Fate of feed plant DNA monitored in water buffalo ( Bubalus bubalis) and rabbit ( Oryctolagus cuniculus

5 (2006) 12–18www.elsevier.com/locate/livsci

Livestock Science 10

Fate of feed plant DNA monitored in water buffalo (Bubalus bubalis)and rabbit (Oryctolagus cuniculus)

Raffaella Tudisco a,⁎, Federico Infascelli a, Monica Isabella Cutrignelli a, Fulvia Bovera a,Caterina Morcia b, Primetta Faccioli b, Valeria Terzi b

a Dipartimento di Scienze Zootecniche e Ispezione degli Alimenti, Sez. B. Ferrara, Universita di Napoli “Federico II”,Via Delpino, 1-80137 Napoli, Italy

b Istituto Sperimentale per la Cerealicoltura, C.R.A., Via San Protaso, 302 29017 Fiorenzuola d' Arda (PC), Italy

Received 30 March 2005; received in revised form 7 February 2006; accepted 5 April 2006

Abstract

The effect of the digestion process in the gastro-intestinal tract (GIT) of animal models on the fate and integrity of plant DNAhas been widely evaluated since DNA availability and integrity is a key factor for hypothetical horizontal gene transfer ofrecombinant DNA from GM crop-derived feeds to animal and human gut microflora. In this study, plant DNA sequences from highand low copy number genes were monitored in GIT and tissues of buffaloes and rabbits. Using a real-time PCR approach to trackplant DNA in animal samples, we demonstrated the persistence of fragmented plant DNA blood and tissues of buffaloes and rabbitsraised with conventional feeding.© 2006 Elsevier B.V. All rights reserved.

Keywords: Buffalo; Rabbit; Plant DNA survival; Real-time qPCR

1. Introduction

The fate and integrity of forage plant DNA in thegastro-intestinal tract (GIT) of various animal modelshas been evaluated by several studies funded by the EU-sponsored ENTRANSFOOD thematic network andGMOBILITY project, as reviewed by Kuiper et al.(2004) and van den Eede et al. (2004). Indeed,transgenic crops are increasingly entering the feedmarket, and the safety and substantial equivalence ofthese novel feeds have been extensively studied

⁎ Corresponding author. Tel.: +39 081 2536074; fax: +39 081292981.

E-mail address: [email protected] (R. Tudisco).

1871-1413/$ - see front matter © 2006 Elsevier B.V. All rights reserved.doi:10.1016/j.livsci.2006.04.036

(Aumaitre et al., 2002). Integrity of DNA is a keyfactor for hypothetical horizontal gene transfer ofrecombinant DNA from GM crop-derived feeds toanimal and human gut microflora (Netherwood et al.,2004). Short plant sequences have been amplified frompoultry blood, muscles and organs (Klotz et al., 2002)and from cow blood (Klotz and Einspanier, 1998),whereas negative results have been obtained for eggs,cow milk, organs and tissues (Einspanier et al., 2001;Phipps et al., 2002). The results in pig are stillcontroversial (Reuter and Aulrich, 2003; Klotz et al.,2002). In the present study, plant DNA sequences fromhigh and low copy number genes were monitored in theGIT and tissues of buffaloes and rabbits using a real-time PCR approach, as it has been shown to be sensitive

13R. Tudisco et al. / Livestock Science 105 (2006) 12–18

and valuable tool for detecting animal, plant andmicrobial species (Brodman and Moor, 2003; Sawyeret al., 2003; Spano et al., 2005; Terzi et al., 2005).

2. Materials and methods

2.1. Animals and diets

2.1.1. BuffaloesTen Italian Mediterranean young bulls (Bubalus bubalis)

were fed ad libitum a total mixed ration (14% crude proteinand 0.85 meat unity forage/kg of dry matter), constituted (1%dry matter) by maize silage (25%), oat hay (25%) andconcentrate (50%) and they had free access to water. Theanimals were slaughtered at 14±2 months of age (live weight:410 kg±22 kg).

