Page 1
Historical Perspective, Distribution, Ecology and Population Genetics
of Saltwater Crocodile (Crocodylus porosus Schneider, 1801) in
Sarawak, Malaysian Borneo
Mohd Izwan Zulaini bin Abdul Gani
Doctor of Philosophy
2019
Faculty of Resource Science and Technology
Page 2
Historical Perspective, Distribution, Ecology and Population Genetics of
Saltwater Crocodile (Crocodylus porosus Schneider, 1801) in Sarawak,
Malaysian Borneo
Mohd Izwan Zulaini bin Abdul Gani
A thesis submitted
In fulfillment of the requirements for the degree of Doctor of Philosophy
(Zoology)
Faculty of Resource Science and Technology
UNIVERSITI MALAYSIA SARAWAK
2019
Page 3
i
DECLARATION
I hereby declare that the thesis has not been accepted for any degree and is not concurrently
submitted in candidature of any other degree.
………………………………………….
Mohd Izwan Zulaini bin Abdul Gani
15010191
Date:
Page 4
ii
ACKNOWLEDGEMENT
First of all, I would like to thank God for always giving me the strength and blessing during
all these challenging times, as well as my beloved parents, Abdul Gani Abdullah and
Nasabah Ismawi, all family members and friends for giving me motivation and moral
support to finish my research. I gratefully acknowledge my supervisor Associate Prof. Dr.
Ruhana Hassan for her continual encouragement, enthusiasm and support throughout my
degree, and for providing constructive comments on all that I have written. I would like to
express heartfelt thanks to my co-supervisor Mr. Rambli Ahmad for his invaluable advices
that had greatly helped me to improve my research.
In addition, I also would like to convey my gratitude to Mr. Oswald Braken Tisen, Mr.
Engkamat Lading, Mr. Christoper Kri, Mr. Paschal Dagang, SWAT members and other
staffs of Sarawak Forestry Corporation Bhd. (SFC) and Forest Department of Sarawak
(FDS) for providing supports during crocodile samplings and other technical aspects of the
study. A special thanks to Dr. Rossazana for advices on currency matters and also to fellow
colleagues in the Molecular Aquatic Laboratory for helping me in the field surveys as well
as to the lab assistants for helping to prepare the equipment before going to the field.
Finally, I would like to express my special gratitude to the University Malaysia Sarawak
(UNIMAS) for providing funds for this research through Dana Pelajar Ph.D. Grant no.
F07/DPP53/1282/2015(28) and also the FDS for granting permit NCCD.907.4.4(jld.12)-193
and Permit No. NPW.907.4.4(JLD.14)-149 to conduct research on the crocodiles in
Sarawak. Last but not least, thanks to Ministry of Higher Education for financing my study
under MyPhD Scholarship Program.
Page 5
iii
ABSTRACT
This study is designed to gather information on historical exploitation and ongoing HCC;
recent distribution and ecology of crocodile and genetic relationship of crocodile population
in Sarawak, to aid sustainable crocodile management and finding solutions for mitigating
the HCC. Historical data saw a connection between the exploitation of crocodile with
decreasing trend of HCC in Sarawak from the Rajah Brooke era (1900 – 1941) until the post-
war period (1946 – 1979), and an increasing trend of HCC from 1980 until 2017 in response
to the recovery of the animal populations. Since 1900, crocodile attacks had been occurred
in 22 major river basins (RB) in Sarawak, suggesting that the reptile has been widely
dispersed throughout all major river basins in the state. For 118 years (1900 – 2017), the
highest number of crocodile attacks were recorded in Lupar RB (22.2%) and the attacks had
happened up to the inland areas of Belaga and Pelagus in Rajang RB. Further analysis of
incidents show crocodile attacks were associated with the human activities pattern, where
more attacks involved male victims (84.4%) and adults from age 31 to 40 years old (19.3%).
The data also revealed that crocodile attacks in Sarawak could happen anytime regardless of
the time, month, season, lunar cycle or tidal. However, more attacks were recorded during
the daylight, in the months of March and April, during the Northeast monsoon, at the nights
of the first quarter of the lunar cycle and at the time of high tide. Furthermore, fishing
(25.2%) and bathing (24.4%) possess the highest risk of crocodile attack in Sarawak, clearly
showed that crocodiles are more likely to attack when the victim is in water. Crocodile
survey in selected tributaries in Rajang RB showed the distribution of the reptiles throughout
the river basin with higher crocodile density at the lower region, the highest density was in
Igan River (1.37 individuals/km); while in the middle and upper regions had recorded
Page 6
iv
relatively low density with the lowest density recorded was in Katibas River (0.06
individuals/km) and no crocodile was spotted in Kanowit River. Four out of eight surveyed
rivers in Rajang RB recorded increase in the density of crocodile compare to previous survey
suggesting that the crocodile population in the river basin is experiencing recovery. The
presence of crocodile in different regions (lower, middle and upper) of Rajang RB indicated
that C. porosus in Sarawak live in wide range of habitats; from large salt water river system
and small tidal tributaries (near to estuary) in lower region into hypo-saline or fresh water
non-tidal tributaries in the middle and upper regions. Variation in term of density and
distribution of crocodile between the different regions are mainly influenced by the saline
characteristic of the river, habitats and the abundance of food sources for crocodile. Based
on the analysis of DNA microsatellite sequence data, distinctive subpopulations of C.
porosus according to geographical area (river basin) could be observed. High gene flow (Nm)
among the crocodile subpopulations suggests frequent movements of the reptile happen
across the river basins throughout Sarawak. In general, populations of C. porosus in Sarawak
are experiencing expansion as supported by the mismatch distribution and evolutionary
neutrality test data, suggesting that populations of crocodile in Sarawak are panmictic
population. The findings of the present study imply that increasing of crocodile attacks is
associated with the recovery and increased distribution of the reptile in Sarawak, thus
crocodile management should emphasis on mitigating HCC and simultaneously continue the
efforts for conservation of crocodile and its habitat.
Keywords: Crocodylus porosus, human-crocodile conflict, recovery, expansion.
Page 7
v
Perpektif Sejarah, Taburan, Ekologi dan Genetik Populasi Buaya Air Masin
(Crocodylus porosus Schneider, 1801) di Sarawak, Borneo, Malaysia
ABSTRAK
Kajian ini direka untuk mengumpul maklumat berkaitan sejarah eksploitasi dan KMB;
taburan terkini populasi dan ekologi buaya serta hubungan genetik antara populasi buaya
di Sarawak, untuk membantu pengurusan buaya secara lestari serta mencari solusi untuk
mengurangkan KMB. Data sejarah memperlihatkan hubungkait antara eksploitasi buaya
dengan tahap penurunan bilangan kes KMB di Sarawak dari era Rajah Brooke (1900 –
1941) sehingga ke tempoh selepas perang (1946 – 1979), dan tahap peningkatan bilangan
kes KMB dari 1980 sehingga 2017 hasil tindakbalas daripada pemulihan populasi buaya.
Semenjak tahun 1900, serangan buaya telah berlaku di 22 sungai utama di Sarawak,
menunjukkan taburan luas reptilia tersebut di semua sungai utama di negeri ini. Dalam
tempoh 118 tahun (1900 – 2017), serangan buaya tertinggi dicatatkan di Lembangan Sungai
Lupar (22.2%) dan serangan telah berlaku sehingga ke kawasan pedalam Belaga dan
Pelagus di Lembangan Sungai Rajang. Analisis lanjut insiden menunjukkan serangan buaya
berkaitan dengan corak aktiviti manusia, dimana lebih banyak serangan melibatkan mangsa
lelaki (84.4%) dan individu dewasa berumur dari 31 sehingga 40 tahun (19.3%). Data juga
mendedahkan bahawa serangan buaya di Sarawak boleh berlaku bila-bila masa tanpa
mengira masa, bulan, musim, kitaran bulan atau pasang surut air. Walau bagaimanapun,
lebih banyak serangan telah direkodkan pada waktu siang, di bulan Mac dan April, semasa
musim monsun Timur Laut, pada malam suku pertama kitaran bulan dan ketika air pasang.
Aktiviti memancing (25.2%) and mandi di sungai (24.4%) mempunyai risiko serangan buaya
yang tertinggi menunjukkan buaya lebih suka menyerang ketika mangsa berada di air.
Survei buaya di sungai-sungai terpilih di Lembangan Sungai Rajang mendapati reptilia
tersebut mendiami pelbagai habitat di sepanjang sungai, dengan kepadatan lebih tinggi di
Page 8
vi
bahagian hilir, tertinggi dicatatkan di Sungai Igan (1.37 individu/km); sementara itu di
bahagian tengah dan hulu mencatatkan kepadatan yang lebih rendah dengan catatan
terendah di Sungai Katibas (0.06 individu/km) dan tiada buaya dijumpai di Sungai Kanowit.
Empat daripada lapan sungai yang disurvei di Lembagan Sungai Rajang mencatatkan
peningkatan kepadatan buaya berbanding dengan survei terdahulu, menunjukkan bahawa
populasi buaya di sungai ini sedang mengalami pemulihan. Kehadiran buaya di bahagian
berbeza (bahagian hilir, tengah dan hulu) di Lembagan Sungai Rajang menunjukkan C.
porosus, hidup di pelbagai habitat; dari sungai besar dan anak sungai (berhampiran muara)
air masin di bahagian hilir sehinggalah kepada anak sungai air tawar yang tidak
dipengaruhi pasang surut di bahagian tengah dan hulu lembagan sungai tersebut.
Kepelbagaian dari segi kepadatan dan taburan di antara bahagian-bahagian berbeza
adalah banyak dipengaruhi oleh ciri kemasinan sungai, habitat dan kelimpahan sumber
makanan untuk buaya. Berdasarkan analisis data jujukan DNA mirosatelit, subpopulasi C.
porosus berdasarkan kawasan geografi (lembangan sungai) dapat diperhatikan. Aliran gen
tinggi (Nm) di kalangan subpopulasi buaya mencadangkan terdapat pergerakan yang kerap
oleh reptilia tersebut di antara sungai-sungai di seluruh Sarawak. Secara umumnya,
populasi C. porosus di Sarawak mengalami pengembangan populasi disokong oleh data
ujian mismatch distribution dan evolutionary neutrality, yang juga mencadangkan bahawa
populasi buaya di Sarawak adalah populasi yang panmictic. Penemuan kajian ini boleh
diterjemahkan sebagai wujud kaitan antara peningkatan serangan buaya dengan pemulihan
dan peningkatan taburan populasi reptilia tersebut di Sarawak, oleh itu pengurusan buaya
perlu memberi penekanan kepada usaha-usaha mengurangkan KMB namun pada masa
yang sama tetap meneruskan usaha untuk pemuliharaan buaya dan habitatnya.
Kata kunci: Crocodylus porosus, konflik manusia dan buaya, pemulihan, pengembangan
Page 9
vii
TABLE OF CONTENTS
Page
DECLARATION i
ACKNOWLEDGEMENT ii
ABSTRACT iii
ABSTRAK v
TABLE OF CONTENTS vii
LIST OF TABLES xii
LIST OF FIGURES xv
LIST OF ABBREVIATIONS xix
CHAPTER 1: GENERAL INTRODUCTION 1
1.1 Background 1
1.2 Problem statements 4
1.3 Objectives 7
1.4 Hypotheses 8
CHAPTER 2: LITERATURE REVIEW 10
2.1 Evolutionary history and classification of crocodiles 10
Page 10
viii
2.2 Distribution of crocodiles 13
2.3 Crocodylus porosus 14
2.3.1 Taxonomy 14
2.3.2 Habitat and distribution of C. porosus in Sarawak 16
2.3.3 Morphology and physiology of C. porosus 18
2.3.4 Historical literature about crocodile in Sarawak 26
2.3.5 Threats and conservation 29
2.3.6 Ecological and social importance of crocodiles 33
2.4 Human-crocodile conflicts (HCC) 35
2.5 Population ecology of crocodiles 37
2.6 Population genetics and its importance 39
2.7 Genetic studies of crocodiles
40
CHAPTER 3: REVIEW OF CROCODILE STATUS AND HUMAN-
CROCODILE CONFLICTS IN SARAWAK FROM 1900
UNTIL 2017
42
3.1 Introduction 42
3.2 Materials and Methods 44
3.2.1 Study area 44
Page 11
ix
3.2.2 Information gathering and analyses 48
3.3 Results and Discussion 52
3.3.1 White Rajah era (1900-1941) 52
3.3.2 Post- war period (1946-1979) 63
3.3.3 Period when wild crocodile populations depleted and the law was
introduced to protect them from hunting (1980-1999)
64
3.3.4 Millennia era (2000-2017) 66
3.3.5 One hundred and eighteen (118) years comparison of human-
crocodile conflicts
80
3.4 Conclusion 89
CHAPTER 4: DISTRIBUTION AND ECOLOGY OF SALTWATER
CROCODILE, Crocodylus porosus IN RAJANG RIVER
BASIN, CENTRAL SARAWAK
91
4.1 Introduction 91
4.2 Materials and Methods 95
4.2.1 Study area 95
4.2.2 Crocodile survey 97
4.2.3 River characteristics and landscapes 100
4.2.4 Selected water quality parameters 104
Page 12
x
4.2.5 Potential aquatic food resources for crocodiles 104
4.2.6 Data analysis 105
4.3 Results 107
4.3.1 Crocodile density 107
4.3.2 Distribution of crocodile in selected rivers of Rajang River Basin 110
4.3.3 River characteristics and landscapes 117
4.3.4 Selected water quality parameters 122
4.3.5 Aquatic food resources for crocodile 124
4.3.6 Relationship between crocodile density, habitat, water quality
parameter and the abundance of food resources for crocodiles
127
4.4 Discussion 131
4.5 Conclusion 142
CHAPTER 5: GENETIC RELATIONSHIP AMONG Crocodylus porosus
FROM DIFFERENT RIVER BASINS IN SARAWAK,
MALAYSIAN BORNEO
144
5.1 Introduction 144
5.2 Materials and Methods 147
5.2.1 Sample collection 147
5.2.2 Total genomic DNA extraction and Polymerase Chain Reaction (PCR)
amplification
152
Page 13
xi
5.2.3 DNA sequencing and alignment 154
5.2.4 Phylogenetic tree and NETWORK reconstruction analyses 154
5.2.5 Population genetics analyses 155
5.3 Results 156
5.3.1 Sequences characterization and Basic Local Alignment Search Tool
(BLAST) analysis
156
5.3.2 Combine genes and haplotype build 160
5.3.3 Phylogenetic analysis 162
5.3.4 NETWORK analysis 168
5.3.5 Population genetic analyses 171
5.4 Discussion 177
5.5 Conclusion 182
CHAPTER 6: GENERAL DISCUSSION 183
CHAPTER 7: CONCLUSION AND RECOMMENDATIONS 201
REFERENCES 204
APPENDICES 223
Page 14
xii
LIST OF TABLES
Page
Table 3.1 List of river basins in Sarawak, its main river and approximate length
(Tisen & Ahmad, 2010).
46
Table 3.2 Periods of time and sources of information on crocodile in Sarawak. 50
Table 3.3 Number and measurement of crocodiles and eggs brought to the
government and amount of bounty paid (extracted from half year
report in Sarawak gazette, 1901-1907).
54
Table 4.1 Details of surveys in eight rivers of Batang Rajang. 97
Table 4.2 Size class for crocodile survey (Bayliss, 1987; Robi, 2014). 100
Table 4.3 Field guide for river habitat assessment (modified from Barbour et
al., 1996; Iwata et al., 2003; Bolhen, 2017).
101
Table 4.4 Scores for stream habitat category (modified from Barbour et al.,
1996; Iwata et al., 2003; Bolhen, 2017).
102
Table 4.5 Characteristics observed and recorded in each river during field
sampling (Montague, 1983; Messel & Vorlicek, 1986).
103
Table 4.6 Relative density of C. porosus in eight tributaries of Rajang River
Basin.
108
Table 4.7 Comparison density of crocodile between survey in 2014 and 2017
(present study).
108
Table 4.8 Stream habitat assessment and its score for each river in study area
of Rajang River Basin.
117
Page 15
xiii
Table 4.9 Selected water quality parameters measured in-situ for rivers and
tributaries of Rajang River Basin.
123
Table 4.10 List of fish and invertebrates caught in Rajang River Basin that may
be the potential food source of the C. porosus.
126
Table 4.11 Pearson’s correlation between crocodile density, water quality
parameters and the abundance of food resources for crocodile
(CPUE).
128
Table 4.12 Summary for PCA analysis for the crocodile density, water quality
parameters and CPUE.
128
Table 4.13 Summary for GLM analysis for the water quality parameters, habitat
and CPUE in response with crocodile density.
130
Table 5.1 Voucher codes for samples according to sampling area. 150
Table 5.2 Microsatellite primers used in this study (Isberg et al., 2004). 153
Table 5.3 Sequence characterization for the microsatellite markers. 157
Table 5.4 Average nucleotide base composition at the 1st, 2nd and 3rd codon
position for the three microsatellite markers in this study. All
frequencies are in percentage (%).
158
Table 5.5 Basic Local Alignment Search Tool (BLAST) result. 159
Table 5.6 Haplotype identity for 22 microsatellite sequences of C. porosus. 161
Table 5.7 Measures of Nucleotide Diversity (π) and Net Nucleotide Divergence
(Da) among populations of C. porosus analysed by locations.
171
Table 5.8 Summary statistics of Microsatellite Cj16 sequences variation in five
populations of C. porosus in Sarawak.
173
Page 16
xiv
Table 5.9 Measures of geographical population differentiation in Crocodylus
porosus based on an analysis of Molecular Variance approach using
microsatellite sequences data.
175
Table 5.10 Genetic differentiation matrix of populations calculated by ϕST. p
values are shown in parenthesis (below the diagonal).
175
Table 5.11 Measures of Nucleotide Subdivision (Nst), Population Subdivision
(Fst) and Gene Flow (Number of Migrants, Nm) among populations
of C. porosus analyzed by locations.
176
Page 17
xv
LIST OF FIGURES
Page
Figure 2.1 Global crocodile species and its common name (De Silva, 2013). 12
Figure 2.2 Taxonomic hierarchy of Crocodylus porosus. 15
Figure 2.3 Head shape of C. porosus (Illustration adapted from Caldicott et al.,
2005).
18
Figure 3.1 Map of river basins in Sarawak (Map modified from Official Website
of Department of Irrigation and Drainage Sarawak, 2017).
47
Figure 3.2 Number of crocodile attacks divided into 10-year periods during the
Rajah Brooke era, 1900-1941.
57
Figure 3.3 (a) Percentage of attacks according to victim’s gender, (b) Percentage
of attacks according to the time when the incident occurred.
*Unknown = no information available.
58
Figure 3.4 Number of crocodile attacks from 1900-1941 according to river basin 59
Figure 3.5 Number of crocodile attacks from 1900-1941 according to month and
season when the incident occurs.
60
Figure 3.6 Types of activities of the victims when crocodile attacked (1900-
1941).
62
Figure 3.7 Number of crocodile fatal and non-fatal attacks for each year from
2000 until 2017.
68
Figure 3.8 (a) Percentage of victims according to gender; (b) Percentage of
crocodile attack cases according to time when the incident occurred
in Sarawak from 2000 - 2017.
70
Page 18
xvi
Figure 3.9 Proportion of the crocodile attacks in Sarawak between 2000 and
2017 plotted over the lunar cycle.
72
Figure 3.10 Proportion of the crocodile attacks in Sarawak between 2000 and
2017 plotted over the tidal cycle.
74
Figure 3.11 Number of fatal and non-fatal attacks from 2000-2017 according to
age of victims.
75
Figure 3.12 Number of crocodile attacks from 2000-2017 according to river
basin.
76
Figure 3.13 Number of crocodile attacks from 2000-2017 according to month and
season when the incident occurred.
77
Figure 3.14 Types of activities of the victims at the moment of crocodile attacked
(2000-2017).
79
Figure 3.15 Average number of crocodile attacks per year divided into 10-year
periods between 1900 and 2017 in Sarawak.
80
Figure 3.16 Number of crocodile attacks from 1900 until 2017 according to river
basin.
84
Figure 3.17 Average of monthly rainfall in Sarawak for the period 1980 - 2014
(adapted from Sa’adi et al., 2017).
86
Figure 4.1 Map of Rajang River Basin. 96
Figure 4.2 Map showing the survey area in Igan River. Each circle indicates the
location of crocodile sighted during the survey and different colours
in the circle represent different size class.
