-
Contents lists available at ScienceDirect
Fish and Shellfish Immunology
journal homepage: www.elsevier.com/locate/fsi
Full length article
Trans-cinnamic acid application for rainbow trout (Oncorhynchus
mykiss): I.Effects on haematological, serum biochemical,
non-specific immune andhead kidney gene expression responses
Sevdan Yılmaz∗, Sebahattin ErgünDepartment of Aquaculture,
Faculty of Marine Sciences and Technology, Canakkale Onsekiz Mart
University, Canakkale 17100, Turkey
A R T I C L E I N F O
Keywords:Rainbow troutTrans-cinnamic acidInnate immunityCytokine
responseYersinia ruckeri
A B S T R A C T
The present study investigated the effects of dietary
trans-cinnamic acid (CA) on pre- and post-challenge
hae-matological, serum biochemical, non-specific immune and head
kidney gene expression responses of rainbowtrout, Oncorhynchus
mykiss juveniles. In this regard, fish with an average weight of
17.01 ± 0.05 g were dividedinto five groups, and fed daily with an
additive free basal diet (control); 250, 500, 750 or 1500mg kg−1 CA
for a60-day period. Fish were sampled every 20 days during the
experiment. On days 20, 40 and 60 (the pre-chal-lenge period), the
dietary CA especially at 250 and/or 500mg kg−1 significantly
increased blood granulocytepercentage, and serum total protein,
globulin, lysozyme and total immunoglobulin values. Furthermore,
dietaryCA increased activities of phagocytic activity, respiratory
burst and potential killing, and increased the ex-pression levels
of immune related genes [serum amyloid A (SAA), interleukin 8
(IL-8), interleukin 1, beta (IL-1β),transforming growth factor beta
(TGF-β), tumor necrosis factor (TNF-α), and immunoglobulin T (IgT)]
in thehead kidney of fish fed with 250 and/or 500mg kg−1 CA.
Following 60 days of feeding, fish were challengedwith Yersinia
ruckeri and mortality was recorded for 20 days. Highest percentage
survival (%) rate was found inthe 250 and/or 500mg kg−1
CA-supplemented feeding groups. During the post-challenge period,
red blood cell(RBC) count, hematocrit (%), respiratory burst
activity, and total antiprotease activity increased in fish fed
withfeed containing 500mg kg−1 content. Moreover, markedly
up-regulated the expression of related genes (SAA, IL-8, IL-1β,
TGF-β, TNF-α, IFN-γ and IgM) in fish fed 250, 500 and/or 750mg kg−1
CA. Therefore, feeding O. mykissfor 60 days with dietary CA at
250–500mg kg−1 CA incorporation levels can be suggested as optimal
to enhancethe immunity and disease resistance against Y.
ruckeri.
1. Introduction
The rainbow trout Oncorhynchus mykiss is one of the most
eco-nomically important fishes cultured in Europe, North America,
Chile,Japan, Australia [1] as well as in Turkey [2]. One of the
importantdiseases in O. mykiss is Enteric Redmouth (ERM) caused by
Yersiniaruckeri [3,4] and can be controlled by vaccination [5,6]
and anti-microbial drugs mainly sulphamethazine, chloramphenicol or
oxyte-tracycline [7]. However, vaccination can lead to an increase
in laborrequirements and it may cause handling stress. On the other
hand, it hasbeen reported that Y. ruckeri strains acquired
resistance to various an-timicrobial agents [8,9].
The unconscious use of antibiotics and chemotherapeutics
inaquaculture facilities presents residual problems in the
surroundingenvironment. Accordingly, farmed terrestrial animals and
humanbeings are adversely affected. Furthermore, the excessive use
of
antibiotics rises antibiotic resistance of fish pathogens in
aquaculturefacilities. For these reasons, studies have been
accelerated in order tosearch environment-friendly alternative feed
additives to reduce the useof antibiotics or environmentally
harmful synthetic chemicals in fishfarming. Accordingly, a great
number of studies have supported thatorganic acids could provide
alternative contributions in aquaculturesuch as promoting growth
and resistance to diseases and boosting im-mune responses
[10–18].
Polyphenols, secondary plant metabolites are reported to have
an-tioxidative, anti-inflammatory and immunomodulatory effects in
ro-dent and human studies [19–22]. Considering that farm animals
mightbe exposed to high levels of oxidative stress and inflammation
underunfavorable culture environments, polyphenols are believed to
be fa-vorable additives in feeding farm animals [23]. Nevertheless,
potentialantioxidative, anti-inflammatory and immunomodulatory
effects ofpolyphenols have not been widely studied in farm animals
unlike many
https://doi.org/10.1016/j.fsi.2018.04.034Received 15 January
2018; Received in revised form 6 April 2018; Accepted 18 April
2018
∗ Corresponding author.E-mail address: [email protected]
(S. Yılmaz).
Fish and Shellfish Immunology 78 (2018) 140–157
Available online 21 April 20181050-4648/ © 2018 Elsevier Ltd.
All rights reserved.
T
http://www.sciencedirect.com/science/journal/10504648https://www.elsevier.com/locate/fsihttps://doi.org/10.1016/j.fsi.2018.04.034https://doi.org/10.1016/j.fsi.2018.04.034mailto:[email protected]://doi.org/10.1016/j.fsi.2018.04.034http://crossmark.crossref.org/dialog/?doi=10.1016/j.fsi.2018.04.034&domain=pdf
-
studies carried out with model animals and humans.Trans-cinnamic
acid (CA) is a natural polyphenolic organic acid
derived from plants, and known to have anti-fungal [24],
anti-microbial[25], anti-oxidant [26], anti-tumor [27] and
anti-inflammatory effects[28]. Further, CA is reported as an
effective food additive for functionalhuman food by U.S. Food and
Drug Administration [29]. Despite thewidely-presented information
regarding the benefits and outstandingprofitability of CA,
questions about the immunostimulary effects of CAin finfish diet
still remain to be answered. It was reported that CApresented
antimicrobial effects under in vitro conditions against bac-teria
such as Aeromonas hydrophila, A. salmonicida and Edwardsiellatarda
[30] and A. sobria, A. salmonicida ATCC 33658, L. anguillarum andY.
ruckeri [31]. These properties show that it can be considered as
aproper feed additive. However, information regarding the
mechanismon how the dietary incorporated CA affects fish, has not
been reportedearlier.
Haematological, serum biochemical and innate immune
parametersare important indicators of health status used in
determining the effectof feed additives in fish [32–36]. The
changes in immune-related geneexpressions have also become an
important research topic in recentyears. CA is known to increase
serum interleukin 1, beta (IL-1β) levelsin mice [37]. The serum
amyloid A (SAA), interleukin 8, interleukin 1,beta (IL-1β),
interferon gamma (IFN-γ), tumor necrosis factor
(TNF-α),transforming growth factor beta (TGF-β), immunoglobulin M
(IgM) andimmunoglobulin T (IgT) investigated in head-kidney tissue
in the pre-sent study are important molecules involved in
inflammation and reg-ulation of innate and acquired immune
response, respectively in teleostfish [38–40]. Because of the
availability of resident macrophage po-pulations, it is believed
that head-kidney is a significant organ in orderto capture and
clear bacteria. Additionally, it is also an important organdue to
the key regulatory functions and has the pivotal role in terms
ofimmune-endocrine interactions and even
neuro-immuno-endocrineconnections [41,42]. Further, previous
studies have reported that po-tential immunostimulants tested in
diets have stimulating or regulatingeffects on O. mykiss
head-kidney cytokines [38,43–45]. Moreover, itwas reported that the
expression of IL-1β, TNF-α and IgM from thegenes, which were also
tested in our study, were up-regulated by 3,4,5-trimethoxy cinnamic
acid, an analog of CA, on the kidney cells ofCtenopharyngodon
idella [46]. These observations indicate the sig-nificance of
kidney as an organ for the investigation of CA effects infish.
To our knowledge so far, there are no data available regarding
theeffective dietary dose of CA in fish feed. However, consumption
of5–30mg kg−1 body weight was sufficient to visualize the
bioavail-ability of the product in rats [47,48]. Hence, the earlier
findings in ratswere used for the determination of feeding rates in
the present study. Adaily feeding rate of around 2–3% body weight
was considered tocalculate the daily feed amount for rainbow trout
(mean weight 17 g),which was equivalent to 5–7.5, 10–15, 15–22.5
and 30–45mg kg−1
body weight, corresponding to a dietary CA incorporation of 250,
500,750 or 1500mg kg−1 feed, respectively.
To date, there are no reports regarding the usage of CA as a
sup-plement in fish feed. This study investigated the changes in
haemato-logical parameters, blood pH, non-specific immune
responses, serumbiochemical variables, head-kidney related genes
expressions in the preand post-challenge period (after the fish
were infected with Y. ruckeri)in O. mykiss juveniles fed with
trans-cinnamic acid (purity ≥99%) indiffering amounts.
2. Materials and methods
2.1. Experimental diet
Trans-cinnamic acid (lot no. #W228826) was obtained from
Sigma(Sigma-Aldrich, St. Louis, MO) with a stated purity of ≥99%,
in-corporated in the test diets at rates of 250, 500, 750 and
1500mg kg−1,
and designated as 25cin, 50cin, 75cin, and 150cin,
respectively.Additionally, a control group was fed on a diet
without cinnamic acidsupplementation. Commercial trout feed
(Anatolian Sea 50% protein/4% lipid, 4 mm, Ugurlu Balik, Aydin,
Turkey) was used as the basaldiet. After heating (40 °C) for 1.5–2
h the 860 g feed was top-dressedwith 140 g anchovy fish oil (final
protein/lipid ratio is about 43%/17%)containing different level of
cinnamic acid (0–1500mg kg−1) by slowlymixing in a drum mixer.
Proximate analyses of the diets were performed using
standardmethods. Moisture was analyzed by drying at 105 °C for 24 h
in an ovento a constant weight, crude protein by the Kjeldahl
method, and crudeash by incineration at 525 °C in a muffle furnace
for 12 h [49]. Crude fatwas analyzed by methanol / chloroform
extraction [50].
2.2. Fish and experimental design
Oncorhynchus mykiss juveniles were obtained from a local trout
farm(Keskin Alabalik Co.) in Canakkale, Turkey. Each fish was
visually in-spected externally according to United States
Environmental ProtectionAgency (EPA) guidelines for qualitatively
assessing fish health [51].Fish were fed a commercial diet (“see
experimental diet” section) adlibitum for 3 weeks to allow for
acclimation prior to initiation of ex-periment. A total of 450 fish
were used in the study carried out with 5experimental treatment
groups in a triplicate design. Fish weighing17.01 ± 0.05 g (mean ±
S.D.) were randomly allotted into 15 ex-perimental fiberglass tanks
(30 fish per tank). Each tank with a watervolume of 140 L was
provided with re-circulated aerated freshwater at arate of 160 L
h−1. All fish were fed ad libitum twice daily (08.00 and17.00 h)
for 60 days. Photoperiod was set to a 12L:12D light-dark
cyclethroughout the study. Water quality characteristics during the
course ofthe experiments were as follows: temperature was 15.8 ±
0.5 °C, pHwas 7.69 ± 0.1, dissolved oxygen was 7.7 ± 0.15mg L−1,
con-ductivity was 435 ± 5.2 μS, total ammonia was0.012 ± 0.0011mg
L−1, nitrite was 0.025 ± 0.001mg L−1, and ni-trate was 0.8 ± 0.1mg
L−1. Temperature was controlled by a heater/chiller (Tuna Mac®,
Canakkale, Turkey). Temperature, oxygenation,conductivity and pH
were measured daily, and ammonia, nitrite andnitrate were measured
weekly.
