes.
Product SpecificationsParticle Composition: Polystyrene or Polystyrene with Copolymer Grafted Surface
Surface Functionalities Sulfate, Carboxyl, Aldehyde-modified, Carboxylate-modified
Dyes Firefli FluorescentGreen UV (360/530 nm), Green Vis (470/510 nm)Red (570/600 nm), Dark Red (640/660 nm)
Size 0.4 μm nominal diameter
Uniformity < 5% CV
Concentration Fluorescent 2% solids by weight
Particle Density: 1.05 g/cm3
Additives: None
Catalog Number Color Parking AreaA2 / group
SolidsContent
Surface Modification
15 mL 100 mL
FG1040PA FG1040PB Green(360ex/530em) N/A 2% Sulfate
FG2040PA GF2040PB Green(470ex/510em) N/A 2% Sulfate
FR2040PA FR2040PB Red(570ex/600em) N/A 2% Sulfate
FR3040PA FR3040PB Red(640ex/660em) N/A 2% Sulfate
FG1040HA FG1040HB Green(360ex/530em) 99 2% Carboxyl
FG2040HA GF2040HB Green(470ex/510em) 132 2% Carboxyl
FR2040HA FR2040HB Red(570ex/600em) 99 2% Carboxyl
FR3040HA FR3040HB Red(640ex/660em) 99 2% Carboxyl
FG1040LA FG1040LB Green(360ex/530em) 110 2% Aldehyde-modifi ed
FG2040LA GF2040LB Green(470ex/510em) 110 2% Aldehyde-modifi ed
FR2040LA FR2040LB Red(570ex/600em) 110 2% Aldehyde-modifi ed
FR3040LA FR3040LB Red(640ex/660em) 110 2% Aldehyde-modifi ed
FG1040CA FG1040CB Green(360ex/530em) 44 2% Carboxylate-modifi ed
FG2040CA GF2040CB Green(470ex/510em) 56 2% Carboxylate-modifi ed
FR2040CA FR2040CB Red(570ex/600em) 44 2% Carboxylate-modifi ed
FR3040CA FR3040CB Red(640ex/660em) 44 2% Carboxylate-modifi ed
43
Thermo Scientifi c Fluoro-Max Fluorescent Application Specifi c Products
CatalogNumber
Diameter Quantity
Aqueous Suspensions, Calibrated by Optical Microscopy
34-1 1 - 10 μm 1 gram
34-1B 1 - 10 μm 5 grams
For marking the risk zone in heart tissue for myocardial infarction studies.
Product SpecificationsParticle Composition: Polystyrene Divinylbenzene (PS-DVB)
Dyes Friefli Fluorescent Green UV (360/530 nm)
Particle Density: 1.05 g/cm3
Additives: Contains trace amount of dispersant
Packaged in 1 and 5 g bottles
Various dyes and particulate markers have
been used to mark the “risk zone” in evaluat-
ing regional ischemia. Markers that have
been used include Evans Blue, India Ink and
Fluorescein; however, these dyes tend to
rapidly migrate throughout the tissue making
the risk zone diffi cult to identify. Fluorescent
particulate markers are effective because
they lodge in the capillaries and can be easily
visualized under illumination.
The fl uorescent marker beads are made of
polymer containing a special fl uorescent dye
that excites effi ciently with a hand held UV
lamp (Wood’s Lamp). The fl uorescence is a
brilliant yellow-green color. The particles are
spherical, 1-10 micrometers in diameter, and
have a density of 1.05 g/cm3. This makes
them easy to suspend in an aqueous medium.
The particles are heavily loaded with dye,
resulting in a very strong fl uorescence that
can easily be seen visually. They are invisible
under white light, allowing the non-risk tissue
to be examined for infarction. Since the dye
is embedded in the interior of the particles,
it does not leach out or cause indiscriminate
staining.
Spectral information is approximate and for reference only. The spectral properties of the dye is independedt on their concentration and physical environment. the exact excitation and emission maxima may vary, depending on the size and composition of the particles.
44
For contamination control and fl ow tracing
Thermo Scientifi c Fluoro-Max Fluorescent Dyed Green, Red, and Blue Aqueous Particles
Fluorescent particles emit bright and distinct colors
when illuminated by light of shorter wavelengths
than the emission wavelength. This improves
their contrast and visibility relative to background
materials. In addition to the features of conven-
tional microscopes, the fl uorescent products offer
improved sensitivity and detectability for analytical
methods.
Fluorescent particles are hard-dyed (internally-dyed)
polymer beads which utilize the Firefl i process to
incorporate the dye throughout the polymer matrix.
This method produces bright fl uorescent colors,
minimizes photobleaching and prevents dye leach-
ing into aqueous media. The particles are made of
polystyrene (PS), which has a density of 1.05 g/cm3
and a refractive index of 1.59 @ 589nm (25°C). The
aqueous suspensions are packaged as 1% solids.
These particles can be detected with an epi-
fl uorescence microscope, confocal microscope,
fl uorometer, fl uorescence spectrophotometer, or
fl uorescence activated cell sorter. In addition, all of
these fl uorescent particles can be detected using a
mineral light or black light (UV).
Spectral information is approximate and for
reference only. The spectral properties of the dyes
are dependent on their concentration and physical
environment. The exact excitation and emission
maxima may vary, depending on the size and
composition of the particles.
To order Fluoro-Max products, call our
Indianapolis, IN offi ce at 1-866-737-2396 or at
1-317-610-3800.
Product SpecificationsParticle Composition: Polystyrene
Dyes Firefl i Fluorescent Green (468/508nm)Red (542/612nm)Blue (365, 388, 412 / 445, 445, 473
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
CatalogNumber
NominalDiameter
Measured Mean Diameter
SizeUniformity
FluorescentColor
FillVol-ume
Aqueous Suspensions, Calibrated by Optical Microscopy
G25 0.03 μm 0.025 μm < 20% Green 15 mL
G25B 0.03 μm 0.025 μm < 20% Green 90 mL
G40 0.04 μm 0.038 μm < 15% Green 15 mL
G40B 0.04 μm 0.038 μm < 15% Green 90 mL
G50 0.05 μm 0.051 μm < 15% Green 15 mL
G50B 0.05 μm 0.051 μm < 15% Green 90 mL
G75 0.07 μm 0.075 μm < 10% Green 15 mL
G75B 0.07 μm 0.075 μm < 10% Green 90 mL
G85 0.09 μm 0.088 μm < 10% Green 15 mL
G85B 0.09 μm 0.088 μm < 10% Green 90 mL
G100 0.10 μm 0.10 μm < 10% Green 15 mL
G100B 0.10 μm 0.10 μm < 10% Green 90 mL
G140 0.14 μm 0.14 μm < 10% Green 15 mL
G140B 0.14 μm 0.14 μm < 10% Green 90 mL
G200 0.20 μm 0.20 μm < 10% Green 15 mL
G200B 0.20 μm 0.20 μm < 10% Green 90 mL
45
CatalogNumber
NominalDiameter
Measured Mean Diameter
SizeUniformity
FluorescentColor
FillVolume
Aqueous Suspensions, Calibrated by Optical Microscopy
G250 0.25 μm 0.25 μm < 5% Green 15 mL
G250B 0.25 μm 0.25 μm < 5% Green 90 mL
G300 0.30 μm 0.29 μm < 5% Green 15 mL
G300B 0.30 μm 0.29 μm < 5% Green 90 mL
G400 0.40 μm 0.39 μm < 5% Green 15 mL
G400B 0.40 μm 0.39 μm < 5% Green 90 mL
G450 0.45 μm 0.43 μm < 5% Green 15 mL
G450B 0.45 μm 0.43 μm < 5% Green 90 mL
G500 0.50 μm 0.50 μm < 5% Green 15 mL
G500B 0.50 μm 0.50 μm < 5% Green 90 mL
G600 0.60 μm 0.59 μm < 5% Green 15 mL
G600B 0.60 μm 0.59 μm < 5% Green 90 mL
G700 0.70 μm 0.72 μm < 3% Green 15 mL
G700B 0.70 μm 0.72 μm < 3% Green 90 mL
G830 0.83 μm 0.83 μm < 3% Green 15 mL
G830B 0.83 μm 0.83 μm < 3% Green 90 mL
G900 0.90 μm 0.92 μm < 3% Green 15 mL
G900B 0.90 μm 0.92 μm < 3% Green 90 mL
G0100 1 μm 1.0 μm < 5% Green 10 mL
G0100B 1 μm 1.0 μm < 5% Green 60 mL
G0200 2 μm 1.9 μm < 5% Green 10 mL
G0200B 2 μm 1.9 μm < 5% Green 60 mL
G0220 2 μm 2.2 μm < 5% Green 10 mL
G0220B 2 μm 2.2 μm < 5% Green 60 mL
G0300 3 μm 3.1 μm < 5% Green 10 mL
G0300B 3 μm 3.1 μm < 5% Green 60 mL
G0500 5 μm 4.8 μm < 5% Green 10 mL