110
Page 19
xvii
Figure 4.3 Map showing the survey area in Belawai River. Each circle indicates
the location of crocodile sighted during the survey and different
colours in the circle represent different size class.
111
Figure 4.4 Map showing the survey area in Sarikei River and Nyelong River.
Each circle indicates the location of crocodile sighted during the
survey and different colours in the circle represent different size class.
112
Figure 4.5 Map showing the survey area in Kanowit River. No crocodile
sighting was recorded during the survey.
113
Figure 4.6 Map showing the survey area in Poi River. Each circle indicates the
location of crocodile sighted during the survey and different colours
in the circle represent different size class.
114
Figure 4.7 Map showing the survey area in Ngemah River. Each circle indicates
the location of crocodile sighted during the survey and different
colours in the circle represent different size class.
115
Figure 4.8 Map showing the survey area in Katibas River. Each circle indicates
the location of crocodile sighted during the survey and different
colours in the circle represent different size class.
116
Figure 4.9 Catch per unit effort (CPUE) at eight rivers in Rajang River Basin. 125
Figure 4.10 PCA ordination bi-plot of eight rivers of Rajang River Basin with
crocodile density, habitat, water quality parameters (Salinity, pH and
Temperature) and food resources for crocodile (CPUE).
129
Figure 5.1 Map of Sarawak showing locations of C. porosus sample collected in
the present study.
151
Page 20
xviii
Figure 5.2 Microsatellite-based phylogenetic relationship for 22 C. porosus in
Sarawak inferred using Neighbour-joining (NJ) analysis. Support
value next to the node are bootstrap values.
164
Figure 5.3 Microsatellite-based phylogenetic relationship for 22 C. porosus in
Sarawak inferred using Maximum Parsimony (MP) analysis. Support
value next to the node are bootstrap values.
165
Figure 5.4 Microsatellite-based phylogenetic relationship for 22 C. porosus in
Sarawak inferred using Maximum likelihood (ML) analysis. Support
value next to the node are bootstrap values.
166
Figure 5.5 Bayesian inference of the 50% majority rule consensus tree of
Combine microsattelite genes of C. porosus. Bayesian posterior
probabilities are accordingly indicated besides the branch nodes.
167
Figure 5.6 The median-joining Network generated by NETWORK software
version 5.0.0.3 illustrating the relationship of the saltwater crocodile,
C. porosus from different localities in Sarawak. Each circle
represents a haplotype and the diameter of the circle is scale to the
haplotype frequency. Different colours in the circle represent
different localities. Bold number next the lines connecting the
haplotypes indicate number of mutation step(s).
170
Figure 5.7 Mismatch distribution of C. porosus at (a) Sarawak RB, (b)
Samarahan/Sadong RB, (c) Saribas/Krian RB, (d) Rajang RB and (e)
Bintulu/Miri RB population. The dark line represents the observed
and light lines represent the expected distribution for each model.
174
Page 21
xix
LIST OF ABBREVIATIONS
ºC Degree Celsius
μL Microliter
AMOVA Analysis of Molecular Variance
ANOVA Analysis of Variance
bp Base pairs
CITES Convention on International Trade in Endangered Species of Wild Fauna
and Flora
cm Centimeter
DNA Deoxyribonucleic acid
FDS Forest Department of Sarawak
ft Feet
HCC Human-crocodile conflict
HL Head Length
hp Horse power
ICT Information and communication technologies
IUCN International Union for Conservation Nature
KMB Konflik manusia dan buaya
km2 Square kilometres
km Kilometer
L Liter
m Meter
mL Milliliter
Page 22
xx
mm Milimeter
MCF Miri Crocodile Farm
MYR Malaysian Ringgit
NEM Northeast monsoon
ppt parts per thousand
psi pounds per square inch
RB River Basin
SFC Sarawak Forestry Corporation Sdn. Bhd.
SWM Southwest monsoon
TL Total length
TTB Tumbina Park, Bintulu
UK United Kingdom
UNIMAS Universiti Malaysia Sarawak
USA United States of America
WWII World War 2
Page 23
1
CHAPTER 1
GENERAL INTRODUCTION
1.1 Background
The saltwater crocodile, Crocodylus porosus (Schneider, 1801) is the most geographically
widespread and the most resilient among all the crocodile species. The distribution covers
Indo-pacific region, including several countries in Southeast Asia, Australia, Papua New
Guinea, Bangladesh, India, Sri Lanka, Palau, Solomon Islands and Vanuatu (Webb et al.,
2010). This species typically occupies tidal rivers of the coastline and associated freshwater
swamps. However, C. porosus could also live in total freshwater habitats, and may move
hundreds of kilometers upstream from the sea, well beyond saline water and tidal influence.
In Malaysia, C. porosus is abundant in Sarawak and Sabah, the two states located in the
island of Borneo compared to the Peninsular (Sarawak Forestry Corporation, 2018). In
Peninsular Malaysia, C. porosus populations can be found in Rembau-Linggi Estuary (Nazli
et al., 2009) and Setui-Chalok-Bari River Basin (RB) on the east coast of Terengganu (Webb
et al., 2010). In Sabah, C. porosus inhabit Kinabatangan RB and its associated wetland
(Evans et al., 2017). Small population of crocodile had also been reported in the Klias River
(Stuebing et al., 1994), Segama River (Kaur, 2006) and Kawang River (Jet et al., 2011).
Sarawak supports the largest population of C. porosus in Malaysia, where they could be
found in almost all major river basins in the state including large or small river systems,
mangroves estuaries and inland freshwater swamps (Tisen & Ahmad, 2010; Hassan &
Page 24
2
Abdul-Gani, 2013; Abdul-Gani, 2014; Ali et al., 2014; Robi, 2014; Zaini et al., 2014;
Sarawak Forestry Corporation, 2018). This species are also found in Logan Bunut, the
Sarawak’s largest natural lake which drains into Teru riverine system in Miri Division (Cox
& Gombek, 1985).
Majority of the C. porosus populations in the range countries are listed in Appendix I in the
Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES)
except for the populations in Papua New Guinea, Australia, Indonesia and Malaysia (wild
harvest restricted to the state of Sarawak and a zero quota for wild specimens for the other
states of Malaysia), which are currently in Appendix II (CITES, 2018). In Appendix I,
international trade for the specimens from the wild populations are not allowed except for
those whose had been issued with permit from CITES. Meanwhile, CITES Appendix II
listing allows utilization of wild caught animals in manners not detrimental to the survival
of the species and that the specimens were legally obtained. The implementation of CITES
in Malaysia is mandated under the International Trade in Endangered Species Act 2008 [Act
686] as well as the individual state’s wildlife laws (Sarawak Forestry Corporation, 2018).
C. porosus in Malaysia is listed as a protected species under state’s wildlife laws; for the
states in peninsular Malaysia, the crocodile is protected by the Wildlife Conservation Act
2010 [Act 716], meanwhile Wild Life Protection Ordinance of Sarawak 1998 and Sabah
Wildlife Conservation Enactment 1997 protect the crocodile in Sarawak and Sabah,
respectively. These laws prohibited any activities of hunting or killing of wild crocodiles in
any states of Malaysia. In addition, any activities involving trades or import-export either in
Page 25
3
the form of life crocodile or crocodile-based products in Malaysia are illegal except for those
who have license and permit from the authority (Sarawak Forestry Corporation, 2018).
During the Rajah Brooke’s era in Sarawak, crocodiles were considered as pest because this
animal had terrorized people and caused much problem to the government. Thus, the
government offers bounty for each crocodile that had been caught (Hornaday, 1885). The
local community started to hunt this animal for the prize and a huge number of crocodiles
had been reported caught during the time. After the World War 2 (WWII), demand and prize
for crocodile’s skin worldwide, especially for C. porosus skin, had been increased and
consequently led to the intensive hunting of crocodiles in rivers of Sarawak. Besides hunting
for its skin, the local community in Sarawak also consumed crocodile’s meat and use its
organs and body parts for medicine to cure asthma and other sickness (Hassan & Abdul-
Gani, 2013). Hunting activities and exploitation of crocodiles in Sarawak were at its peak in
the late 80’s, leading to the reduction in the number of crocodiles in rivers of Sarawak.
According to the survey by Cox and Gombek (1985), prior to the introduction of a law that
prohibited any crocodile hunting activity, the density of crocodile in several rivers in
Sarawak were less than 1 individual/ km and in some rivers, no crocodile could be sighted.
After more than three decades protected by the laws that prohibits any hunting activities of
crocodiles in the wild, populations of C. porosus in Sarawak are recovering. Simultaneously,
the human-crocodile conflicts (HCC) in Sarawak are also on the rise, possibly due to the
growing crocodile populations as well as the expanding of human populations in the state
(Lading, 2013; Tisen et al., 2013). Increasing in the number of crocodiles in the river would
intensify competition among crocodiles for a shrinking habitat (Amarasinghe et al., 2015),
Page 26
4
which could lead to the expansion of crocodile population including towards further up-
river. The local people claimed that C. porosus can be seen as far as Kapit town at the Rajang
RB, which is more than 160 km from its river mouth and the waterway is not affected by the
tidal influence (Tisen & Ahmad, 2010).
1.2 Problem statements
Conflicts between human and crocodile (HCC) in Sarawak showed an increasing trend, most
notably after the year 2010 (Tisen et al., 2013; Abdul-Gani, 2014) which led to the
assumption that the recovery of crocodile population in the rivers might be one of the major
factor contributing to the problem. Meanwhile, at least eight major rivers in Sarawak
recorded a marked increase in density of crocodiles (Tisen & Ahmad, 2010; Sarawak
Forestry Corporation, 2018), hence further reaffirm the assumption. Increasing in the density
of crocodiles in the river could trigger the competition for space, food sources and mating
companions as more crocodiles are living in the limited stretch of the river. Fierce
competition among the crocodiles sometimes affect the level of aggressiveness of the animal
which could lead to attacks on human.
C. porosus, the crocodile species that is identified as the main perpetrator for almost all
attacks in Sarawak, is known for its territorial behavior which mean a crocodile especially
the adult cannot tolerate with other crocodiles or other animals including human entering its
territory (Campbell et al., 2013). A very large adult crocodile typically dominates large
section of the river that has the best spot for food hunting, basking and resting, while smaller
crocodiles that are unable to access the area guarding by the dominant crocodile usually will
Page 27
5
forage into other places resulting in habitat range expansion of this species (Hanson et al.,
2015). In finding new area for living, there is a possibility that this crocodile will travel
further upstream and end up staying in the upper side of the river.
Several sightings of C. porosus in the upper region of Batang Rajang (about 160 km from
river mouth and no tidal influence) rise question about the movement pattern of this animal.
The ability to travel in long range movement (Read et al., 2007; Campbell et al., 2010;
Campbell et al., 2013) and also highly adapted to new environment as it possesses functional
lingual salt glands and other organs (Grigg & Gans, 1993) could facilitate the dispersion of
C. porosus not just along the coastline of Sarawak, but also possibility towards further
upstream of large river basins. This population expansion theory has never been tested in
Sarawak, leading to the difficulties for the authority to manage crocodile populations in a
sustainable manner for the benefit of local people and the state.
Despite reports on the presence of C. porosus in the upper part of Batang Rajang, information
about the distribution, ecology and habitat of this reptile in the particular region are largely
unknown. Prior to 2010, majority of the crocodile’s survey in Sarawak focused in the rivers
within the coastal region. Cox and Gombek (1985) had first initiated preliminary surveys on
populations and distributions of C. porosus and T. schlegelii in Sarawak in mid-1980’s. The
surveys involved several large rivers in Sarawak including Samarahan River, Batang Lupar,
Batang Rajang, Baram River and Kuching mangrove wetland.
The Sarawak Forestry Corporation (SFC) and Forest Department of Sarawak (FDS) had
been conducting surveys on crocodile population in several major rivers of Sarawak since
Page 28
6
1994 (Tisen & Ahmad, 2010; Sarawak Forestry Corporation, 2018). However, due to the
vast areas of rivers in Sarawak and the high cost needed to conduct a survey, earlier crocodile
surveys only involved rivers in the western part of Sarawak, such as Sarawak River, Kuching
wetland, Batang Sadong, Batang Samarahan, and Batang Lupar. Only in 2012 to 2014, the
agencies have started a comprehensive state-wide crocodile surveys that cover 40 rivers
throughout Sarawak including the Rajang RB (Robi, 2014; Sarawak Forestry Corporation,
2018). Surveys by Cox and Gombek (1985) and Robi (2014) in Rajang RB reported an
increase of 2150% (from 0.02 individuals/km in 1985 to 0.43 individuals/km in 2014) in the
density of crocodiles. However, the data have set back such as survey by Cox and Gombek
(1985) only examined the lower part of the river, including tributaries such as Sarikei River,
Belawai River, Paloh River and few smaller tributaries near to the mouth of the river basin,
while survey by Robi (2014) cover up to nine rivers from lower to upper side of the river
basin. Therefore, using the Rajang RB as a model river basin, this study uses combination
of survey and genetic data to shed light on the possible expansion of crocodiles in Sarawak.
To ensure successful wildlife management, all historical information, ecological and genetic
components need to be examined (Bradshaw et al., 2006). Historical information on
crocodiles including exploitation of the animal, crocodile attacks data and distribution could
help in understanding the timeline of events related to the crocodile population in Sarawak
and the data could assist crocodile management in deciding better actions for the better future
of the reptile in the state. Genetic data are important as it allow inferences about the
geographic patterns and extent of historical isolation of one species (Moritz, 1999).
Therefore, this study is designed to assess genetic relationship among crocodile populations
in order to resolve population structure of C. porosus in Sarawak. The ecological and habitat
Page 29
7
data collected in this study will also help in providing clues concerning the potential
movement of crocodiles and the possible risk of danger posed by them in Rajang RB. Habitat
use by a particular species can be best understood by monitoring its movements,
which ultimately would reflect its behaviour or responses to the habitat (Taigor & Rao,
2014).
1.3 Objectives
Objectives of this study are:
i. To gather and examine the historical information on crocodile in Sarawak including
the exploitation of the animal and conflicts between human and crocodile from the
year 1900 to 2017.
ii. To analyze data on crocodile attacks incidents in Sarawak from the year 1900 to
2017.
iii. To assess the density and distribution of C. porosus in eight rivers representing the
upper, middle and lower part of Rajang River Basin.
iv. To compare the current density of C. porosus in eight selected rivers in Rajang River
Basin with previous survey.
v. To determine the crocodile habitats, selected water quality parameters and the
abundance of potential food sources for crocodile in the eight rivers of Rajang River
Basin.
Page 30
8
vi. To determine relationship between crocodile density and distributions with habitats,
selected water quality parameters and the abundance of food sources for crocodile.
vii. To investigate the genetic relationship among crocodile populations from 13
localities in Sarawak using DNA microsatellite marker.
viii. To examine population expansion and migrations (gene flow) between the crocodile
populations in Sarawak.
6.1 Hypotheses
At the beginning of this study, the hypotheses suggested were as follows:
Chapter 3
H0: There is no change in terms of number of human-crocodile conflicts (HCC) in Sarawak
within the period of 1900 until 2017.
Ha: There is fluctuation in terms of number of human-crocodile conflicts (HCC) in Sarawak
within the period of 1900 until 2017.
Page 31
9
Chapter 4
H0: There is no difference in ecological characteristics and river habitats supporting
populations of C. porosus in the estuary, middle and upper regions of Rajang River
Basin.
Ha: There are differences in ecological characteristics and river habitats supporting
populations of C. porosus in the estuary, middle and upper regions of Rajang River
Basin.
Chapter 5
H0: Microsatellite markers are unable to clarify to the population structure of C. porosus in
Sarawak and are not useful to explain the expansion of the animal population in the state.
Ha: Microsatellite markers could clarify the population structure of C. porosus in Sarawak
and could explain the expansion of the animal population in the state.
Page 32
10
CHAPTER 2
LITERATURE REVIEW
2.1 Evolutionary history and classification of crocodiles
All crocodiles belong to Order Crocodilia under the Class Reptilia. Reptiles first appeared
around 320 million years ago and arose directly from the amphibians, a diverse group of
animals at that time. At the time that reptiles evolved, the world's fauna consisted of
invertebrates, fish and amphibians. Between 320 and 220 million years ago, reptile came in
many different body forms where some of them were large, others were small, some
dominated the land surfaces, others the sea. This marked the "Age of Reptiles" had arrived,
and reptiles were to flourish for the next 155 million years. However, about 65 million years
ago the group suddenly suffered mass extinction, about the same period of time that saw the
end of the dinosaur. During the event, most of the known reptiles entered the fossil record.
Today’s crocodilian including crocodile, alligator, caimans and gharials are thus considered
“living fossils” that survived the mass extinction (De Silva, 2013).
Crocodilians are thought to share common ancestor with the dinosaurs and birds (Seymour
et al., 2004). The birds are said to split off from dinosaur ancestor later than the crocodiles.
This group that share the same lineages is called Archosauria. Even when looking at modern
crocodilians, their biology and behavior are closely similar to the dinosaurs. While for birds,
there are some traits shared with the crocodiles such as the presence of gastroliths in the
stomach of extant crocodilians (Brazaitis, 1969; Brazaitis & Watanabe, 2011). These are
Page 33
11
among the evidences that connecting crocodiles with dinosaur and birds which share
common ancestor.
According to Seymour et al. (2004), one of the oldest complete basal archosaur fossils came
from the Early Triassic, the 1.5 m long Proterosuchus, which resembled modern crocodiles.
Then it was followed by the Orthosuchus, a terrestrial crocodilian in the Middle Triassic,
which at that time became the most important predators. It was believed that all crocodilians
were terrestrial before they invaded the seas, lakes and swamps. Then came Euparkeria, a
small archosaur that is considered to be closed to the common ancestor of crocodilians and
dinosaurs (De Silva, 2013). Approaching the Middle Triassic, archosaurs split into two
lineages: Crurotarsi (crocodilians and relatives) and Ornithodira (dinosaurs, birds, pterosaurs
and relatives).
During the Tertiary periods (approximately 65 million years ago), the periods after the mass
extinction of reptiles, all surviving crocodilians were widely distributed in the world with
the help of favorable weather conditions. These crocodilians are in the Order Crocodylia,
which is divided into three discrete Families (Crocodylidae, Alligatoridae, Gavialidae),
which have been separated from each other for at least 60 million years (De Silva, 2013).
However, several factors including severe climate change has contributed to the extinction
of several species of crocodiles. According to De Silva (2013), all periods of expansion in
diversity of crocodiles in the fossil record coincided with periods of warm global
temperature, which explained why some species were extinct and also because of this,
crocodiles are restricted to certain geographical area.
Page 34
12
There are at least 24 species of modern crocodilian that still exist on the present day, disperse
around the world under Order Crocodylia. They are grouped under three extant families and
nine genera (Figure 2.1).
Class Reptilia
Order Crocodylia
Family Alligatoridae
Genus Alligator
A. mississippiensis - American alligator
A. sinensis - Chinese alligator
Genus Caiman – the true caimans
C. crocodilus – spectacled or common caiman
C. yacare – Yacaré caiman
C. latirostris – broad-snouted caiman
Genus Melanosuchus
M. niger – black caiman
Genus Paleosuchus – the dwarf caimans
P. palpebrosus – Cuvier’s dwarf, or dwarf caiman
P. trigonatus – Schneider’s dwarf, or smooth-fronted caiman
Family Crocodylidae
Genus Crocodylus – the true crocodiles
C. acutus – American crocodile
C. intermedius – Orinoco crocodile
C. rhombifer – Cuban crocodile
C. moreletii – Morelet’s crocodile
C. niloticus – Nile crocodile
C. siamensis – Siamese crocodile
C. palustris – mugger crocodile
C. porosus – estuarine or saltwater crocodile
C. mindorensis – Philippine crocodile
C. novaeguineae – New Guinea crocodile
C. johnstoni – Australian freshwater crocodile
C. cataphractus – African slender-snouted crocodile
Genus Mecistops – the African slender-snouted crocodiles
M. cataphractus – African slender-snouted crocodile
Genus Osteolaemus
O. tetraspis – African dwarf crocodile
Family Gavialidae – the gharials
Genus Gavialis
G. gangeticus – true or Indian gharial
Genus Tomistoma
T. schlegelii – false gharial/Malayan gharial
Figure 2.1: Global crocodile species and its common name (De Silva, 2013).