2.3. Sampling
Blood samples were collected from the experimental fish during
thefeeding period at days 20, 40 and 60, and 20 days after
infection with Y.ruckeri. Fish were starved for 1 day prior to
blood sampling. Three fishfrom each tank (9 fish per group) were
used for the sampling. After thefish were randomly caught and
quickly removed from the tanks, theywere anesthetized with 20mg L−1
clove oil [52]. Blood was taken fromthe caudal vein through a 2.5
mL plastic syringe as soon as possibleafter the area behind the
anus fin was cleaned thoroughly with alcoholto avoid the mixing of
the mucous membrane into the blood. For theanalyses of
haematological and some immune-related parameters[white blood cell
(WBC) count and types, phagocytic index, and pha-gocytic activity,
respiratory burst and potential killing activities], a partof the
blood samples were transferred into tubes containing
K3EDTA(MiniCollect®Tube, Austria), while the remaining part of the
bloodsamples were placed into Eppendorf tubes for the measurements
ofblood pH values. The rest of the blood was taken into serum tubes
(Zserum sep. Tubes MiniCollect® Tube, Austria) and centrifuged at
5000 gfor 10min. Obtained serum samples were stored at −80 °C for
furtheranalysis [53]. Fish were euthanized with clove oil
overdose(200mg L−1) after blood sampling, and then head kidney
tissues wereimmediately collected and placed in RNAlater
(Sigma-Aldrich, lot no.#R0901) solution at 4 °C overnight and then
stored at −20 °C until thegene expression analysis [54].
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
141
-
2.4. Haematological parameters
Red blood cell (RBC, 106 mm−3) count, hemoglobin
concentration(Hgb, g dL−1) and hematocrit ratio (Hct, %) were
conducted with au-tomatic blood count instrument (Mindray BC 3000
plus) previouslyused in O. mykiss [55]. To validate the reliability
of the automatic re-sults, a manual haematological analysis was
performed according toBlaxhall and Daisley [56] on all blood
samples immediately after col-lection in K3EDTA tube.
2.5. Biochemical analysis
Commercial test kits (Bioanalytic Diagnostic Industry,
Germany)were used to determine the serum glucose, total protein,
albumin andglobulin (subtracting albumin from total protein) levels
[32]. Serumbiochemical analysis were carried out on a
spectrophotometer (OptizenPOP UV/VIS). The serum cortisol levels
were determined using theimmunoenzymatic assay method previously
reported in fish [57].Analysis were performed at 450 nm using a
microplate reader (ThermoMultiskan Go) using a commercial cortisol
kit (Diametra, Italy).
2.6. Blood pH
Blood pH was measured by FC 200 electrode and HANNA (HI 2221)pH
meter [58].
2.7. Immune related parameters
2.7.1. White blood cell (WBC) counts and typesFor WBC counts and
types, a small amount of blood was spread on
the glass slide and allowed to dry at room temperature. The
slides werewashed under running tap water following the
May-Grünwald-Giemsastaining procedure. Then, 100% leukocyte cells
were counted at1000×magnification using immersion oil and
percentage of leukocytecells (lymphocytes, granulocytes and
monocytes) were determined. Thenumber of white blood cells (WBC,
104mm−3) was calculated in-directly by the method previously
reported in the literature [33]:
Number of leukocytes in the blood smear× erythrocytes
quantifiedin the haemocytometer/7000 erythrocytes in the blood
smear.
2.7.2. Phagocytic activity and phagocytic indexPhagocytic
activity was previously performed according to the mi-
croscopic counting method reported in the literature [59].
Briefly,100 μL of the blood sample and 100 μL of formalin killed Y.
ruckeri E42(1.5×108 in PBS) suspension were mixed and left to
incubate for30min. Then, a drop of blood was taken on the glass
slide and was airdried. The slides were fixed with ethyl alcohol
(95%) for 5min andstained with Giemsa solution for 10min.
The slides were observed under the light microscope to count100
cells per slide. The phagocytic activity and phagocytic index
werecalculated as follows:
Phagocytic activity (%) = (Number of phagocytic cells with
engulfedbacteria/number of phagocytes)× 100
Phagocytic index=Number of engulfed bacteria/phagocytic
cells
2.7.3. Respiratory burst activityModified Stasiack and Bauman
[60] method was followed for re-
spiratory burst activity of the phagocytes. Fifty microliters of
the bloodwas placed into the 96 well plates (Thermo Scientific,
Nunc, #167008)which coated 50 μL of PLL (poly-L-lysine) solution
(Sigma-Aldrich, lotno. #P4832) and incubated at 25 °C for 1 h to
allow adhesion of cells.Then the supernatant was removed and the
wells washed three times inHBSS (Sigma-Aldrich, lot no. #H6648).
After washing, 100 μL 0.2%NBT (Sigma-Aldrich, lot no. #N5514) in
HBSS solution was added and
incubated for a further 1 h. The cells were then fixed with 100%
me-thanol for 5min and washed three times with 70% methanol. The
plateswere air dried and 60 μL 2M potassium hydroxide (KOH,
Sigma-Al-drich, lot no. #P5958) and 70 μL dimethyl sulphoxide
(DMSO, Sigma-Aldrich, lot no. #D2650) were added to each well. The
absorbance (OD)was recorded in a plate reader (Thermo Multiskan Go)
at 620 nm.
2.7.4. Potential killing activityA modification of a technique
by Siwicki [61] was used to measure
potential killing activity of blood phagocytic cells. First, 50
μL of theblood sample was added in a microtiter plate well which
coated with50 μL of PLL. The plate was incubated for 1 h at 25 °C
to allow ad-herence of cells to the plastic surfaces. Then, the
supernatant and non-adherent cells were gently removed and the
adhered cells were washedthree times with HBSS. After washing, 100
μL of 0.2% NBT in HBSSsolution containing formalin killed 1.5 × l08
cfumL−1 Y. ruckeriE42 cells was added to the wells. Then, plate was
centrifuged for5min at 150 g to bring the bacteria into contact
with the adherent cells.After incubation for 30min at room
temperature, supernatant was re-moved and the cells were fixed with
100% (v/v) methanol for 5min,and then washed three times with 70%
(v/v) methanol. The plates wereair-dried before 60 μL of 2M KOH and
70 μL DMSO were added to so-lubilize the formazan. The OD of the
resulting solution was read in aplate reader (Thermo Multiskan Go)
at 620 nm against a KOH/DMSOblank.
2.7.5. Lysozyme activityLysozyme activity was determined by a
microtitre plate method
[62]. Briefly, the serum samples (25 μL) were added to 175 μL of
Mi-crococcus luteus (Sigma-Aldrich, lot no. # 4698) aqueous
suspension(0.375mg in 500 μL of 0.1M phosphate/citrate buffer with
0.09%NaCl, pH 5.8) in a 96-well plate. The hen egg white lysozyme
(Sigma-Aldrich, lot no. #L6876; 0–40 μgmL−1 of 0.1 M
phosphate/citratebuffer with 0.09% NaCl, pH 5.8) was used to
develop standard curve.The spectrophotometric measurements were
carried out with a micro-plate reader (Thermo Multiskan Go) set at
25 °C and followed for30min at 450 nm with a time interval of 60 s.
As a result, 15min waschosen as the optimal incubation time. The
rate of lysis was determinedagainst M. luteus blank at 450 nm. The
rate of reduction in absorbanceof samples was converted to lysozyme
concentration (μg mL−1) using astandard curve.
2.7.6. Myeloperoxidase activityTotal myeloperoxidase (MPO)
content was measured according to
Sahoo et al. [63] with slight modification. 10 μL serum was
diluted with90 μL of HBSS without Ca2+ or Mg2+ in 96 well plate.
Then, 35 μL of asubstrate buffer (0.05M phosphate-citrate buffer,
pH 5.0) containing0.1 mgmL−1 3,3′,5,5′-tetramethylbenzidine
dihydrochloride (Sigma-Aldrich, lot no. #T3405) and 0.006% hydrogen
peroxide was added toeach well. The reaction was followed
kinetically by measuring the in-crease of absorbance. Reaction
velocities were determined as IU, de-fined as the amount of enzyme
required to produce a 0.001 increase inabsorbance per minute
0.135mL of reaction mixture (ΔA450min−1 mL−1).
2.7.7. Total antiprotease activityTotal antiproteases activity
in serum was determined according to
Magnadottir et al. [64] with partial modification. 10 μL of
serum wereincubated with 100 μL trypsin (Sigma-Aldrich, lot no.
#T8003, bovinepancreas Type I, 200 μgmL−1of PBS). All tubes were
incubated at 22 °Cfor 30min. Then, 1mL of azocasein (Sigma-Aldrich,
lot no. # A2765)dissolved in PBS (2.5 mgmL−1) was added to all
tubes and incubatedfurther for 15min at 22 °C. The reaction was
terminated with the ad-dition of 500mL of 10% tricholoroacetic
acid. The sample was cen-trifuged at 10 000× g for 5min to remove
protein precipitates. 100 μLof the supernatant was transferred to a
96 well plate containing 100 μL
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
142
-
of 1 N NaOH per well. The OD was read at 450 nm in a
microplatereader (Thermo multiscan Go, Thermo Fisher Scientific,
Waltham, MA,USA). The blank was PBS in place of serum and trypsin
and the re-ference sample was PBS in place of serum.
2.7.8. ɑ1-antiproteaseThe method was applied according to
Newaj‐Fyzul et al. [65] with
some modifications. Briefly, 10 μL of serum was mixed with 100
μL oftrypsin (100 μgmL−1) and 90 μL of 50mM Tris-HCl (pH 8.2), and
in-cubated at 22 °C for 1 h. Then, 2mL of 2mM
Nabenzoyl-DL-arginine-p-nitroanilide HCl (lot no. #B4875, Aldrich,
St. Louis, MO) was addedand incubated for a further 15min. The
reaction was stopped by adding500 μL of 30% acetic acid and the OD
read at 450 nm in a spectro-photometer (Optizen POP UV/VIS
Spectrophotometer, Seoul, Republicof Korea). The serum blank
contained 100 μL of Tris instead of trypsin,and the positive
control contained trypsin but no serum.
2.7.9. Total immunoglobulinThe total immunoglobulin
concentration was measured according to
the method described by Siwicki and Anderson [59]. The total
proteinconcentration of the serum was determined by a colorimetric
assaybased on the Biuret reaction, using a protein diagnostic
reagent kit(Bioanalytic Diagnostic Industry, Co.). After, 100 μL of
each serumsample was mixed with equal volume of polyethylene glycol
solution(lot no. #P1458, Aldrich, St. Louis, MO) and the mixture
was incubatedfor 2 h (under constant mixing) to bring down the
immunoglobulinmolecules. After centrifuged at 1000× g for 10min,
the protein contentof the supernatant was determined by the assay
described above. Thetotal immunoglobulin value was calculated
according to the followingformula:
Total immunoglobulin level (mg mL−1)= Total protein in
serum/Totalprotein in supernatant
2.7.10. Natural hemolytic complement activitySerum natural
hemolytic complement activity was determined by
the method of Lim et al. [66]. This assay is based on the
hemolysis ofsheep erythrocytes (GBL, Istanbul/Turkey) by complement
present infish serum. Sheep erythrocytes were washed five times
with coldPBS + solution (0.85% PBS, 0.1% gelatin, 0.15 mM CaCl2 and
0.5mMMgCl2) followed by centrifugation at 300g at 4 °C for 10min
andstandardized to 5×107 cells mL−1 in PBS + prior to use. Starting
with40 μL of serum, twofold serial dilutions were made in 96-well
microtiterplates by transferring 40 μL of serially diluted serum
into each wellplated with 40 μL PBS+. Diluted serum volume in each
well wasbrought up to 200 μL by adding 160 μL of buffer.