2.1.2. RabbitsTen Yila rabbits (Oryctolagus cuniculus) were caged

individually and fed 100 g/day of a pelletted concentrate(16.5% crude protein and 15% crude fibre, as fed; dehydratedalfalfa meat, sunflower meal, wheat, carob, soft wheatmiddlings, sugar beet pulps, barely) and 30 g/day of barelygrain. The animals had free access to water. The rabbits wereslaughtered at 70±5 days of age (live weight 2 kg±0.2 kg).

2.2. Sampling procedures

Immediately before slaughtering the area surrounding thejugular and the hear vein, for buffaloes and rabbits respectively,was cleaned with ethanol and then a blood sample (10 ml and2 ml for buffaloes and rabbits, respectively) was taken using aseparate sterile needle and syringe for each animal. The bloodsample was transferred to a sterile 15 ml polypropylene tubecontaining ∼0.2 ml of sodium citrate solution (4%, w/v), andthe tubes kept at−20 °C until the samples were processed. Eachanimal was carefully dissected to obtain the appropriate tissueand digesta samples. Liver, muscle, kidney and spleen werecollected from buffaloes and rabbits. Rumen, jejune-ileum andlarge intestine contents were collected from buffaloes; jejune-ileum and caecum contents and faces from rabbits. All sampleswere placed in clean nylon bags and then transferred to thesampling laboratory. Slaughter and sampling rooms weredistinct to avoid possible contamination. Samples (∼20 g) ofeach tissue, organs and digesta were placed in separate labelledtubes and immediately frozen at −20 °C.

As controls, a representative sample (∼10 g) each of Zeamays and Hordeum vulgare plant species were prepared byfinely grinding in liquid nitrogen using clean, sterile mortars andpestles. The ground material was then placed in labelled plastictubes and stored at −20 °C.

2.3. DNA extraction

Plant and rumen samples were extracted according to theWizard® Plus Minipreps DNA Purification System (Promega,

Medison, Wis., U.S.A.). 100 mg of sample were resuspendedby careful vortexing in 860 μl of extraction buffer [10 mM TrisHCl (pH 8.0), 150 mM NaCl, 2 mM EDTA, 1% (w/v) SDS],100 μl guanidine hydrochloride (5 M) and 40 μl of proteinaseK (20 mg/ml). Samples were then incubated at 58 °C for atleast 3 h on a shaking incubator and then centrifuged at20,000 g for 10 min. 500 μl of the supernatant were incubatedwith 5 μl RNase (10 mg/ml) at 37 °C for 10 min. 1 ml ofWizard® DNA Purification Resin (Promega) was added to thesupernatant and mixed by gently inversion. A 2 ml syringe wasmounted on the column and the mixture was pushed with theplunger through the column. The DNA-resin mixture waswashed with 2 ml 80% (v/v) isopropyl alcohol following bycentrifugation at 20,000 g for 1 min. After drying at 70 °C for10 min, the DNAwas eluted with 50 μl of 70 °C elution buffer[10 mM Tris HCl (pH 9.0), 0.1 mM EDTA] and centrifuged at20,000 g for 1 min.

All the tissue part samples to be extracted were cut out fromthe middle of the organ with a sterile individual scalpel blade tominimize contamination from the surface. Tissue (25 mg) andblood (200μl) sampleswere extracted by using the “Nucleo-SpinTissue” and “Blood-Spin Tissue” (Macherey-Nagel, Duren,Germany), respectively, according to users' manual. Briefly,25mg of ground tissue were incubated with 180 μl buffer T1 and25 μl proteinase K solution at 56 °C for at least 3 h on a shakingincubator. After digestion, the lysates were again incubated with200 μl buffer B3 at 70 °C for 10 min. About the blood samples,they were slowly defrosted (in ice-water bath) and then 200 μl ofwhole blood were incubated with 25 μl proteinasi K solution and200 μl lysis buffer B3 at 70 °C for 15min on a shaking incubator.To both samples (tissue and blood) were added 210 μl ethanol(96–100%), and all of the precipitate was loaded on the columnplacing into a 2 ml collecting tube and then centrifuged at11,000 g for 1min. The silica membrane was washedwith 500 μlbuffer BW and 600 μl buffer B5 following by centrifugation at11,000 g for 1 min. After drying by centrifugation at 11,000 g for1 min, the DNA was eluted with 100 μl pre-warmed elutionbuffer BE (70 °C), incubating for 1 min, and centrifuged thecolumn at 11,000 g for 1 min. Deoxynucleic acid from intestinalcontents (jejune-ileum and large intestine from buffaloes andjejune-ileum and caecum and faeces from rabbits) was extractedusing a kit Nucleo-Spin Tissue (Macherey-Nagel) according tothe manufacturer's protocol with slight modifications as follows.The samples (250 mg each) were resuspended by vigorousvortexing (30 s) in 1ml TE buffer (10mMTris/Cl; 1 mMEDTA,pH 8) and centrifuged at 4000 g for 15 min. After discarding thesupernatant, the pellet was resuspended in 800 μl buffer T1.200 μl of the resuspended sample were transferred to a newmicrocentrifuged tube and incubated with 25 μl proteinase Ksolution at 56 °C for at least 3 h on a shaking incubator. From this,we are following themanufacturer's protocol used for the tissues.