Page 35
13
2.2 Distribution of crocodiles
Extant modern crocodilians are distributed geographically throughout tropical, sub-tropical
and warmer temperature wetlands regions of the world (Martin, 2008). This is because
crocodiles are unable to survive and reproduce successfully in cold climates (Grigg & Gans,
1993; De Silva, 2013). However, Genus Alligator (the American alligator and Chinese
alligator) are the most cold-tolerant and are both found in the highest latitudes of any species
(Grigg & Seebacher, 2000).
Crocodiles can live in various aquatic habitats such as forest streams, rivers, marshes,
swamps and elbow lakes. They can be found in over 90 of the world's countries and islands
(Martin, 2008). Alligators and caimans (Family Alligatoridae) are found almost exclusively
in North, Central and South America. The sole exception is the Chinese alligator which is
found in the eastern China. There are a few members from the Family Crocodylidae (true
crocodiles) in the Americas, but the majority of them can be found throughout Africa and
Asia. One member of the Family Gavialidae (the Indian gharial), is found in India and
adjacent countries, while another family member, the false gharial is distributed in few
countries in the Southeast Asia (Martin, 2008).
Majority of crocodiles species are restricted to certain part of the worlds. Among them are
Chinese alligator (Alligator sinensis), can only be found in Yangtze River, China; Orinoco
crocodile (Crocodylus intermedius), in Orinoco water system in Venezuela and Colombia
and the Philippines crocodile (Crocodylus mindorensis) which live only in the archipelago
of the Philippines (Martin, 2008). In addition, some species are distributed widely and can
Page 36
14
be found in specific continent or region such as the Nile crocodile (Crocodylus niloticus) in
Africa, the saltwater crocodile (Crocodylus porosus) in the Indo-Pacific region or the
spectacled caiman (Caiman crocodilus) in South America.
Out of 24 species of crocodiles in the world, only two species can be found in Sarawak, the
saltwater crocodile, Crocodylus porosus and the Malayan false gharial, Tomistoma
schlegellii (Abdul-Gani, 2014; Hassan et al., 2016; Sarawak Forestry Corporation, 2018).
Both species can be easily distinguished as both crocodiles have a distinctive snout feature.
The false gharials have elongated and slender snouts compared to those of the saltwater
crocodiles, which are shorter and blunt (Grigg & Gans, 1993). Both species live in different
habitats; C. porosus mainly occupying waterway areas near to the coast, meanwhile the T.
schlegellii is can only be found in further inland freshwater rivers with peat swamps habitat
and black water (Hassan et al., 2016). C. porosus are more abundance and aggressive,
perpetrator for almost all crocodile attacks in Sarawak, compare to the T. schlegellii, hence
the literature review chapter will mainly focus on C. porosus.
2.3 Crocodylus porosus
2.3.1 Taxonomy
Crocodylus porosus SCHNEIDER 1801 was first discovered and described as new species
by a German naturalist Johann Gottlob Schneider (Schneider, 1801). This species is
classified in the Family of “true crocodile”, Crocodylidae, and Order Crocodilia (Figure 2.2).
Page 37
15
Kingdom Animalia
Phylum Chordata
Subphylum Vertebrata
Class Reptilia Laurenti, 1768
Order Crocodylia
Family Crocodylidae
Genus Crocodylus Laurenti, 1768
Species Crocodylus porosus Schneider, 1801
Figure 2.2: Taxonomic hierarchy of Crocodylus porosus.
Worldwide, C. porosus is commonly known as saltwater crocodile or estuarine crocodile.
The crocodile species was given a nickname “saltie” by the Australian as it is widely
distributed in the coastal areas and rivers in the Northern Territory of Australia (Webb et al.,
2010). Another name for this crocodile is “Naked-neck” crocodile, because this is the only
species without large scales on the back of its neck. With a reputation as human killer and
causing more fatalities to human when compared to the other crocodile species, C. porosus
had earned a fearsome name as the “man-eating crocodiles”.
In general, local people in Sarawak called the saltwater crocodile ‘buaya katak’ or ‘buaya
tembaga’ (translated as frog crocodile or copper crocodile, respectively), basically based on
observation that crocodiles can jump like a frog or leap out of water and also because of the
copper-like brownish colour on the body of the crocodiles found in certain rivers. In native
Iban language, the crocodile is referred as ‘baya’. Yet, when talking about crocodile in
Page 38
16
Sarawak, the infamously huge crocodile known as ‘Bujang Senang’, once shook fear among
people in Sarawak as many victims fall into the mouth of the crocodile, is the most
remembered crocodile by the people in the state. Historically, the name of Bujang Senang
literally means a happy bachelor came from a crocodile that inhabited Batang Lupar in Sri
Aman, Sarawak, Malaysia. The word “Bujang” in Malay means bachelor, which refers to
the crocodile while “Senang” refers to the Senang River, which is one of the tributaries in
Batang Lupar, a place where the first known attack by this crocodile had happened (Ritchie
& Jong, 2002). It had been a custom in Sarawak when a large and ferocious crocodile that
had been kill or captured to be given a name according to the name of a river where it was
found such as “Bujang Samarahan”, “Bujang Tisak” and “Bujang Seblak” (Abdul-Gani,
2014).
2.3.2 Habitat and distribution of C. porosus in Sarawak
Sarawak is situated on the north-eastern part of Borneo Island, geographically separated
from Peninsular Malaysia by the South China Sea, sharing the island with the Malaysian
state of Sabah, the Sultanate of Brunei Darulsalam and the Indonesian’s Kalimantan. The
topography of the state is generally flat closer to the coast to gently undulating hills and
rugged mountains towards the borders in the west and south (Tisen et al., 2013). The tidal
portions of the rivers are typically linked with mangrove in the coastal area and the rivers
flow through great distances over broad flood plains, giving rise to the extensive crocodile
habitats. The waterways of Sarawak are comprising of 22 major river basins and its cover
Page 39
17
an area of 12 million hectares, in which the saltwater crocodile, C. porosus, is reported to
occur in all of the river basins in the state (Sarawak Forestry Corporation, 2018).
In Sarawak, C. porosus are majorly abundant in the large river systems, mangrove
floodplains and inland freshwater swamps (Tisen & Ahmad, 2010). The highest crocodile
densities in Sarawak are usually found in estuary and mid-river areas of medium sized to
large rivers (Tisen & Ahmad, 2010; Abdul-Gani, 2014; Ali et al., 2014; Robi, 2014; Zaini et
al., 2014; Sarawak Forestry Corporation, 2018). Crocodiles in Sarawak particularly the
female ones prefer to build nest in small and secluded tributaries connected to the major
rivers. Juvenile crocodiles can be found abundant in these tributaries especially after the
nesting season (Abdul-Gani, 2014; Ali et al., 2014; Robi, 2014; Zaini et al., 2014).
C. porosus can be seen in Logan Bunut, the Sarawak’s largest natural lake, situated
approximately 130 km from the city of Miri (Cox & Gombek, 1985). The lake is mainly
surrounded by peat swamp and the water drains into Sungai Teru. The species have also
been spotted in several locations in the upper region of river basin, hundreds kilometers away
from sea such as Belaga in the upper Rajang RB and Kelauh, a small freshwater tributary of
Lupar RB (Tisen & Ahmad, 2010). There are also reports received by authorities about the
sighting of crocodiles in man-made waterbodies such as in water drainages, agriculture
canals, community lakes and private ponds (Sarawak Forestry Corporation, Unpublished
report).
Page 40
18
2.3.3 Morphology and physiology of C. porosus
The saltwater crocodile, C. porosus has a large triangular head with broad and long snout
and round eyes at the top of the head. The C. porosus is the only species without large scales
on the back of its neck, a unique feature distinct the species from other species in
Crocodylidae (Figure 2.3) (Grigg & Gans, 1993). There is a pair of ridges along the centre
of the snout and it becomes more distinct with age. The upper surface of the top jaw becomes
more shrunken in large adult males. Juveniles C. porosus have more oval scales than other
crocodile species, although belly scales are rectangular, even and relatively small (Isberg et
al., 2006). C. porosus are normally green or pale tan in colour with black stripes and spots
on the body and tail but they became paler and less colourful after reaching adult stage. This
happens because the crocodile’s body usually covered with mud, grime and algae. The
ventral surface or belly is creamy yellow to white in colour, except the tail which tends to
be greyer on the underside nearer to the tip (Grigg & Gans, 1993).
Figure 2.3: Head shape of C. porosus (Illustration adapted from Caldicott et al., 2005).
Page 41
19
C. porosus possess a set of 64 to 66 teeth which designed to grab and hold onto prey and the
size of the teeth can be from 10 to 13 cm long according to the size of the crocodile (O'Shea
& Halliday, 2002; Caldicott et al., 2005). They also have powerful pterygoid muscles in its
jaw which enable this crocodile species to crush hard-shell or larger preys. Saltwater
crocodiles have the strongest bite of any living animal with 3,700 pounds per square inch
(psi) bite force, even beating the bite force of the great white sharks (Erickson et al., 2012).
The crocodilian eye possesses a set of relatively large lens, retina and tapetum lucidum, all
features commonly associated with optimized sensitivity in dim light environments (Nagloo
et al., 2016). When the spotlight or flashlight directed to crocodile’s eyes, the tapetum
lucidum, will reflect distinctive orange or red color (depending on the angle and intensity of
lights) allowing crocodiles to be detected easily at night. A semi-transparent membrane, slit
pupil, control the amount of light that reaches the retina during the day as well as protected
crocodile eyes when they submerge under water (Grigg & Gans, 1993; Nagloo et al., 2016).
Among all the extant crocodilians, C. porosus is the largest living crocodile species based
on confirmed measurements and also the world's largest living reptile in terms of mass. The
species can growth up to 6 - 7 meters length and weight perhaps could reach a ton or 1,000
kg. Crocodilians display a pronounced sexual dimorphism where males grow larger and
often more rapidly than females (Grigg & Gans, 1993). Generally, the size of adult male
saltwater crocodiles is over 5 m in length, but in rare occasion they can grow bigger and their
size can reach more than 6 m. In contrary, the length of female C. porosus is relatively
smaller and the normal maximum adult size is between 2.5 m to 3 m. For the maximum
Page 42
20
weight, it varies according to its size. Usually, less than 5 meters adults are closer to 400 to
500 kg in weight.
The largest wild crocodile ever captured alive and properly measured is a male C. porosus
called ‘Lolong’ with a size of 6.17 m (20.24 ft) (Britton et al., 2012). The exceptionally large
saltwater crocodile was captured in September 2011 from a small creek in Mindanao island,
Philippines. Meanwhile in Sarawak, the infamous white back crocodile, Bujang Senang,
killed in early 1990’s, was measured at 5.87 m (19.24 ft) and weighed more than 2000
pounds (907.2 kg) (Ritchie & Jong, 2002). Although there are some unconfirmed reports
claimed about the sighting of huge crocodiles in the rivers of Sarawak, until now, no
crocodiles were capture or killed that a have size greater than the Bujang Senang.
Majority of crocodilians can live for a long time (Cooper-Preston & Jenkins, 1993). The
saltwater crocodiles are known to live for over 70 years and may even reach 100 years.
Crocodiles who live over 50 years are considered old. A crocodile in captivity at a farm in
Australia called “Cassius” is estimated to be 110 years old. “Cassius” was captured in 1984
from a river in the Northern Territory, Australia, has been in captivity for more than 26 years
and still alive at the farm until today. With the death of “Lolong” in 2013, “Cassius” now
has been named as the world's largest crocodile in captivity (Britton et al., 2012).
Crocodiles are amphibious animals, thus they can move both in land and in water. However,
crocodilians travel more easily in the water. The saltwater crocodile is an excellent swimmer,
under water or at water surface and sometime utilizing water current to facilitate its
movement (Campbell et al., 2010). The reptile uses its long muscular tail to propel itself in
Page 43
21
the water, holding the limbs at the sides. This massive tail also came in handy when crocodile
attack its preys (Grigg & Gans, 1993). Crocodile can stay under water for 4-5 hours long,
however, this ability is very much reliant on the size; larger crocodile can stay under water
longer than the small one (Rodgers et al., 2015). When submerge, crocodile's eye is covered
by the slit pupils and flaps of skin seal its nostrils and ears against water inflow. They also
can control their heart beat by virtually slowing it into 2 or 3 beats per minute so that they
can stay longer underwater without the need to come to the surface for air (Axelsson &
Franklin, 2011). On land, crocodiles have several ways of walking or gaits including the
“belly crawl”, walking in which the crocodile slides using its legs to push itself along on its
belly over a slippery mud. Another crocodile gait is high walking with the body held clear
of the ground and they can walk faster or running. They are also had been seen sliding down
steep slope at the riverbank before entering water (Grigg & Gans, 1993).
Breeding season for crocodiles typically coincide with the wet season. C. porosus in Sarawak
started to mate at the end of the dry season (Stuebing et al., 1985). During the courting
process, a male crocodile may display his dominancy and fight with other males for potential
mate before mating takes place briefly after the courtship. In general, crocodile mating
occurs entirely in the water where male and female swim together, often in circles, make
body contact frequently and rub their head over one another (Cooper-Preston & Jenkins,
1993). Stuebing et al. (1985) suggested that crocodiles in Sarawak are actively build their
nest and lay eggs in two periods of the year, from March to May and from October to
November, based on the data collected in a crocodile farm. The months of these two periods
match with the months when the transition between the two monsoon seasons (NEM and
SWM) or inter-monsoon in Sarawak. Stuebing et al. (1985) also reported that the breeding
Page 44
22
season of crocodiles in Sarawak concur with the prawn season, hence suggest that the
abundance of prawn as the food supply for the crocodiles may be one of the environment
cues that trigger the breeding season.
During the nesting period, female crocodiles can travel up to hundreds kilometers to find
suitable place to build nest (Campbell et al., 2013). Crocodile’s nest is typically builds in an
open area not far from river or water sources, but in some occasions the nest were found up
to hundreds of meter from waterbody, but the access to freshwater is still available close to
the nest (Webb et al., 1983; Fukuda & Cuff, 2013; Evans et al., 2016). The female crocodile
built nest from available plants in the surrounding area especially grasses or shrub and used
mud to mound the plants together (Fukuda & Cuff, 2013). On average, a female C. porosus
could lay between 50 to 60 eggs and incubation period took about 60 to 100 days before the
eggs hatch. The sex of the hatchling is determined by the temperature of the nest; if the nest
temperature is around 32°C to 33°C, the egg is most likely hatch as male, whereas when
temperature above or below that, female will be produced (Cooper-Preston & Jenkins, 1993).
In wild population, only about 25% off the eggs will hatch and less than 1% of hatchlings
will survive to reach maturity. Others might be killed by other animals including human or
other crocodiles. After hatch, young crocodile tends to stay near to its nest for few months.
Adult females are said to remain near the nest up to several months, assisting hatchlings out
from the nests and protecting them from predators (Webb et al., 1977).
Crocodilians are carnivorous and opportunistic predators (Webb et al., 1991). They eat a
wide range of preys depend on their developmental stage, habitats and potential prey
diversity. C. porosus, from hatchling to adult, eat primarily at the water edge, however, the
Page 45
23
size of preys varies according the crocodile age. Young and small crocodiles eat small
animals like fish, crabs, prawns, frogs and insects. When they grow bigger the crocodiles are
capable to hunt and eat larger preys like turtles, mammals, snakes, primates, wild pigs and
livestock (Webb et al., 1991; Hanson et al., 2015). Stuebing et al. (1985) have listed potential
preys of C. porosus in rivers of Sarawak, particularly Batang Lupar. Younger C. porosus
feeds majorly on Penaeus and Caridina prawns, while larger adult diet varies from aquatic
preys like fish and crabs into large terrestrial vertebrate such as tortoise, monkey or other
animals that come to drink at the river’s edge (Stuebing et al., 1985).
Saltwater crocodiles especially the adults hunt their preys alone and as a nocturnal animals,
they are mostly active hunting preys at night (Emerling, 2017; Evans et al., 2017). They tend
to ‘sit and wait’ in shallow water or at water edge for suitable prey to come within striking
distance (Caldicott et al., 2005). Sometimes, the crocodile submerges underwater to sneak
near the potential prey. Once in the range the crocodile rapidly attacks the prey with powerful
bite and immobilise it before it is swallowed. A large prey may be stored until it starts to
disintegrate before it consumes by the crocodile (Grigg & Gans, 1993). Crocodiles swallow
stones frequently but the purpose of this action or the function of the gastroliths are still
unclear. Some researchers said that the stone are ingested incidentally and serve no function.
Others suggest that stones have an important role in buoyancy and digestion (Brazaitis, 1969;
Cooper-Preston & Jenkins, 1993; Grigg & Gans, 1993). It is believed that a gastrolith can
remain inside the crocodile’s stomach for years.
C. porosus is highly territorial animal. Large male adult crocodiles may able to monopolize
specific parts of the river that provide them with access to key resources, such as riverbanks,
Page 46
24
foods and mates (Hanson et al., 2015). The crocodiles often cannot tolerate with anything
that tried to trespass and they can be quite violent in defending their territories or nests during
the breeding season. Crocodilians are ectothermic where they exploit the external
environment to regulate body temperature through behaviours such as basking, movement
in and out of water, and mouth gaping (Cooper-Preston & Jenkins, 1993). In colder months,
the saltwater crocodile typically spends the morning basking under the sun. When their body
became too hot, the crocodile will move into the water or sometimes they seem to noticeably
avoid the sun and use the shade of mangroves when out of the water (Evans et al., 2017). In
warmer months, the saltwater crocodile avoids heat by remaining in the water during the day
and comes up on the banks at night, often burying itself in the mud of tidal areas. During
basking, crocodile open their mouths in a behaviour called “mouth gaping” in order to reduce
impact of heat on its brain (Grigg & Gans, 1993).
Ambient temperature is among the strong factor that could influence the distribution of
ectothermic animals like crocodiles as the temperature affects the behaviour and physiology
of crocodiles. The saltwater crocodile can tolerate with a wide range of water temperature,
but the optimal temperature for crocodile is around 28 0C to 30 0C (Rodgers et al., 2015).
When the temperature is outside of the optimal range, crocodiles commonly seek to maintain
body temperatures through behaviours such as basking, shade-seeking, and shifts into and
out of water (Grigg & Gans, 1993). The temperature is also a determinant for breeding and
nesting season. Heavy rains and rapid increase in the temperature in the late dry season to
the early wet season seems to trigger reproductive activities in C. porosus (Stuebing et al.,
1985). The temperature in Sarawak is relatively uniform throughout the year with an average
daily temperature ranging from 23oC during the early hours of the morning to 32oC during
Page 47
25
the day, but the average temperatures could vary between SWM and NEM (Sa’adi et al.,
2017).
Whereas most of crocodilians species are found in fresh water, C. porosus occur routinely
in hyperosmotic estuarine habitats and the species respond behaviourally to changes in
environmental salinity. The presence of lingual salt glands in C. porosus plays a crucial role
in osmoregulation that allows the species to live in saline water (Cramp et al., 2008).
Movement between marine habitat and freshwater is thought to be common in C. porosus,
particularly nomadic male juveniles or female crocodiles during nesting (Campbell et al.,
2013). Although crocodile prefers to build nest in freshwater habitat, C. porosus is also able
to nesting in hypo-saline habitats in estuary or coastal floodplain (Fukuda & Cuff, 2013).
Even, hatchlings of C. porosus are also able to survive and grow without access to fresh
water (Cramp et al., 2008). The influence of salinity on the abundance and distribution of
crocodile is also related to the waterbody habitat and riverbank vegetation. Brackish water
bodies such as saline floodplain and mangroves near to estuaries are the common habitat for
C. porosus in Sarawak (Tisen & Ahmad, 2010; Sarawak Forestry Corporation, 2018), and
these habitats support diverse fauna including fish, crustaceans, insects, mammals and birds
(Nagelkerken et al., 2008). Hence, a high productivity in the habitats may contribute to the
higher abundance of crocodiles.
Page 48
26
2.3.4 Historical literature about crocodile in Sarawak
Historical information regarding crocodiles in the island of Borneo, particularly Sarawak
can be found in records or journals by European explorers who had visited this part of the
world. Majority of them came after the arrival of an English adventurer, James Brooke in
1839 who was helping the Sultan of Brunei in quelling a local rebellion in Sarawak and later
on he was awarded the territory. He then proclaimed himself as the Rajah of Sarawak and
started to rule the north-western territory of Borneo. As the result of the political stability
and also with the supports and invitation from the Rajah himself, soon it began to attract,
among others, the natural historians, botanist and collectors of the flora and fauna came to
Sarawak.