G0500B 5 μm 4.8 μm < 5% Green 60 mL
G1000 10 μm 9.9 μm < 5% Green 10 mL
G1000B 10 μm 9.9 μm < 5% Green 60 mL
R25 0.03 μm 0.022 μm < 20% Red 15 mL
R25B 0.03 μm 0.022 μm < 20% Red 90 mL
R50 0.05 μm 0.048 μm < 15% Red 15 mL
R50B 0.05 μm 0.048 μm < 15% Red 90 mL
R60 0.06 μm 0.063 μm < 10% Red 15 mL
R60B 0.06 μm 0.063 μm < 10% Red 90 mL
R100 0.10 μm 0.10 μm < 10% Red 15 mL
R100B 0.10 μm 0.10 μm < 10% Red 90 mL
R160 0.16 μm 0.16 μm < 10% Red 15 mL
R160B 0.16 μm 0.16 μm < 10% Red 90 mL
R200 0.20 μm 0.21 μm < 5% Red 15 mL
R200B 0.20 μm 0.21 μm < 5% Red 90 mL
R300 0.30 μm 0.30 μm < 5% Red 15 mL
R300B 0.30 μm 0.30 μm < 5% Red 90 mL
R400 0.40 μm 0.40 μm < 5% Red 15 mL
R400B 0.40 μm 0.40 μm < 5% Red 90 mL
R500 0.50 μm 0.52 μm < 3% Red 15 mL
R500B 0.50 μm 0.52 μm < 3% Red 90 mL
R600 0.60 μm 0.60 μm < 3% Red 15 mL
R600B 0.60 μm 0.60 μm < 3% Red 90 mL
46
CatalogNumber
NominalDiameter
Measured Mean Diameter
SizeUniformity
FluorescentColor
FillVolume
Aqueous Suspensions, Calibrated by Optical Microscopy
R700 0.70 μm 0.71 μm < 3% Red 15 mL
R700B 0.70 μm 0.71 μm < 3% Red 90 mL
R800 0.80 μm 0.79 μm < 3% Red 15 mL
R800B 0.80 μm 0.79 μm < 3% Red 90 mL
R900 0.90 μm 0.86 μm < 3% Red 15 mL
R900B 0.90 μm 0.86 μm < 3% Red 90 mL
R0100 1 μm 1.0 μm < 5% Red 10 mL
R0100B 1 μm 1.0 μm < 5% Red 60 mL
R0200 2 μm 2.0 μm < 5% Red 10 mL
R0200B 2 μm 2.0 μm < 5% Red 60 mL
R0300 3 μm 3.0 μm < 5% Red 10 mL
R0300B 3 μm 3.0 μm < 5% Red 60 mL
B50 0.05 μm 0.049 μm < 15% Blue 15 mL
B50B 0.05 μm 0.049 μm < 15% Blue 90 mL
B100 0.10 μm 0.10 μm < 10% Blue 15 mL
B100B 0.10 μm 0.10 μm < 10% Blue 90 mL
B150 0.15 μm 0.15 μm < 10% Blue 15 mL
B150B 0.15 μm 0.15 μm < 10% Blue 90 mL
B200 0.20 μm 0.20 μm < 5% Blue 15 mL
B200B 0.20 μm 0.20 μm < 5% Blue 90 mL
B300 0.30 μm 0.31 μm < 5% Blue 15 mL
B300B 0.30 μm 0.31 μm < 5% Blue 90 mL
B400 0.40 μm 0.41 μm < 5% Blue 15 mL
B400B 0.40 μm 0.41 μm < 5% Blue 90 mL
B500 0.50 μm 0.48 μm < 3% Blue 15 mL
B500B 0.50 μm 0.48 μm < 3% Blue 90 mL
B520 0.52 μm 0.52 μm < 3% Blue 15 mL
B520B 0.52 μm 0.52 μm < 3% Blue 90 mL
B600 0.60 μm 0.62 μm < 3% Blue 15 mL
B600B 0.60 μm 0.62 μm < 3% Blue 90 mL
B700 0.70 μm 0.70 μm < 3% Blue 15 mL
B700B 0.70 μm 0.70 μm < 3% Blue 90 mL
B800 0.80 μm 0.80 μm < 3% Blue 15 mL
B800B 0.80 μm 0.80 μm < 3% Blue 90 mL
B900 0.90 μm 0.91 μm < 3% Blue 15 mL
B900B 0.90 μm 0.91 μm < 3% Blue 90 mL
B0100 1 μm 1.0 μm < 5% Blue 10 mL
B0100B 1 μm 1.0 μm < 5% Blue 60 mL
B0200 2 μm 2.0 μm < 5% Blue 10 mL
B0200B 2 μm 2.0 μm < 5% Blue 60 mL
47
Improved sensibility and detectibility for analytical methods
Thermo Scientifi c Fluoro-Max Fluorescent Dyed Green and Red Dry Particles
Fluorescent particles emit bright and distinct colors
when illuminated by light of shorter wavelengths
than the emission wavelength. This improves
their contrast and visibility relative to background
materials. In addition to the features of conven-
tional microscopes, the fl uorescent products offer
improved sensitivity and detectability for analytical
methods.
Fluorescent particles are internally dyed polymer
beads which utilize the Firefl i™ process to
incorporate the dye throughout the polymer matrix.
This method produces bright fl uorescent colors,
minimizes photobleaching and prevents dye leach-
ing into aqueous media. The particles are made of
polystyrene divinylbenzene (PS-DVB), which has a
density of 1.05 g/cm3 and a refractive index of 1.59
@ 589nm (25°C).
These particles can be detected with an epi-
fl uorescence microscope, confocal microscope,
fl uorometer, fl uorescence spectrophotometer, or
fl uorescence activated cell sorter. In addition, all of
these fl uorescent particles can be detected using a
mineral light or black light (UV).
Spectral information is approximate and for
reference only. The spectral properties of the dyes
are dependent on their concentration and physical
environment. The exact excitation and emission
maxima may vary, depending on the size and
composition of the particles.
Product SpecificationsParticle Composition: Polystyrene
Dyes Firefl i Fluorescent Green (468/508nm)Red (542/612nm)
Particle Density: 1.05 g/cm3
Index of Refraction: 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
CatalogNumber
NominalDiameter
Measured Mean Diameter
SizeUniformity
FluorescentColor
Quantity
Aqueous Suspensions, Calibrated by Optical Microscopy
35-2 5 μm 7 μm < 18% Green 1 g
35-2B 5 μm 7 μm < 18% Green 5 g
35-3 10 μm 8 μm < 18% Green 1 g
35-3B 10 μm 8 μm < 18% Green 5 g
35-4 15 μm 16 μm < 12% Green 1 g
35-4B 15 μm 16 μm < 12% Green 5 g
35-5 25 μm 24 μm < 12% Green 1 g
35-5B 25 μm 24 μm < 12% Green 5 g
35-6 30 μm 32 μm < 13% Green 1 g
35-6B 30 μm 32 μm < 13% Green 5 g
35-7 40 μm 39 μm < 9% Green 1 g
35-7B 40 μm 39 μm < 9% Green 5 g
35-8 50 μm 51 μm < 12% Green 1 g
35-8B 50 μm 51 μm < 12% Green 5 g
35-9 70 μm 68 μm < 7% Green 1 g
35-9B 70 μm 68 μm < 7% Green 5 g
35-10 80 μm 80 μm < 6% Green 1 g
35-10B 80 μm 80 μm < 6% Green 5 g
35-11 100 μm 90 μm < 7% Green 1 g
35-11B 100 μm 90 μm < 7% Green 5 g
35-12 120 μm 116 μm < 6% Green 1 g
35-12B 120 μm 116 μm < 6% Green 5 g
48
Cat. NoPackage
Size Application Sample Pack Includes:
FG1040K
FG2040K
FR2040K
FR3040K
4 x 5 mL
4 x 5 mL
4 x 5 mL
4 x 5 mL
Lateral Flow/ Diagnostics
Four surface coatings of green fl uorescent,UV excitation
Four surface coatings of green fl uorescent,visible excitation
Four surface coatings of red fl uorescent
Four surface coatings of dark red fl uorescent
Cat. NoPackage
Size Application Sample Pack Includes:
S9347 3 x 1 mL Lateral Flow/Aglutination
9347-032001-1150 (0.1 μm)
9347-052001-1150 (0.2 μm)
9347-072001-1150 (0.3 μm)
Fluoro-Max Green and Red Fluorescent Particles with Different Surface Coatings
Flouro-Max Fluorescent Carboxylate-modifi ed Europium Chelate
Thermo Scientifi c Fluoro-Max Sample Packs
CatalogNumber
NominalDiameter
Measured Mean Diameter
SizeUniformity
FluorescentColor
Quantity
35-13 140 μm 143 μm < 6% Green 1 g
35-13B 140 μm 143 μm < 6% Green 5 g
35-14 160 μm 157 μm < 5% Green 1 g
35-14B 160 μm 157 μm < 5% Green 5 g
36-2 5 μm 7 μm < 18% Red 1 g
36-2B 5 μm 7 μm < 18% Red 5 g
36-3 10 μm 8 μm < 18% Red 1 g
36-3B 10 μm 8 μm < 18% Red 5 g
36-4 15 μm 15 μm < 14% Red 1 g
36-4B 15 μm 15 μm < 14% Red 5 g
36-5 25 μm 24 μm < 12% Red 1 g
36-5B 25 μm 24 μm < 12% Red 5 g
36-6 30 μm 31 μm < 11% Red 1 g
36-6B 30 μm 31 μm < 11% Red 5 g
36-11 100 μm 107 μm < 7% Red 1 g
36-11B 100 μm 107 μm < 7% Red 5 g
49
Introduction
Processing particles is one of the mostcritical phases in particle technology. Guidance on use of sonication will make your life easier. We offer you a completeparticle technology and give you particlevalidated protocols for coupling proteinsand processing the particles. We take the mystery out of working with particlesby giving you concrete data, backed byyears of applications research in our ownlabs. Use our experience, read our com-munications and save yourself months of aggravation. We have benefi cial new ways to utilize our particle products and services. They have all been designed and engineered to meet the productivity re-quirements of multiple industries such asdiagnostics, genomics, and proteomics.