The DNA concentration was determined by measuring theUV absorption at 260 nm, and adjusted to 20 ng/μl prior toPCR. Then its quality was checked from 260/280 nm UVadsorption ratios (Spectrophotometer: Thermo Electron Cor-poration, Waltham, MA). Each sample was extracted induplicate and stored at −20 °C until used.

14 R. Tudisco et al. / Livestock Science 105 (2006) 12–18

2.4. PCR primers

The primer (Table 1) were synthesised by Sigma–GenosysLtd, Haverhill, United Kingdom and diluted with an appro-priate volume of sterilized ultrapure water to a finalconcentration of 100 pmol/μl, and stored at −20 °C untilthey were used.

Five primer pairs framing specific target sequences (Table1) were used: BUF301/BUF492 prmer pair was developed byBottero et al. (2002) to track buffalo species, and UNIV P/UNIV Q primers, previously designed and assayed in real-timePCR by Sawyer et al. (2003), to amplify a region of the mtDNA16S rRNA gene that is conserved among animal species. Clor1/Clor2 primers were designed on chloroplast trnL sequence andused to amplify DNAs from several plant species (Terzi et al.,2004). Adh-F3/Adh-R4 primer pair is designed on house-keeping maize gene adh1, coding for alcohol dehydrogenase 1(Hernandez et al., 2004). The specificity of these primers hasbeen tested against a wide range of non-target taxa and onseveral maize lines. ISC002F01 F/ISC002F01 R primers weredesigned on ISC002.F01F990411 EST (Expressed SequenceTag) sequence (Gene Bank Accession BE411151), included inTC143986 by the TIGR Barley Gene Index (release 9.0,September 15, 2004) and tentatively annotated as a metal-dependent hydrolase-like protein. ISC002F01 F/R primers,after amplification of wheat, oat, barley, rice and maize DNAsamples, give a barley-specific amplicon using melting curveanalysis (data not shown).

2.5. Real-time PCR: SYBR Green detection

Reactions for real-time PCR using SYBR Green detectionconsisted of 12.5 μl of SYBR® Green PCR Master Mix(Applied Biosystems, Foster City, USA), 900 nM forward andreverse primers (Table 1), DNA template (100 ng) and water to25 μl. Reactions were run in an Applied Biosystems 7300Real-Time PCR System, where the PCR mixture was held at50 °C for 5 min and denatured at 95 °C for 10 min. After thisinitial step, forty amplification cycles were carried out with thefollowing conditions for each cycle: 95 °C for 20 s, 60 °C for1 min (for primers BUF 301/492, Clor1/2, Adh-F3/R4 and

Table 1Primers used in PCR reactions to detect five target sequence

Name Sequence (5′ to 3′)

BUF301 GGCATATACTACGGATCATATACCBUF492 AATTCATTCAACCAGACTTGTACCAUNIV P GGTTTACGACCTCGATGTTGUNIV R CCGGTCTGAACTCAGATCACClor1 TTCCAGGGTTTCTCTGAATTTGClor2 TATGGCGAAATCGGTAGACGAdh-F3 CGTCGTTTCCCATCTCTCTTCCTCCAdh-R4 CCATCCGAGACCCTCAGTCISC002F1 F GGTGGCACAGTGGTTGTTGACAAISaC002F1 R AAGGCAACATGGGCAGTGAT

The sequence of sense and antisense primers for each target gene and the ex

ISC002F01 F/R) or 95 °C for 20 s, 55 °C for 30 s and 60 °C for1 min (for primers UNIV P/Q). The PCR reactions weresubjected to a heat dissociation protocol in the 7300 SystemSDS software v1.2.3 (Applied Biosystems, Foster City, USA)for melting (Tm) curve analysis. Following the final PCRcycle, the reactions were heat-denatured at 0.03 °C/s over a35 °C temperature gradient from 60 to 95 °C.