Among the first checklist of animals in Borneo appeared in an appendix of a book published
in 1848 by Hugh Low. Hugh Low, a botanist from Scotland, who was known as a person
closed and admirer of Rajah Brooke wrote the checklist of animals he found during his stay
in Sarawak. The species checklist listed a number of mammals, birds, fish, insects,
amphibians and also reptiles (Low, 1848). Among the reptiles listed by Huge Low are two
species of crocodiles, Crocodilus (Gavialis) schlegelii MÜLLER 1838 and Crocodilus
biporcatus CUVIER 1807, which are later known by then name Tomistoma schlegelii and
Crocodylus porosus, respectively (Low, 1848).
In 1868, an Italian botanist, Odoardo Beccari arrived in Sarawak to collect samples for his
botanical collections and during his visit, he had made some significant collections of
amphibians and reptiles. In one of his trips to the interior of Borneo, Beccari had reported
Page 49
27
that he found a polustrine crocodile, possibly the enigmatic and mysterious Crocodylus
raninus Muller & Schlegel, 1844 (refer as Boaya Katak or frog crocodile by Beccari) in
Kanowit River (Beccari, 1904). However, he never mentioned if a specimen was actually
secured.
Of all the visits by well-known naturalists to Borneo, Sir Alfred Russel Wallace perhaps is
the most celebrated collector. According to Das (2004), Wallace arrived in Sarawak after his
visit to Singapore on 1st November 1856 and left Sarawak on 25th January 1856. His visit to
Sarawak was recorded in his famous work, The Malay Archipelago (Wallace, 1869).
Wallace’s collecting activities in Sarawak only covered Sadong River area (Simunjan and
Sadong) and his main primary targets are insects and orang utan, also known as “Mias” in
the book. From the information told by the Dayaks community in that area, Mias are very
strong that no animals dare to attack them except for two, the crocodile and the phyton
(Wallace, 1869). In the book, Wallace once saw a crocodile tried to seize Mias when the
animal went to seek foods on the riverbank but with his strong hands and feet the Mias was
able to beat the crocodile out and killed it.
The establishment of Sarawak Museum in 1886 by Rajah Brooke that further flourished and
developed much interest on studying and collecting specimens of flora and fauna in Sarawak.
It was believed that Sir Alfred Russel Wallace had influenced Rajah Brooke to establish the
museum with the intention to collect and study the natural flora and fauna of Sarawak. Even
after the death of the first Rajah Brooke, the Sarawak Museum continued to develop further
with the encouragement of his successor, Charles Brooke and Charles Vyner Brooke (Das,
2004). They started to hire professional curators and started to publish scientific findings in
Page 50
28
their own publications, the Sarawak Museum Journal. The first two curators of the Sarawak
Museum were John E. A. Lewis and George Darby Haviland (1888 to 1895) where both of
them were primarily interested in botany and ornithology, hence there were not much
research and information related to crocodile in the state during that time.
It was only when Edward Barlett appointed as the curator, zoological collections in the
museum started to grow. He served with the Sarawak Museum only for two years from 1895
to 1897. His most important contribution was a 24 page accounts of crocodiles and lizards
of Borneo and all the specimens that he collected were deposited in the Sarawak Museum
(Bartlett, 1895). Interestingly in his paper, he listed a large number of lizard species that can
be found in Sarawak which eight of them described as new species. While for crocodile, he
listed two species similar to what had been described by Low (1848) earlier, Crocodylus
porosus and Tomistoma schlegelii, but in his writing, Bartlett described further details about
the distribution of the crocodiles in Sarawak during that time. According to Bartlett (1895),
C. porosus can be found abundantly along the sea coast and in all rivers of Borneo while T.
schlegelii was only restricted to the estuary and Sadong River. He also had mentioned about
Crocodylus polustris which was reported to be found in some parts of Sarawak, but he did
not find any physical difference from the specimens in the museum. One specimen of C.
porosus from Baram River and one specimen of T. schlegelii from Sadong River were kept
in the Sarawak Museum (Bartlett, 1895).
Besides attracting explorers and collectors from Europe, the richness in nature and
biodiversity found in Borneo had also attracted explorers from the American continent.
Among the early American collector who came to Borneo was William Temple Hornaday.
Page 51
29
Arrived in Sarawak in 1878, Hornaday concentrated all his collecting activities only in
Sarawak (Hornaday, 1885), with his primary targets were orang utan, crocodiles,
amphibians and reptiles. Hornaday expressed a great interest in crocodilians and one of his
specimens now kept in the Museum of Comparative Zoology, Harvard which was believed
to be a specimen of Crocodylus raninus. Although this specimen was retrieved by Hornday
from an unknown Borneo locality, but many presumed that the specimen was collected in
Sarawak. In his journal book, Hornaday told a story in his book about the Brooke
government waging a war to exterminate crocodiles specifically species C. porosus that
infested all the rivers of Sarawak and had been terrorizing people (Hornaday, 1885). During
that time too, Hornaday found out that true gavial (T. schlegelii) was growing to a great size
in the Sarawak River and the Rajang River. He also obtained a very large skull from the
upper Sarawak River, which he described as much rarer than the other, but did not succeed
in securing a fresh specimen.
2.3.5 Threats and conservation
When CITES was established and came into force in 1975, all populations of the saltwater
crocodile (C. porosus) were listed in Appendix II. However, in 1979, global population of
C. porosus was shifted from Appendix II to Appendix I in the CITES except for those in
Papua New Guinea, on the grounds that the species was at risk of imminent extinction due
to excessive harvesting and trade of wild crocodiles (Jalden, 2004). Few years later, in 1985,
populations of C. porosus in Australia and Indonesia had been recovering and these countries
had successfully down listed back their C. porosus population from CITES Appendix I into
Appendix II. Recently in 2016, proposal to transfer the C. porosus in Malaysia from
Page 52
30
Appendix I to Appendix II, with wild harvest restricted to the state of Sarawak and a zero
quota for wild specimens for the other states of Malaysia (Sabah and Peninsular Malaysia)
had been approved by the CITES (Sarawak Forestry Corporation, 2018). The International
Union for Conservation of Nature and Natural Resources (IUCN) Red List of Threaten
Species also had been categorized C. porosus as lower risk / least concerned due to the news
on the recovery of this species in several countries.
Saltwater crocodile populations in Sarawak was once seriously depleted due to unregulated
hunting and overexploitation in the late 1980’s, primarily for their lucrative hide and meat
(Cox & Gombek, 1985). Hunting and killing of crocodiles were started back during the time
when Sarawak was governed by the White Rajahs. At that periods of time, crocodiles had
been a big problem to the Brooke’s government and the animals were considered as vermin,
due to the terror that are brought by the reptile as they had killed many people in Sarawak.
Therefore, the government at that time encouraged the locals in Sarawak to hunt and kill the
crocodile and offer rewards for those who brought the animal to the government (Hornaday,
1885).
The booming of tanning industry especially after the World War 2 (WWII) had increased
the demand for crocodile skins globally (Thorbjarnarson, 1999). As the result, crocodiles
hunting in Sarawak increased as the local hunters ran for the well-paid offers by the hide
companies for the crocodile skins. Crocodile hunting activities in Sarawak are believed to
reach its peak in between 1954 to 1964 and during that period, it was estimated that more
than 80,000 crocodiles were killed and on average more than 10,000 skins were exported
from Sarawak every year (Cox & Gombek, 1985). At that time, skins export from Sarawak
Page 53
31
were tax exempted, hence attracted more companies including those from outside Sarawak
to involve in hide industry in the state, eventually resulted in the increasing hunting
activities. Besides hunting for skin, crocodile’s hatchlings and eggs were taken by the locals
from their nest and sold to crocodile farms.
Thereafter, the effect of unregulated hunting and overexploitation rapidly manifested
themselves. Surveys by Cox and Gombek (1985) in several major rivers and their tributaries
in Sarawak had recorded only 56 sightings of crocodile from 1,043 km survey distance,
revealing a very low density of crocodiles, ranging from 0.014 to 0.231 individual/km. In
three of the rivers surveyed, there was no sighting of crocodile at all. In response with the
depleting number of crocodile populations in Sarawak, the state government has listed both
species of crocodiles, C. porosus and T. schlegellii, as protected animals under Wild Life
Protection Ordinance 1990 in conjunction with the listing of the animals into the Appendix
I of CITES. After the law being introduced to protect the crocodiles, conservation efforts
were carried out by the relevant agencies in the state and among them by illegalise any
hunting or selling activities related to crocodiles. The government also helps the former
crocodile hunters in finding other jobs to support themselves and their families.
After three decades protected by the law, crocodile populations in Sarawak are recovering
and several rivers in the state recorded a marked increase in the density of crocodile
compared to survey result in 1985 (Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Robi,
2014; Zaini et al., 2014). Comprehensive surveys by the relevant agencies from 2012 to 2014
reported that there were estimated more than 13,000 crocodiles live in over 40 rivers in
Sarawak (Sarawak Forestry Corporation, 2018). However, the recovery of crocodile
Page 54
32
population has resulted in a marked increase in conflict between human and crocodile (Tisen
et al., 2013).
In recent years, hunting pressure is not the major threat to crocodile populations in Sarawak,
instead they are facing greater threats as the reptile have come increasingly into conflict with
human because of their need for undisturbed nesting and foraging habitats (Lading, 2013).
Growing human population especially in riverbank areas has contributed to the increasing
encounters between human and crocodile, frequently lead to crocodile attacks on human. As
the response to the attack incidents, culling activities had been carried out by the related
government agencies. In the efforts to find the culprit, sometimes, large number of crocodiles
were taken out from the river to ease public concern and to ensure the safety of surrounding
community. In some cases, the relatives of the victim are taking the matter into their own
hands by hunting the crocodile using any available methods. These untrained hunters are not
only endangered themselves but also could result in the death of younger crocodiles which
are most likely not responsible for the attack.
Residential developments and land clearing for plantations areas that has been expanded in
riverbank areas could contribute to potential loss of riparian vegetation, hence destroy
natural habitats and nesting areas for crocodiles. Furthermore, constant encroachment into
crocodile habitat and high impact land use could indirectly affect the ecology of the rivers,
hence change the nature of the waterways (Fukuda et al., 2008). Man-made drainage system
for residential area and also water gate for the agricultural purpose could alter the dynamic
of water flow, leading to habitat fragmentations and at the same time could cause pollution
to the rivers as sewage are most likely be discharged into the waterways. Dam construction
Page 55
33
on water streams has blocked seasonal migration of aquatic species, hence limit the potential
food sources for the crocodile (Martin, 2008). Heavy pour of rain in monsoonal season in
Sarawak could increase the water level inside the dam, thus when it reaches the limit
capacity, the dam will discharge the excess water consequently increase the water level in
lower part of the river (Sa’adi et al., 2017). Flood water could destroy crocodile nests and
kill their eggs.
Increasing in human population and tourism activities near the river eventually lead to more
human activities like bathing, swimming and fishing to happen along the river during the
day and night. In addition, more people are using boats to travel from one place to another,
hence increase the traffic in the rivers. All these disturbances could affect the behaviour of
the crocodile (e.g., increase wariness or aggressiveness of crocodile) and also could drive
the animals away from the rivers (Webb & Messel, 1979; Grant & Lewis, 2010; Fukuda et
al., 2015). Meanwhile, expanding in the fishing activities could endanger crocodiles as nets
that are abundantly setup along the river could trap crocodiles especially the younger ones.
These crocodiles will end up dead entangled on the nets or kill by the fishermen (Shaney et
al., 2017).
2.3.6 Ecological and social importance of crocodiles
For centuries, the local people in Sarawak have been living side by side in harmony with the
crocodiles in riverine areas. The reptiles play parts in the oral tradition and custom of
indigenous tribes in Sarawak (Datan et al., 2012). Therefore, they are respected by the native
communities, and some still regard crocodiles as their protectors, hence the animal should
Page 56
34
not be disturbed or killed (Ritchie & Jong, 2002). There is a taboo among the people in
Sarawak saying that if a crocodile was disturbed or killed, it will come back to inflict revenge
on human. The story about the mighty Bujang Senang, a huge saltwater crocodile that has a
white stripe on its back and who is said to be responsible for numerous of attacks towards
local peoples and livestock in Batang Lupar in 1980’s and 1990’s, had been used to justify
the taboo. In May 21, 1992, a woman from the Iban ethnic had become the victim of this
crocodile in a tributary of Batang Lupar. A day after the attack, a group of police snipers and
Iban hunters successfully killed the crocodile after hours of struggling due to the ability of
the crocodile to dodge harpoons and bullets aim for it (Ritchie & Jong, 2002). The story had
become household words among the local people in Sarawak and some still believe that
crocodile attacks happened afterward were inflicted by the descendant of the Bujang Senang
(Ritchie & Jong, 2002).
Ecologically, crocodiles play key roles as an apex predator at the top of the food chain, thus
they help in guarding the balance in the complex web of life in wetland ecosystems by
feeding on wide range of prey (Hanson et al., 2015). The crocodiles also help in raising
genetic quality and keeping the ecosystem healthy by feeding on weak, sick and injured
animals. When a wetland habitat is healthy, the fishery is considered to be healthy too. It has
been claimed that the presence of crocodiles had brought positive impact on fisheries by
feeding on predators of commercially valuable fish such as catfish, turtle, water birds and
others (Whitaker, 1984).
Crocodiles also play important roles in boosting the economy of the local community
through eco-tourism. The eco-tourism activities like wildlife-viewing have become popular
Page 57
35
globally especially among new generation as people will be able to experience the thrill
watching wild animals closely in their own habitats. The presence of crocodiles in rivers in
Sarawak could be utilized by the local community to generate income, as example through
crocodile watching activities (Hassan et al., 2018). There are two crocodile farms currently
operated in Sarawak, Jong’s Crocodile Farm (in Kuching) and Miri Crocodile Farm (MCF)
own by a private company, Benaya Sdn. Bhd. Both of the farms are registered with CITES,
once primarily for the purpose of the crocodile skins production and exported to other
countries, but now majorly involved in tourism and in situ conservation as they now offer a
wide range of experiences from watching crocodiles in captivity, crocodile feeding
demonstration, research/educational displays as well as selling souvenirs to visitors.
2.4 Human-crocodile conflicts (HCC)
During the 1950’s to 1980’s, global crocodilian species are exposed to extinction due to
overexploitation and habitat loss (Martin, 2008), but protection by the international and
countries laws along with the implementation of effective conservation programs have seen
some populations in several countries achieve extensive recovery (Platt & Thorbjarnarson,
2000; Mazzotti et al., 2007; Fukuda et al., 2011; Balaguera-Reina et al., 2017). Recovery of
the crocodile’s populations had brought along a new set of problem, increasing in negative
interactions between people and crocodilians (human-crocodile conflicts, HCC) (Webb,
2008). Thus, this situation urges the crocodile managements in finding solutions to tackle
the growing problem by collecting and analysing crocodile attacks data as the data could
inform the managements about the HCC trends as well as helping them in formulating ways
to mitigate attacks of crocodile on people (Sideleau et al., 2016).
Page 58
36
While HCC have become an increasing issue, numerous attacks by crocodilians go
unreported or are poorly documented in many countries where crocodilians are distributed
(Sideleau & Britton, 2013). Analysis of attacks by American alligators (Alligator
mississippiensis) are well documented, although fatal attacks by the crocodile species are
uncommon due to their smaller size and more passive nature compare to other crocodilian
species (Langley, 2010; Woodward et al., 2014). On the other hand, more aggressive
crocodile species such as Nile crocodiles (Crocodylus niloticus) and saltwater crocodile (C.
porosus) are responsible for much higher fatality of human compared to the rest of
crocodilian species. It is estimated that 494 attacks by C. porosus were reported worldwide
in between January 2008 to July 2013, resulting in 285 fatalities, meanwhile, 428 attacks
resulting in 309 fatalities were attributed to C. niloticus during the same period (Sideleau &
Britton, 2013). Based on combine attack data for both species, it was found out that C.
niloticus and C. porosus had been responsible for almost 75% of all reported crocodilian
attacks and 88% of all reported crocodilian fatalities around the world.
Statistics of attacks on humans by crocodilians have been documented reasonably well in
several countries in the last few decades. In Australia, crocodile attacks from different parts
of the country including in Northern Territory and Queensland, were analysed in detail by
researchers and the data had been helpful for crocodile management in the country (Fukuda
et al., 2014; Brien et al., 2017). Moreover, attacks data from other countries were also had
been analysed and documented including in African nations such as Mozambique, South
Africa and Swaziland, and also Asian countries like Iran, Indonesia, Timor Leste, India and
Sri Lanka (Dunham et al., 2010; Pooley, 2014; Stevenson et al., 2014; Amarasinghe et al.,
2015; Ardiantiono et al., 2015; Sideleau et al., 2016; Das & Jana, 2018). Meanwhile, in
Page 59
37
Malaysia particularly in the state of Sarawak where most of the crocodile attacks occurred,
there is still lack of proper analysis on the HCC, although several studies had documented
attacks data that occurred in recent years (Lading, 2013; Tisen et al., 2013; Abdul-Gani,
2014). By analysing the crocodile attacks data, researchers will be able to understand the
pattern of attacks including hotspot areas, peak time or month of the attacks, victim’s gender
and age group as well as activities that associated with high risk of attack (Caldicott et al.,
2005).
2.5 Population ecology of crocodiles
Increased HCC may be related to the increasing and expanding of crocodile populations as
well as the growing human populations, urbanisation and encroachment by humans into
crocodile habitats (Webb, 2008). Fukuda et al. (2008) had examined the broad-scale
influences of the environment and anthropogenic pressures on the contemporary population
abundance of C. porosus in northern Australia. Their study identified several factors as most
likely to influence the abundance and distribution of C. porosus, among them are
temperature, salinity, riverbank vegetations, riverbank land-use and human population
density (Fukuda et al., 2008).
Human population and riverbank land-use are among the factors that have adverse impact
on the distribution and abundance of crocodiles. It is thought that increasing in human
population contributed to the increasing activities (e.g., tourism, fishing, boating etc.) in the
waterbodies and also lead to riverbank clearing for residential, industrial and agricultural
developments (Fukuda et al., 2008). Several studies suggested that these anthropogenic
Page 60
38
pressures appeared to keep the crocodile population low in the waterways. For example,
Read et al. (2004) suggested that intensive development and clearing of riparian vegetation
corridors for agricultural, pastoral and urban expansion had contributed to the low densities
of crocodile in Queensland, Australia. In Indonesia, a study by Shaney et al. (2017) found
out that the abundance of both crocodiles species in the country, C. porosus and T. schlegelii,
is correlated negatively with proximity to humans, even though C. porosus still could be
spotted in disturbed areas. They also claimed that common fish-trapping methods had
contributed to the less abundance of crocodiles in the waterbodies. Similar situation also had
been reported in Thailand where widespread fishing activities had affected the density and
abundance of the Siamese Crocodile, C. siamensis (Kanwatanakid-Savini et al., 2012).
Meanwhile in Sarawak, degradation of rivers due to the expansion of human population and
intensive usage of the river for fishing and transportation are among the contributing factors
to the depletion of wild crocodile population in 1950’s to 1980’s (Cox & Gombek, 1985).
Furthermore, constant encroachment into crocodile habitat and high impact land use could
indirectly affect the ecology of the rivers, hence change the nature of the waterways.
Pollution from industrial and agricultural activities could change the quality of water in the
rivers by increasing its acidity and the addition of chemical that could be harmful to the
crocodiles and their eggs. A study by Woodward et al. (2011) shows that there was negative
effect of pesticide pollution from agricultural activities towards the poor reproductivity of
American alligator (Alligator mississsippiensis) in Florida, USA. Furthermore, the
environmental pollution could also affect the abundance of preys for crocodile, hence drive
them away from the waterbodies.
Page 61
39
2.6 Population genetics and its importance
Population genetics is the study of genetic variation within and among the populations, and
it involves the examination and modelling of changes in the frequencies of genes and alleles
in populations over space and time (Keats & Sherman, 2013). Population genetics study also
enable us to understand the evolutionary factors that might cause the genetic variation. The
variation in genes or alleles is found throughout the genome, and by examining this genetic
diversity, evolutionary patterns can be inferred. Genetic variation within the populations and
species can be analyzed at the level of nucleotide sequences in DNA (genome analysis) and
the amino acid sequences of proteins (proteome analysis). This can now be done through
automated technology designed for genotyping and sequencing the genome and analyze
using bioinformatic software in computer. With the help of the technologies, population
geneticist is able to map and examine genetic variation within and among the populations
with histories of bottlenecks, admixture, and migration, and for advancing understanding of
wildlife (Keats & Sherman, 2013).