Sonication
Sonication provides a way to re-suspendthe particles thoroughly and effi ciently without harm to the reagents. Aftercentrifugation, processing steps, andcoupling reactions, diffi culties that arise from iparticleroper particle resuspension can be avoided by using sonication. Weroutinely sonicate our protein-coatedparticle preparations with a probe-type ultrasonicator to re-suspend pellets after centrifugation, and to reversemild aggregation induced by couplingproteins. We have not found this to be detrimental to sensitized Particles in anyway, and have even seen iparticlerove-ment in agglutination sensitivity aftersonication. It is advised to guard against teparticleerature rise during sonication in sensitive systems. Using HSA/anti-HSA as a model system, we tested whethersonication caused desorption of pro-teins or loss of functional activity. We subjected particle reagents to full power sonication. Prolonged sonication did not result in measurable loss of HSA from theparticle surface. From our experience ithas proven iparticleossible to damage our plain Sulfate (S) and magnetic beads withsonication or heat. In certain instances we take the plain PS to boiling with no illeffect. This is not true if you have ligandsbound to the surface of the particle.
Particle Sonication & Mixing
50
The particle will survive, but surfaceligands may be lost. In the process ofoptimization of the following procedure,one should consider the characteristics of one’s ligand and adjust the time andhandling to ensure ligand activity.
Materials
1. Probe sonicator: An immersibleultrasonic probe is the ideal tool for ef-fi cient resuspension of Particle pellets.Vortex mixing and bath-type sonicatorsare not effective for resuspending most pellets.
Note: proper performance of the soni-cator is ensured when one performsappropriate maintenance of the probe.
2. Appropriate sonicator probes: A keyfactor that affects optimal performance of sonication is the sonication probe.The volume to be sonicated is consid-ered when selecting the proper probe:i.e. for saparticleles with volumes of500 mL or less, or saparticleles in a 1Liter (L) narrow-mouth container we typically use a tapered micro-tip (diam-eter 1/8 inch) and use a “macro”-tipprobe (diameter 1/2 inch) for saparti-cleles greater than 500 mL that are not in a narrow mouth container.
3. Container for sonication: If the volume of material is 1 L or less, then the material may be sonicated in thebottle or transferred to a beaker. If asaparticlele is larger than 1 L and in a narrow-mouth container, it will have tobe transferred to an appropriate-size beaker before sonication. Typically, sonication is more effective in glasscontainer than plastic.
4. Optical microscope and necessary sup-plies: Capable of use at 400X magnifi -cation
Procedure
1. Handling particles before sonication:For effi ciency, the material should be thoroughly mixed before sonicationbegins. This can be done by rolling the
bottles of material using a mechanical roller or with an overhead mixer forbulk material.
2. Select sonication intensity: Forvolumes using the micro-tip probe, the intensity is set between 30% and 40%, or a setting from 3 to 4 on a scale of10. For volumes using the “macro”- tipprobe, the intensity is set to 50%, or 5 on a scale of 10.
3. Select sonication time: Material being sonicated with the micro-tip probe isexposed for the followintimes accord-ing to fl uid volume:
Up to 10 mL 15-20 seconds
10 to 50 mL 20-30 seconds
50 to 100 mL 30-45 seconds
100 to 1000 mL minimum 60-90 sec.
NOTE: When sonicating smaller sapar-ticleles the solution heats more quickly due to less volume available to disperse the heat. Material being sonicated with the “macro”tip probe is exposed for the following times according to fl uid volume:
1L 5 minutes
3L 5 to 10 minutes
Greater than 3 L Up to 20 minutes
4. Mixing particles during sonicationprocess: It may be necessary eitherto mix the larger saparticleles as theysonicate or to sonicate them using more repetitions of shorter times, if the material tends to settle out of solutionquickly. For exaparticlele, when work-ing with large particles (greater than 1micron) or if the material is excessively cluparticleed:
• If sonication of material is in a 1L bottle, in between sonication incre-ments of 10 minutes, the bottle withmaterial is rolled for fi ve minutes.
• If sonication of nonmagnetic material is performed in a beaker, a magneticstirrer is recommended to keep anyaggregates in solution during sonica-tion.
Technical Supplement
5. Observe dispersity of particles: After a set amount of sonication time, the material should be mixed thoroughlyand observed under a microscope at400X. When in focus, one should notsee cluparticles but a nice uniformfi eld. If you see aggregates, then thematerial is not monodispersed. Repeat sonication and observation until you do not see cluparticles.
Mixing
When handling particles it is best to mixthe material to ensure the material is monodispersed and uniformly distributed.Particles may be mixed according to the type of particle and volumes by the use of various equipment including overheadmixer, magnetic stirrer, vortex mixer androller mixer. An overhead mixer is typical-ly used for pooling, diluting, and handlinglarge batches. The use of a vortex mixercan be used for mixing product stored insmall containers such as 15 mL bottles,or other applications where the containeris of similar size. The roller mixer is usedto re-suspend if necessary and mix uni-formly the particles. Magnetic stirrers are used for the purpose of making a uniform mixture rather than re-suspending.
Before you Begin
• If higher than normal levels of surfactant are in the solution or ifexcessive foaming is observed in anyof the mixing techniques, reduce thespeed and time of mixing accordinglyto minimize the iparticleact on theproduct.
• When resuspending material, visuallyconfi rm if possible that re-suspensionis coparticlelete by checking the bot-tom of the container for unsuspended material.
• Magnetic material can be mixedusing all of the above methods except for the magnetic stirrers. Rolling and/or mixing times are the same forthe magnetic particles as they are for any other particle of similar size andpercent solids.
51
Particle Sonication & Mixing
Mixing by Roller
Roller Mixer
The roller mixer has a motor-drivenhorizontal cylinder adjacent to a free-turn-ing horizontal cylinder that together forma cradle on which containers of product can be placed. The placement of thefree-turning cylinder can be adjusted asnecessary to accommodate different-size containers. Use a roller mixer of suffi cientsize and speed for the container beingmixed. The roller for smaller bottles suchas 100 mL can be found in general smalllab supply catalogs.
Mixing Time
Since the speed of the mixer is con-stant, mixing time is the way to controlsuffi cient mixing. This mixing time can also vary based on the diameter of the container; smaller diameter containersrotate faster than large diameter contain-ers, therefore mixing is accomplishedmore quickly. Mixing time can also varybased on the size of the particles; largerparticles may take more time to re-sus-pend. Higher concentrations of particles also require more mixing time.
Note: Containers must be at least 50%and less than 90% full to have enough material covering the bottom of the container when rolling, yet not too full to prevent insuffi cient mixing. Extending the mixing time is acceptable, howevernothing should need to mix for longer than 72 hours.
The following guidance is for minimum mixing time according to microparticle and container size.
MINIMUM MIXING TIMES USINGTHE ROLLER MIXER
Container Size Particle Size (μm)
≤ 0.4μm > 0.4
≤1 L 10 min 40 min
>1 L 30 min 60 min
Mixing by Vortex
Vortex Mixer
A mixer used for mixing small volumes byholding the container of solution in a rub-ber holder and allowing a motor to rotate the shaft in an oscillating motion causing the solution to be mixed.
Different models of vortex mixers have different methods of being activated.Most have a continuous action and amanual pressure activated system. Either may be used as is convenient with thecontinuous mode preferred for longervortexing times and the manual modepreferred for shorter mixing times. A vor-tex mixer with adjustable speed setting ispreferred.
Mixing Speed
Using the controller on the mixer, adjustthe speed of the mixer to a speed suf-fi cient to cause good mixing (usuallyaround 80% of full speed). Going too fast makes the container diffi cult to control.
Mixing Time
Mixing usually can be completed in 30seconds, however larger particles such as 0.8 and 1.0 μm require longer mixing tore-suspend, at least one minute or longer,especially if the product has been storedfor an extended period of time.
Verifi cation of Mixing
Visually verify mixing is completed byobserving the product during mixing to ensure adequate agitation. After mixing,make sure no product remains settled on the bottom of the container. Clumps should not be observed in the suspensionunder a microscope at 400X.
Technical Supplement
52
Mixing by Overhead Mixer
Overhead Mixer
An overhead mixer consists of anelectrical or air-driven motor whosespeed can be controlled, to which an agitator blade and shaft is attached.Choose an overhead mixer of suf-fi cient capability to mix the volumerequired. The range of volumes isdependent on the proper agita-tor (use short-shafted agitator for smaller volumes).