After PCR amplification, Tm curve analysis were per-formed using the Dissociation Curve Analysis software (SDSv 1.2.3 System). Obtained fluorescence signals were con-tinuously monitored during the slow warming-up gradient andshowed a decreasing curve with a sharp fluorescence drop nearthe denaturation temperature. Plotting the negative derivate ofthe fluorescence over temperature versus the temperature(−dF/dT vs T) generated peaks from which the Tm of theproducts was calculated.

In every PCR run, positive and negative controls wereincluded to ensure reproducibility and absence of contami-nants. For positive controls, reference DNA consisting ofpurified maize and barley DNA, was amplified in parallel withthe samples to ensure the correct performance of the PCR; fornegative control (NTC, buffer blank), water instead of DNAwas added to the PCR mix to check for cross contaminationwith maize or barley DNA in the PCR mix or its constituents(Klaften et al., 2004).

Each PCR was done three times, and samples with positiveresults at least twice were considered as positive.

2.6. PCR product sequencing and annotation

The amplification products (20 μl) obtained with Clor1/2primers on buffalo and rabbit DNA samples were separated byelectrophoresis at 100 Von a 2.5% (w/v) agarose gel in 1× TBEbuffer (89 mM Tris pH 8.4; 89 mM boric acid; 2 mM EDTA),containing ethidium bromide (10 mg/ml). The excised bandswere purified following QIAquick gel extraction kit protocol(QIAGENGmbH, Hilden, Germany). Sequence reactions wereperformed using a Big Dye® Terminator Cycle Sequencing Kit(Applied Biosystems) and Clor1 primer. Dye terminator excesswas removed using the MultiScreen separation system(Millipore Corp., Bedford, USA). Sequencing was performed

Amplicon size (bp) Target element

192 Buffalo Cyt b

104 Region of mtDNA 16S rRNA

100 Chloroplast trnL

136 Maize alcohol dehydrogenase 1 gene

100 Hydolase-like protein in barley

pected PCR product size are reported.

15R. Tudisco et al. / Livestock Science 105 (2006) 12–18

using the ABI PRISM® 310 Genetic Analyzer (AppliedBiosystems). Similarities with all sequences in the internationalnucleotide non-redundant data banks and with sequences fromEST division were detected using the BLAST program(Altschul et al., 1997) on network servers. Amplification andsequencing were done in duplicate.

3. Results

3.1. Fate of feed chloroplast and maize-specific DNA inbuffalo

The quality of each DNA sample extracted fromblood and tissues was first verified using the BUF301/BUF492 primers (Bottero et al., 2002) that were used toamplify a buffalo-specific portion of a gene coding formitochondrial cyt b. An example of the melting curvesobtained is reported in Fig. 1.

The presence of plant DNA was subsequentlyascertained on the same DNA samples, as reported inFig. 2. Two classes of plant DNA sequences weremonitored via real-time PCR: a high copy numberchloroplast gene encoding for tRNA Leu and theadh1 maize-specific gene encoding for alcoholdehydrogenase 1, which is a single-copy gene asreported by Hernandez et al. (2004). Melting curveanalysis was used to identify the PCR products. Theuse of real-time PCR, using the melting curve

Fig. 1. Melting curves obtained after real time PCRwith BUF301/BUF492 inand large intestine samples and NTC (No Template Control).

analysis approach, for the detection and the discrimi-nation of cereals has been previously reported bySandberg et al. (2003).

Chloroplast DNA was found in the great majority ofDNA samples extracted from liver, muscle, kidney andspleen of the animals, and in the blood of five buffaloes.In the rumen content, chloroplast sequences weredetectable in five animals, whereas in the chyme theamplifications did not lead to utilizable results.