Management and conservation of wildlife are predicted to be more efficient with the
incorporation of population genetic information of the species (Shafiei-Astani et al., 2015).
Assessment of genetic diversity in wild population is an important step for better
understanding of the population structure and demography history, mainly through
application of genetic markers. The use of genetic markers to obtain data on genetic variation
is valuable for the species management as high genetic variation within a population reflects
a healthy population and the species is more adaptive to environmental changes, but if
otherwise, low genetic variation could lead to extinction of the species (Shafiei-Astani et al.,
Page 62
40
2015). Genetic markers has been used to evaluate population structure and historical
information of numerous species of animals as well as elucidate their geographical
distribution (phylogeography) (Maltagliati et al., 2010; Zainudin et al., 2010; Gehring et al.,
2012).
2.7 Genetic studies of crocodiles
For crocodilians, several common types of genetic markers had been used in genetic studies
such as mitochondrial DNA (mtDNA) and Short Sequence Repeats (SSRs) or also known
as microsatellite. However, the selection of microsatellites markers for population genetics
is preferred, since they are known to have high mutation rates that lead to higher allelic
variability and high levels of polymorphism. Microsatellite markers are ubiquitous in most
eukaryote genomes and provide hyper-variable sequenced tagged single locus markers
which capable of providing relatively contemporary estimates of migration and relatedness
among individuals (Miles et al., 2009a). For these reasons, the markers have been widely
used by many researchers to assess population structure and diversity, mating behaviour,
hybridisation, as well as dispersal systems, in a variety species of crocodile (Isberg et al.,
2004; Lewis et al., 2013; Hekkala et al., 2015; Lapbenjakul et al., 2017; Mauger et al., 2017).
At the same time, a sufficiently large source microsatellite primers for various species of
crocodiles had been constructed for research purposes and have facilitated many researches
on crocodilians genetic studies. Miles et al. (2009a) developed 253 novel polymorphic
microsatellite markers derived from the saltwater crocodile (C. porosus), and the markers
had successfully tested for cross-species amplification in 18 other species of crocodiles
Page 63
41
(Miles et al., 2009b). Since then, the markers had been used by researchers for genetic studies
in much less known crocodilian species such as T. schlegelii. C. rhombifer and C.
intermedius (Bashyal et al., 2014; Shafiei-Astani et al., 2015).
In Sarawak, although several genetic studies have provided some clues about the population
structure of C. porosus, however these aspects remain unclear. Studies using Cytochrome b
and 12S Ribosomal gene were unable to resolve genetic structure among population from
different areas in Sarawak (Shoon, 2009; Abdullah, 2010). Further analysis then utilized
nuclear gene markers such as randomly amplified polymorphic DNA (RAPD) and
microsatellite, and successfully identified genetic differentiation in saltwater crocodile
sample from Miri, Sibu and Bako (Kasim, 2011; Sulaiman, 2011). However, Sulaiman
(2011) and Kasim (2011) only used small sample size (one or two samples from each
locality), hence the result might be less reliable. Meanwhile, a recent study by Abdul-Gani
(2014) used more samples from localities representing western (Bako), central (Sibu) and
northern (Miri) part of Sarawak and able to map genetic structure among the populations
using microsatellite genes. However, there are questions about the genetic of crocodile
populations in areas in between the three parts of the state. Population genetic analyses of
crocodile populations in the three parts of Sarawak reveal genetic bottlenecks that had been
occurred in the populations, probably due to overexploitation in 1950’s to 1980’s and also
high gene flow among the population, suggesting frequent migration of the reptile
throughout the state (Abdul-Gani, 2014).
Page 64
42
CHAPTER 3
REVIEW OF CROCODILE STATUS AND HUMAN-CROCODILE CONFLICTS
IN SARAWAK FROM 1900 UNTIL 2017
3.1 Introduction
Crocodiles have been long living in rivers of Sarawak even before the arrival of James
Brooke. This can be proven by the presence of ‘Baya Tanah’, crocodile’s effigies or earthen
crocodile replicas, found in Engkilili, Skrang, Kanowit and Kapit. These effigies are
believed to be between 50 to 200 years old (Datan et al., 2012). The Baya Tanah played an
important role in the lives of native Iban farmers in the past, who held ‘mali umai’ ceremony
(ritual at paddy farms) in October or November each year. The main purpose for the
construction of the Baya Tanah is for the protection of the paddy farms against pests, rodents
and locusts. Crocodiles are regarded as special animals by the Ibans, especially those who
are still practising traditional beliefs. It is believed that the spirits of crocodiles will arise and
devour all the pests in the paddy field after the ‘mali umai’ ceremony and the Ibans are not
allowed to leave their longhouses for three nights as the spirit will harm them if they do so
(Datan et al., 2012).
However, the earliest documentation and the historical information regarding crocodile in
north-western of Borneo or Sarawak only came after the territory rule by the first White
Rajah, James Brooke. After Sarawak had been awarded to him in 1841, the Englishmen
brought peace and political stability to the state by ending the resistance and piracy (Baring-
Gould & Bampfylde, 1909). Soon it began to attract, among others, the historians, botanists
Page 65
43
and collectors of the flora and fauna to come to visit Sarawak. A number of famous explorers
cum naturalists also had been invited and welcomed with great hospitality by the Rajah
himself to see the richness of biodiversity in Sarawak (Low, 1848; Wallace, 1869). Many
explorations by these collectors had been mentioned in The Sarawak Gazette, however not
much in details being provided as what had been written by the explorers in their books.
Charles Brooke, the second Rajah of Sarawak had established The Government Printing
Office of Sarawak in 1870 and one of its first publications was The Sarawak Gazette. This
publication was intended to promulgate the Rajah’s orders and reports from outstation
officers. The first issue of Sarawak Gazette was on 26th August 1870, with only three pages
leaflet. Later in late 1800’s, this publication had increased in the number of printed pages as
many other issues and news being reported including matters related with administrations,
trade, agriculture, sport, law, commodity prices as well as reports from each division in
Sarawak. The Sarawak Gazette was an essential source of historical information on Sarawak
affairs, but the publication was suspended during the Japanese occupation (1942 until 1946).
Information on crocodiles in Sarawak can be found in the Sarawak Gazette such as crocodile
skin trade, bounty payment for killing crocodiles and cases of crocodile attacks on people.
Thus, this chapter examine the information on crocodiles from the year 1900 until 2017,
gathered from the Sarawak Gazette and other sources. The information is valuable to assess
the historical distribution of crocodile in Sarawak as well as to investigate the possible
expansion of the animal in the major river basins in the state. In addition, analysis of
crocodile attacks in Sarawak could identify trends of human crocodile conflicts (HCC) in
the state which could provide clues for formulating ways to solve the HCC in the future.
Page 66
44
Therefore, the objectives of this chapter are;
i. To gather and examine the historical information on crocodile in Sarawak including
the exploitation of the animal and conflicts between human and crocodile from the
year 1900 to 2017.
ii. To analyze data on crocodile attacks incidents in Sarawak from the year 1900 to
2017.
3.2 Materials and Methods
3.2.1 Study area
Sarawak is one of the two Malaysian states located in the north-western part of the Borneo
Island, the third largest island in the world. The state of Sarawak is neighbouring with
another Malaysian state in Borneo, Sabah and the state also bordering to a small nation of
Brunei and an Indonesian province of Kalimantan (Figure 3.1). Sarawak has an area of
124,450 square kilometers (km2), located immediately north of the equator between latitude
0º0’ and 5ºN and longitude 109º 36’ and 115º 40’. The coastal line of Sarawak stretches over
700 km along the north-eastern coast of the island of Borneo and the inland is generally over
300 m above sea levels with certain areas exceeding 1,200 m, particularly the mountainous
area in central region of the Borneo that form border between Sarawak and Kalimantan.
Sarawak has a tropical rainforest climate, with annual rainfall ranging between 3,300 mm
near the coastland and 4,600 mm further inland (Sa’adi et al., 2017). Average temperature
in Sarawak is around 26 ºC, but it can vary according to location. Highland areas like Bario
Page 67
45
in north-eastern corner of Sarawak where the place lying at an altitude of about 1,100 m
above sea level, the temperature in that place is a bit lower. The state experiences two
monsoonal seasons (Northeast and Southwest monsoons) and two shorter periods of inter-
monsoon seasons. The Northeast monsoon (NEM) is more prominent because of the sudden
surge in the rainfall amounts, which typically occurs from months of November until March.
Meanwhile, the Southwest monsoon (SWM) extends from April to September is on the
contrary associated with relatively dry period and less rainy days during the active monsoon
months. The inter-monsoon periods occur during the transition between the two monsoon
seasons and it usually happen in April and October respectively (Sa’adi et al., 2017). Despite
the monsoon seasons, the climate in Sarawak remains fairly stable with rain occurrence
throughout the year.
As the largest state in Malaysia, Sarawak has a vast area of waterways, comprising of 22
major river basins that originating from highland in the centre of Borneo and flow across the
state into South China Sea (Figure 3.1). Out of all river basins in Sarawak, two river basins
have a distance more than 500 km in length including Rajang River which is the longest
river in Malaysia (Table 3.1). Another important river basin in Sarawak are Samarahan,
Sarawak River, Sadong, Lupar, Saribas, Baram and Limbang. There are also large number
of tributaries, mangrove and peat swamp areas that are linked to the major river basins
throughout Sarawak such as Kuching wetland in Sarawak RB and Belawai mangroves delta
in Rajang RB.
Page 68
46
Table 3.1: List of river basins in Sarawak, its main river and approximate length (Tisen &
Ahmad, 2010).
No Basin Main River Length, km
1 Kayan Batang Kayan 125
2 Sarawak Sungai Sarawak 120
3 Samarahan Batang Samarahan 115
4 Sadong Batang Sadong 150
5 Lupar Batang Lupar 275
6 Saribas Batang Saribas 160
7 Krian Sungai Krian 120
8 Rajang Batang Rajang 760
9 Oya Batang Oya 240
10 Mukah Batang Mukah 205
11 Balingian Batang Balingian 160
12 Tatau Batang Tatau 270
13 Kemena Batang Kemena 190
14 Similajau Sungai Similajau 65
15 Suai Batang Suai 130
16 Niah Sungai Niah 105
17 Sibuti Sungai Sibuti 80
18 Baram Batang Baram 635
19 Limbang Sungai Limbang 275
20 Trusan Batang Trusan 205
21 Lawas Batang Lawas 75
22 Miri Sungai Miri 56
*“Batang”, refer as a large river by local people in Sarawak.
Page 69
47
Figure 3.1: Map of river basins in Sarawak (Map modified from Official Website of Department of Irrigation and Drainage Sarawak,
2017).
Kalimantan
(Indonesia)
Sabah
Brunei
Sarawak
Page 70
48
3.2.2 Information gathering and analyses
The Sarawak Gazette was published on monthly basis except from 1908-1920 whereas it
was published twice monthly. It contained source materials on economic history, coastal
trade returns, commodity prices, agricultural information, mineral and oil production
statistics, anthropology and archaeology. The publications of Sarawak Gazette were
suspended during the war time (Japanese occupation) in 1942. The Sarawak Gazette resumed
its publication after the end Japanese occupation in 1946 and the publication still continue
until now. However, since the transition of administration from the Brooke Government to
Crown Colony and later, forming Malaysia with Malaya and Sabah in 1964, the Sarawak
Gazette had changed and now it covers various topics and events that occurred in Sarawak
including government and administration, district annual reports, travelling reports,
confrontation and the emergency period, development, peoples and culture, history, towns,
education, agriculture, medical and health, natural history and wildlife, environment and
forestry, tourism, sports, music, law, aspects of religious life and perspectives from the
young. Due to strong competition with other media, today the role of The Sarawak Gazette
as mass media had become less important.
In this study, a total of 613 volumes of the Sarawak Gazette publications from 1900 to 1941
were examined in the Sarawak Museum archive. Certain volumes, from 1907 to 1941 (not
all available), can also be accessed online through e-Sarawak Gazette website
(http://www.pustaka-sarawak.com/gazette/home.php). However, the Sarawak Gazette
volumes for the years 1923, 1930 and 1940 were absent (not available in the Sarawak
Page 71
49
Museum archive). All the volumes were read thoroughly and information regarding
crocodiles in Sarawak were collected and recorded.
Besides the Sarawak Gazette, the information on crocodile in Sarawak especially crocodile
attacks incidents were accessed from other sources such as records kept by local agencies,
publications like books and journals, media (newspapers, online news and social media
platform) and through an online database known as CrocBITE (http://www.crocodile-
attack.info). The CrocBITE is an online database of recording attacks by crocodilians on
humans worldwide, developed by researchers from Charles Darwin University. The main
goal of the database is to improve understanding on the crocodile attacks trend for safety of
humans as wells as to assist conservation of crocodilians by providing data for research
purpose. New cases of crocodile attacks are being added to the database by contributors,
mostly officials or researchers from the countries or regions where the attacks occurred.
Information related to crocodile in Sarawak from 1900 until 2017 was divided into four
periods of time as in Table 3.2.
Page 72
50
Table 3.2: Periods of time and sources of information on crocodile in Sarawak from 1900
until 2017.
Years Period Sources
1900 – 1941 White Rajahs era • Sarawak Gazette
• Books, journals, e.g.:
i) Two years in the jungle. The experiences of
a hunter and naturalist in India, Ceylon, the
Malay Peninsula and Borneo by Hornaday
(1885)
ii) My Life in Sarawak, by The Ranee of
Sarawak by Brooke (1913)
iii) A History of Sarawak under its Two White
Rajahs, 1839-1908 by Baring-Gould and
Bampfylde (1909)
1946 – 1979 Post-war period • Sarawak Gazette
• Books, journals, e.g.:
i) A preliminary survey of the crocodile
resources in Sarawak, East Malaysia by
Cox and Gombek (1985)
ii) Man-eating Crocodiles of Borneo by
Ritchie and Jong (2002)
1980 – 1999 Period when wild
crocodile
populations depleted
and the law was
introduced to protect
them from hunting
• Reports from crocodile management agencies
(e.g., SFC, FDS)
• CrocBITE database
• Books, journals e.g.:
i) A preliminary survey of the crocodile
resources in Sarawak, East Malaysia by
Cox and Gombek (1985)
ii) Man-eating Crocodiles of Borneo by
Ritchie and Jong (2002)
2000 - 2017 Millennia era • Reports from crocodile management agencies
(e.g., SFC, FDS)
• CrocBITE database
• Online and mass media (newspaper, online
news portal etc.)
Page 73
51
All incidents of crocodile attacks reported in Sarawak from 1900 until 2017 were compiled
into database created in Microsoft Excel. The details of the victims were collected when
available including their sex, age, activity of victim during the incident, time of attack, and
outcome from the attack incidents (fatal or non-fatal). Geographic information such as
location and river basin where the incident happened as well as the month when the attack
occurred were determined from the sources. Information on the tide of the river when the
incident occurred were collected from the sources, but if the information was absent the tide
was estimated from the Sarawak tide tables (2000 to 2017) based on the time and locations
of the attacks. For attacks that occurred at night from year 2000 to 2017, information about
moon phase on the date of the incidents were also collected from website
(https://www.timeanddate.com/moon/malaysia/kuching) and the Sarawak tide table. The
moon phase was defined as four moon phases of seven-day period blocks. For instance, a
`new moon' phase was defined as the period from three days prior to new moon to three days
after new moon. A similar seven-day block was used for full moon, first and third (last)
quarter of moon. All the incidents were considered unprovoked attacks and only attacks
confirm caused by the crocodile were included in this analysis.
Minitab 17 (Minitab Inc., USA) and OriginPro 9.0 (OriginLab Corporation, USA) were used
in this study for statistical analyses and preparation of figures based on the attack data. For
statistical analyses, crocodile attacks were grouped into 10-year periods between 1900 and
2017, except for 2010 – 2017, grouped as one period. Then, the average attack per years
(mean attacks) was calculated in each period and plotted in a graph along with standard
deviation. The trend of the crocodile attacks in Sarawak from 1900 until 2017 were examined
by fitting linear regression to the mean attacks (average attacks per year) for each period
Page 74
52
(Fukuda et al., 2014). Statistical analysis of T-test and ANOVA were used to compare
variation of attacks in between river basin and months as well as to compare mean attacks
between two monsoon seasons (SWM and NEM). Chi-square tests of independence (χ2)
were applied to see whether moon phase and tidal cycle had influence on frequency of
crocodile attacks in Sarawak using Minitab 17 (Minitab Inc., USA).
3.3 Results and Discussion
3.3.1 White Rajah era (1900-1941)
During the reign of Rajah Brooke in Sarawak, crocodiles were considered as pest by the
government. William Hornaday, an American collector, in his book told stories about the
government waging a war of extermination against crocodiles specifically C. porosus that
infested all the rivers of Sarawak territory and had terrorized people during his visit to
Sarawak (Hornaday, 1885). According to him, in 1878 alone a total of 266 crocodiles had
been caught from Samarahan River and Sarawak River (Hornaday, 1885). The Ranee of
Sarawak, Margaret Brooke also mentioned in her book about the numerous loss of life
caused by crocodile and she herself experienced the terror of the creature as a man was
attacked in front of her eyes (Brooke, 1913).
To encourage people in Sarawak to catch crocodiles, the government offered rewards for
every crocodile that had been captured (Baring-Gould & Bampfylde, 1909). In order to claim
the reward, each crocodile that had been captured or killed must be brought to the
government or they must provide the crocodile’s skin (from back of its head to the end of its
Page 75
53
tail) as proofs. The government will measure the crocodile or the skin and for each foot
(approx. 30 cm), they will pay 36 cents. In addition, the government also paid money to
people that brought crocodile eggs to them. Extra rewards were given for those who had
successfully captured crocodiles that were responsible for attacking people.
Table 3.3 shows the number of crocodiles and eggs that have been brought to the government
and amount of money paid for bounty from 1901 to 1907. There is no specific detail on
species of crocodile in the reports, however it is believed that the crocodiles were C. porosus.
It was estimated that at least 1,244 crocodiles and 187 eggs were brought to the government
from 1900 to 1907. There is an increase trend in terms of number of crocodiles captured at
that period of time, except from 1903 until 1905, where the number dropped from 181
crocodiles and 36 eggs to 121 crocodiles and 29 eggs. The data also shows contrast trends
between the number of crocodiles captured with the cumulative measurement of the
crocodile, as well as the amount of reward money in certain years. As an example, in 1901,
a total of 124 crocodiles were presented to the government with cumulative measurement of
721’4” and total bounty of S$ 259.68, while in 1902, higher number of crocodiles were
brought in, 133 crocodiles, but with less cumulative measurement (664’14”) and total bounty
(S$ 239.46). This data suggest that a higher number of large crocodiles were caught in 1901
compared to in 1902. This document evidently shows a relatively large number of crocodiles
was taken out from the rivers during that time. The amount of money spent by the Brooke
government to pay local hunter for catching crocodile in Sarawak from 1901 to 1907 were
estimated to be around MYR 268,245.05 to MYR 610,935.36 in current day currency.
Page 76
54
Table 3.3: Number and measurement of crocodiles and eggs brought to the government
and amount of bounty paid (extracted from half year report in Sarawak Gazette, 1901-
1907).