Thereafter, 40 μL ofsheep erythrocyte suspension was added to each
well. Positive controls(100% lysis) of distilled water plus sheep
erythrocytes and negativecontrols (spontaneous lysis) of buffer and
sheep erythrocytes were alsoprocessed in each plate. Samples were
incubated at 22 °C for 1 h. Thereaction was stopped by placing
plates on ice. The plates were cen-trifuged at 800 g for 10 min at
4 °C and supernatants (200 μL) weretransferred to flat-bottom
96-well microtiter plates and the absorbancewas measured at 415 nm
using microplate reader. The 50% lysis point(CH50) was calculated
by logarithmic regression of each serum sampleand expressed as the
log dilution.
2.8. Bacteria and challenge experiment
The Y. ruckeri E42 (GenBank accession no. KX388238) used in
thisstudy was previously isolated from diseased O. mykiss and
obtainedfrom Dr. Ertan Emek ONUK (Ondokuz Mayis University, Faculty
ofVeterinary Medicine, Samsun - Turkey). Bacterial culture was
generatedovernight in TSB (Tryptic Soy Broth) at 22 °C, and then
washed twicewith PBS to adjust the density to 3× 108 CFUmL−1. The
density of the
pathogen was determined according to the previously calculated
LD50value for the O. mykiss.
At the end of the 60-day feeding trial, 100 μL bacterial
suspension(3×108 CFUmL−1 in PBS) were intraperitoneally injected
into fish (75fish/group) with an insulin syringe. Dead O. mykiss
were removed fromthe tank daily and mortality was recorded daily
for 20 days. The post-challenge time was determined to be 20 days,
considering that total Igand specific antibody-secreting cells
reached the highest levels on days18 and 21 after O. mykiss were
infected with Y. ruckeri [67]. Y. ruckeriwas re-isolated to confirm
the mortality due to the bacterial infection.Conventional
microbiological tests [68] and 16S rDNA analysis havebeen used to
identify isolates.
2.9. Agglutination antibody titer assay
A modification of the method described by Yildirim et al. [69]
wasused. Y. ruckeri E42 was grown in tryptic soy broth for 24 h and
killedwith formalin 3 h before the assay. The bacterial cell
suspension wascentrifuged at 2100× g for 10min and supernatant was
discarded. Theresulting pellets were washed twice with PBS solution
and pellets werere-suspended in PBS. Then, two-fold serial serum
dilutions were madein 96-well round bottom microtiter plates by
adding 50 μL of dilutedserum into the remaining wells plated with
50 μL of PBS. Thereafter,50 μL of bacterial cell suspension
(McFarland # 1.5) was added to eachwell. The plates were covered
with plastic film and incubated at 16 °Cfor 16–18 h. Titers were
recorded as the log2 of the reciprocal of the lastdilution that had
caused agglutination. Agglutination antibody titerassay was also
performed for 2 fish from each tank (6 fish/group) be-fore fish
were infected with pathogen.
2.10. RT-qPCR analyses of gene expression
Total RNA was extracted from the head kidney using GeneMATRIXKit
(Cat. no. E3598, Poland) according to the manufacturer's
instruc-tions. The quality and purity of the extracted RNA were
determined viaspectrophotometry using a Nanodrop 2000c with
absorption at 260 and280 nm. After one DNAse treatments (DNA-free,
Eurx Poland) for theremoval of possible contaminated genomic DNA,
first-strand cDNA wasgenerated in a 15 μL reaction consisting of 2
μg RNA and 4 μL oligo dT18primer (50 pmol). This mix was heated at
70 °C for 8min and chilled onice, and then 4 μL reaction master mix
containing 10 μL 5X RT Buffer,0.30 μL RNase inhibitor, 1 μL reverse
transcriptase, 4 μL DTT (100mM),1 μL dNTP Mix (20mM) and 18.7 μL
RNase-free water were added.After incubation at 37 °C for 60min,
the reaction was stopped heatingat 90 °C for 10min. The synthesized
cDNA was immediately stored at−20 °C for further analysis.
The expression level of the genes SAA, IL-8, IL-1β, IFN-γ,
TNF-α,TGF-β, IgM and IgT (Table 1) was determined with an Applied
Biosys-tems 7500 Sequence Detection system (USA). β-actin was used
as theinternal control. The real time PCR cocktail consisted of 3
μL cDNAtemplate, 0.5 μL each of the primers (0.4 μM), 5 μL HOT
FIREPol®EvaGreen® qPCR Mix Plus (ROX) (Solis BioDyne, Estonia), and
11 μLPCR grade water. RT-PCR was performed in two replicates of
eachsample and repeated at least with two independent experiments
in 96-well plates using the following thermocycling conditions: an
initial 1cycles at 95 °C for 12min, followed by 40 cycles at 95 °C
for 15 s, 60 °Cfor 60 s. Data analyses were performed on 7500
System SDS softwareversion 1.3.1 (Applied Biosystems). Gene
expression levels were ana-lyzed using 2− ΔΔCt, and β-actin was
used as reference to normalize theRNA input [70].
2.12. Statistical analysis
Data were analyzed by analysis of one way analysis of
variance(ANOVA). Values were expressed as Means ± Standard Error of
Mean(SEM). Tukey's multiple comparison test was used when there
was
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
143
-
homogeneity of variances; otherwise, a Tamhane post hoc test
wasapplied. When normality variances were not assumed,
Kruskal-Wallistest followed by Dunn's post hoc test was performed.
To validate thereliability of haematological results which was
determined with theautomatic method, a paired t-test was applied
between the values ob-tained by the manual and automated method
[71]. Univariate PERM-ANOVA analyses [72] using PAST 2.17 (Hammer
and Harper®, Oslo,Norway;
https://folk.uio.no/ohammer/past/index_old.html) were per-formed to
identify how each parameter was individually influenced bycinnamic
acid dose and/or time of exposure in experiment. The survivalof
fish in each challenge treatment group was estimated using
Kaplan-Meier analysis, whilst the differences amongst the groups
were assessedusing the log-rank (Mantel-Cox) test for pairwise
comparisons. Theanalysis was performed using SPSS 19.0 (SPSS
Statistics) and the sig-nificance level was considered to be
0.05.
3. Results
A univariate PERMANOVA test results are given in Table 2.
TheRBC, Hct, phagocytic index and total Ig were significantly
affected bydose or time interval. The Hgb, cortisol and
ɑ1-antiprotease were onlysignificantly affected by time interval.
The interaction between doseand time interval, and time interval
significantly affected the albumin.The other parameters were
significantly affected by both dose and timeinterval, and
significant interaction was found between dose and
timeinterval.
3.1. Haematological variables
No statistical differences were observed between
haematologicalparameters evaluated with manual and automatic
methods. There wasno statistically significant change in the RBC,
Hb and Hct values untilthe 60th day of the experiment (Table 3).
However, RBC and Hct valuesof 50cin group were found to be
statistically higher than the controlgroup at 21 dpi (P <
0.05).
3.2. Blood pH results
The blood pH level (Fig. 1) was lower in the 150cin group than
thecontrol and 50cin groups on the 20th day (P < 0.05). However,
therewas no significant change in blood pH levels on the 40th and
60th daysof the experiment (P > 0.05). On the 21 dpi, the pH
levels were lowerin the 25cin and 50cin groups than the control and
75cin groups(P > 0.05).
3.3. Biochemical variables
The serum glucose levels (Fig. 2A) were similar between all
groupsuntil day 60 (P > 0.05). However, on the 20 dpi, it was
lower in the75cin and 150cin groups than the other experimental
groups(P < 0.05).
It was determined that the serum total protein levels (Fig. 2B)
werenot statistically different between the experimental groups on
day 20(P > 0.05), while it was higher in the 25cin group
compared to the
Table 1Primers used for relative quantitative real-time PCR.
Gene FWD or REV Sequence (5′–3′) Product size (bp)
References
SAA Forward GGAGATGATTCAGGGTTCCA 78 Evenhuis and Cleveland
[40]Reverse TTACGTCCCCAGTGGTTAGC
IL-8 Forward CTCGCAACTGGACTGACAAA 148 Evenhuis and Cleveland
[40]Reverse TGGCTGACATTCTGATGCTC
IL-1β Forward ACCGAGTTCAAGGACAAGGA 181 Awad et al [38].Reverse
CATTCATCAGGACCCAGCAC
TGF-β Forward AGATAAATCGGAGAGTTGCTGTG 275 Awad et al
[38].Reverse CCTGCTCCACCTTGTGTTGT
IFN-γ Forward CTGTTCAACGGAAACCCTGT 62 Evenhuis and Cleveland
[40]Reverse AACACCCTCCGATCACTGTC
TNF-α Forward TCTTACCGCTGACACAGTGC 130 Evenhuis and Cleveland
[40]Reverse AGAAGCCTGGCTGTAAACGA
IgM-(heavy chain)
Forward CAAACCGGTGGAAGCTACAT 150 Evenhuis and Cleveland
[40]Reverse AGACGGCTGCTGCAGATATT
IgT Forward AACATCACCTGGCACATCAA 80 Evenhuis and Cleveland
[40]Reverse TTCAGGTTGCCCTTTGATTC
β-Actin Forward GGACTTTGAGCAGGAGATGG 186 Awad et al [38].Reverse
ATGATGGAGTTGTAGGTGGTCT
Table 2The effect of dose and time interval (fixed factors) on
individual parameter(univariate PERMAONVA).
Univariate PERMAONVA1
Dose Time interval Dose×Time interval
RBC *** *** NSHgb NS *** NSHct ** *** NSBlood pH *** ***
***Glucose * ** ***Total protein *** *** *Albumin NS *** *Globulin
*** *** **Cortisol NS * NSWBC NS NS NSLymphocyte percentage *** ***
***Granulocyte percentage *** *** ***Monocyte percentage NS NS
NSPhagocytic activity *** *** ***Phagocytic index *** *
NSRespiratory burst activity *** *** ***Potential killing activity
*** *** ***Lysozyme * *** ***Myeloperoxidase *** *** ***Total
antiprotease activity *** *** ***ɑ1-antiprotease NS *** NSTotal Ig
*** *** NSNatural hemolytic complement *** *** ***Serum amyloid A
*** *** ***Interleukin 8 *** *** ***Interleukin 1, beta *** ***
***Transforming growth factor beta *** *** ***Interferon gamma ***
*** ***Tumor necrosis factor *** *** ***Immunoglobulin M *** ***
***Immunoglobulin T *** *** ***
1 Significance levels are.***P < 0.001, **P < 0.01, *P
< 0.05 and NS P > 0.05.
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
144
https://folk.uio.no/ohammer/past/index_old.html
-
control, 75cin and 150cin groups on the 40th day (P < 0.05).
On day60, it was higher in the 25cin and 50cin groups over the
control group(P < 0.05).