The specificity of the amplicons obtained waschecked by the sequencing and annotation. In Fig. 3we report the electrophoretic separation of PCRproducts obtained with Clor1/2 primers on animalDNA samples, and the sequence obtained afterpurification of the amplified bands. The sequenceswere annotated after BLASTN analysis as plant trnLgene. BLASTN analysis vs cow genome (http://www.ncbi.nih.gov/genome/seq/BtaBlast.html) found no sig-nificant similarity with cow-specific nucleotidesequences. All the sequences of PCR products obtainedwith Clor1/2 primers on DNA samples from blood andorgans gave the same result, confirming that wemonitored a plant-specific sequence.

The results of monitoring the adh 1 encoding low-copy maize sequence are reported in Fig. 2: amplifica-tions were obtained in the blood of three animals, in theliver of seven, in the muscle of four, in the kidney ofeight, in the spleen of five and in three rumen contents.

one buffalo on blood, liver, muscle, kidney, spleen, rumen, jejune-ileum

Fig. 2. Detection of chloroplast gene (trnl, black) and low-copy maize(adh1, grey) sequences by real time PCR in buffalo samples.

16 R. Tudisco et al. / Livestock Science 105 (2006) 12–18

3.2. Fate of feed DNA in rabbit

The quality of DNAs extracted from all the sampleswere checked using the same analytical approach as forbuffalo. Chloroplast DNA (Fig. 4) was found in thegreat majority of DNA samples extracted from liver,

Fig. 3. a) PCR amplification pattern of plant DNA fragments using Clor1/2 pMarkers: 1 kb DNA-marker. The 100 bp bands amplified from animal sampleLeu gene is reported, matching the sequences of the amplicons reported in (awith bold letters and the primers are underlined.

muscle, kidney and spleen, and in the blood of 4 rabbits;for the ISCOO2F1, the amplifications were obtained inthe blood of 1 animal, in the liver of 5, in the muscle of2, in the kidney of 5, in the spleen of 5 and in 4 GITcontents.

4. Discussion

The results obtained demonstrate that fragmentedplant DNA can be recovered from several tissues andfrom the GIT of water buffalo, with marked variabilityamong individuals for the presence of residual plantDNA. Variability in the presence of plant DNA wasshown by different buffalo organs, with maximum levelof persistence for kidney. Moreover, plant DNA seemsto be degraded within the more caudal buffalo intestinalorgans.

In rabbits our data show that there is persistence ofDNA sequences from low and high copy number plantgenes in the GIT of animals fed fresh plant tissues, likebarley seeds.

These findings are in accordance with other studieson different ruminants and monogastrics. The persis-tence of short DNA sequences from plant tissues fed has

rimer pair on buffalo and plant samples. NTC: No Template Controls;s were isolated from the gel and sequenced. b) The sequence of a tRNA). The location of the homologous parts of the sequences are indicated

Fig. 4. Detection of chloroplast gene (trnL, black) and low-copy barley (ISC002, grey) sequences by real time PCR in rabbit samples.

17R. Tudisco et al. / Livestock Science 105 (2006) 12–18

been found in the GIT of ruminants, from the oral cavityof sheep to rumen and abomasum ingesta of cattle,differing in the case of maize silage and grain (Dugganet al., 2003; Einspanier et al., 2004). The high level ofdegradation of ubiquitous plant chloroplast DNA in thelast section of cattle GIT (jejunum and colon) has beendemonstrated by Einspanier et al. (2004), such dataagreeing with our results on buffalo. In the GIT ofmonogastrics, plant DNA is detectable in pigs (Klotz etal., 2002; Reuter and Aulrich, 2003; Chowdury et al.,2003), in chickens (Chambers et al., 2002) and inhumans (Martìn-Orùe et al., 2002; Netherwood et al.,2004). In blood, muscular tissues and organs thepresence of residual plant DNA has been demonstratedin poultry, but not in pig (Jennings et al., 2003; Reuterand Aulrich, 2003; Klotz et al., 2002), and controversialresults are reported even for ruminants, such as cattleand sheep (Phipps et al., 2003; Duggan et al., 2003;Einspanier et al., 2001).