Year Number of
crocodiles /
eggs collected
Cumulative
measurement,
inches
Amount of
money
paid, S$*a
Value in current
day (estimation),
MYR*b
January-June 1901 70 crocodiles 358’3” S$128.97 MYR167,652.15
July-December 1901 54 crocodiles 363’1” S$130.71 MYR171,634.20
Total 1901 124 crocodiles 721’4” S$259.68 MYR341,006.81
January-June 1902 61 crocodiles 327’6” S$117.90 MYR154,817.86
July-December 1902 72 crocodiles 337’8” S$121.56 MYR159,611.19
Total 1902 133 crocodiles 664’14” S$239.46 MYR314,471.50
January-June 1903 101 crocodiles 472’11” S$170.25 MYR221,172.54
July-December 1903 98 crocodiles,
23 eggs
514’2” S$185.79 MYR241,389.34
Total 1903 199 crocodiles,
23 eggs 986’13” S$356.04 MYR462,589.95
January-June 1904 123 crocodiles 564’10” S$203.34 MYR264,207.44
July-December 1904 58 crocodiles,
36 eggs
335’5” S$121.11 MYR157,355.36
Total 1904 181 crocodiles,
36 eggs 899’15” S$324.45 MYR421,552.22
January-June 1905 59 crocodiles 269’0” S$96.84 MYR125,831.74
July-December 1905 62 crocodiles,
29 eggs
302’1” S$109.62 MYR142,432.62
Total 1905 121 crocodiles,
29 eggs
571’1” S$206.46 MYR268,245.05
January-June 1906 70 crocodiles 322’9” S$116.19 MYR150,968.56
July-December 1906 143 crocodiles 394’4” S$141.96 MYR184,457.00
Total 1906 213 crocodiles 716’13” S$258.75 MYR336,204.24
January-June 1907 162 crocodiles,
50 eggs
707’6” S$256.20 MYR329,333.81
July-December 1907 111 crocodiles,
44 eggs
604’11” S$219.09 MYR281,636.99
Total 1907 273 crocodiles,
99 eggs
1311’17” S$475.29 MYR610,935.36
TOTAL 1901-1907 1,244
crocodiles,
187 eggs
5,868’77” S$2,120.13 MYR2,755,005.13
*a S$, Sarawak dollar, the currency used in Sarawak at the period of time.
*b Estimations for value of bounty paid in current day were calculated using United Kingdom (UK)
Inflation Calculator website (https://www.officialdata.org/1900-GBP-in-2017?amount=1) based
on formula by UK Office for National Statistics (2019). Currency exchange for Sarawak Dollar
(S$) and British Pound (£) at the period of time (1901-1907) were based on information by
Kemmerer (1904). Currency converter website (https://www.xe.com/currencyconverter) was
used for converting the current value from British Pound (£) to Malaysian Ringgit (MYR).
Page 77
55
Rewards for catching crocodiles had attracted many people in Sarawak to involve in hunting
the reptile, which led to the bloom of professional crocodile catchers. Crocodile catchers in
Sarawak were known as Pengalir or crocodile charmer, as most of them use some sort of
chanting alongside with tools such as hook or trap to captured crocodile (Cox & Gombek,
1985). Some of the professional crocodile catchers were very good in their work and they
could capture up to 60 crocodiles in a month (Sarawak Gazette, July 1, 1929). Crocodile
hunting activities in the early 1900 were mainly occurred in Samarahan, Lupar, Sadong,
Krian and Bakong rivers. The Brooke government during that time sometimes employed
professional crocodile catchers to hunt crocodiles that had killed the public.
In the early 1900’s to 1930’s, not many people were interested in harvesting crocodile skins
as the skin was not as important or lucrative as today. Thus, crocodiles that had been brought
to the government were destroyed including their skin. Only flesh or meats were sold to
those who were interested to buy such as the Japanese people (Ritchie & Jong, 2002). When
the wars started in Europe and other regions in 1930’s and 1940’s, the demand for crocodile
skin increased. The huge number of crocodiles living in the river of Sarawak had attracted
foreign companies involvement in harvesting crocodiles activities from rivers. For instance,
in a report from Sarawak Gazette (June 1, 1933), an agent from Eastern Tanneries requested
permission from Brooke government to catch crocodiles in rivers between Bintulu to Miri
and Baram. To ensure a plentiful supply for the company, they also employed local people
to catch the crocodiles and willing to pay more money for high quality crocodiles skin that
were brought to them from those rivers. The price for the skin at this time was approximately
40 cents per inch, while for meat and gallbladders the price was around 50 cents per kilogram
Page 78
56
(Cox & Gombek, 1985). Crocodile gallbladders were mainly used by people at that time for
medicinal purposes (Cox & Gombek, 1985).
Riverine communities in Sarawak during the era of Rajah Brooke lived in terror of killer
crocodile especially the one that had once having tasted human flesh (Brooke, 1913). From
1900 to 1941, a total number of 232 cases of crocodile attacks were reported in the Sarawak
Gazette. During this period of time, on average 5 cases of crocodile attack occurred every
year. Almost three quarter (73.7%) of the cases claimed the life of the victims while 26.3%
survived from the attack. In some of the cases, victims who survived after the attacks were
severely wounded and without immediate proper treatment, the victims later ended up dead
due to the injuries. During that period of time, hospitals or medical facilities were only
available in towns. In rural areas, people who needed immediate medical attention like
victims of crocodile attacks, has to travel to the towns and it usually took a long time to reach
the facilities.
The limitations of any data set must be considered and, as noted earlier, reports of crocodile
attack on human in Sarawak during the colonial era of Rajah Brooke (1900-1941) had likely
been influenced by the reports of the assigned district officers. Brooke government assigned
outstation officers into every district in Sarawak territory and among their tasks were to
monitor and report things that happened in their areas. Cases of crocodile attack could be
higher than this, as there is a possibility that some cases had not been reported in the Sarawak
Gazette.
Page 79
57
The highest number of crocodile attack cases had been recorded from 1900 to 1909 with 68
cases (Figure 3.2). The number of crocodile attacks in Sarawak showed decreasing trend in
the following years, recorded 65 cases from 1910 to 1919 and 53 cases from 1920 to 1929.
The lowest number of crocodile attack was recorded from 1930 to 1941, with only 46 cases.
In general, less frequency of crocodile attack typically associated with the fewer number of
crocodiles in the river (Fukuda et al., 2011). Thus, it is very likely that the introduction of
reward system had caused relatively large number of crocodiles being taken out of the rivers,
and this could be the reason of the decreasing trend in crocodile attacks in Sarawak.
1900 - 1909 1910 - 1919 1920 - 1929 1930 - 1941
0
10
20
30
40
50
60
70
80
90
100
Num
ber
of
case
Year
Total case
Non-fatal
Fatal
Figure 3.2: Number of crocodile attacks divided into 10-year periods during the Rajah
Brooke era, 1900-1941.
Page 80
58
The analysis of attacks reveals that more male victims (67.7%) were involved in the
crocodile attacks in Sarawak during the period of time compared to female (25.9%) (Figure
3.3a) and attacks occurred more common during daylight (55.2%) compared to night (7.3%)
(Figure 3.3b);
Figure 3.3: (a) Percentage of attacks according to victim’s gender, (b) Percentage of
attacks according to the time when the incident occurred. *Unknown = no information
available.
From 1900 to 1941, crocodile attacks occurred in 20 out of 22 major river basins in Sarawak
(Figure 3.4). The highest number of crocodile attacks were reported in the Rajang RB with
35 cases (15.1%). The second and third highest number of crocodile attacks were recorded
in Lupar RB and Baram RB with 28 cases (12.1%) and 25 cases (10.8%), respectively. The
lowest number of crocodile attack was in Similajau RB and Niah RB, where both of the river
basins recorded only one case (0.4%). There was no report of crocodile attack from Suai RB
and Sibuti RB in Sarawak Gazette from 1900 to 1941 (Figure 3.4). The Rajang RB has the
highest reports of crocodile attacks on human from 1900 to 1941 probably due to relatively
Male
67.7%
Female
25.9%
Unknown
6.5%
Day
55.2%
Night
7.3%
Unknown
37.5%
(b)(a)
Page 81
59
high number of human settlements that have already been established along the river at that
time. During the Rajah Brooke era, several major towns and villages could be found from
the lower region up to the upper region of the Rajang RB such as Sarikei, Sibu, Kanowit
and Kapit, and the settlements are navigable by steamers (Baring-Gould & Bampfylde,
1909). Furthermore, in early 1900’s, two outstation officers were assigned in Rajang, each
one of them was responsible to report things that happened in lower and upper regions of the
river basin, respectively. Hence, more crocodile attacks were reported from Rajang RB in
the Sarawak Gazette. Interestingly, crocodile attacks in Rajang RB at that period of time
were reported as far as Belaga and Pelagus, which is located more than 200 km distance
from its river mouth (Sarawak Gazette, November 1, 1927).
Raj
ang
Lupar
Bar
am
Kay
an
Limba
ng
Oya
Sadon
g
Kria
n
Saraw
ak
Muk
ah
Kem
ena
Sarib
as
Tatau
Samar
ahan
Bal
ingi
an
Miri
Trusa
n
Lawas
Nia
h
Simila
jau
Suai
Sibut
i 0
2
4
6
8
10
12
14
16
18
20
22
24
26
28
30
32
34
36
38
40
Nu
mb
er o
f ca
se
River Basin
Figure 3.4: Number of crocodile attacks from 1900-1941 according to river basin.
Page 82
60
From 1900 to 1941, incidents of crocodile attacks had occurred in monthly basis with the
highest attacks recorded in April (Figure 3.5). There were 27 cases of crocodile attacks in
April, representing 11.6% of the total cases. The second highest was in September with 22
cases (9.5%) and closely followed by May, July and October (21 cases, 9.1%). December
had recorded the least number of attacks with 12 cases (5.2%). Crocodile attacks in Sarawak
during the Rajah Brooke era occurred relatively higher during the dry season (southwest
monsoon, SWM). The SWM in Sarawak occurs approximately from April to September,
recorded 56.5% of crocodile attacks compared to the northeast monsoon (NEM), 43.5%.
Unlike SWM, rains typically occur in most of the days during NEM and the rainy season
could be lasting from October to March (Figure 3.5).
Januar
y
Febru
ary
Mar
ch
Apri
l
May
June
July
Augu
st
Septe
mber
Oct
ober
Nov
ember
Dec
ember
0
2
4
6
8
10
12
14
16
18
20
22
24
26
28
30
Nu
mb
er o
f case
Month
Total cases
Non-fatal
Fatal
Figure 3.5: Number of crocodile attacks from 1900-1941 according to month and season
when the incident occurs.
Southwest monsoon (SWM) Northeast monsoon (NEM)
Northeast monsoon (NEM)
Page 83
61
The highest number of victims were taken or attacked by crocodiles while they were bathing
or defecating in the river or landing stage (pangkalan) with 25.9% of the cases (Figure 3.6).
This followed by the victims that were grabbed from their boats by the crocodiles (14.7%)
and victims were taken by crocodile while fishing (6.9%). Approximately 14.2% of the
crocodile attacks happened while the victims were working or playing or fishing at
riverbanks or area near to the rivers. Victims attacked by crocodiles while swimming or
crossing the river (or small stream) recorded 3.4% of the cases. One case (0.4%) of suicide
reported where the victim threw himself into the river and was devoured by crocodile. The
activity of victims for 34.1% of the crocodile attack cases was not stated or explained in the
reports in the Sarawak Gazette from 1900 to 1941.
Page 84
62
Figure 3.6: Types of activities of the victims when crocodile attacked (1900-1941).
Bathing /
defecating
25.9%
Swimming /
wadding / crossing
river
3.4%
Washing /
performing
ablutions
3.4%
Fishing
6.9%
Working at
rivebank
6.0%Walking at
rivebank or road
0.4%
Playing at
riverbank / landing
stage
3.0%
Grab from boat
14.7%
Slip into water
0.4%
Boat overturn /
capsize
5.6%
Suicide
0.4%
Unknown
29.7%
Page 85
63
3.3.2 Post-war period (1946-1979)
After the World War II (WWII) and Japanese occupation, Sarawak was ceded to the British
government by the last Rajah Brooke and became one of their colonies. A governor was
appointed by the British to administer Sarawak before the state was given independence and
formed Malaysia with Malaya and North Borneo in 1963. Under the new government,
rewards for capturing crocodile were continued. It is believed that the activities of crocodile
hunting during this period of time were more intensive as demand for the crocodile skin
increased globally. Since WWII, demand for crocodile leather shoes, handbags, luggage,
wallets, watchbands, and other expensive luxury articles has far exceeded supply.
The crocodile trade peaked in the mid-1960s, when world markets absorbed more than 2
million crocodile skins each year (National Research Council of United State of America,
1983).
In Sarawak, hunting of crocodile already at its full swing started in 1954 with large harvests
were produced until mid-1960’s. Cox and Gombek (1985) reported that more than 10,000
skins were exported out from Sarawak annually between the years 1957 and 1961. It did not
take a long time for the effect of overhunting showed result. Skins export from Sarawak was
reported plummeted more than 90% within a decade, from 7,245 kg in 1961 to only 692 kg
in 1971 (Cox & Gombek, 1985). Sarawak skin export started to rise again around 1983-1984
primarily due to successful captive breeding by Jong Joon Soon Crocodile Farm. Jong Joon
Soon Crocodile Farm (now known as Jong’s Crocodile Farm) is the first crocodile farm
opened in Sarawak. The farm started their operation in 1963 with the first batch of 6
hatchling crocodiles acquired from the wild. In 1979, the farm move into larger area at
Page 86
64
Siburan, about 18 miles from Kuching and they started to breed their crocodiles. After a few
years of successful in the breeding activities, the farm had started to export crocodile skins
out of Sarawak.
There was not much information about crocodile attacks from 1947 until 1979 collected in
the present study due to unavailable records kept by the authority on this matter. After the
Sarawak Gazette resumed it publications in 1946, less coverages of crocodile attack
incidents were reported, probably due to the need of reporting other important affairs of
Sarawak or because crocodile attacks in the state were increasingly rare. The available
attacks data show not less than 31 cases of attacks were known to occur in Sarawak from
1947 until 1979, where 58% of the incidents happened in Lupar RB.
3.3.3 Period when wild crocodile populations depleted and the law was introduced
to protect them from hunting (1980-1999)
When Sarawak was under the rule of the White Rajahs and later being a colony of the British,
crocodiles were considered as vermin to the government as well as to the local people. The
crocodiles had no value and always terrorizing them, thus they wanted the animals to be
destroyed. Rewards offered for capturing the crocodiles and high demand for crocodile skins
had encouraged hunting activities. The importance of retaining the populations of crocodiles
during that time was also not recognised.
Aggressive hunting activities for the skins in Sarawak continued after the Japanese
occupation from 1950’s to 1970’s, resulting in significant depletion of crocodile populations
Page 87
65
(Cox & Gombek, 1985). There was also no monitoring of harvesting impact and
management plan for the species or its habitat during that period of time. It is believed that
the number of crocodiles in Sarawak was reduced tremendously and it was not easy to find
the animal in the wild during this period of time. Pak Deris, one of the known crocodile
hunter in Samarahan River revealed that it was very hard to find crocodiles in the river and
last crocodile caught by him was in 1974 (Cox & Gombek, 1985).
The first comprehensive survey of crocodile population in Sarawak was conducted by Cox
and Gombek (1985). Their surveys covered a distance of 1,043 km of main rivers including
selected tributaries in Kuching wetland area, Samarahan, Samunsam, Lupar, Baram, lower
Rajang, Suai and Limbang River. The survey results showed that the average density of
crocodile in Sarawak was at 0.054 individual per km (almost 6 crocodiles for every 100 km).
In Samarahan River, among the river where crocodiles were intensively hunt since the era
of Rajah Brooke, Cox and Gombek (1985) were surprised to find only one hatchling in the
river during their survey (71 km of survey distance). Three rivers surveyed by Cox and
Gombek (1985) recorded zero sighting of crocodile, namely Tisak, upper Lupar and middle
Baram River. They also reported that the crocodile habitats were seriously disturbed and
degraded while waterways were intensively used for fishing and transporting goods and
people. They claimed that the use of cross-netted fishing techniques caused not only
entanglement and drowning but also halt mobility and recruitment of crocodiles in the rivers.
This report led to the recommendations of the Special Select Committee for Flora and Fauna
to accord crocodile as protected animals in Sarawak under the Wild Life Protection
Ordinance in 1990, and also accordance with the listing of the animals in the Appendix I of
Page 88
66
CITES. Hence, starting from 1990 onwards, any hunting or selling activities related to wild
crocodiles in the state without permits are prohibited. A fine of MYR 10,000 and one year
jail will be applied to those guilty of breaking the law.
The information on crocodile attacks within the period from 1980 to 1999 were limited, due
to lack of records were collected by the authority on this matter. Incidents of crocodile
attacks were commonly been reported in the local newspapers, but it is difficult to access the
reports as majority of the reports were not been digitised, unlike today’s news where
information are easy to access as the news are both published on paper and online. Ritchie
and Jong (2002) had compiled a number of attack incidents from 1980 to 1999 in their book
and several attack cases were also added into CrocBITE database by contributors. Between
the year 1980 to 1999, not less than 39 cases of crocodile attacks were known to happened
in Sarawak, whereas most of the attacks occurred in Lupar RB (59%).
3.3.4 Millennia era (2000-2017)
After more than three decades the law was introduced (Section 3.3.3), crocodile populations
in Sarawak are on the road of recovery. Local agencies, Forestry Department of Sarawak
(FDS) and Sarawak Forestry Corporation (SFC), started patchy surveys on crocodile
populations back in 1994, covering selected rivers in Sarawak and Lupar RB (Tisen &
Ahmad, 2010). Comprehensive surveys on crocodile populations by the agencies were only
started in the years 2000 - 2001, covering more river basins in the state including Krian,
Sadong, Baram, Miri, Sibuti, Niah and Similaju. The survey results showed that the densities
of crocodiles in Sarawak were in the range of 0.1 to 1.9 individuals/km.
Page 89
67
From 2012 to 2014, FDS and SFC conducted intensive surveys on crocodile population
throughout Sarawak in conjunction with the intention of Sarawak government to down list
C. porosus from Appendix I into Appendix II CITES. The surveys covered a distance of
almost 2,200 km of all 22 river basins in the state, including their tributaries and small
streams. The surveys recorded the density of crocodile in the range from 0.05 to 3.37
individuals/km. From the survey, the number of crocodiles live in rivers in Sarawak was
estimated around 13,000 individuals (Sarawak Forestry Corporation, 2018).
With the development of information and communication technologies (ICT),
communications are easier and more effective. Thus, report or information on crocodile
attacks can be received faster and more accurate, compared to more than 20 or 30 years ago.
New cases of crocodile attacks in Sarawak can be reported instantly and the public could be
aware about the incidents in the same day. Every known details of the attack incidents can
be recorded in the database and the information can be used for research purposes.
From 2000 to 2017, a total of 135 cases of crocodile attack on human reported in Sarawak,
with the average of 7.5 cases per year. The number of crocodile attack cases for each year
per annual period showed a marked increase (regression analysis, DF = 1, p = 0.000 [p <
0.05], R2 = 55.5%, F = 19.92) especially between the year 2003 and 2015 (Figure 3.7).
Page 90
68
2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017
00
1
22
3
44
5
66
7
88
9
1010
11
1212
13
1414
15
1616
17
1818
19
2020N
um
ber
of
case
Year
Non-fatal
Fatal
Total
Figure 3.7: Number of crocodile fatal and non-fatal attacks for each year from 2000 until
2017.
The average of crocodile attacks in Sarawak from 2000 to 2017 (7.5 cases/year) is higher
when compared with the nearby countries or regions such as Timor Leste with the average
attacks of 6.4 cases/year in between 2007 until 2014 (Sideleau et al., 2016) and Queensland,
Australia with average 0.8 cases/year (Brien et al., 2017). In addition, the average number
of attacks in Sarawak is also not far less when compare to Sundarban, India where the
average attacks recorded 9.1 cases/year in 2000 until 2013 (Das & Jana, 2018).
C. porosus was identified as the culprit for almost all the attacks reported in Sarawak from
2000 until 2017. The crocodile attacks claimed the life of a slightly more than half (50.4%)
of the victims, while another 49.6% of the victims survived through the attacks. The fatality
Page 91
69
rate associated with crocodile attack in Sarawak (50.4%) is considered high compared to
nearby countries or regions. In Queensland, Australia, 34.3% of attacks by crocodile since
1971 have been fatal (Brien et al., 2017), while fatality rate of 48.8% have been reported in
Indonesia from 2000 until 2014 (Ardiantiono et al., 2015). In comparison, relatively high
fatality rate was recorded in Surdarban, India with 62.2% of attacks (Das & Jana, 2018)
and 82.2% for Timor Leste (Sideleau et al., 2016). Meanwhile in other part of the world,
fatality rates of 60% caused by saltwater crocodile and 51% caused by mugger crocodile
have been recorded in South Asia and Iran (Stevenson et al., 2014). In Mozambique,
mortality rates of 79% was observed among people attacked by crocodiles (Dunham et al.,
2010).