• Ensure that the container is such that the blade will be covered withenough product to prevent splash-ing.
• Position the blade high enoughon a stand to allow clearance ofthe container but not so high as to prevent suffi cient submersion of the agitator. Best results are usually ob-tained when the agitator blade can be placed at a position in the lowerone-third of the container.
Mixing Speed
The proper mixing speed can be determined by observing the action of the solution. If there is no visible movement of the product, increase the speed of the mixer until there is visible movement. In most circum-stances, overhead stirring is used to achieve or maintain a uniformmixture; therefore mixing speed is not critical as long as it maintainssuffi cient motion. If one is remov-ing aliquots from the mixture, then care should be taken to monitor the level of product being mixed, in orderto periodically reduce the speed ofthe mixing so that product does notsplash on the side of the container as the volume changes.
Mixing Time
If mixing is for the purpose of re-suspension, then follow the Table forMinimum Mixing Times Using a RollerMixer.
Mixing by Magnetic Stirrer
Magnetic Stirrer
A mixer that consists of a variable speed motor with an attached mag-netic rotor encased in a platform.The rotor causes a magnetic stir bar placed in the solution to spin,thereby causing mixing. Select a stirrer that has suffi cient power tomove the volume of solution andhold the container on the stirrer.
NOTE: Magnetic stirrers are not usedfor the mixing of magneticparticles.
• Container: Effective mixing requiresmatching the size of the containerwith the volume of the solution andselecting a suitable stir bar that will be large enough to effectively move the solution but not so large as tocause splashing. The size of the con-tainer is determined by the size ofthe batch taking into considerationseveral factors. Too large a container may cause splashing and loss ofyield due to increased surface area.Containers should have a volumetricworking range of 20 to 80%; use a fl at bottom in order for the stir bar tospin freely.
• Select an appropriate sized magneticstir bar which will fi t the containerand thoroughly move the volume to be stirred.
Mixing Speed
Adjust the speed of the stirring to create enough movement of the suspension to adequately mix. Suffi cient movementranges from creating a “dimple” ¼ inchinto the surface to a funnel shape extend-ing approximately one-fourth of the way into the suspension. Because the purposeof the mixing is to evenly distributethe material in the suspension, it is not necessary to rapidly mix the suspension;however, slightly faster mixing may berequired for large particles. Avoid splash-
ing the material. If the volume decreases, then mixing is to decrease; slow the speed of the mixing as the volume decreases to reduce splashing.
Mixing Time
The length of time for mixing will varywith the size of the batch; the larger thebatch the longer the mixing time. How-ever, mixing should not require longer than 30 minutes unless re-suspension isthe purpose of the mixing. If mixing is forthe purpose of re-suspension, then followthe Table for Minimum Mixing Times Us-ing a Roller Mixer.
View our technical notes at www.thermo.com/particletechnology.
Particle Sonication & MixingTechnical Supplement
Thermo Scientifi c Particles for Clinical Diagnostics and Specialty Applications
Plain Particles Undyed Sulfate, Carboxyl, Carboxylate-modifi ed and Aldehyde particles
Opti-Bind and Turbi-Bind Sulfate particles
Opti-Link and Turbi-Link Carboxylate-modifi ed particles
Power-Bind Streptavidin-coated particles
5000 Series - Latex Particle Suspensions
7000 Series - Copolymer Particle Suspensions
Spherical Polymer Materials (Dry)
Non-Polymer Particles Glass Materials (Dry)
Pollens and Spores
Metal and Mineral Particles
Laser Diffraction Conrol
Cleanroom Particles HEPA-Check™ Filter Challenge Particles
SMOKE-Check™ Smoke Detector Challenge
Thermo Scientifi c Undyed Particles Sulfate, Carboxyl, Carboxylate-modifi ed and Aldehyde
These beads are available in many sizes with
a variety of surface chemistries to accommo-
date a wide range of coupling strategies.
These particles were developed with surfaces
designed for attaching biological molecules. A
variety of sizes and surface functionalities are
available providing researchers with a wide
choice of products for applications in diagnos-
Catalog Number MeanDiameter
Parking AreaA2 / group
Surface Modification
15 mL 100 mLW010PA W010PB 0.10 μm N/A Sulfate
W020PA W020PB 0.18 μm N/A Sulfate
W030PA W030PB 0.32 μm N/A Sulfate
W040PA W040PB 0.38 μm N/A Sulfate
W050PA W050PB 0.51 μm N/A Sulfate
W060PA W060PB 0.61 μm N/A Sulfate
W080PA W080PB 0.78 μm N/A Sulfate
W120PA W120PB 1.2 μm N/A Sulfate
W010HA W010HB 0.10 μm 175 Carboxyl
W020HA W020HB 0.19 μm 192 Carboxyl
W030HA W030HB 0.29 μm 148 Carboxyl
W040HA W040HB 0.39 μm 102 Carboxyl
W010LA W010LB 0.10 μm 107 Aldehyde-modifi ed
W020LA W020LB 0.19 μm 166 Aldehyde-modifi ed
W030LA W030LB 0.32 μm 227 Aldehyde-modifi ed
W040LA W040LB 0.39 μm 121 Aldehyde-modifi ed
W080LA W080LB 0.80 μm 80 Aldehyde-modifi ed
W004CA W004CB 0.04 μm 100 Carboxylate-modifi ed
W007CA W007CB 0.07 μm 85 Carboxylate-modifi ed
W010CA W010CB 0.10 μm 276 Carboxylate-modifi ed
W020CA W020CB 0.20 μm 45 Carboxylate-modifi ed
W025CA W025CB 0.25 μm 56 Carboxylate-modifi ed
W030CA W030CB 0.32 μm 64 Carboxylate-modifi ed
W040CA W040CB 0.39 μm 46 Carboxylate-modifi ed
W050CA W050CB 0.51 μm 39 Carboxylate-modifi ed
W080CA W080CB 0.78 μm 51 Carboxylate-modifi ed
W090CA W090CB 0.95 μm 8 Carboxylate-modifi ed
W400CA W400CB 3.6 μm 7 Carboxylate-modifi ed
W500CA W500CB 4.6 μm 5.3 Carboxylate-modifi ed
Product SpecificationsParticle Composition: Polystyrene or Polystyrene with Copolymer Grafted Surface
Surface Functionalities Sulfate, Carboxyl, Aldehyde-modified, Carboxylate-modified
Uniformity < 15% CV
Concentration 4% solids by weight
Particle Density: 1.05 g/cm3
Additives: None
tics, genomics, cell labeling/sorting, and other
functions. Most of the particles are prepared
without surfactants and have surfaces
optimized for either hydrophobic adsorption or
covalent attachment of biological molecules.
To order Thermo Scientifi c undyed particle
products, call our Fremont, CA offi ce at
1-800-232-3342 or at 1-510-979-5000.
54
Thermo Scientifi c Opti-Link and Turbi-LinkCarboxylate-modifi ed Particles
Opti-Link Carboxylate-modifi ed (CM) particles
contain carboxylic acid groups for covalent
coupling and can be used in a variety of ap-
plications. The multiple acid contents within
the Opti-Link product line allow you to control
important parameters such as sensitivity,
specifi city and stability. For most applications,
Opti-Link particles can be used direct from
the bottle without any pre-cleaning. Our pro-
prietary anionic surfactant does not interfere
with the binding of proteins nor cause proteins
to desorb from microparticle surfaces. Various
surface acid concentrations are available
to help optimize your reagent development
efforts.
In addition, we have created a series of
specially treated 0.1 to 0.3 μm carboxylate-
modifi ed particles, designed exclusively for
turbidimetric immunoassay applications.
These new Turbi-Link particles have been
treated to enhance turbidimetric assay
performance.
Thermo Scientifi c Opti-Bind and Turbi-Bind Sulfate Particles
Opti-Bind sulfate particles can be used direct
from the bottle, without any pre-cleaning, for
most applications. Our production does not
utilize common surfactants (like SDS, Tween
20, Triton X-100) that can interfere with
protein binding to particle surfaces. Our pro-
prietary anionic surfactant does not interfere
with the binding of proteins nor cause proteins
to desorb from microparticle surfaces. Opti-
Bind particles are available in a wide range of
diameters (from 0.1 μm to 2.5 μm) for a variety
of applications. The Turbi-Bind particles, very
similar to the Opti-Bind product line, are spe-
cifi cally designed for turbidimetric assays.
Sulfate surfaces are very hydrophobic and
adsorb proteins almost instantaneously.
Opti-Bind particles have been optimized for
maximum reactivity in many diagnostic ap-
plications.
To order Thermo Scientifi c Opti-Bind or Opti-
Link products, call our Indianapolis, IN offi ce
at 1-866-737-2396 or at 1-317-610-3800.
55
From clinical immunoassays to molecular biology sample preparation to researchapplications, Thermo Scientific particles are critical components used by many ofthe world’s leading diagnostic and molecular biology companies.