The serum albumin levels (Fig. 2C) were not statistically
differentbetween experimental groups during the feeding
experiment(P > 0.05). However, on the 20 dpi, there was a
significant differencebetween the groups of 50cin and 75cin (P <
0.05).
The serum globulin levels (Fig. 2D) of the experimental groups
werefound to be similar on 20th day (P > 0.05). However, it was
higher inthe 25cin group than the control, 75cin and 150cin groups
on the 40thday (P < 0.05). On 60 day, it was higher in the 25cin
and 50cin groupscompared to the control group (P < 0.05).
The serum cortisol levels were (Fig. 2E) found to be similar
amongthe groups during the experiment (P > 0.05).
Table 3Effects of dietary supplementation of trans-cinnamic acid
(CA) on haematological parameters of rainbow trout during pre- and
post-challenge periods.
Parameters Days Experimental Groups
Control 25cin 50cin 75cin 150cin
RBC(x106mm−3)
Initial A: 2.04 ± 0.06M: 2.03 ± 0.05
2.04 ± 0.062.03 ± 0.05
2.04 ± 0.062.03 ± 0.05
2.04 ± 0.062.03 ± 0.05
2.04 ± 0.062.03 ± 0.05
20 A: 2.23 ± 0.03M: 2.25 ± 0.04
2.30 ± 0.032.30 ± 0.02
2.34 ± 0.022.35 ± 0.03
2.31 ± 0.032.31 ± 0.02
2.28 ± 0.022.28 ± 0.03
40 A: 2.53 ± 0.09M: 2.53 ± 0.07
2.78 ± 0.072.79 ± 0.05
2.80 ± 0.062.80 ± 0.03
2.72 ± 0.042.70 ± 0.06
2.76 ± 0.102.78 ± 0.05
60 A: 2.20 ± 0.04M: 2.20 ± 0.05
2.06 ± 0.072.06 ± 0.06
2.01 ± 0.052.03 ± 0.05
2.07 ± 0.082.07 ± 0.10
2.12 ± 0.072.11 ± 0.05
20 dpi A: 2.35 ± 0.07b
M: 2.36 ± 0.05b2.52 ± 0.06ab
2.51 ± 0.09ab2.64 ± 0.06a
2.64 ± 0.03a2.37 ± 0.07ab
2.38 ± 0.04ab2.40 ± 0.09ab
2.40 ± 0.05ab
Hgb(g dL−1)
Initial A: 7.33 ± 0.64M: 7.35 ± 0.48
7.33 ± 0.647.35 ± 0.48
7.33 ± 0.647.35 ± 0.48
7.33 ± 0.647.35 ± 0.48
7.33 ± 0.647.35 ± 0.48
20 A: 8.65 ± 0.49M: 8.64 ± 0.26
8.53 ± 0.588.50 ± 0.36
10.19 ± 0.5010.06 ± 0.22
8.92 ± 0.218.91 ± 0.10
9.45 ± 0.349.47 ± 0.16
40 A: 9.82 ± 1.03M: 9.79 ± 0.58
10.04 ± 0.2310.08 ± 0.11
9.18 ± 0.379.15 ± 0.24
9.44 ± 0.279.24 ± 0.17
8.99 ± 0.589.01 ± 0.33
60 A: 9.87 ± 0.34M: 9.89 ± 0.10
9.25 ± 0.299.25 ± 0.20
9.18 ± 0.339.18 ± 0.11
9.91 ± 0.449.89 ± 0.21
10.29 ± 0.3610.27 ± 0.31
20 dpi A: 8.13 ± 0.34M: 8.13 ± 0.11
8.31 ± 0.338.29 ± 0.16
8.56 ± 0.608.55 ± 0.41
7.73 ± 0.237.75 ± 0.09
7.50 ± 0.367.49 ± 0.11
Hct (%) Initial A: 25.79 ± 1.11M: 25.78 ± 0.96
25.79 ± 1.1125.78 ± 0.96
25.79 ± 1.1125.78 ± 0.96
25.79 ± 1.1125.78 ± 0.96
25.79 ± 1.1125.78 ± 0.96
20 A: 28.58 ± 0.78M: 28.58 ± 0.42
29.70 ± 0.6629.72 ± 0.10
30.64 ± 0.4030.61 ± 0.51
30.04 ± 0.5030.09 ± 0.16
29.79 ± 0.3829.81 ± 0.21
40 A: 34.80 ± 0.95M: 34.78 ± 0.16
36.63 ± 0.6836.63 ± 0.21
36.09 ± 0.7836.11 ± 0.14
35.52 ± 0.5835.51 ± 0.31
34.84 ± 1.4334.80 ± 0.96
60 A: 37.94 ± 0.55M: 37.91 ± 0.13
35.62 ± 1.1035.62 ± 0.99
34.33 ± 0.8734.31 ± 0.19
35.86 ± 1.2835.88 ± 1.01
36.31 ± 0.9936.30 ± 0.51
20 dpi A: 30.22 ± 0.98b
M: 30.23 ± 0.57b33.23 ± 0.89ab
33.20 ± 0.18ab35.12 ± 0.97a
35.08 ± 0.25a31.22 ± 1.05ab
31.24 ± 0.96ab31.17 ± 1.29ab
31.20 ± 1.12ab
Mean ± SEM, n=9. The mean values denoted with different letters
within same experimental days are statistically significant (P<
0.05).A: automatic analysis results, M: manual analysis
results.
Fig. 1. Blood pH of rainbow trout, O. mykiss (mean ± SEM, n=9)
fed diets supplemented with different concentrations (0, 250, 500,
750 or 1500mg cinnamic acidkg−1) of trans-cinnamic acid. The mean
values denoted with different letters within same experimental days
are statistically significant (P< 0.05).
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
145
-
3.4. Immune related variables
The immune related variables of O. mykiss after dietary CA
treat-ments are shown in Figs. 3–5. During the experiment, the
white bloodcell count (Fig. 3A), monocyte percentage (Fig. 3D) and
ɑ1-antiproteaseactivity (Fig. 5D) was found to be similar between
the experimentalgroups (P > 0.05).
On the 20th day of experiment, lymphocyte percentage (Fig.
3B)was lower in the 25cin, 50cin, and 150cin groups compared to
thecontrol. It was also lower on the 40th and 60th days in the
25cin and50cin groups than the other experimental groups (P <
0.05).
Granulocyte percentage (Fig. 3C) was higher in all CA
supplementedgroups compared to the control on the 20th day (P <
0.05). On day 40,it was found to be higher in the 25cin and 50cin
groups compared to theother groups (P < 0.05). It was also
higher in 50cin group compared tothe other groups on the 60th day
(P < 0.05). At 20 dpi, lymphocyteand granulocyte percentages
were similar between the experimentalgroups (P > 0.05).
Relative to the value for the control group, phagocytic
activity(Fig. 4A), phagocytic index (Fig. 4B) and potential killing
activity(Fig. 4D) were higher in the 25cin and 150cin groups on the
20th day(P < 0.05). They were also higher in the 25cin and 50cin
groups thanthe control group on the 40th day (P < 0.05). The
phagocytic indexand potential killing activity were higher in the
25cin group than thecontrol group on day 60 (P < 0.05). On the
20 dpi, there was only asignificant change in the potential killing
activity among the experi-mental groups and it was lower in the
75cin and 150cin groups com-pared to the other treatment groups (P
< 0.05).
On the 20th day, the respiratory burst activity (Fig. 4C) was
higherin the 150cin group than the control (P < 0.05). It was
also higher inthe 25cin, 50cin and 150cin groups, and all CA
supplemented groupsthan the control group on the 40th and 60th
days, respectively(P < 0.05). However, on the 20 dpi, it was
lower in the 75cin groupthan the other experimental groups (P <
0.05).
Lysozyme activity (Fig. 5A) was statistically different
betweengroups of 150cin and 75cin at 20th day (P < 0.05), but
there was si-milarity between the control group and other
experimental groups(P > 0.05). However, on the 60th day, it was
higher in all CA sup-plemented groups than the control group (P
< 0.05).
On the 20th day, the myeloperoxidase activity (Fig. 5B) was
higherin the 50cin group than the control group. It was also higher
in the50cin, 75cin and 150cin groups, and 50cin group than the
controlgroup on the 40th and 60th days, respectively (P < 0.05).
Further-more, it was statistically higher in the 75cin and 150cin
groups than the25cin group on the 40th day (P < 0.05). MPO
activity was found to besimilar to all groups on the 20 dpi of the
experiment (P > 0.05).
It was found that the total antiprotease activity (Fig. 5C) did
notchange significantly between 20th and 40th days (P > 0.05),
whereasat day 60, it was lower in the 150cin group than the
control, 25cin and50cin groups (P < 0.05). On the 20 dpi, it was
higher in the 25cin and50cin groups than the control and 150cin
groups (P < 0.05).
The total immunoglobulin (Fig. 5E) was higher in all CA
supple-mented groups than the control group on the 20th day. It was
alsohigher in the 25cin, 50cin and 150cin groups, and 25cin and
50cingroups than the control group on days 40 and 60,
respectively(P < 0.05). Moreover, it was higher in the 25cin
group than the 75cinand 150 cin groups on the 40th day (P <
0.05). At 20 dpi, it was foundto be similar between the groups.
The hemolytic complement (Fig. 5F) was higher in the 25cin
groupthan the control, 50cin and 75cin groups on the 20th day (P
< 0.05). Itwas determined that there was no change on day 40
among the ex-perimental groups. However, it was higher in the
50cin, 75cin and150cin groups compared to the control group on the
60th day(P < 0.05). On the 20 dpi, it was higher in the 150cin
group than thecontrol and 75cin groups (P < 0.05).
Fig. 2. Serum glucose (A), total protein (B), albumin (C),
globulin (D) andcortisol (E) of rainbow trout, O. mykiss (mean ±
SEM, n= 9) fed diets sup-plemented with different concentrations
(0, 250, 500, 750 or 1500mg cinnamicacid kg−1) of trans-cinnamic
acid. The mean values denoted with differentletters within same
experimental days are statistically significant (P< 0.05).
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
146
-
Fig. 3. White blood cell counts (A), lymphocyte percentage (B),
granulocyte percentage (C) and monocyte percentage (D) of rainbow
trout, O. mykiss (mean ± SEM,n= 9) fed diets supplemented with
different concentrations (0, 250, 500, 750 or 1500mg cinnamic acid
kg−1) of trans-cinnamic acid. The mean values denoted withdifferent
letters within same experimental days are statistically significant
(P< 0.05).
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
147
-
Fig. 4. Phagocytic activity (A), phagocytic index (B),
respiratory burst activity (C) and potential killing activity (D)
of rainbow trout, O. mykiss (mean ± SEM, n= 9)fed diets
supplemented with different concentrations (0, 250, 500, 750 or
1500mg cinnamic acid kg−1) of trans-cinnamic acid. The mean values
denoted withdifferent letters within same experimental days are
statistically significant (P< 0.05).
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
148
-
3.5. Expression of investigated immune genes in the head kidney
of rainbowtrout
The expression profiles of the eight immune related genes in
headkidney of O. mykiss after dietary CA treatments are shown in
Fig. 6A–H.The SAA gene expression level (Fig. 6A) was higher in the
50cin, 75cin,150cin groups than the control and 25cin groups, on
the 20th day(P < 0.05). On 40 day, it was higher in the 25cin
and 150cin groupsthan the control group (P < 0.05). It was also
higher in the 50cingroup than the other experimental groups on the
40th day and 60th day(P < 0.05). Moreover, it was higher in the
25cin and 50cin groups thanthe control group, while lower in the
150cin group than the other ex-perimental groups on the 60th day (P
< 0.05). At 20 dpi, it was higherin the 50cin group than the
control, 75cin and 150cin groups(P < 0.05).