The frequency of male became the victims to crocodiles is higher with 84.4% when
compared to female which recorded only 15.6% from total number of crocodile attack cases
(Figure 3.8a). More male victims involved in crocodile attack in Sarawak compared to
female, most likely be attributed to the prevalence of specified gender roles within the
community in Sarawak with the occupation or activities related to water body. Occupation
or activities like fishing, collecting shrimp and crab during low tide and collecting plants or
woods (e.g., rumbia, sago) at the riverbank in Sarawak are mostly dominated by men.
Conversely in Sundarban, India where tiger prawn and crab collections are among the
important activities, there were fewer male victims of crocodile attack than females. This is
because in Sundarban, more women than men are involved in the collection of tiger prawn
and crabs (Das & Jana, 2018).
Page 92
70
Figure 3.8: (a) Percentage of victims according to gender; (b) Percentage of crocodile
attack cases according to time when the incident occurred in Sarawak from 2000 - 2017.
Crocodile attacks in Sarawak from 2000 until 2017 (n = 135) happened more in daylight
(58.9%) compared to night (41.1%) (Figure 3.8b). The timing of attacks seems to associate
with human activity pattern. Local people in Sarawak are more likely to use rivers for daily
chores, travel or working during daylight (Hassan & Abdul-Gani, 2013). Further analysis
shows that the highest proportion of the attacks happened in late evening to midnight,
between 1800 to 2359 hours (6.00 – 11.59 pm) with 34.8% (39 cases), closely followed the
time period between 1200 to 1959 hours (12.00 – 5.59 pm) whereas 33.0% (37 cases) of
attacks taking place in that period of time. Almost 25.9% (29 cases) of attacks occurred in
the morning from 0600 to 1159 hours (6.00 – 11.59 am), while crocodile attacks were rarely
occurred between midnight to early morning, 0000 to 0559 hours (12.00 – 5.59 am) with
only 6.3% (7 cases) (Figure 3.8b).
Although most of the activities are done during the day, some people prefer to do activities
like bathing or washing tools in the river at dusk or night. Certain activities such as fishing
Male
84.4%
Female
15.6%
(a)
0600 -
1159
hours
25.9%
1200 -
1759
hours
33.0%
1800 -
2359
hours
34.8%
0000 -
0559
hours
6.3%
(b)
Page 93
71
and collecting mangrove crabs could also be carried out during night. At night, human is
more vulnerable to crocodile and risk of attacks are greater compared to the daylight as
crocodile could hardly be seen by human naked eyes in the dark. On the other hand, crocodile
is a nocturnal animal and they actively hunt preys at night (Campbell et al., 2013; Emerling,
2017; Evans et al., 2017), hence contribute to the attack on human. In addition, the crocodile
has advantages in the dark situation as they possess a relatively large lens, a retina and a
tapetum lucidum in its eyes which enhance vision in dim light environments (Grigg & Gans,
1993).
Several studies have found that lunar cycle and the availability of moonlight has an influence
on wildlife activity and conflicts with humans, especially when it involves nocturnal
predators like lion and cheetah or large herbivores like elephant (Packer et al., 2011; Cozzi,
et al., 2012; Gunn et al., 2014; Lamichhane et al., 2018). In the present study, the is no
significant relationship on the frequency of attacks caused by crocodiles with the moon phase
(χ2 = 2.866, df = 3, p = 0.413[p > 0.05]) where more attacks were reported during the first
quarter of the lunar cycle with 34.8% (16 cases) of total attack incidents that were known
occurred at night (n = 46) (Figure 3.9). Attacks that occur during full moon were the second
highest with 26.1% (12 cases), followed by the new moon (21.7%, 10 cases) and the least
crocodile attacks happened in the third quarter of the lunar cycle with 17.4% (8 cases).
Therefore, there is not enough evidence to suggest that lunar cycle had influence on the
frequency of crocodile attack on human in Sarawak. Other nocturnal predators like lion and
cheetah in Africa were found more aggressive leading to more attacks on humans during the
dark nights following the full moon (Packer et al., 2011; Cozzi, et al., 2012). However, these
terrestrial animals have better chance on encountering human compare to crocodile.
Page 94
72
Crocodile encounter with human only happen when human go down to the river or doing
activities in the riverbank. It is not known whether the lunar cycle influence the usage of
river by people in Sarawak, but for activities like fishing, some fishermen or anglers like to
fish on the days when sunrise or sunset and moonrise or moonset coincide with new or full
moon phases. It is believed that during that periods, combine with good river condition, the
chance for the fishermen to get a good fishing catch will increase (Sulaiman, 2018).
New moon First quarter Full moon Third quarter
0.0
0.1
0.2
0.3
0.4
0.5
Prop
orti
on
of
att
ack
s
Moon phase
Figure 3.9: Proportion of the crocodile attacks in Sarawak between 2000 and 2017 plotted
over the lunar cycle.
Page 95
73
River tidal seems to have no influence on the frequency of crocodile attacks on people in
Sarawak as there is no significant relationship between the two variables (χ2 = 3.204, df =
3, p = 0.361 [p > 0.05]). Majority of attacks occurred when the tide in the river was high
with 43.4% or 49 cases out of total number of crocodile attacks reported in Sarawak from
2000 until 2017 (Figure 3.10). Then, it was followed by low tide where 27.4% (31 cases) of
crocodile attacks occurred in that period. Ebb tide, the period between high and
low tide during which water flows away from the shore and flood tide, the reverse flow,
occurring during rising tides from low to high tide were the third highest and the last with
15.0% (17 cases) and 14.2% (16 cases), respectively.
Although the statistical analysis showed lack of significant influence of river tidal on
frequency of attacks, high proportion of attack occurred during high tide indicating high risk
of crocodile attack during the particular period. River will be flooded with water during high
tide allowing the reptile travel further to area near to human. During the spring tides, the
water level becoming exceptionally high and the phenomenon which also known as “king
tide” when collided with heavy rain in monsoon season could lead to flood in lowland areas
(Sa’adi et al., 2017). During the flood, crocodile could swim closer to people’s houses and
potentially attacks them. There has been reports of crocodile attacks occurred during the
flood including an incident in 2016 where a man was attack by a crocodile while removing
woods under his house during flood. High frequency of attacks during high tide could also
associated with the behaviour of crocodile. A study by Mohd-Azlan et al. (2016) suggested
that crocodiles prefer to stay near riverbanks during high tides or incoming tides, therefore,
increase the possibility of crocodile encounter human. Furthermore, crocodiles are in
advantages when water level is high as the animals could easily approaching victims
Page 96
74
unnoticed, especially those who are doing activities in water edge or at riverbank, before the
crocodiles launch a sneak attack on the victims (Caldicott et al., 2005). During low tide,
activities like knee-deep fishing in shallow water and collecting foods or materials in the
riverbanks are common for people in Sarawak, therefore they could face danger of attacks
by crocodiles when doing those activities. The reptile could be lurking near to the victims
waiting to attack or when walking along the riverbank, they could bump into crocodiles
while the animals are resting or possibly guarding their nest.
Low tide Flood tide High tide Ebb tide
0.1
0.2
0.3
0.4
0.5
Pro
port
ion
of
att
ack
s
Tide
Figure 3.10: Proportion of the crocodile attacks in Sarawak between 2000 and 2017
plotted over the tidal cycle.
Adults (31 to 40 years old) were the most common victims to crocodile attacks with 19.3%,
followed by adult from the age of 41 to 50 years old (16.3%). Meanwhile, kids from the age
of less than 10 years old and old people (aged more than 60 years old) were the least common
Page 97
75
victims to crocodile attack with 5.2% of total number of cases (Figure 3.11). Higher
proportions of attacks in Sarawak involving adult (age between 31 to 40 years old and age
between 41 to 50 years old) are likely be attributed to the occupation or activities. Adult
person especially in the riverine communities typically takes the responsibility to find
income and foods for their families (Department of Statistics Malaysia, 2017), mostly with
river-related activities for example fishing using active and passive techniques. All seven
cases (100%, Figure 3.11) of crocodile attacks involving children below 10 years old were
resulting death to the victim, showing how much vulnerable this age group when they were
attacked by the crocodiles. Children usually unaware about the danger they face when come
near to the water body. Furthermore, children when were attack by crocodiles, they were
powerless to escape, even the attack came from a small crocodile (Fukuda et al., 2015).
0 - 10 11 - 20 21 - 30 31 - 40 41 - 50 51 - 60 > 60 Unknown
0
2
4
6
8
10
12
14
16
18
20
22
24
26
28
30
Non-fatal
Fatal
Nu
mb
er o
f ca
se
Age (years old)
Figure 3.11: Number of fatal and non-fatal attacks from 2000 to 2017 according to age of
victims.
Page 98
76
From 2000 until 2017, crocodile attacks occurred in 18 out of 22 major river basins in
Sarawak. The highest crocodile attacks were recorded in the Lupar RB with 28 cases (20.7%)
from the total number of cases, followed by the Saribas RB and Samarahan RB with 18 cases
(13.3%) and 15 cases (11.1%), respectively. The Kayan, Tatau, Limbang and Lawas RBs
recorded the lowest cases of crocodile attack with only one case (0.7%) for each river basin.
No attack was recorded in Mukah, Balingian, Trusan and Miri RBs (Figure 3.12).
Lup
ar
Sarib
as
Sam
arah
an
Sara
wak
Sado
ng
Bar
amKria
n
Rajan
gNiah
Sibu
tiSu
ai
Sim
ilajau
Kem
ena
Oya
Law
as
Lim
bang
Kay
an
Tatau
Miri
Muk
ah
Tru
san
Balin
gian
02468
10121416182022242628303234363840
Nu
mb
er o
f ca
se
River Basin
Figure 3.12: Number of crocodile attacks from 2000-2017 according to river basin.
Page 99
77
The peak month for a crocodile attack in Sarawak from 2000 to 2017 was in March with 23
of attacks (17%). The number of attacks in May was the second highest with 16 cases
(11.9%), followed by July (12 cases, 8.9%). October recorded the lowest number of attacks
with only 6 cases or 4.4% (Figure 3.13). Meanwhile in term of monsoon season, the attack
occurred slightly higher during the NEM (October to March), with 52.2% of the total number
of cases, while another 47.8% of crocodile attacks occurred during the SWM (April to
September).
Janu
ary
Feb
ruar
y
Mar
ch
Apr
il
May
June
July
Aug
ust
Sept
embe
r
Oct
ober
Nov
embe
r
Dec
embe
r
0
2
4
6
8
10
12
14
16
18
20
22
24
26
28
30
Nu
mb
er o
f ca
se
Month
Total cases
Non-fatal
Fatal
Figure 3.13: Number of crocodile attacks from 2000-2017 according to month and season
when the incident occurred.
Southwest monsoon (SWM) Northeast monsoon (NEM)
Northeast monsoon (NEM)
Page 100
78
The most common case of crocodile attacks in Sarawak from 2000 until 2017 occurred while
the victims were fishing with 25.2% from the total attacks, followed by bathing or defecating
(24.4%) and working at the riverbank (9.6%) (Figure 3.14). Besides that, crocodile attacks
were also occurred while the victims were washing or performing ablutions (wuduk) (8.1%),
grab from boat (6.7%), swimming or wadding in the river (5.2%) and playing at the riverbank
or near the river (1.5%). Meanwhile, victim slipped into water from the boat, their boat
overturned or collides and attack while walking at the riverbank recorded the least incidents,
with only one case or 0.7%. Incomplete information about the activities of the victim when
the crocodile attack comprised 17.0% of the cases occurred from 2000 to 2017.
The data also clearly shows that activities in water like fishing, swimming, bathing and
washing possess the highest risk of crocodile attacks (combine 63%, Figure 3.14) compare
to the ones on the land. Fishermen frequently use cast net (jala) as the methods of fishing
and they are commonly thrown the cast net in waist or knee-deep water during the low tide,
exposing themselves to the crocodile attack. Meanwhile, activities like swimming, bathing
or washing where the persons will be in the water completely or at the water’s edge, they are
vulnerable to an attack by crocodile as the reptiles are capable to swim or submerge
underwater and sneak near the victim undetected before they launch an attack (Caldicott et
al., 2005). In a number of reports, victims were having no idea of the presence of a crocodile
near them before the attack.
Attacks on people in boats are of particular interest. Although the number is less compared
to fishing and bathing, the incidents concerned the public as it could indicate that travelling
using boat is unsafe. People are worried about the crocodiles that responsible for attacking
Page 101
79
people in boat will repeat the behaviour and strike again (Ritchie & Jong, 2002). Typically,
large and aggressive crocodiles are the one who responsible for attacking people on boat as
they are capable to overturn boat or leap out of water and grab victims from boat (Caldicott
et al., 2005).
Figure 3.14: Types of activities of the victims at the moment of crocodile attacked (2000-
2017).
Bathing /
defecating
24.4%
Swimming /
wadding
5.2%
Washing /
performing
ablutions
8.1%
Waist / knee-deep
fishing
25.2%
Working at
rivebank
9.6%
Walking at
rivebank or road
0.7%
Playing at
riverbank / landing
stage
1.5%
Grab from boat
6.7%
Slip into water
0.7%
Boat overturn /
collide
0.7%
unknown
17.0%
Page 102
80
3.3.5 One hundred and eighteen (118) years comparison of human-crocodile conflicts
Between 1900 and 2017, there were at least 437 cases of crocodile attacks on humans
occurred throughout Sarawak. The average cases per year from 1900 until 2017 were
represented in Figure 3.15;
1900
- 19
09
1910
- 19
19
1920
- 19
29
1930
- 19
39
1940
- 19
49
1950
- 19
59
1960
- 19
69
1970
- 19
79
1980
- 19
89
1990
- 19
99
2000
- 20
09
2010
- 20
17
-2
0
2
4
6
8
10
12
14
16
Average a
ttack
s p
er y
ear
Year
Figure 3.15: Average number of crocodile attacks per year divided into 10-year periods
between 1900 and 2017 in Sarawak.
*Japanese occupy Sarawak from 1942 until 1946
DF = 1 F = 118.53 R2 = -95.2% P = 0.00
DF = 1 F = 13.59 R2 = 81.9% P = 0.03
Page 103
81
The average number of crocodile attacks showed a decreasing trend starting from year 1900-
1909 until 1970-1979 (regression analysis, DF = 1, p = 0.000 [p < 0.05], R2 = - 95.2%, F =
118.53) before bounce back from 1970-1979 until 2000-2017 (regression analysis, DF = 1,
p = 0.035 [p < 0.05], R2 = 81.9%, F = 13.59) (Figure 3.15). The trend seems related to the
trend of crocodile exploitation in Sarawak. The period between 1950-1959 and 1970-1979
where the lowest average number of crocodile attack per year recorded, were the time when
crocodile hunting activities in Sarawak at its peak. Over hunting of crocodiles during that
period had reduced the number of the animal in the wild. Hence, less chance for people to
encounter crocodiles which led to less number of crocodile attacks. However, starting from
1980-1989, number of reported crocodile attacks on people in the state have increased
significantly, which led to the assumption that the population of crocodile in the wild are
recovering. The law that protect crocodile from hunting introduced in early 1990’s helped
the recovery of the animal and several rivers in Sarawak had recorded noted increase in
crocodile density (Sarawak Forestry Corporation, 2018). Recovery of crocodile population
in Sarawak along with other contributing factors such as increasing in human population in
the state could be related to the increasing number of crocodile attacks. In 2010-2017, the
average number of crocodile attacks was 11 cases / year, more than twice the average of
crocodile attacks in 2000-2009 (4.7 cases / year).
The proportion of fatal attacks in Sarawak were reduced from 73.7% in 1900 – 1941 to
50.4% in 2000 – 2017, indicating the improving survival rates of the victims. According to
Caldicott et al. (2005), massive blood loss due to injury and drowning are among the cause
of death in a large number of crocodilian attacks, indicating the importance of immediate
medical treatments. Immediate medical treatments are vital for crocodile attack victims as
Page 104
82
the wound inflicted by the crocodile could be infected by bacteria or the victims might lose
too much blood (Caldicott et al., 2005), hence it is essential to have nearby medical facilities.
The higher rate of fatality in the 1900 – 1941 period (73.7%) compare to 2000 – 2017 period
(50.4%) reflected the lack of medical facilities and transportation at that time. During the
time of White Rajah administration (1900-1941), medical facilities were only available in
major towns such as Kuching and Sibu, thus, for people from rural areas who need for
medical attentions, they have to travel to the towns which at that time took days before
reaching hospitals (Baring-Gould & Bampfylde, 1909). Nowadays, with the availability of
medical facilities like clinics and hospitals in almost every district in Sarawak (Department
of Statistics Malaysia, 2017), crocodile attack victims were able to receive treatments faster.
Thus, this could contribute to the lower percentage of fatality among the crocodile attack
victims.
For 118 years, crocodile attacks had occurred in all 22 river basins in Sarawak, suggesting
that the crocodiles are dispersed in all river basins in the state (Figure 3.16). There is a
significant difference (p = 0.002 [p < 0.05]) between river basins in term of number of
crocodile attacks in Sarawak from 1900 until 2017, where the highest number of attacks was
recorded in Lupar RB. Batang Lupar, famously known with the story of a huge crocodile
known as Bujang Senang who is said to be responsible for a number of attacks on humans,
recorded 97 cases or 22.2% of total crocodile attacks in Sarawak. The second highest number
of crocodile attacks occurred in Rajang RB with 45 cases (10.3%), followed by Baram RB
with 38 cases (8.7%). The lowest cases of crocodile attack reported in Suai RB and Similajau
RB with only 3 cases (0.7%). Statistical analysis also showed significant correlation between
number of attacks with the length of the river (Pearson correlation = 0.454, p = 0.034 [p <
Page 105
83
0.05]), indicating that a large area of waterways contributes to the high number of crocodile
attacks. Large river basin that have long stretch of waterways such as Rajang RB (river
length, 760 km), Baram RB (635 km) and Lupar RB (275 km) are among the river basins
that recorded high number of crocodile attacks in Sarawak.
Two rivers, Rajang RB and Lupar RB, are the two ‘hotspot’ river basins for human-crocodile
conflicts in Sarawak since 1900. During the era of the White Rajah (1900 – 1941), the highest
crocodile attacks was recorded in the Rajang RB (15.1%), while the Lupar RB (12.1%) was
the second highest (Figure 3.4). However, the Lupar RB (20.7%) had overtaken the Rajang
RB (3.7%) as the river basin that had the highest number of attacks from the year 2000 until
2017 (Figure 3.12). Moreover, the attack data in 118 years (1900 – 2017) showed that the
total number of crocodile attacks in Lupar RB (97 cases) were more than double the number
of attacks in Rajang RB (45 cases). The high variation between the number of crocodile
attacks in Lupar RB with the rest of the river basins in Sarawak is particularly interesting,
hence further studies need to be carried out in the Lupar RB in future to investigate factors
that influence high frequency of attacks.
Page 106
84
Lupar
Raj
ang
Bar
am
Saraw
ak
Sarib
as
Sadon
g
Samar
ahan
Kria
n
Kay
an
Limba
ng
Oya
Kem
ena
Muk
ah
Tatau
Miri
Bal
ingi
an
Nia
h
Trusa
n
Lawas
Sibut
i
Suai
Simila
jau
0
10
20
30
40
50
60
70
80
90
100N
um
ber
of
case
River Basin
Figure 3.16: Number of crocodile attacks from 1900 until 2017 according to river basin.
The crocodile attacks cases from 1947 - 1979 and 1980-1999 did not have complete details
of the months and activities of victims. Thus, comparison only can be made between the
White Rajahs era (1900-1941) and Millennium era (2000-2017). In the 1900-1941 and 2000-
2017 periods, incidents of crocodile attacks had occurred in every month of the year with no
significant different among the months (p = 0.998 [p > 0.05]). Although the crocodile attacks
had occurred in monthly basis, the peak attacks were happened in April for 1900-1941
(Figure 3.5) and March for 2000 – 2017 (Figure 3.13), which are coincided with the end of
wet season in Sarawak. Similarly, in nearby countries such as Indonesia and Australia, more
crocodile attacks tend to happen at the end of the wet season (Fukuda et al., 2014;
Ardiantiono et al., 2015). The increasing attacks on human during the wet season most likely
associated with the breeding season of crocodiles. The crocodiles tend to be aggressive
Page 107
85
during mating and nesting, where the male crocodiles compete for potential mating partner,
while the female ones can be hostile to any animals or humans that try to approach or disturb
their nests (Webb et al., 1977; Campbell et al., 2013).