Thermo Scientifi c Opti-Bind and Opti-Link Particle Product Listing
Opti-BindSulfate Particles
ParticleDiameter
BottleSize
Surface Acid Load-ing/ Post Process Cat. Number
Packaged in 15 mL, 15 mL Low SO4/Pasteurized 8100-0397-100290
100 mL and 1000 mL 0.1 μm 100 mL Low SO4/Pasteurized 8100-0397-100390
10% solids, 100 mg/mL 0.1 μm 1000 mL Low SO4/Pasteurized 8100-0397-100490
0.2 μm 15 mL Low SO4/Pasteurized 8100-0597-100290
0.2 μm 100 mL Low SO4/Pasteurized 8100-0597-100390
0.2 μm 1000 mL Low SO4/Pasteurized 8100-0597-100490
0.3 μm 15 mL Low SO4/Pasteurized 8100-0797-100290
0.3 μm 100 mL Low SO4/Pasteurized 8100-0797-100390
0.3 μm 1000 mL Low SO4/Pasteurized 8100-0797-100490
0.4 μm 15 mL Low SO4/Pasteurized 8100-0997-100290
0.4 μm 100 mL Low SO4/Pasteurized 8100-0997-100390
0.4 μm 1000 mL Low SO4/Pasteurized 8100-0997-100490
0.6 μm 15 mL Low SO4/Pasteurized 8100-1397-100290
0.6 μm 100 mL Low SO4/Pasteurized 8100-1397-100390
0.6 μm 1000 mL Low SO4/Pasteurized 8100-1397-100490
0.85 μm 15 mL Low SO4/Pasteurized 8100-1897-100290
0.85 μm 100 mL Low SO4/Pasteurized 8100-1897-100390
0.85 μm 1000 mL Low SO4/Pasteurized 8100-1897-100490
1.0 μm 15 mL Low SO4/Pasteurized 8100-2397-100290
1.0 μm 100 mL Low SO4/Pasteurized 8100-2397-100390
1.0 μm 1000 mL Low SO4/Pasteurized 8100-2397-100490
1.25 μm 15 mL Low SO4/Pasteurized 8100-2697-100290
1.25 μm 100 mL Low SO4/Pasteurized 8100-2697-100390
1.25 μm 1000 mL Low SO4/Pasteurized 8100-2697-100490
2.5 μm 15 mL Low SO4/0.05% Az 7100-3497-100250
2.5 μm 100 mL Low SO4/0.05% Az 7100-3497-100350
2.5 μm 1000 mL Low SO4/0.05% Az 7100-3497-100450
Opti-Link Carboxylate-modifi ed Particle
DiameterBottleSize
Surface Acid Loading Cat. Number
Packaged in 15 mL, 0.2 μm 15 mL PA70, Low Acid 8300-03701-00290
100 mL and 1000 mL 0.2 μm 100 mL PA70, Low Acid 8300-037010-0390
10% solids, 100 mg/mL 0.2 μm 1000 mL PA70, Low Acid 8300-037010-0490
0.2 μm 15 mL PA50, Med. Acid 8300-03501-00290
0.2 μm 100 mL PA50, Med. Acid 8300-035010-0390
0.2 μm 1000 mL PA50, Med. Acid 8300-035010-0490
56
57
ParticleDiameter
BottleSize
Surface Acid Loading Cat. Number
Opti-Link 0.2 μm 15 mL PA20, High Acid 8300-0320-100290
Carboxylate-modifi ed 0.2 μm 100 mL PA20, High Acid 8300-0320-100390
0.2 μm 1000 mL PA20, High Acid 8300-0320-100490
0.3 μm 15 mL PA70, Low Acid 8300-0570-100290
0.3 μm 100 mL PA70, Low Acid 8300-0570-100390
0.3 μm 1000 mL PA70, Low Acid 8300-0570-100490
0.3 μm 15 mL PA50, Med. Acid 8300-0550-100290
0.3 μm 100 mL PA50, Med. Acid 8300-0550-100390
0.3 μm 1000 mL PA50, Med. Acid 8300-0550-100490
0.3 μm 15 mL PA20, High Acid 8300-0520-100290
0.3 μm 100 mL PA20, High Acid 8300-0520-100390
0.3 μm 1000 mL PA20, High Acid 8300-0520-100490
0.4 μm 15 mL PA70, Low Acid 8300-0770-100290
0.4 μm 100 mL PA70, Low Acid 8300-0770-100390
0.4 μm 1000 mL PA70, Low Acid 8300-0770-100490
0.4 μm 15 mL PA50, Med. Acid 8300-0750-100290
0.4 μm 100 mL PA50, Med. Acid 8300-0750-100390
0.4 μm 1000 mL PA50, Med. Acid 8300-0750-100490
0.4 μm 15 mL PA20, High Acid 8300-0720-100290
0.4 μm 100 mL PA20, High Acid 8300-0720-100390
0.4 μm 1000 mL PA20, High Acid 8300-0720-100490
2.0 μm 15 mL PA5, High Acid 7300-3305-100250
2.0 μm 100 mL PA5, High Acid 7300-3305-100350
2.0 μm 1000 mL PA5, High Acid 7300-3305-100450
3.0 μm 15 mL PA20, High Acid 7300-3420-100250
3.0 μm 100 mL PA20, High Acid 7300-3420-100350
3.0 μm 1000 mL PA20, High Acid 7300-3420-100450
Parking Area InformationThe surface area per gram of a particle varies inversely with the particle diameter. Acid content refers to
the titrated milliequivalents per gram (mEq/g) and is weight-based. Parking area combines surface area
and acid content to give you the surface acid distribution that is useful for assay optimization. Refer to
the chart below.
Acid Content Parking Area Properties
Low 60 - 100 Hydrophobic surface, more colloidally stable than plain polystrene
Medium 35 - 59 Hydrophobic and hydrophilic areas; good colloidal stability and good covalent coupling
High 10 - 34 Hydrophilic surface; excellent colloidal stability; excellent covalentcoupling
Thermo Scientifi c Opti-Bind and Opti-LinkParticle Product Listing (continued)
Turbi-Link
Carboxylate-modifi ed
ParticlesParticle
DiameterBottleSize
Parking Area/ Post Process Cat. Number
Packaged in 15 mL, 0.10 μm 15 mL PA20/Pasteurized 100-153-100240
100 mL and 1000 mL 0.10 μm 100 mL PA20/Pasteurized 100-153-100340
10% solids, 100 mg/mL 0.10 μm 1000 mL PA20/Pasteurized 100-153-100440
0.15 μm 15 mL PA20/Pasteurized 100-204-100240
0.15 μm 100 mL PA20/Pasteurized 100-204-100340
0.15 μm 1000 mL PA20/Pasteurized 100-204-100440
0.2 μm 15 mL PA20/Pasteurized 100-255-100240
0.2 μm 100 mL PA20/Pasteurized 100-255-100340
0.2 μm 1000 mL PA20/Pasteurized 100-255-100440
0.3 μm 15 mL PA20/ Pasteurized 100-311-100290
0.3 μm 100 mL PA20/ Pasteurized 100-311-100390
0.3 μm 1000 mL PA20/ Pasteurized 100-331-100490
Turbi-Bind
Sulfate Particles ParticleDiameter
BottleSize
Surface Acid Loading/ Post
Process Cat. Number
Packaged in 15 mL, 0.1 μm 15 mL Low SO4/0.05% Az 6100-0397-100250
100 mL and 1000 mL 0.1 μm 100 mL Low SO4/0.05% Az 6100-0397-100350
10% solids, 100 mg/mL 0.1 μm 1000 mL Low SO4/0.05% Az 6100-0397-100450
0.2 μm 15 mL Low SO4/0.05% Az 6100-0597-100250
0.2 μm 100 mL Low SO4/0.05% Az 6100-0597-100350
0.2 μm 1000 mL Low SO4/0.05% Az 6100-0597-100450
0.3 μm 15 mL Low SO4/0.05% Az 6100-0797-100250
0.3 μm 100 mL Low SO4/0.05% Az 6100-0797-100350
0.3 μm 1000 mL Low SO4/0.05% Az 6100-0797-100450
0.4 μm 15 mL Low SO4/0.05% Az 6100-0997-100250
0.4 μm 100 mL Low SO4/0.05% Az 6100-0997-100350
0.4 μm 1000 mL Low SO4/0.05% Az 6100-0997-100450
Thermo Scientifi c Turbi-Bind and Turbi-Link Particle Product Listing
58
We covalently coat our Opti-Link Carboxylate-
Modifi ed Particles with Streptavidin. This
results in high biotin-binding capacity and long
shelf life.
We have developed a series of non-magnetic
Streptavidin coated particles (Power-Bind
Streptavidin particles) to improve and simplify
the binding of ligands to particles. Power-Bind
Streptavidin particles combine the advantages
of high surface area and easy, high affi nity,
high specifi c activity binding. They can also
be used in a variety of diagnostic and molecu-
lar biology applications.
Power-Bind Streptavidin-coated particles are
monodisperse particle suspensions with
Streptavidin covalently bound to the surface
(of Opti-Link carboxylate-modifi ed particles) in
a highly active form. The use of particles as a
solid phase support in various immunoassays
and affi nity purifi cations has been known for
some time. Achieving high activity and stable
binding of solid phase ligands has been a
major diffi culty. Biotinylated compounds
become stably bound to Power-Bind
Streptavidin particles after simple incubation
in buffer. This is due to the high affi nity of the
biotin-Streptavidin interaction. Power-Bind
Streptavidin particles also functions as a
spacer, which improves the specifi c activity of
the bound ligand.