Higher IL-8 gene expression level was found (Fig. 6B) in the
75cinand 150cin groups compared to the other experimental groups on
the20th day (P < 0.05). It was also higher in the 25cin, 50cin
and 75cingroups than the control and 150cin groups on the 40th day
and 60thday (P < 0.05). However, lower level of IL-8 gene
expression wasfound in the 150cin group compared to the other
treatment groups onday 60 (P < 0.05). On the 20 dpi, it was
higher in the 25cin and 50cingroups than the control, 75cin and
150cin groups (P < 0.05).
During the course of the study, the IL-1β (Fig. 6C) and
TGF-β
(Fig. 6D) gene expression levels were higher in all CA
supplementedgroups (except 150cin group on day 60) compared to the
control group(P < 0.05). They were statistically higher in the
150cin group than thecontrol on the 20th day and 40th day (P <
0.05). However, IL-1β andTGF-β gene expression levels in the 150cin
group returned to the samelevel on day 60 and 20 dpi as the control
group.
The IFN-γ gene expression level (Fig. 6E) was higher in the
50cin,75cin and 150cin groups than the control and 25cin groups on
the 20-40th days (P < 0.05). Moreover, it was also higher in the
50cin and75cin groups than the 150cin group on the 40th day and
60th day(P < 0.05). At 20 dpi, it was higher in the 50cin and
75cin groupscompared to the control group (P < 0.05).
During 20-40th days, the TNF-α gene expression level (Fig. 6F)
washigher in all CA supplemented groups than the control group(P
< 0.05). It was also higher in the 25cin, 50cin and 75cin
groupscompared to the control group on the 60th day and 20 dpi (P
< 0.05).However, it was lower in the 150cin group than the other
experimentalgroups on the 20 dpi (P < 0.05).
The IgM gene expression level (Fig. 6G) was higher in all CA
sup-plemented groups compared to the control group on the 20-40th
days(P < 0.05). It was also higher in the 50cin and 75cin groups
than theother experimental groups on the 60th day (P < 0.05). At
20 dpi, itwas higher in the 25cin, 50cin and 75cin groups compared
to thecontrol and 150cin groups (P < 0.05).
Fig. 5. Lysozyme (A), myeloperoxidase (B), total antiprotease
activity (C), ɑ1-antiprotease (D), total Ig (E) and natural
hemolytic complement (F) in the serum ofrainbow trout, O. mykiss
(mean ± SEM, n= 9) fed diets supplemented with different
concentrations (0, 250, 500, 750 or 1500mg cinnamic acid kg−1) of
trans-cinnamic acid. The mean values denoted with different letters
within same experimental days are statistically significant (P<
0.05).
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
149
-
Higher IgT gene expression level was found (Fig. 6H) in all
CAsupplemented groups (except 150cin group on day 40) on the
20-40thdays (P < 0.05). It was also higher in the 25cin and
50cin groups(P < 0.05), but lower in the 75cin and 150cin groups
than the otherexperimental groups on the 60th day (P < 0.05).
However, the IgTgene expression level was not significantly
different among the fiveexperimental groups on the 20 dpi (P >
0.05).
3.6. Disease resistance and antibody titer results
After 60 d of feeding, the fish were challenged with Y.
ruckeri.Clinically infected fish displayed erratic swimming,
darkened in color,and redness around the mouth. Internally,
petechial hemorrhages on
the surfaces of the liver and pyloric ceca, expanded spleen and
inflamedintestine were present. Mortality in the disease-exposed
fish was ob-served between day 3 and 9 post infection (Fig. 7). The
fish startedaccepting experimental diets, 7 days after challenge.
The highest sur-vival rates (P < 0.05) and RPS (Table 4) were
found in the 25cin and50cin groups compared to other experimental
groups. The antibodytiter (Table 4) was higher in the 50cin and
75cin groups than thecontrol group.
4. Discussion
Haematological parameters are important criteria used for the
as-sessment of stress conditions, disease and health status of fish
[33]. In
Fig. 6. Gene expression profiles in head kidney of serum amyloid
A (A), interleukin 8 (B), interleukin 1, beta (C), transforming
growth factor beta (D), interferongamma (E), tumor necrosis factor
(F), immunoglobulin M (G) and immunoglobulin tau (H) of rainbow
trout, O. mykiss (mean ± SEM, n=9) fed diets supplementedwith
different concentrations (0, 250, 500, 750 or 1500mg cinnamic acid
kg−1) of trans-cinnamic acid. The mean values denoted with
different letters within sameexperimental days are statistically
significant (P< 0.05).
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
150
-
the present study, reference values of haematological parameters
de-termined for rainbow trout were similar to the values reported
in earlierstudies [73–75]; RBC: 0.74–4.45× 106mm−3, Hgb: 6.2–11.5 g
dL−1
and Hct: 22.2–45%. Furthermore, no change was detected in the
hae-matological parameters of the fish fed with CA incorporated
test diets inthe pre-challenge period. Similarly, BioAcid Ultra®
was added to fishfeeds at a rate of 0.1% and 0.2% in a different
study with O. mykiss andno change in haematological parameters
(RBC, Hct and Hgb) were re-ported at the end of 60 days feeding
trial [76]. However, in this study,increased levels of RBC and Hct
were recorded in the 50cin groupduring the post-challenge period.
This may support the fact that fish fedwith a 500mg kg−1 CA
supplemented feed were healthier similar to thefish fed with the
same probiotic and herbal additives [77–79].
Besides haematological parameters, the blood pH values are
alsoreported as specific blood pathology indicator that might be
considered,in fish studies, and is noted to show species-specific
values [73]. Normalblood pH values for O. mykiss were reported to
be in 7.28–7.6 range
[73,80]. In this study, pH was found in the range of 7.04–7.38
in thepre- and post-challenge periods, and low pH values compared
to thefindings in earlier reports were found in the experimental
groups fedwith especially CA containing diets. It was observed that
during theongoing sampling periods, the fish body buffered the
decreasing pHvalues, which returned to normal, while the fish fed
diets containing750 and 1500mg kg−1 CA were found to have decreased
blood pHvalue on the 20th day of the pre-challenge period. However,
during thepost-challenge period, the blood pH values showed a
decrease espe-cially in fish with a high survival rate, which were
fed diets containing250 and 500mg kg−1 of CA. This might be
attributed to the organicacids that might inhibit or slow the
growth of bacteria by decreasing theambient pH value and/or
cytoplasmic pH value after the bacteria passthrough cell membranes
[13]. In an earlier study [81], an increase ofthe amount of
Yersinia ruckeri in the blood was reported two days afterY. ruckeri
infection in O. mykiss. According to the findings in the
presentstudy, it is likely that CA addition to the feed might have
reduced theamount or pathogenicity of Y. ruckeri in the blood, but
further in-vestigations are encouraged to clearly justify this
hypothesis.
Cortisol is primarily a stress indicator in fish [82]. No study
on theeffects of organic acids on fish cortisol levels has been
found in theliterature so far. However, some herbal
immunostimulants have beenreported to reduce blood cortisol levels
in Labeo victorianus [83] and O.mykiss [84]. In this study, no
difference between the serum cortisollevels in the fish fed with
the experimental diets were found. Similarresults were obtained in
Tilapia (GIFT) fingerlings fed with Aloe vera-containing feed
during pre and post-challenge periods [79]. In ourstudy, it can be
noted that the addition of CA into the diet did not causestress in
fish.
Serum glucose is used as a non-specific stress indicator in fish
stu-dies [85]. In this study, CA did not show an effect on serum
glucoselevels in the pre-challenge period. Similar results were
obtained with O.mykiss [76] and Oreochromis sp [86]. fed with
different organic acids.
Fig. 7. Kaplan–Meier survivorship curves (cumulative sur-vival
[%] over time [Days 0, 5, 10, 15, 20]) for rainbowtrout after
challenge with Yersinia ruckeri; the fish were fedwith
trans-cinnamic acid supplemented diets (0, 250, 500,750 or 1500mg
cinnamic acid kg−1 feed; control diets,25cin, 50cin, 75cin and
150cin, respectively) prior to bac-terial challenge.
Table 4Mortality rate, survival, relative percentage survival
(RPS) and antibody titer ofinfected rainbow trout fed with cinnamic
acid (CA) at different ratios.
Mortality Rate(%)
Survival Rate(%)
RPS Antibody Titer (Log2)1
Control 50.67 49.33 – 2.35 ± 0.16b
25cin 25.33 74.67 50.00 2.93 ± 0.05ab
50cin 25.33 74.67 50.00 3.02 ± 0.08a
75cin 50.67 49.33 0 3.10 ± 0.06a
150cin 57.33 42.67 −13.16 2.95 ± 0.07ab
n= 75 for each group.1Nine fish per group (3 fish/tank) randomly
selected from surviving fish at day21 dpi. Agglutination antibody
titer assay was also performed for 2 fish fromeach tank (6
fish/group) before fish were infected with pathogen. No
aggluti-nation titer against Y. ruckeri was detected in
non-infected fish.
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
151
-
However, CA decreased blood glucose level by increasing insulin
re-lease in diabetic mice [47]. The hypoglycaemic effect of CA was
seen toemerge in the first 3 h of the time period when diabetic
mice consumed5 and 10mg per kg body weight. However the
postprandial effect of CAon glucose is still not known for fish. In
this study, decreased levels ofserum glucose in fish fed with diets
containing 750 and1500mg kg−1 CA were observed in the
post-challenge period. There-fore, further studies are needed in
order to shed better light on thehypoglycaemic effect of CA on
fish.
White blood cells are the main components of the innate
immuneresponse, which regulate immune function in teleost fish and
play amajor role in combating diseases [17]. No exact information
has beenobtained regarding how organic acids stimulate blood cells
to this day[87]. In this study, white blood cell (WBC) levels in
fish did not changesignificantly during the experiment. Similar
results were also obtainedin Cirrhinus mrigala juveniles fed with
0.5% organic acid mixture sup-plemented feeds [88]. However, in
different studies, WBC counts in-creased in pre-challenge and/or
post-challenge periods in line with theincreased organic acid dose
(1% and over) [17,88]. On the other hand,the addition of BioAcid
Ultra® to O. mykiss feeds at 0.1% and 0.2%increased the WBC counts
of fish [76]. These results indicate that theorganic acid type and
dose may show different effects on WBC counts.For instance, WBC
counts of Oreochromis sp. hybrids fed at a rate of 2%with different
kinds of organic acids (butyrate, acetate, propionate andformate)
were reduced by the addition of the formate, whereas otherorganic
acid additives did not affect the WBC counts [86].