Our data can add some information on the fate offeed plant DNA in buffaloes and rabbits to widen thecase histories available, given that the persistence ofDNA after dietary exposure is one aspect of riskassessment for novel food. Indeed, as concerns thehypothetical horizontal gene transfer of recombinantDNA from GM crop-derived feeds to animal andhuman gut microflora, Netherwood et al. (2004), foundthat a small proportion of feed DNA survives passagethrough the human upper gastrointestinal tract and avery small proportion of the small intestinal microfloracontaining transgenic feed. According to the authors,even if this result does not indicate a completetransgenic transfer to the prokaryotes, the survival oftransgenic DNA during the passage through the smallintestine should be considered in future safety assess-ments of GM foods.

5. Conclusion

In conclusion our results show that, using the real-time PCR approach, chloroplastic and low copy gene offeed DNA could be detected in tissue, organs anddigesta of buffalo and rabbit, animal species neverstudied until now for this purpose. Our data represent acontribution to the knowledge on the fate of feed DNAin the animal organism for which to demonstrate theintegrity, further researches are required.

Acknowledgements

This work was supported byMiPAF projects “AGRO-NANOTECH” (2004–2006) and BIOCER (2004–2006)and by the MIUR project “SafeEat” (2005–2008).

References

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z.,Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST;a new generation of protein database search programs. NucleicAcids Res. 25, 3389–3402.

Aumaitre, A., Aulrich, K., Chesson, A.C., Flachowsky, G., Piva, G.,2002. New feeds from genetically modified plants: substantialequivalence, nutritional equivalence, digestibility and safety foranimals in the food chain. Livest. Prod. Sci. 4, 223–238.

Bottero, M.T., Civera, T., Anastacio, A., Turi, R.M., Rosati, S., 2002.Identification of cow's milk in Buffalo cheese by duplexpolymerase chain reaction. J. Food Prot. 65, 362–366.

Brodman, P.D., Moor, D., 2003. Sensitive and semi-quantitativeTaqMan real time polymerase chain reaction systems for thedetection of beef (Bos Taurus) and the detection of the familyMammalia in food and feed. Meat Sci. 65, 599–607.

Chambers, P.A., Duggan, P.S., Heriatge, J., Forbes, J.M., 2002. Thefate of antibiotic resistance marker genes in transgenic plant feedmaterial fed to chickens. J. Antimicrob. Chemother. 49, 161–164.

Chowdury, E.H., Kuribara, H., Hini, A., Sultana, P., Mikami, O.,Shimada, N., Guruge, K.S., Saito, M., Nakajama, Y., 2003.

18 R. Tudisco et al. / Livestock Science 105 (2006) 12–18

Detection of corn intrinsic and recombinant DNA fragments andCry1Ab protein in the gastrointestinal contents of pigs fedgenetically modified corn and Cry1Ab protein in the gastrotestinalcontents of pigs fed genetically modified corn Bt11. J. Anim. Sci.81, 2546–2551.

Duggan, P.S., Chambers, P.A., Heritage, J., Forbes, J.M., 2003. Fate ofgenetically modified maize DNA in the oral cavity and rumen ofsheep. Br. J. Nutr. 89, 159–166.

Einspanier, R., Klotz, A., Kraft, J., Aulrich, K., Poser, R., Schwägele,F., Jahreis, G., Flachowsky, G., 2001. The fate of forage plantDNA in farm animals: a collaborative case-study investigatingcattle and chicken fed recombinant plant material. Eur. Food Res.Technol. 212, 129–134.

Einspanier, R., Lutz, B., Rief, S., Berezina, O., Zverlov, V., Schwarz,W., Mayer, J., 2004. Tracing residual recombinant feed moleculesduring digestion and rumen bacterial diversity in cattle fedtransgene maize. Eur. Food Res. Technol. 218, 169–273.

Hernandez, M., Duplan, M.-N., Berthier, G., Vaïtilingom, M., Hauser,W., Freyer, R., Pla, M., Bertheau, Y., 2004. Development andcomparison of four real-time polymerase chain reaction systemsfor specific detection and quantification of Zea mays L. J. Agric.Food Chem. 52, 4632–4637.