Power-Bind Streptavidin particles addresses
the concerns of diagnostic test kit manufactur-
ers and nucleic acid researchers. With well-
known biotin-streptavidin reactions, scientists
can now easily bind ligands to microparticle
surfaces.
Power-Bind Benefi ts• Dissociation constant (Kd 10-15 Molar)
• Stably bound ligands
• Easy one-step binding protocols for biotinyl-
ated ligands
• High activity of surface bound ligands
• Easily solve diffi cult coupling problems
• Simple aqueous biotinylation reactions
• Low nonspecifi c interactions
• Highly mobile particles for membrane-
based applications
• Can be used in EIA formats with biotin/en-
zyme detection systems
• Benefi cial spacer effect of SA molecule
• Choice of 0.3 μm or 0.8 μm diameters for
different application requirements
• High biotin-binding capacity for molecular
biology applications
Compounds which are diffi cult to attach to
particle surfaces by conventional means may
be amenable to biotinylation. This includes
compounds for which activation reactions
must be performed in organic solvent. In this
instance, biotinylation may be carried out in
organic solvent; then the biotin derivative is
simply mixed with the Power-Bind Strepta-
vidin particles. Nucleic acids, which adsorb
poorly to particle surfaces, are readily bound
to Power-Bind Streptavidin particles after
biotinylation.
To order Thermo Scientifi c PowerBind
products, call our Indianapolis, IN offi ce at
1-866-737-2396 or at 1-317-610-3800.
Thermo Scientifi c Power-BindStreptavidin Coated Particles
Power-Bind Streptavidin
ParticleDiameter
BottleSize
BindingCapacity Cat. Number
Packaged in 1 mL, 5 mL, 100 mL 0.3 μm 1 mL ~1000 pmol/mg 2900-0701-011150
1% solids 0.3 μm 5 mL ~1000 pmol/mg 2900-0701-010150
0.3 μm 100 mL ~1000 pmol/mg 2900-0701-010350
0.85 μm 1 mL ~1000 pmol/mg 2900-1801-011150
0.85 μm 5 mL ~1000 pmol/mg 2900-1801-010150
0.85 μm 100 mL ~1000 pmol/mg 2900-1801-010350
59
Thermo Scientifi c 5000 Series:Polymer Particle Supsensions
They are useful for applications such as
fi lter evaluation and testing, fl uid mechanics
research, dispersion studies and many other
research and development projects.
This group of products is designed to meet
the need for particulate materials with a vari-
ety of particle sizes and properties. They are
useful for applications such as fi lter evaluation
and testing, fl uid mechanics research, disper-
sion studies and many other research and
development projects. They are not intended
for use in instrument calibration or diagnostic
reagents because they lack the exacting speci-
fi cations needed for those applications.
Particles of this series are of special interest
for research in light scattering, microporous
fi lter checking and aerosol particle genera-
tion. The polystyrene particles have a density
of 1.05 g/ cm3 and a refractive index of 1.59
@ 589 nm. Particle diameters are measured
by optical microscopy, photon correlation
spectroscopy or light scattering. They are
packaged as aqueous suspensions at 10%
solids by weight.
The 5000 Series particles sizes are up to 3.2
microns in size. If you require larger particles,
please refer to our Copolymer Microsphere
Suspensions - 7000 Series particles.
* 15 mL (“A” bottles) listed below are avail-
able for immediate purchase. 100 mL (“B”
bottles) and 1000 mL (“C” bottles) are pack-
aged to order; example (5003B and 5003C).
Please allow 3-7 working days when ordering
these fi ll volumes.
CatalogNumber
MeanDiameter
SizeUniformity
5003A 0.03 μm ≤ 30%
5006A 0.06 μm ≤ 18%
5008A 0.08 μm ≤ 18%
5009A 0.09 μm ≤ 15%
5010A 0.10 μm ≤ 15%
5011A 0.11 μm ≤ 12%
5012A 0.12 μm ≤ 12%
5014A 0.14 μm ≤ 6%
5016A 0.16 μm ≤ 6%
5017A 0.17 μm ≤ 5%
5020A 0.20 μm ≤ 5%
5022A 0.22 μm ≤ 3%
5024A 0.24 μm ≤ 3%
5026A 0.26 μm ≤ 3%
5030A 0.30 μm ≤ 3%
5031A 0.31 μm ≤ 3%
5033A 0.32 μm ≤ 3%
5036A 0.36 μm ≤ 3%
Product SpecificationsParticle Composition: Polystyrene
Concentration 10% solids by weight
Particle Density: 1.05 g/cm3
Index of Refraction 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
CatalogNumber
MeanDiameter
SizeUniformity
5043A 0.43 μm ≤ 3%
5045A 0.45 μm ≤ 3%
5049A 0.49 μm ≤ 3%
5050A 0.50 μm ≤ 3%
5051A 0.51 μm ≤ 3%
5052A 0.52 μm ≤ 3%
5060A 0.60 μm ≤ 3%
5065A 0.65 μm ≤ 3%
5067A 0.67 μm ≤ 3%
5077A 0.77 μm ≤ 3%
5081A 0.82 μm ≤ 3%
5088A 0.87 μm ≤ 3%
5093A 0.93 μm ≤ 3%
5100A 1.0 μm ≤ 3%
5130A 1.3 μm ≤ 5%
5153A 1.5 μm ≤ 4%
5200A 2.0 μm ≤ 4%
5300A 2.9 μm ≤ 5%
5320A 3.2 μm ≤ 5%
60
61
Suspensions of large copolymer particles are
useful as model systems for fl uid mechanics
experiments and as challenge particles for
large pore fi ltration systems.
These products are designed to meet the need
for particulate materials with a variety of
particle sizes and properties. They are useful
for applications such as fi lter evaluation, fi lter
testing, fl uid mechanics research, disper-
sion studies and many other research and
development projects. They are not intended
for use in instrument calibration or diagnostic
reagents because they lack the exacting speci-
fi cations needed for those applications.
Suspensions of large copolymer particles are
useful as model systems for fl uid mechanics
experiments and as challenge particles for
large pore fi ltration systems.
They are also useful as experimental particles
for acoustical and optical analytical systems.
They are composed of polystyrene polymer,
cross-linked with 4-8% divinylbenzene (DVB).
The particles are chemically inert. They can
be washed with alcohol, vacuum or air dried.
The polymer density is 1.05 g/cm3 and the
index of refraction is 1.59 @ 589 nm. They
are packaged as aqueous suspensions at 10%
solids by weight.
* 15 mL (“A” bottles) listed are available for
immediate purchase. 100 mL (“B” bottles)
and 1000 mL (“C” bottles) are packaged to
order; example (7503B and 7503C). Please
allow 3-7 working days when ordering these
fi ll volumes.
To order Thermo Scientifi c 5000 or 7000 Series
particle products, call our Fremont, CA offi ce
at 1-800-232-3342 or at 1-510-979-5000.
Thermo Scientifi c 7000 SeriesCopolymer Particle Suspensions
CatalogNumber
MeanDiameter
SizeUniformity
7503A 3.2 μm ≤ 45%
7505A 4.3 μm ≤ 25%
7508A 7.9 μm ≤ 20%
7510A 11 μm ≤ 18%
7516A 17 μm ≤ 16%
7520A 19 μm ≤ 16%
7525A 25 μm ≤ 15%
7545A 45 μm ≤ 15%
7550A 55 μm ≤ 16%
7575A 71 μm ≤ 15%
7590A 85 μm ≤ 16%
7602A 97 μm ≤ 12%
7640A 134 μm ≤ 16%
7725A 222 μm ≤ 12%
Product SpecificationsParticle Composition: Polystyrene crossed linked with divinylbenzene (DVB)
Concentration 10% solids by weight
Particle Density: 1.05 g/cm3
Index of Refraction 1.59 @ 589 nm (25°C)
Additives: Contains trace amount of surfactant
Stable in a wide variety of organic solvents,
these particles can be used in chemical
engineering and contamination control stud-
ies. They can also be used as preparations of
special sizes for sieve analysis.
These spherical polymer particles have the
same physical and chemical properties as
the general purpose 7000 Series - Copolymer
Particle Suspensions, except these particles
are more economical and have a wide size
distribution.
Thermo Scientifi c Polymer Materials (Dry)For Chemical Engineering Studies
Product SpecificationsParticle Composition: Polystyrene crossed linked with divinylbenzene (DVB)
Content Dry Polystyrene DVB particles
Particle Density: 1.05 g/cm3
Index of Refraction 1.59 @ 589 nm (25°C)
Additives: May contains trace amount of dry dispersant
CatalogNumber
Size Range Quantity
434 100-500 μm 100 g
62
63
Glass beads are useful as models for analyti-
cal, sedimentation and separation applica-
tions. Other uses for glass beads are as spac-
ers, insulators and refl ectors. The products
are packaged as dry materials.