The immune cells which are found in the blood are
basophils,neutrophils, eosinophils, monocytes, and lymphocytes
[89]. Lympho-cytes are important cells that can affect immune
responses in fish byproducing antibodies and also boosting
macrophages activity [90]. Onthe other hand, fish are endowed with
an innate complex defensesystem. It is anticipated that this system
becomes more significantagainst bacteria compared to specific
immunity [91]. Granulocytes areinvolved with non-specific cellular
defense responses of teleost fish[92], by deactivating pathogen
microorganisms in the body. During thepre-challenge period of the
present study, a decrease was observed inthe lymphocyte ratio and
an increase in the granulocyte ratio was ob-served in fish when fed
diets supplemented with CA, especially in the250 and 500mg kg−1 CA
incorporated diet group. The decreasing levelsof lymphocytes here
might be attributed to the induced transfer oflymphocytes from the
blood into lymphoid organs in fish, as has beenreported earlier in
mammals [101]. On the other hand, an increasednumber of circulating
neutrophils could be expected since some im-munostimulants inhibit
neutrophil migration through capillary en-dothelial barrier, via
increasing TNF-α and IL-8 gen expressions [102].In the present
study, TNF-α and IL-8 gen expressions in the kidney in-creased when
fish was given CA supplemented diets, especially at levelsof 250
and 500mg kg−1. It might be possible that dietary CA also couldhave
triggering effect on TNF-α and IL-8 gen expressions in the
neu-trophils, since similar findings were reported in the renal
cells (in vitro)of Ctenopharyngodon idella after exposure to
3,4,5-trimethoxy cinnamicacid, an analog of CA, in terms of
increased TNF-α gene expression inthe cells [46]. However, it seems
that information on the exact me-chanism of CA is still lacking,
thus needs further investigations.
Our results in terms of decreasing lymphocyte and
increasinggranulocyte ratio are in full agreement with findings of
earlier studiesin Oreochromis sp. hybrids fed diets incorporated
with 2% formate [86]and Dicentrarchus labrax fed with 1%
herb-supplemented diets such asthyme (Thymus vulgaris), rosemary
(Rosmarinus officinalis) and fenu-greek seed (Trigonella foenum
graecum) [33,93].
Among the serum proteins, albumin and globulin are the
majorproteins, which play a significant role in the immune response
[94]. Inthe present study, the dietary CA especially at 250 and/or
500mg kg−1
levels significantly increased serum protein and globulin than
thecontrol group without any change in the albumins. Since the
globulinwas calculated by subtracting albumin from total protein in
the present
study, it can be assumed that the remainders were globulins.
Hence, thesimultaneous increase of both blood protein and globulin
might be dueto the stable level of albumins. Increases in serum
protein and globulinlevels are usually thought to be associated
with a stronger innate im-mune response in fish [33]. It is known
that nearly all serum proteinsare produced and secreted by
hepatocytes [95], and some globulins areproduced in the liver while
others produced by the immune system[96]. A close correlation was
reported between the levels of proteinsynthesized in liver tissue
and serum protein levels [97]. Hence, in thepresent study, the
elevated total serum protein levels might be attrib-uted to the
increased levels of protein synthesis in liver tissue of fish
fedwith CA incorporated diets. This results is in agreement with a
previousstudy in fish treated with organic acid [87].
Parallel with our study, innate immune parameters have also
beendeveloped in fish and/or shrimp species fed with organic
acid-con-taining feeds. For instance, Epinephelus fuscoguttatus fed
with a dietcontaining 1.0 or 2.0 g kg−1 sodium alginate (sodium
salt of alginicacid) showed an increase in non-specific immune
response by in-creasing respiratory burst, phagocytic activity and
ACH50 [98]. Redaet al. [17] added 1.0 and/or 2.0 g kg−1 formic and
propionic acid/saltmixture to the feeds of O. niloticus and
reported that innate immunitydeveloped with increasing serum
killing percentage, serum lysozymeactivity and serum nitric oxide.
Feeding Litopenaeus vannamei with2.0 g kg−1 of acidic calcium
sulphate resulted in increased haemolymphprotein concentration,
haemocyte phagocytic capacity, phenoloxidaseactivity and
respiratory burst [99].
In a different study, a mixture of organic acids was added to
the feedof C. mrigala juveniles at different rates (0.5%, 1% and
1.5%), pre-challenge (60 days after feeding) and post-challenge (15
days afterbeing infected with Aeromonas hydrophilla) lysozyme
activities of allorganic acid supplemented groups were increased
[88]. However, re-spiratory burst activity increased only with the
addition of high-doseorganic acid (1.5%) during the pre-challenge
period [88]. In the presentstudy, lysozyme and respiratory burst
activities increased in fish feddiets supplemented with CA during
the pre-challenge period, while thelysozyme activities of fish
demonstrated similarities and respiratoryburst activity increased
only in fish when fed diets containing500mg kg−1 CA during the
post-challenge period. Additionally, amongall of the
immunity-related parameters (excluding respiratory burstactivity
and albumin) tested in our study in the post-challenge period,only
antiprotease activity was found to be high in fish fed with 250
and500mg kg−1 CA supplemented feeds. These different results might
beassociated with differences in experimental conditions,
post-challengeperiods, organic acid types, and fish and/or pathogen
types. Moreover,this study also revealed that increases or
decreases occurred in theimmune parameters tested with CA addition
was time-depend. To ourknowledge, immunological memory is not
present in the fish innateimmune system. Also, fish innate immune
system response duration isshorter in comparison with the specific
system [100]. Moreover, severalhumoral and cellular factors
constitute the innate defenses in combi-nation and they may show
differential specificity in the presence of agiven immunomodulatory
substance [101]. As a result of these specificfeatures, each
activity reached the maximum value, which disappeareddepending on
time and dose. The peaks of different activities presentedin
earlier reports might not be completely similar in terms of
magnitudeand time [102,103].
According to our knowledge, no previous study is available so
far onthe relationship between polyphenolic organic acid
supplementationand immune-related genes in aquatic organisms. For
this reason, dis-cussion section compared SAA, IL-8, IL-1β, TGF-β,
IFN-γ, TNF-α, IgM andIgT gene expression changes obtained in the
head-kidney for O. mykisswith the effects of different
immunostimulants, organic acids and/orsalts on the same genes
obtained by different studies. In this study,immune relevant genes
tested in the head-kidney of the rainbow troutbecame significantly
up-regulated by the CA addition to the feed. It isreported that
SAA, an acute phase protein that we also investigated
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
152
-
regarding its efficiency, plays a role for detoxification of
endotoxin,mediation of inflammatory responses, proliferation of
endothelial celland induce leukocyte extravasation [104]. In the
present study, in-creases were observed in the levels of SAA
expression in the head-kidneys at different sampling periods with
the addition of 250, 500and/or 750mg kg−1 CA to fish diets. The
most significant increasescompared to the control were detected in
the 500mg kg−1 CA supple-mented group at the 20th, 40th, 60th and
20dpi, 4.1, 7.9, 5.6 and 2.1-fold, respectively. Besides, it is
fair to say that there is a positive cor-relation between the
innate immune parameters (such as phagocyticactivity, respiratory
burst activity, etc.) that we tested in our study withSAA
expression levels and resistance to the Y. ruckeri. As is known,
SAAis believed to have a significant role for Gram-negative
bacteria as aninnate immune recognition protein [105]. In parallel
with the resultswe obtained, it is shown that SAA binds
Gram-negative bacteria,functions as an opsonin and accordingly
enhances phagocytosis, re-spiratory burst activity and secretion of
inflammatory molecule such asTNF-α [105].
In support of our study, liver SAA levels increased
significantly inPerca flavescens fed with 1% Astragalus
membranaceus and Glycyrrhizaglabra mixture (1: 1) added feeds for 4
weeks [106]. Moreover, 30-dayfeeding with prebiotic
(mannan-oligosaccharides) and probiotics (Sac-charomyces
cerevisiae) addition in O. mykiss feeds significantly
increasedliver SAA expression levels in the presence of chronic
stress (High stockdensity) or in its absence (only for probiotic
group) and when the fishwere infected with Vibrio anguillarum
[39].
Unlike our study, Skov et al. [45] added 1% β-1,3-glucan to
O.mykiss feeds, and fish were fed with test feeds for 13 days prior
to beingvaccinated with Y. ruckeri and 55 days prior to being
infected with Y.ruckeri and no change was observed in the
head-kidney SAA expressionlevels and plasma lysozyme activity. In
addition, researchers reportedthat in the post-challenge period (3,
14 and 28 dpi), β−1,3-glucan didnot have a significant impact on
the SAA expression levels of the un-vaccinated fish head kidneys
[45]. The liver SAA expression levels of O.mykiss fish fed with
0.2%, 2% and 5% β-1,3-glucan-supplemented feedsfor 13 days were
found to be similar to that of the control, only 14 daysafter the
fish were infected with Ichthyophthirius multifiliis (28th day
ofthe test) SAA levels increased in the high-dose
glucan-supplementedgroup [107]. Again O. mykiss was fed with feeds
supplemented withmannan-oligosaccharides (MOS), probiotic bacteria,
plant extracts, β-glucan and nucleotides mixtures for 30 and 60
days before being in-fected with I. multifiliis, and the fin SAA
expression levels showed si-milarities in both the pre- and
post-challenge periods [108]. Not allinternal organ SAA expression
levels showed changes in O. mykiss frybathed with β-1,3-glucan
[109]. It can be said that differences betweenstudies may be
devoted to the duration use and dose of im-munostimulants.
Cytokines have a pivotal role in the immune system binding
tospecific receptors at the cell membrane, setting off a cascade
that leadsto induction, enhancement or inhibition of a number of
cytokine-regulated genes in the nucleus [110]. IL-1β, IFN-γ and
TNF-α, proin-flammatory cytokines motivate immune cells, enhancing
phagocytosis,respiratory burst activity and nitric oxide production
[17,111]. The IL-8chemokine takes part in the early inflammatory
reaction with itcreating chemoattractive effect on neutrophils in
O. mykiss [112]. Inthis study, head-kidney pro-inflammatory
cytokines (IL-1β, IFN-γ andTNF-α) and chemokine (IL-8) were mostly
up-regulated depending onthe CA dosage (except for 1500mg kg−1 CA
addition) and time.
The most significant increases at the end of the pre-challenge
period(60th day) were obtained as 28.8-fold for IL-1β, 6.2-fold for
IL-8, and4.7-fold for TNF-α for fish fed with 250mg kg−1. In fish
fed with 500and 750mg kg−1 CA containing feed, significant
increases were ob-tained as 82.8 and 81.3-fold for IL-1β, 34.5 and
45-fold for IFN-γ, 4.7and 9.4 fold for TNF-α, and 6.7 and 10.6-fold
for IL-8. Ivanovska et al.[37] indicated that the level of serum
IL−1β of mice increased, whichmeans that CA could activate
macrophages and the initial events of the
immune response are effected [113]. 3,4,5-trimethoxy cinnamic
acid,an analog of CA, has also been reported to up-regulate IL-1β
and TNF-αexpressions in Ctenopharyngodon idella renal cells in
vitro [46]. CA up-regulates the immunological gene expressions at
cellular dimension andthus it supports the results obtained in our
study.