Jennings, J.C., Kolwyck, D.C., Kays, S.B., Whetsell, A.J., Surber, J.B., Cromwell, G.L., Lirette, R.P., Glen, K.C., 2003. Determiningwhether transgenic and endogenous plant DNA and transgenicprotein are detectable in muscle from swine Roundup Readysoybean meal. J. Anim. Sci. 81, 1447–1455.

Klaften, M., Whetsell, A., Webster, J., Grewal, R., Fedyk, E.,Einspanir, R., Jennings, J., Lirette, R., Glenn, K., 2004. Animalbiotechnology: challenges and prospects. In: Bhalgat, M.M.,Ridley, W.P., Felsot, A.S., Sieber, J.N. (Eds.), ACS SymposiumSeries, vol. 866. American Chemical Society, Washington, DC,pp. 83–99.

Klotz, A., Einspanier, R., 1998. Nachweis von Novel-Feed im Tier?Beeinträchtigung des Verbrauchers von Fleish oder Milch ist nichtzur waten. Mais 3, 109–111.

Klotz, A., Mayer, J., Einspainer, R., 2002. Degradation and possiblecarry over of feed DNA monitored in pigs and poultry. Eur. FoodRes. Technol. 214, 271–275.

Kuiper, H.A., König, A., Kleter, G.A., Mammes, W.P., Knudesn, I.,2004. Concluding remarks. Food Chem. Toxicol. 42, 1195–1202.

Martìn-Orùe, S.M., O'Donnell, A.G., Arino, J., Netherwood, T.,Gilbert, H.J., Mathers, J.C., 2002. Degradation of transgenic DNAfrom genetically modified soya and maize in human intestinalsimulations. Br. J. Nutr. 87, 533–542.

Netherwood, T., Martìn-Orùe, S.M., O'Donnell, A.G., Gockling, S.,Graham, J., Mathers, J.C., Gilbert, H.J., 2004. Assessing thesurvival of transgenic plant DNA in the human gastrointestinaltract. Nat. Biotechnol. 22, 1–6.

Phipps, R.H., Beever, D.E., Humpries, D.J., 2002. Detection oftransgenic DNA in milk from cows receiving herbicide tolerant(CP4PSPS) soybean meal. Livest. Prod. Sci. 74, 269–273.

Phipps, R.H., Deaville, E.R., Maddison, B.C., 2003. Detection oftransgenic and endogenous plant DNA in rumen fluid, duodenaldigesta, milk, blood, and faeces of lactating dairy cows. J. DairySci. 86, 4070–4078.

Reuter, T., Aulrich, L., 2003. Investigations on genetically modifiedmaize (Bt Maize) in pig nutrition: fate of feed ingested foreignDNA in pig bodies. Eur. Food Res. Technol. 216, 185–192.

Sandberg, M., Lundberg, L., Ferm, M., Yman, I.M., 2003. Real timePCR for the detection and discrimination of cereal contaminationin gluten free foods. Eur. Food Res. Technol. 217, 344–349.

Sawyer, J., Wood, C., Shanahan, D., Gout, D., McDowell, D., 2003.Real-time PCR for quantitative meat species testing. Food Control14, 579–583.

Spano, G., Benedice, L., Terzi, V., Stanca, A.M., Massa, S., 2005. Realtime PCR for the detection of Escherichia coli O157:H7 in dairyand cattle wastewater. Lett. Appl. Microbiol. 40, 164–171.

Terzi, V., Infascelli, F., Yudisco, R., Russo, G., Stanca, A.M., Faccioli,P., 2004. Quantitative detection of Secale cereale by real-time PCRamplification. LWT 37, 239–246.

Terzi, V., Gorrini, A., Stanca, A.M., Shewry, P., Faccili, P., 2005.DNA-based methods for identification and quantification of smallgrain cereal mixtures and fingerprinting of varieties. J. Cereal Sci.41, 213–220.

van den Eede, G., Aarts, H., Buhk, H.-J., Corthier, G., Flint, H.J.,Hammes, W., Jacobsen, B., Midtvedt, T., van der Vossen, J., vonWright, A., Wackernagel, W., Wilcks, A., 2004. The relevance ofgene transfer to the safety of food and feed derived from geneticallymodified (GM) plants. Food Chem. Toxicol. 42, 1127–1156.