Good quality research glass beads with fewer
inclusions, scratches, non-spherical material
and broken glass fragments than other com-
mercial products.
To order Thermo Scientifi c Polymer or Glass
Material, call our Fremont, CA offi ce at
1-800-232-3342 or at 1-510-979-5000.
Thermo Scientifi c Glass Material (Dry)For Analytical, Sedimentation and Seperation
Product SpecificationsParticle Composition: Soda Lime Glass
Appearance White powder
Particle Density: 2.5 g/cm3
Index of Refraction 1.51 @ 589 nm (25°C)
Softening Temperature 720 °C
Dialectric Constant 7.3 @ 1 kHz and 20 °C
Additives: May contains trace amount of dry dispersant
CatalogNumber
Size Range Quantity
414 1-40 μm 2 g
414B 1-40 μm 10 g
424 5-50 μm 100 g
424B 5-50 μm 500 g
443 70-105 μm 2 g
443B 70-105 μm 10 g
428 140-165 μm 10 g
428B 140-165 μm 50 g
429 180-210 μm 10 g
429B 180-210 μm 50 g
The pollens are useful for applications such as
fl uid mechanics research, dispersion studies,
fi lter evaluation and testing, and many other
research projects.
This selection of products provides model
specimens for analyzing and controlling
pollens, a common industrial contaminant.
Pollens can also be used as controls for test
systems, or as models of biological cells when
stained with cytochemical dyes. Packaged as
dry powder, the pollens will swell to a spheri-
cal shape after immersion in aqueous solu-
tions. The size data pertains to the hydrated
spherical condition.
Spherical Pollen and Spores (Dry)Fluid Mechanics/ Dispersion Studies
CatalogNumber
Description Size Range Quantity
213 Paper Mulberry Pollen 11-17 μm 1 g
213B Paper Mulberry Pollen 11-17 μm 5 g
214 Ragweed Pollen 17-21 μm 1 g
214B Ragweed Pollen 17-21 μm 5 g
215 Lycopodium Spores 25-35 μm 10 mL
215B Lycopodium Spores 25-35 μm 50 mL
217 Pecan Pollen 43-53 μm 1 g
217B Pecan Pollen 43-53 μm 5 g
395 Bermuda Grass Pollen 21-29 μm 1 g
395B Bermuda Grass Pollen 21-29 μm 5 g
396 Black Walnut Pollen 29-41 μm 1 g
396B Black Walnut Pollen 29-41 μm 5 g
397 Corn Pollen 79-97 μm 2 g
397B Corn Pollen 79-97 μm 10 g
419 Bermuda Grass Smut Spores 6-8 μm 1 g
419B Bermuda Grass Smut Spores 6-8 μm 5 g
420 Johnson Grass Smut Spores 6-9 μm 1 g
420B Johnson Grass Smut Spores 6-9 μm 5 g
Product SpecificationsParticle Composition: Spherical Pollen and Spores
Appearance Yellow to brown powder
Content Naturally occurring botanical materials (dry)
Additives: May contains trace amount of dry dispersant
64
65
Cat. Number Package Application Sample Pack Includes:
Opti-Bind Sulfate Particles S81123 3 x 15 mLClinical/
Molecular
8100-0397-100290 (0.1 μm)
8100-0597-100290 (0.2 μm)
8100-0797-100290 (0.3 μm)
Opti-Link Carboxylate-
modifi ed Sulfate Particles
0.2 μm Sample Pack
S8302 3 x 15 mLClinical/
Molecular
8300-0370-100290 (Low Acid)
8300-0350-100290 (Medium Acid)
8300-0320-100290 (High Acid)
Opti-Link Carboxylate-
modifi ed Sulfate Particles
0.3 μm Sample Pack
S8303 3 x 15 mLClinical/
Molecular
8300-0570-100290 (Low Acid)
8300-0550-100290 (Medium Acid)
8300-0520-100290 (High Acid)
Opti-Link Carboxylate-
modifi ed Sulfate Particles
0.4 μm Sample Pack
S8304 3 x 15 mLClinical/
Molecular
8300-0770-100290 (Low Acid)
8300-0750-100290 (Medium Acid)
8300-0720-100290 (High Acid)
Turbi-Link
Carboxylate-modifi ed
Particles
S100 4 x 15 mL Turbidimetric
1001-531-00240 (0.10 μm)
1002-041-00240 (0.15 μm)
1002-551-00240 (0.2 μm)
1003-311-00290 (0.3 μm)
Turbi-Bind
Sulfate ParticlesS61 4 x 15 mL Turbidimetric
6100-0397-100250 (0.1 μm)
6100-0597-100250 (0.2 μm)
6100-0797-100250 (0.3 μm)
6100-0997-100250 (0.4 μm)
Thermo Scientifi c Plain Particles Sample Packs
To order these Thermo Scientifi c Sample Packs, call our Indianapolis, IN offi ce at 1-866-737-2396 or at 1-317-610-3800.
66
Thermo Scientifi c Metal and Mineral ParticlesReal world particulates and particles for chemical,
engineering and metallurgical studies.
This series of particles meets the need for an
assortment of materials for chemical, engineering
and metallurgical studies. They are also useful
as particles for fi ltration testing and air particle
counters. The stainless steel and nickel
particles are paramagnetic.
To order Thermo Scientifi c pollen and spores,
metal and minerals or SMOKE-CHECK prod-
ucts, call our Fremont, CA offi ce at 1-800-232-
3342 or at 1-510-979-5000.
CatalogNumber
Description Size Range Quantity Density (g/cm3)
415 AC Fine Test Dust 1-80 μm 50 g 2.6
416 AC Coarse Test Dust 1-200 μm 50 g 2.6
347 Aluminum Oxide Particles 0.6-6.0 μm 5 g 3.9
421 Aluminum Oxide Particles 0.3-20 μm 5 g 3.9
423 Aluminum Oxide Particles 0.5-20 μm 5 g 3.9
235 Aluminum Silicate Particles 0.2-8.0 μm 20 g 2.6
437 Calcium Carbonate Particles 0.1-8.0 μm 20 g 2.7
136 Nickel Spheres 2-10 μm 20 g 8.9
358 Nickel Particles 40-80 μm 5 g 8.9
359 Nickel Particles 75-90 μm 10 g 8.9
435 Stainless Steel Spheres, Type 316 24-65 μm 25 g 8
436 Stainless Steel Spheres, Type 316 60-125 μm 100 g 8
451 Stainless Steel Spheres, Type 316 64-76 μm 2 g 8
356 Walnut Shell Particles 3-30 μm 25 g 1.35
Product SpecificationsMiscellaneous Metals and Minerals
Additives: May contains trace amount of dry dispersant
Thermo Scientifi c SMOKE-CHECK Smoke Detector Challenge Particles
We have developed a complete testing kit to
check the transport time of air sampling smoke
detectors as required by the United States
NFPA Standard 72. A suspension of polystyrene
particles in high purity water is nebulized using a
hand held ultrasonic atomizer to create a mimic of
natural smoke, thus eliminating residues caused
by traditional oil-based sprays or real smoke.
This makes SMOKE-CHECK especially useful in
cleanrooms and other critical environments. The
particle size and concentration have been opti-
mized to consistently trigger the smoke detector.
In addition, the particles will not pass through
HEPA fi lters, ensuring the integrity of the
cleanroom environment.
The Smoke Detector Challenge Kit includes a
battery powered portable ultrasonic nebulizer,
a draft shield and a 10 mL bottle of particles.
Instructions for operating and cleaning the
nebulizer are included. Additional bottles of
SMOKE-CHECK may be purchased separately.
Product SpecificationsParticle Composition: Polystyrene
Particle Density 1.05 g/cm3
Refractive Index 1.59 @ 589 nm (25° C)
Additives: Trace surfactant to inhibit agglomeration
CatalogNumber
Description
SD-01 Smoke Detector Challenge Particles (10 mL)
SD-02 Smoke Detector Challenge Kit
Thermo Scientifi c HEPA-CHECK
Filter Challenge Particles
There is a worldwide growing demand for
polystyrene latex* particles (PS) by fi lter
manufacturers, end-users and third-party
testing services. PS’s are listed as suitable test
materials when using particle counters by both
the Institute of Environmental Sciences (IEST)
and European Norm (EN) standards.
HEPA-CHECK™ Filter Challenge Particles are
polystyrene latex particles optimized for per-
formance, aerosolization, safety and economy
for both HEPA and ULPA fi lter testing. Unlike
traditional oil-based fi lter test materials such
as dioctylphthalate (DOP), HEPA-CHECK does
not carry the health risks associated with
atomized oils such as dioctylphthalate (DOP) or
other oil-based fi lter test materials. Due to the
clean oil-free nature of this ultra-pure water
suspension, HEPA-CHECK is ideal for leak
testing in-situ fi lters where the highest degree
of cleanliness is required.
Our polystyrene particles, for HEPA and ULPA
fi lter testing, are manufactured so you are en-
sured a consistently controllable and repeat-
able supply of highly uniform, monodisperse
particles which meet or exceed effi ciency test-
ing requirements. Each 25 mL bottle is to be
diluted in one US gallon (3.79 liters) of clean
water and then nebulized. Nebulizing can be
accomplished by using commercially available
ultrasonic humidifi ers. Single use bottles
ensure reproducible test conditions from site
to site. The product is available in particle
sizes traditionally associated with testing and
is sold individually or in convenient packs of 6
or 20 bottles.