Similar to this study, the addition of organic acids and/or
salts tofish feeds increased immune-related gene expression levels
in differentorgans. For instance, Reda et al. [17] reported that
the up-regulation ofIL-1β and TNF-α expression in liver and kidney
by the mixture of formicacid, propionic acid and calcium propionate
O. niloticus occurred after60 days of feeding. The addition of 10
or 20 g kg−1 propionic acid so-dium salt to Danio rerio feeds
remarkably regulated the intestine TNF-αand IL-1β genes at the end
of 60 days feeding [114]. Furthermore,foregut IL-1β (11.3-fold) and
TNF-α (9.04-fold) gene expressions weresignificantly up-regulated
in MSB3·0 type of Cyprinus carpio fed for 8weeks with two different
types of butyric acid sodium salt micro-encapsulated at 300mg kg−1
compared to MSB1·5 type, however dif-ferent changes were observed
in gene expressions in comparison withdifferent regions of the gut
(fore, mid or distal gut) [115]. On the otherhand, addition of 0.2%
sodium butyrate to D. labrax feeds did not leadto any changes in
liver and intestinal IL-1β, TNF-α and IL-8 gene ex-pressions after
8 weeks feeding [116]. Tian et al. [117] added500–2000mg kg−1
sodium butyrate to the feeds of C. idella and re-ported that
microencapsulated butyrate was more effective (3.5-fold)on the
intestinal immune function than the powdery sodium butyrate.
The most remarkable increases in the post-challenge period of
ourstudy were obtained as 3.40-fold for IL-1β and IL-8, 2.6-fold
for IFN-γand 4.8-fold for TNF-α for fish fed the 250mg kg−1 CA
supplementeddiet. They were also determined as 3.2 and 3.5-fold for
IL-1β, 5.9 and3.9-fold for IFN-γ and 4.4 and 4.5 fold for TNF-α,
respectively in fish fedwith 500 and 750 kg−1 CA. Besides, IL-8
gene expression increased 4.5-fold in fish fed with 500mg kg−1 CA.
In the post-challenge period,compared to the control, head-kidney
TNF-α gene expression was de-creased only in fish fed with 1500mg
kg−1 CA containing feed.Likewise, the addition of 1000, 1500 and
2000mg kg−1 sodium buty-rate to feeds of C. idella reduced TNF-α
gene expressions in the proximalintestine during the post-challenge
period (14 days after infection withA. hydrophila) compared to the
control [117]. However, in the samestudy, fluctuations were
observed in the TNF-α, IL-1β, IFN-γ and IL-8gene expression levels
in different regions of the intestine (proximal,middle or distal)
of the fish fed with 1000mg kg−1 or higher levels ofsodium
butyrate. Contrary to the findings in our study, these genesnever
showed an increase compared to the control.
TGF-β plays a vital role in the immune system by promoting
toler-ance by means of regulation of lymphocyte proliferation,
differentia-tion, and survival [118]. Moreover, initiation and
resolution of in-flammatory responses are controlled by TGF-β by
means of regulation ofchemotaxis, activation, and survival of
lymphocytes, dendritic cells,natural killer cells, mast cells,
macrophages, and granulocytes [119]. Inthe present study,
head-kidney TGF-β gene expressions were sig-nificantly up-regulated
(3.53-fold and over) in the CA supplementedgroups (except 60th day
and 20 dpi in the 150cin group). At the end ofthe 60-day feeding
period, the head-kidney TGF-β gene expression le-vels were
increased by 23.2, 21 and 11.8-fold in fish fed with 250, 500and
750mg kg−1 CA, respectively. Similar to our study,
particularlyforegut TGF-β gene expressions in C. carpio fed for 8
weeks with sodiumbutyrate were significantly up-regulated
(7.9-fold) [115]. In the post-challenge period of our study,
head-kidney TGF-β gene expression le-vels of fish fed with 250, 500
and 750mg kg−1 CA increased 3.5, 4 and4-fold, respectively.
Similarly, the middle or distal intestinal TGF-β1and -β2 gene
expression levels in the post-challenge period were sig-nificantly
increased in C. idella fed with 1000mg kg−1 sodium butyrate,however
no changes were recorded in the increasing and/or decreasingdoses
[117].
In teleost fish, three different immunoglobulin (Ig) isotypes
can beidentified, namely, IgM, IgD, and teleost-specific IgT
[120].
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
153
-
Immunoglobulin M (IgM), known as the primary antibody of fish,
andthe main constituent of the humoral immune system in teleost may
helpto determine and neutralize foreign antigens such as bacteria
andviruses [121]. The most recent immunoglobulin class
distinguished invertebrate species is IgT [122], and in various
teleost their genomicorganization, protein structure and
biochemical functions have beenrevealed [123]. The mucosal immune
function of IgT is very evident inO. mykiss gut [124], skin [125]
and gill [126]. Furthermore, IgT- andIgM-positive cells are
reported to disperse widely in the liver, heart andhead kidney of
O. mykiss [127].
In this study, head-kidney IgM expression levels increased in
fish fedwith 500 and 750mg kg−1 CA addition in time, and it was
observedthat these increases were 10.5 and 13.6-fold, respectively
at the end ofthe pre-challenge period compared to the control. A
similar trend wasnot observed in the IgT expression levels. In all
CA supplementedgroups, 4.1 and 10.6-fold increases were observed
with the highestexpression levels recorded on day 20, and day 60
only in the 250 and500mg kg−1 supplemented groups, respectively.
Similar to our study,Lactobacillus rhamnosus addition to O. mykiss
feeds increased im-munoglobulin gene expression levels in kidney
and spleen [128]. Lac-tobacillus sakei and L. sakei + inulin
supplemented diet up-regulatedexpression of IgM at weeks 4 and 8 in
intestine and head kidney ofMycteroperca rosacea [129]. However,
unlike our study, head-kidneyIgM gene expression levels in S.
aurata fed with feed containing pro-biotic (Shewanella putrefaciens
Pdp11) for 4 weeks remained unchanged[130].
In the present study, no difference occurred in the head-kidney
IgTexpression levels in experimental groups at 20 dpi. Conversely,
theintestinal IgT expression levels of O. mykiss fed with L.
plantarum for 21days remained unchanged, however fish were fed for
another 15 daysafter being infected with Lactococcus garvieae and
probiotic additionsignificantly up-regulated IgT expressions [131].
In our study, IgM ex-pression levels at 20 dpi were increased by
2.5, 4.8 and 2.9-fold in the250, 500 and 750mg kg−1 CA supplemented
groups, respectively. It isevident that the duration of feeding
with different immunostimulantadditions in the pre- or
post-challenge periods result in fluctuations onlevels of gene
expressions with different tissues in fish. For example, itwas seen
that dietary incorporation of probiotic (Bacillus sp.),
im-munostimulant (palm fruit extract) or a mixture of the two +
probiotic(S. putrefaciens Pdp11) to S. aurata feeds did not show
any effect on skinIgT gene expression levels, while; increased skin
IgM gene expressionlevels were observed if fish at week two [132].
However, in the 4thweek, opposite results were obtained [132]. It
was reported that 3,4,5-trimethoxy cinnamic acid, an analog of CA,
did not affect the IgM ex-pression levels of kidney cells of C.
idella at 2, 8 and 24th hour ex-posure, however it up-regulated at
10mg L−1 concentration on the 48thhour and no changes were recorded
in the increasing and/or decreasingdoses [46]. This can explain the
impacts created by the different im-munostimulants and CA on
immunoglobulin and/or other gene ex-pressions depending on time and
dose.
Additionally, it is not surprising that CA up-regulates the
cytokinegene expression levels of fish tissues. Earlier studies
reported that or-ganic acid may improve gram-positive and
gram-negative bacteria po-pulations, which can stimulate the
production of cytokine through gut-associated lymphoid tissue due
to their selective promoter effects onintestinal microbiota
[17,118,140]. This was supported in a recentstudy, where malic acid
(an organic acid) and probiotics (B. subtilis)mixture enhances both
growth and health through its positive impacton the
gastrointestinal tract, liver function, blood parameters and
non-specific immune responses in O. niloticus [87]. In a similar
way, it isfound that other dietary additives, including lupin,
mango and stingingnettle [38], probiotic [131], caper [133],
mannan-oligosaccharides andS. cerevisiae [39] also increased the
pro-inflammatory (IL-1β, TNF-α andIL-8) and/or anti-inflammatory
(TGF-β) gene expression levels of O.mykiss tissues.
In this study, SAA, IL-8 and IgT expression levels in the
head-kidney
of fish fed with high dose (1500mg kg−1) CA containing feeds
weregenerally at the highest level on day 20, whereas gradual
decreaseswere observed on the 40th and 60th days and they became
significantlydown-regulated on day 60. This suggests that addition
of high doses ofCA in O. mykiss feeds and overfeeding for more than
40 days negativelyaffect fish. However, it was not easy to
determine whether the effectseen at gene expression levels had
immunostimulatory or im-munosuppressive characteristics since it
was not recorded in the sur-vival curve.
There is a growing interest in the prophylactic abilities of
organicacids on bacterial challenge to aquatic animals in recent
years [13]. Ithas been reported that different organic acid
additives provide re-sistance to pathogenic bacteria Edwardsiella
tarda in olive flounder[134] and to Aeromonas sobria in O.
niloticus fingerlings [17]. However,in the literature, there is
only one study on the resistance developmentsof the organic
acid-fed O. mykiss to Y. ruckeri. Jaafar et al. [12] fed O.mykiss
with a mixture of propionic acid and formic acid, but the fish
didnot gain resistance to the Y. ruckeri pathogen. Only few reports
havebeen published on the use and effects of various dietary
additives for O.mykiss exposed to Y. ruckeri pathogen. Among these
addititives garlicpowder, mannanoligosaccharide and
poly-β-hydroxybutyrate are themost salient ones [135,136], with
reference to resistance of fish againstY. ruckeri. However,
different than the present study, none of theseearlier reports
presented information on gen expressions at molecularlevel.
According to the findings in the present study, feeding O.
mykissjuveniles with 250 and 500mg kg−1 CA for 60 days decreased
mortalityrate against Y. ruckeri, but similar mortality rates were
found in thegroups with increasing doses when compared to the
control. It has beenreported that the addition of 0.001% of
Ducrosia anethifolia essence oilto O. mykiss feed slightly
increases survival rate of fish against Y.ruckeri, but negative
effects were noted on the survival rate at in-creasing
concentrations of 0.01% and 0.1% [137]. Similarly, in Or-eochromis
sp. fingerlings fed diets with 0.5% incorporation of a mixtureof
organic acids increased survival rate against Streptococcus
agalactiae,however, survival was not affected when dietary
inclusion of the or-ganic acid mixture increased to 1.0% [138].
Improved resistanceagainst Y. ruckeri in O. mykiss by CA additives
could be due to im-munomodulatory effects which was determined by
different assays inthis study, and antimicrobial effect of CA
against this pathogen [31].
In infected O. mykiss a significant and a positive corresponding
re-lationship was obtained between antibody titers and protection
againstlive Y. ruckeri [139,140]. Siwicki and Dunier [141]
presented a max-imum of antibody secreting cells in the O. mykiss
on the 21th post-vaccination day. In this study, the antibody titer
analyzed on day 20was found to be high particularly in fish with
high survival rate, whichwere fed with feeds containing 500mg kg−1
of CA, however no corre-lation was seen between the survival rate
and antibody titers in theother treatment groups. This suggests
that the impact of CA on thesurvival rate can be explained by
changes in the innate immune para-meters, rather than specific
antibody production level, as is the casewith fish fed on different
immunostimulant supplemented feeds[69,142,143].
5. Conclusion
In today's fish farming, natural feed additives alternative to
anti-biotics are of significant importance, due to their effects on
specificdiseases with different durations of action or effects,
similar to che-motherapeutic drugs. The present study is the first
attempt to in-vestigate the effects of CA on the immunity
parameters of Oncorhynchusmykiss and its resistance to Yersinia
ruckeri. Findings of our studyespecially showed that (1) dietary CA
improved the immunity by in-creasing granulocyte (%), phagocytic
activity, phagocytic index, re-spiratory burst activity, potential
killing activity in the blood of fish,and lysozyme,
myeloperoxidase, total Ig and CH50 in the serum of fish;
S. Yılmaz, S. Ergün Fish and Shellfish Immunology 78 (2018)
140–157
154
-
(2) dietary CA orchestrated the inflammatory response by
up-regulatingthe SAA, IL-8, IL-1β, TGF-β, IFN-γ, TNF-α, IgM and IgT
in the headkidney of fish; (3) dietary CA increased the survival
rate of the fishinfected with Y. ruckeri. Therefore, feeding O.
mykiss with diets con-taining 250–500mg kg−1 CA for a period of 60
days might be suggestedas optimal to enhance the immunity and
disease resistance against Y.ruckeri. However, this study is a
single experimental model, and furtherinvestigations on the use of
different concentrations of trans-cinnamicacid (CA) in different
fish species and different fish pathogens are en-couraged in terms
of the evaluation of various blood parameters, sinceit is likely
that the responses of fish seem to be subject to change inrelation
to different doses.
Ethics statement
Fish experiments were performed in accordance with the
guidelinesfor fish research from the animal ethics committee at
CanakkaleOnsekiz Mart University (Protocol Number: 2013/03-22).
Conflicts of interest
No potential conflict of interest.
Acknowledgments
This study is summarized from a part of the PhD thesis of the
firstauthor, supported by TUBITAK (Scientific and Technological
ResearchCouncil of Turkey) under the Project No: 113O364. We also
thank Prof.Dr. Murat Yigit and Prof. Dr. Yesim Buyukates for
reviewing themanuscript.
References
[1] I.G. Cowx, Cultured Aquatic Species Information
Programme-Oncorhynchus mykiss,(2006)
http://www.fao.org/fishery/culturedspecies/Oncorhynchus_mykiss.
[2] TÜİK, Fishery Statistic, Turkish Statistical Institute,
Türkiye, 2015.[3] B. Austin, D.A. Austin, Bacterial Fish Pathogens,
Springer, 2012.[4] D.A. Austin, P.A.W. Robertson, B. Austin,
Recovery of a new biogroup of Yersinia
ruckeri from diseased rainbow trout (Oncorhynchus mykiss,
Walbaum), Syst. Appl.Microbiol. 26 (1) (2003) 127–131.
[5] J.K. Chettri, R.M. Jaafar, J. Skov, P.W. Kania, I.
Dalsgaard, K. Buchmann, Boosterimmersion vaccination using diluted
Yersinia ruckeri bacterin confers protectionagainst ERM in rainbow
trout, Aquaculture 440 (2015) 1–5.
[6] U. Ispir, M. Dorucu, Effect of immersion booster vaccination
with Yersinia ruckeriextracellular products (ECP) on rainbow trout
Oncorhynchus mykiss, Int. Aquat.Res. 2 (2) (2010) 127–130.
[7] E. Tobback, A. Decostere, K. Hermans, F. Haesebrouck, K.
Chiers, Yersinia ruckeriinfections in salmonid fish, J. Fish Dis.
30 (5) (2007) 257–268.
[8] Y.D. Huang, G.B. Michael, R. Becker, H. Kaspar, J. Mankertz,
S. Schwarz,M. Runge, D. Steinhagen, Pheno- and genotypic analysis
of antimicrobial re-sistance properties of Yersinia ruckeri from
fish, Vet. Microbiol. 171 (3–4) (2014)406–412.
[9] S.Q.A. Shah, S. Karatas, H. Nilsen, T.M. Steinum, D.J.
Colquhoun, H. Sorum,Characterization and expression of the gyrA
gene from quinolone resistant Yersiniaruckeri strains isolated from
Atlantic salmon (Salmo salar L.) in Norway,Aquaculture 350 (2012)
37–41.
[10] C. Chi, S.S. Giri, J.W. Jun, S. Yun, H.J. Kim, S.G. Kim,
S.C. Park, Immune responseof the bay scallop, Argopecten irradians,
after exposure to the algicide palmitoleicacid, Fish Shellfish
Immunol. 57 (2016) 371–378.
[11] Y. Gao, J. He, Z. He, Z. Li, B. Zhao, Y. Mu, J.Y. Lee, Z.
Chu, Effects of fulvic acid ongrowth performance and intestinal
health of juvenile loach Paramisgurnus dab-ryanus (Sauvage), Fish
Shellfish Immunol. 62 (2017) 47–56.
[12] R.M. Jaafar, P.W. Kania, A.H. Larsen, D.S. Nielsen, B.
Fouz, C. Browdy,K. Buchmann, Gut microbiota changes in rainbow
trout, Oncorhynchus mykiss(Walbaum), during organic acid feed
supplementation and Yersinia ruckeri in-fection, J. Fish. Dis. 36
(6) (2013) 599–606.
[13] W.K. Ng, C.B. Koh, The utilization and mode of action of
organic acids in the feedsof cultured aquatic animals, Rev.
Aquacult. 9 (4) (2017) 342–368.
[14] W.K. Ng, C.B. Koh, K. Sudesh, A. Siti-Zahrah, Effects of
dietary organic acids ongrowth, nutrient digestibility and gut
microflora of red hybrid tilapia, Oreochromissp., and subsequent
survival during a challenge test with Streptococcus
agalactiae,Aquacult. Res. 40 (13) (2009) 1490–1500.
[15] T. Pérez-Sánchez, I. Ruiz-Zarzuela, I. Blas, J.L. Balcázar,
Probiotics in aquaculture:a current assessment, Rev. Aquacult. 6
(3) (2014) 133–146.
[16] S. Pourmozaffar, A. Hajimoradloo, H.K. Miandare, Dietary
effect of apple cider
vinegar and propionic acid on immune related transcriptional
responses andgrowth performance in white shrimp, Litopenaeus
vannamei, Fish ShellfishImmunol. 60 (2017) 65–71.
[17] R.M. Reda, R. Mahmoud, K.M. Selim, I.E. El-Araby, Effects
of dietary acidifiers ongrowth, hematology, immune response and
disease resistance of Nile tilapia,Oreochromis niloticus, Fish
Shellfish Immunol. 50 (2016) 255–262.
[18] S. Nayak, Probiotics and immunity: a fish perspective, Fish
Shellfish Immunol. 29(1) (2010) 2–14.
[19] C.M. John, P. Sandrasaigaran, C.K. Tong, A. Adam, R.
Ramasamy,Immunomodulatory activity of polyphenols derived from
Cassia auriculata flowersin aged rats, Cell. Immunol. 271 (2)
(2011) 474–479.
[20] N. Kamalakkannan, P.S. Prince, Antihyperglycaemic and
antioxidant effect ofrutin, a polyphenolic flavonoid, in
streptozotocin-induced diabetic wistar rats,Basic Clin. Pharmacol.
Toxicol. 98 (1) (2006) 97–103.
[21] M. Krifa, I. Bouhlel, L. Ghedira-Chekir, K. Ghedira,
Immunomodulatory and cel-lular anti-oxidant activities of an
aqueous extract of Limoniastrum guyonianum gall,J. Ethnopharmacol.
146 (1) (2013) 243–249.
[22] C.C. Tangney, H.E. Rasmussen, Polyphenols, inflammation,
and cardiovasculardisease, Curr. Atherosclerosis Rep. 15 (5) (2013)
324.
[23] D.K. Gessner, R. Ringseis, K. Eder, Potential of plant
polyphenols to combat oxi-dative stress and inflammatory processes
in farm animals, J. Anim. Physiol. Anim.Nutr. 101 (4) (2017)
605–628.
[24] S. Said, F.M. Neves, A.J.F. Griffiths, Cinnamic acid
inhibits the growth of thefungus Neurospora crassa, but is
eliminated as acetophenone, Int. Biodeterior.Biodegrad. 54 (1)
(2004) 1–6.
[25] M. Sova, Antioxidant and antimicrobial activities of
cinnamic acid derivatives,Mini Rev. Med. Chem. 12 (8) (2012)
749–767.
[26] E. Pontiki, D. Hadjipavlou-Litina, K. Litinas, G.
Geromichalos, Novel cinnamic acidderivatives as antioxidant and
anticancer agents: design, synthesis and modelingstudies, Molecules
19 (7) (2014) 9655–9674.
[27] L. Liu, W.R. Hudgins, S. Shack, M.Q. Yin, D. Samid,
Cinnamic acid - a naturalproduct with potential use in cancer
intervention, Int. J. Canc. 62 (3) (1995)345–350.
[28] M. Fernandez, M. Saenz, M. Garcia, Natural Products:
anti-inflammatory activityin rats and mice of phenolic acids
isolated from Scrophularia frutescens, J. Pharm.Pharmacol. 50 (10)
(1998) 1183–1186.
[29] U. Food, D. Administration, Code of Federal Regulations
vol. 3, (2010) Title 21.[30] V.G.N.V. Prasad, P.L. Swamy, T.S. Rao,
G.S. Rao, Antibacterial synergy between
quercetin and polyphenolic acids against bacterial pathogens of
fish, Asian Pac. J.Trop. Dis. 4 (2014) S326–S329.
[31] S. Yilmaz, The Effect of Dietary Cinnamic Acid or Bacillus
subtilis on GrowthPerformance and Immunological Parameters in
Rainbow Trout, Department ofAquaculture, Çanakkale Onsekiz Mart
University, Graduate School of Natural andApplied Sciences,
Türkiye, 2017, p. 210.
[32] S. Yilmaz, S. Ergun, Effects of garlic and ginger oils on
hematological and bio-chemical variables of sea bass Dicentrarchus
labrax, J. Aquat. Anim. Health 24 (4)(2012) 219–224.
[33] S. Yilgmaz, S. Ergün, E.S. Celik, Effect of dietary spice
supplementations on wel-fare status of sea bass, Dicentrarchus
labrax L, Proc. Natl. Acad. Sci. India B Biol.Sci. 86 (1) (2016)
229–237.
[34] S. Yılmaz, Ü. Acar, O.S. Kesbiç, N. Gültepe, S. Ergün,
Effects of dietary allspice,Pimenta dioica powder on physiological
responses of Oreochromis mossambicusunder low pH stress,
SpringerPlus 4 (1) (2015) 719.
[35] F. Fazio, C. Faggio, A. Torre, M. Sanfilippo, G. Piccione,
Effect of Water Quality onHematological and Biochemical Parameters
of Gobius niger Caught in Faro Lake(Sicily), (2013).
[36] F. Fazio, C. Saoca, S. Casella, G. Fortino, G. Piccione,
Relationship between bloodparameters and biometric indices of
Sparus aurata and Dicentrarcus labrax culturedin onshore tanks,
Mar. Freshw. Behav. Physiol. 48 (4) (2015) 289–296.
[37] N. Ivanovska, H. Neychev, Z. Stefanova, V. Bankova, S.
Popov, Influence of cin-namic acid on lymphocyte proliferation,
cytokine release and Klebsiella infectionin mice, Apidologie 26 (2)
(1995) 73–81.
[38] E. Awad, W.J. Mitchell, B. Austin, Effect of dietary
supplements on cytokine geneexpression in rainbow trout,
Oncorhynchus mykiss (Walbaum), J. Fish. Dis. 34 (8)(2011)
629–634.
[39] D. Castro-Osses, C. Carrera-Naipil, C. Gallardo-Escarate,
A.T. Goncalves,Functional diets mo