To order Thermo Scientifi c HEPA-CHECK
products, call our Fremont, CA offi ce at 1-800-
232-3342 or at 1-510-979-5000.
Product SpecificationsParticle Composition: Polystyrene
Concentration 7.5 x 1012 particles per mL
Particle Density 1.05 g/cm3
Refractive Index 1.59 @ 589 nm (25° C)
Additives: Trace surfactant to inhibit agglomeration
Catalog Number MeanDiameter
SizeUniformity
Bottle Pack (6) Box (20)
HF12 HF12-PK HF12-BX 0.12 μm ≤ 5%
HF14 HF14-PK HF14-BX 0.14 μm ≤ 5%
HF17 HF17-PK HF17-BX 0.17 μm ≤ 5%
HF20 HF20-PK HF20-BX 0.20 μm ≤ 5%
HF22 HF22-PK HF22-BX 0.22 μm ≤ 5%
HF26 HF26-PK HF26-BX 0.26 μm ≤ 5%
HF30 HF30-PK HF30-BX 0.30 μm ≤ 5%
6767
Selecting Particle Surface Properties For Diagnostic Applications
Polymer particles are used in diagnostics for lateral fl ow chromatographic striptests, latex agglutination assays, suspen-sion array tests and nephelometric as-says. When changes in particle properties are suspected as a root cause of reagent batch failures, it is important to gain a better understanding of the particle selec-tion process. There are wide variations in particle composition, surface properties and size control that can affect the perfor-mance of a diagnostic reagent.
The importance of particle surface properties
The surface of particles is one of the most important properties for particles usedin diagnostic tests and other applica-tions where proteins and other biomol-ecules are bound to particles. Residual surfactants, monomers and microbialcontamination can interfere with the successful conjugation to the particles.These contaminants are often the cause of batch-to-batch non-reproducibilityof the conjugation reactions, and thesevariations can interfere with the produc-tion process for diagnostic tests. Carefulcontrol of particle diameter is also veryimportant since the surface area changes exponentially with changing diameter.Variations in surface area can causeapparent changes in sensitivity and can contribute to false positive and negativeresults. These potential problems can re-sult in a manufacturing dilemma—should a new batch of particles that doesn’t passincoming product tests be used and riskan assay that doesn’t work. Consistencyin particle manufacturing and qualitycontrol assures that these problems will not occur.
The functional groups available on the surface of the particles control the chem-istry of the conjugation process. Selectingparticles with the appropriate surface and quality characteristics is the key todeveloping stable, reproducible diag-nostic tests. Following is a discussion ofhow surface properties effect two broadcategories of biomolecular conjugation.
Properties affecting hydrophobic adsorption
Particles with sulfate and carboxyl groups are designed for hydrophobic
68
(passive) adsorption. The particle surface is very hydrophobic, with a low density of negatively charged surface ions to provide charge stabilization. These par-ticles will bind to any molecules that arecharacteristically hydrophobic, includingproteins, peptides and small hydrophobicmolecules.
The binding affi nity tends to increase as molecular weight increases, and can result in the preferential binding of higher molecular weight proteins in mixtures.Specifi c adsorption of substances such asantibodies is easily accomplished by mix-ing the particles and the protein together at an optimal pH and then separating theunbound protein from the solid phase,usually by centrifugation or cross-fl owfi ltration. The charge groups on theseparticles are derived from the initiatorsused in the synthesis of the particles,resulting in either sulfate or carboxyl ionicgroups on the particle surface. The main difference between these two types ofhydrophobic particles is their pH stability.Sulfate particles are stable above pH 3,while carboxyl particles are stable abovepH 6. There are other, more subtle differ-ences, and these come into play when one or the other particle types give asuperior result when antibody is bound to its surface. These differences are not well understood and are not predictable, so it is necessary to experiment to determinewhich of the two hydrophobic surfaces is best for a particular application.
Properties affecting covalent coupling
Carboxylate-modifi ed (CML) and alde-hyde-modifi ed particles are designed for covalent attachment by reactionwith amines. The modifi ed particles are made from sulfate particles by grafting acopolymer containing the desired chemi-cal group onto the surface, producing a thin, relatively hydrophilic polymeric layer. This results in a high density of carboxyl or aldehyde surface groups that can be chemically activated to give a reactive intermediate that will couple with amineson proteins and other biomolecules.Carboxylate-modifi ed particles differfrom the hydrophobic carboxyl particlesin that the surface is somewhat porous,more hydrophilic and has a relatively highcharge density of 10-125 Å2 /carboxyl.
y p y
They are more stable in the presence ofhigh concentrations of electrolytes (up to
1 M univalent salt). Unlike the hydropho-bic carboxyl particles, the high densityand better availability of the carboxylgroups on these particles facilitate reac-tion with protein amines after activationwith carbodiimide reagents. Alternatively, one can convert to the active esters ina two-step process. Aldehyde-modifi edparticles have aldehyde groups graftedto the surface and can react with proteinamines through Schiff base formation.Since the aldehyde-modifi ed particlesdo not require chemical activation andthus offer a convenient one-step methodof covalent attachment, they should beconsidered as a simpler alternative tocarboxylate-modifi ed particles. Amine-modifi ed particles are prepared from carboxylate-modifi ed particles by convert-ing some of the carboxyl groups to aminegroups. The resulting aminemodifi ed particles still retain a net negative chargeto ensure good charge stability, and can easily be coupled to antibodies and otherproteins using a variety of bi-functionallinkers. This conjugation approach offersa different way of attaching molecules to the particle surface, and often results inbetter activity of the conjugate.
Particle manufacturing quality
With so many particle variables affecting the reagent-making process, it is es-sential that all phases of particle designand production be tightly controlled in areproducible environment. This is a strongcontribution to reagent batch repeat-ability.
View our technical notes at www.thermo.com/particletechnology.
Technical Supplement
Placing an OrderFor faster service when placing an order, please
provide the following information to our Customer
Relations Department:
• Account Number
• Quote Number
• Order Number
• Catalog Number
• Quantity
• Shipping Requirements. If you have special require-
ments for
shipping, please indicate this clearly in your order
Product ReturnsNo returns accepted without prior authorization.
Please contact Customer Service for assistance.
Payment InformationThermo Fisher Scientifi c sales terms are net 30 days from the date of invoice for companies that
have established a credit account with us.
To establish a credit account, please complete our
New Account form. If you have any questions, please
feel free to contact our Customer Relations Depart-
ment.
Customer Service Department
Our Customer Service Department can be reached by
telephone, fax or email.
For Size Standards and Flow Cytometry products,
call our Fremont, CA offi ce at 1-800-232-3342 or at
1-510-979-5000.
Hours: 8 a.m. - 5 p.m. Pacifi c
Email: info.particles@thermofi sher.com
For magnetic and all other particle products, call the
Indianapolis, IN offi ce at 1-866-737-2396 or at 1-317-
610-3800.
Hours: 8 a.m. - 5 p.m. Eastern
Fax: 1-317-610-3888
Email: info.particles@thermofi sher.com
Web site: www.thermo.com/particletechnology
Ordering Information
When ordering samples or evaluation packs, please
specify product volume and catalog numbers. When
reordering (“approved”) bulk material, please advise
us of specifi c manufacturing lot numbers and volume.
Nominal diameters, surface acid content and binding
capacities are listed in the product tables. Exact
parameters and other technical information is listed
on package inserts and certifi cates of analysis.
Not all particles are available at all times. For specifi c
product and lot availability, please email Customer
Relations at info.particles@thermofi sher.com.
Although we can manufacture up to 300 liter batch
sizes, please advise us of your particle usage require-
ments so that we can confi rm suffi cient inventory
quantities for your application.
Sample Evaluation Packs
Some of our particle products are sold in economi-
cal sample evaluation pack form. These evaluation
packs allow you to buy small samples from among our
standard inventory of different surfaces, colors, sizes
and binding capacities at greatly reduced prices. You
can fi nd sample pack information at the end of each
product section in this catalog.
MSDS
Material Safety Data Sheets are available for all
Thermo Scientifi c products. Please contact our
Customer Service Department if you need more
information or visit our Web site at www.thermo.
com/particletechnology.
Technical Support
Our Technical Service personnel are trained to answer
your questions. Our technical notes can also be a
helpful resource for whatever project you are working
on. Just log on to www.thermo.com/particletechnol-
ogy and click on technical notes.
Quality Commitment
We provide high quality manufacturing in our
ISO certifi ed facilities. We are FDA registered as an
in vitro diagnostic device manufacturer and are cGMP
compliant.
Striving To Meet Your Needs
69
Particle Products 7998 Georgetown Rd.
Indianapolis, IN 46268
1-866-737-2396
1-317-610-3888 fax
46360 Fremont Blvd.
Fremont, CA 94538
1-800-232-3342
www.thermo.com/particletechnology
DCR 11210
Indianapolis, IN
USAISO Certified
Fremont, CA
USA