There is a slightly difference, although not statistically significant (p = 0.219 [p > 0.05]), in
proportion of crocodile attacks during the Southwest and Northeast monsoon seasons
between the 1900-1941 and 2000-2017 periods. From 1900 to 1941, crocodile attacks in
Sarawak occurred relatively higher in Southwest monsoon compared to Northeast monsoon
(SWM, 56.5% : NEM, 43.5%), while from 2000 until 2017, attacks occurred more in
Northeast monsoon compared to Southwest monsoon (SWM, 47.7% : NEM, 52.3%). This
slight change carries the same notion that crocodile attacks could happen anytime regardless
of the season. However, historical change in the months of each season might also explained
the difference in proportion of crocodile attacks during the NEM and SWM. According to a
study by Sa’adi et al. (2017), there is no significant shift or change in between wet and dry
season corresponds to the month of the season occurred in Sarawak. Based on the rainfall
data from 1980 to 2014 (Figure 3.17), high amounts of rainfall were recorded in Sarawak
starting from month of October until March, signalling the NEM. On the contrary, the SWM
which extends from April to September, recorded lower amount of rainfall and associated
with relatively dry period (Figure 3.17).
Page 108
86
Janu
ary
Febru
ary
Mar
chA
pril
May
June
July
Aug
ust
Septe
mbe
r
Oct
ober
Nov
embe
r
Dec
embe
r0
50
100
150
200
250
300
350
400
450
500R
ain
fall
(m
m)
Month
Figure 3.17: Average of monthly rainfall in Sarawak for the period 1980 - 2014 (adapted
from Sa’adi et al., 2017).
The changing pattern of crocodile attacks in the two monsoon seasons might be influenced
by the improvement in the quality of life in Sarawak. During SWM, less rain usually
occurred in most of the days in the months leading to the hotter and drier conditions (Sa’adi
et al., 2017). During the White Rajah era, majority of the people in Sarawak depended on
water from the river for daily chores like bathing and washing clothes or tools (Brooke,
1913). Another source of water is from water reservoirs like wells or lakes, but it could dried
out during dry season especially when draught happened for a long period of time, hence the
local people turn into river for water sources. The earliest water supply system in Sarawak
was established in the early 1900’s. However, at that time the water supply to houses only
available in Kuching area and the water was obtained from nearby streams (Mahyan &
Selaman, 2016). After Sarawak join others states to form Malaysia in 1960’s, the water
Page 109
87
supply has been expanded into other cities and the water supply connected to more areas in
Sarawak (Mahyan & Selaman, 2016). The local people also used river frequently during
SWM for traveling to other places and going out fishing as the condition is usually good for
these two activities. Dependency on the river increased the frequency of encountering with
crocodiles and it could lead to risk of attack by the animal.
In contrast, rainfalls frequently occurred during the months in NEM and the rainy season is
lasting from October to March. As the rain pour heavily, water levels in the river become
higher and rivers are usually in rough condition as the currents are running fast (Baring-
Gould & Bampfylde, 1909). These conditions are dangerous for those who used small
wooden canoes or perahu, which is comonly used by majority of riverine communities in
Sarawak at that time (Brooke, 1913), hence most people avoid using river during this time
of the year.
The data clearly show that activities in the water or at the riverbank are posing a higher risk
of crocodile attacks. Majority of the attacks in both periods (1900-1941 and 2000-2017)
happened while victims were bathing and defecating, washing or fishing in the river (or
water edge) and landing stage (pangkalan) (Figure 3.6 and 3.14). During the period of 1900
to 1941, bathing or washing in the river are common for local people who live near the river
as it is the main source of water for them. From the years 2000 until 2017, people in some
rural areas were still using water from the river for daily chores as their areas may have not
been supplied with clean pipe water yet. Based on data by Department of Statistics Malaysia
(2017), as of 2017, it is estimated that 81% of the area in Sarawak has been supplied with
treated water through pipe line system while the rest of the area are not yet connected with
Page 110
88
the system. Meanwhile, lack of proper bathing and toilet facilities provided by some of the
plantations owners to their workers also contributed to the crocodile attacks. In between
2000 to 2017, there are at least 8 cases of plantation workers attacked by crocodile while
bathing, washing cloths and defecating in the waterways near their dormitory were reported
in Sarawak. High percentage of attacks involving fishermen (about 25.2%) is major concern
as this indicate that there is still lack awareness among them about safety precautions and
the danger they facing especially for those who are fishing in the waist or knee deep water.
The majority of crocodile attack incidents in countries like Australia, Indonesia, Timor-
Leste, India and Sri Lanka were also occurred when the victims were in the middle of doing
water-bound activities like bathing, washing and fishing (Fukuda et al., 2014; Amarasinghe
et al., 2015; Ardiantiono et al., 2015; Sideleau et al., 2016; Das & Jana, 2018). According to
Caldicott et al. (2005), humans are most vulnerable to crocodile attack when doing activities
in the water or at water’s edge as this reptile is capable to sneak near to the victims
undetected before attack them.
Attacks on people in boats are of particular interest as the percentage decreases from 19.8%
(1900-1941) to 6.3% (2000-2017). In the White Rajahs era (1900-1941), most of people
travelled in the river using small wooden canoes (sampan or perahu). A large crocodile is
capable of grabbing victim from the sampan, in some case the reptile run rampage crushing
or overturn the sampan before seizing the victim. From 2000 until 2017, most of the people
had already used fibre or metal motorize boats and these types of boats are safer compared
to wooden sampan. However, in certain cases when the victims are careless, a crocodile was
able to leap out of water and grabbed the victim from the boat or using its powerful tails to
Page 111
89
knock the victims into the river. There is one bizarre case of a person intentionally jumped
into the river infest with crocodile in the Rajah Brooke era (1900-1941) and get himself
killed by the reptile (Sarawak Gazette, May 2, 1908). This one case is an exceptional,
compared to other case where crocodile aggressively attacked human.
3.4 Conclusion
From 1900 until 2017, number of human-crocodile conflicts in Sarawak were fluctuated and
based on the attacks data, it was noted that the trend of crocodile attacks on human in the
Sarawak was associated with the exploitation trend and recovery of the crocodiles in the
state. From the colonial era of Rajah Brookes (1900 - 1941) until post World War II periods
(1946 - 1979), crocodiles were hunted and heavily exploited resulting the number of the
animals in wild were depleted. In the same period, HCC in Sarawak recorded constant
decrease in number of attacks incidents. Population of crocodiles in Sarawak started to
recover after the law protected the animal was introduced in 1980’s and at the same time
frequency of crocodile attacks on human began to increase. Based on the 118 years record,
crocodile attacks had taken place in all 22 river basins in Sarawak, indicating that crocodiles
are well distributed in all river basins throughout the state since 1900. Further analysis
showed that human-crocodile conflicts pattern in Sarawak is most likely associated with
human activities pattern. The water-bound activities possess a higher risk of crocodile attack
in Sarawak compared to inland activities. Crocodile attacks occurred more during daylight
compare to night as human do most of their daily activities at that period. Meanwhile, most
common victims fall into crocodile mouth were adult men as this group of age are using
river more frequent as source of foods and incomes for their family. Furthermore, crocodile
Page 112
90
attacks happened in all months of the year, while monsoon season, moon phase and tidal
cycle had a minor influence on the frequency of attacks. The analysis of crocodile attacks in
Sarawak in this chapter had shed lights on the conflicts between human and crocodile in the
state, and it is hoped that the information could help in improving human safety, especially
for riverine communities.
Page 113
91
CHAPTER 4
DISTRIBUTION AND ECOLOGY OF SALTWATER CROCODILE, Crocodylus
porosus IN RAJANG RIVER BASIN, CENTRAL SARAWAK
4.1 Introduction
Crocodylus porosus can live in various type of habitats (Webb et al., 2010). This species,
commonly known as estuarine or saltwater crocodile due to their existence in marine
ecosystem, typically inhabit tidal rivers and small tributaries in the coastal area where
salinity changes according to seasons and the distance upstream. The C. porosus regularly
moves between rivers around the coast and in few cases they were found occupying offshore
islands (Webb et al., 2010). Interestingly, contrary to its common name ‘saltwater’ crocodile,
the crocodile species also can be found in non-tidal freshwater sections of the rivers and
inland freshwater lakes, swamps and marshes associated with rivers (Letnic et al., 2011).
One of the important major river basin (RB) in Sarawak that supports high number of
crocodiles is the Rajang RB (Sarawak Forestry Corporation, 2018). The main river of Rajang
or Batang Rajang (Batang, refer as a large river by local people in Sarawak) is the longest
river in Sarawak (and also in Malaysia) with approximate length of 760 km. The Rajang RB
originates from the Nieuwenhuis Mountain Range and the upper Kapuas Mountains in the
border of Sarawak-Kalimantan, flowing across major cities and towns such as Kapit, Song,
Kanowit, Sibu, Bintangor and Sarikei before reaching the South China Sea.
Page 114
92
C. porosus are abundant in the lower and middle region of Batang Rajang (Robi, 2014) but
this species could also be found in the upper region of Batang Rajang. Reports stated that C.
porosus were sighted as far as Kapit town, which is more than 200 km from Batang Rajang’s
river mouth (Tisen et al., 2013). Local people also claimed that C. porosus can be found in
several non-tidal and less saline tributaries of Batang Rajang in Kanowit and Song Districts.
Despite reports about the presence of C. porosus in the upper part of several major river
basins in Sarawak including Rajang, there is still lack of information regarding their
distribution and ecology in the area. Up to date, research on crocodile focused on coastal
region of Sarawak (Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Zaini et al., 2014;
Azreen, 2015; Hassan et al., 2018). Cox and Gombek (1985) had first initiated preliminary
surveys on populations and distributions of C. porosus and T. schlegelii in Sarawak,
involving several major rivers including Batang Rajang. However, their survey only covered
the lower part of Batang Rajang. The local agencies, SFC and FDS has been conducting
surveys on crocodile populations in several major rivers of Sarawak since 1994. However,
due to the vast areas of rivers in Sarawak and the high cost needed to conduct the surveys,
most of the surveys only involved rivers in the western part of Sarawak (Tisen & Ahmad,
2010). Only in 2014, the agencies have started to conduct comprehensive surveys in Batang
Rajang in conjunction with state-wide crocodile population survey programs to provide
important data for CITES appendix down-listing proposal (Robi, 2014).
Sarawak’s extensive crocodile habitats are found in the mangroves estuaries and middle
region of large river system and recent surveys data showed that this area have the highest
crocodile densities (Sarawak Forestry Corporation, 2018). Fukuda et al. (2008) had outlined
Page 115
93
several environmental factors that could influence the abundance and distribution of
crocodile in the waterways, among them are temperature, salinity, riverbank vegetations as
well as anthropogenic pressures like riverbank land-use and human activities.
The influence of salinity on the abundance and distribution of crocodile is mainly linked to
the waterbody habitats and riverbank vegetations. Brackish waterbodies such as saline
floodplain and mangroves near to estuaries are the common habitat for C. porosus as these
habitats have high productivities and support diverse fauna of fish, crustaceans, insects,
mammals and birds (Nagelkerken et al., 2008). The C. porosus could adapt to hyperosmotic
environment with the help of functional organ, lingual salt glands (Cramp et al., 2008), and
the species regularly move between marine habitat and freshwater especially when the
season change. For ectothermic animals like crocodiles, their behaviour and physiology are
influence by ambient and water temperature. The optimal temperature for crocodile is around
28 0C to 30 0C (Rodgers et al., 2015) and when the temperature is outside of the optimal
range, crocodiles commonly seek to maintain body temperatures through behaviours such as
basking, shade-seeking, and moving in and out of water (Grigg & Gans, 1993).
Human activities and riverbank land-use could influence the distribution and abundance of
crocodile and these anthropogenic pressures appeared to keep the crocodile population low
in the waterways (Read et al., 2004; Kanwatanakid-Savini et al., 2012; Shaney et al., 2017).
Furthermore, constant encroachment into crocodile habitat and high impact land use could
indirectly affect the ecology of the rivers, hence change the nature of the waterways.
Degradation of rivers due to the expansion of human population and intensive usage of the
river for fishing and transportation are among the contributing factors to the depletion of
Page 116
94
wild crocodile population in 1950’s to 1980’s (Cox & Gombek, 1985). In addition, pollution
from industrial and agricultural activities could change the quality of water in the rivers and
affect the abundance of preys for crocodile, hence in a way could influence the distribution
of the crocodiles in certain areas.
Although C. porosus typically occur at very low densities in non-tidal rivers and upstream
reaches the freshwater rivers, their presence has a significant impact on the use of rivers and
riparian areas by the people and livestock. Increasing in frequency of the crocodile sightings
in the upper region of Batang Rajang for the past few years had brought concern to the people
who live near the river. The people also claimed that the crocodiles were spotted in the area
where the animal was not seen before such as in the freshwater section, several kilometers
upstream of non-tidal tributaries in upper Batang Rajang. Majority of riverine communities
in Rajang RB still rely on the river as a mean of transportation, source of food and incomes.
Therefore, the objectives of this chapter are;
1. To assess the density and distribution of C. porosus in eight rivers representing upper,
middle and lower part of Rajang River Basin.
2. To compare the current density of C. porosus in eight selected rivers in Rajang River
Basin with previous survey.
3. To determine the crocodile habitats, selected water quality parameters and the
abundant of potential food sources for crocodile in the eight rivers of Rajang River
Basin.
4. To determine relationship between crocodile density and distributions with habitats,
selected water quality parameters and the abundant of food sources for crocodile.
Page 117
95
4.2 Materials and Methods
4.2.1 Study area
The Rajang River Basin (RB) has drainage area of approximately 51,153 km2 and the length
of its main river, Batang Rajang is approximately 760 km. The river basin is located in
northwest of Borneo Island and in the central part of Sarawak, next to the Saribas RB and
Oya RB. The Rajang RB originates from the Nieuwenhuis Mountain Range and the upper
Kapuas Mountains in the border of Sarawak-Kalimantan. The main trunk of the Rajang
River flows a relatively straight path before begins to separate into several tributaries starting
at the approximate position of the town of Sibu. The distributaries are, from the southwest
to northeast, the Rajang, Belawai, Paloh, Lassa, and Igan and these tributaries flow directly
into South China Sea (Figure 4.1). Among the major cities and towns can be found along the
Rajang River are Kapit, Song, Kanowit, Sibu, Bintangor and Sarikei. Some other important
tributaries of Batang Rajang are the Balleh River, Balui River, Katibas River, Ngemah River
and Kanowit River. Large areas of swampy delta can be found in the lower part of Rajang
RB including in Tanjung Manis and Belawai.
The eight rivers and tributaries from upper, middle and lower region of Rajang RB were
selected in this study, namely:
1. Igan River
2. Belawai River
3. Sarikei River
4. Nyelong River
5. Kanowit River
6. Poi River
7. Ngemah River
8. Katibas River
Lower region
Middle region
Upper region
Page 118
96
µ0 10 20 30 405
Kilometers
Sibu
Kanowit Sarikei
Song Kapit
Igan
Belawai
Figure 4.1: Map of Rajang River Basin. (A, Kuala Igan; B, Belawai River; C, Sarikei and Nyelong River; D, Kanowit River; E, Poi River; F,
Ngemah River and G, Katibas River)
A
Middle region
B
C D
E F G
Lower region
Upper region
Figure 4.1: Map of Rajang River Basin (A, Igan River; B, Belawai River; C, Sarikei and Nyelong River; D, Kanowit
River; E, Poi River; F, Ngemah River and G, Katibas River).
Rajang River Basin
Page 119
97
4.2.2 Crocodile survey
Crocodile surveys in eight rivers of Rajang RB were held in Southwest Monsoon (SWM),
from the month of March to September 2017. The surveys covered the distance ranged from
10.2 km to 18.0 km, totalling 106 km of linear distance of the rivers (Table 4. 1).
Table 4.1: Details of surveys in eight rivers of Rajang River Basin.
River
Date GPS coordinates
Survey linear
distance (km)
Igan 22nd and 23rd
April 2017
*1 2°49'58.83"N, 111°40'47.36"E *2 2° 48'05.39"N, 111°44'43.05"E
10.2
Belawai 25th and 26th
April 2017
*1 2°11'39.87"N, 111°15'55.24"E *2 2° 16'05.88"N, 111°17'03.34"E
10.3
Sarikei 24th and 25th
March 2017
*1 2°8'0.1650"N, 111°30'50.51"E *2 2°2'55.13"N, 111°29'37.70"E
13.8
Nyelong 26th and 27th
March 2017
*1 2°8'4.97"N, 111°31'30.73"E *2 2° 4'5.69"N, 111°35'11.32"E
11.5
Kanowit
30th and 31st
July 2017
*1 2°5'53.16"N, 112°9'28.99"E *2 2°1'7.70"N, 112°4'28.40"E
18.0
Poi
2nd and 3rd
August 2017
*1 2°3'31.79"N, 112°16'50.19"E *2 1°59'20.00"N, 112°15'27.70"E
12.8
Ngemah 21st and 22nd
September 2017
*1 2°1'28.40"N, 112°23'52.57"E *2 1° 57'41.48"N, 112°23'53.65"E
12.4
Katibas 19th and 20th
September 2017
*1 2°0'36.13"N, 112°33'14.10"E *2 1° 54'32.78"N, 112°33'37.92"E
17.0
* GPS reading coordinates for (*1) starting point and (*2) end point of the survey
When planning a crocodile survey, several factors need to be considered before choosing the
date and time for the survey including tides, moon phase and weather. Hence, daily tides
table, information on moon phase periods and weather forecast were assessed carefully. The
survey was conducted in spring tide during full moon (or almost full moon). The spring tides
Page 120
98
are preferable to the neap tide because they exposed more of the riverbank for longer periods.
The survey began on a falling tide (one or two hours before the lowest tide) as this will give
the surveyor more time for scanning the bare riverbank. Maximum exposure of bare
riverbanks without vegetation during low tide are important as vegetations like nipa and
mangrove trees could shields crocodiles from surveyor’s view and spotlight (Abdul-Gani,
2014). Furthermore, a good weather condition with clear sky (although sky in some areas
were cloudy) allowed the survey to be carried out smoothly. Heavy rain could disturb the
survey process and the visibility are limited in this condition which could resulting
crocodiles miss spotted by the surveyors (Fukuda et al., 2013a).
Two days of night survey were carried out in each selected river in the Rajang RB. The
survey was started from the starting point in the downstream (the river mouth) and moved
towards the designated end point in the upstream (inland). The survey took about 2 to 4 hours
to complete, thus counter direction survey from the end point to the starting point was not
be able to carry out after the first survey as water level in the river were higher due to
incoming tide. The crocodile counting during high tide periods are typically lower as
juveniles (hatchling and yearling) normally retire amongst flooded nipa and mangroves
while the adult ones might stay in the water or in the higher ground which is more difficult
to spot (Abdul-Gani, 2014). After survey in the first night was carried out, the survey was
repeated in the next night, covered the same river stretch and distance with the first night
survey. Repetitive survey on the consecutive nights could reduce the possibility of double
counting of crocodile (Fukuda et al., 2013a). For wider rivers (>500m width) like Belawai
and Igan, each sides of the bank were surveyed separately, where the survey commenced
Page 121
99
from the left side of the bank, then once reached the coordinates of the end points of the
survey, the boat turned back and continued the survey along the right side of the bank.
The night spotting technique adapted from Bayliss (1987) and Fukuda et al. (2013a) was
used in the survey. The technique involved direct counting of the crocodile at night from the
boat using 12 Volt Quartz-Halogen handholds spotlight powered by 12V Fujiya NS60 car
battery. A fibreglass boat (size 5m length x 1.2m width x 0.5m height) with a single 30 horse
power (hp) engine was used during the survey, operated by an experience boatman. The boat
was cruised slowly at 10 to 15 knots throughout the survey distance. Two spotters were
assigned to scan both side of riverbank and middle of the river simultaneously, looking for
eyes shine. The crocodile’s eye usually will reflect distinctive orange or red colour when the
spotlight directed to them. The light beam directed to the glowing eyes often mesmerises
crocodile and discourage the animal from moving off. When eye shine was detected, the
spotters will slowly and quietly direct the boat towards the eye shine, allowing them to
approach the crocodile as close as possible for capturing or at least the observer can
approximate the size (total length, TL) or age cohort of the crocodiles. To minimise conflict
and bias, only one observer was given the task to estimate the size of the crocodile in all
studied rivers.
All crocodiles spotted were categorized according to size class adapted from Bayliss (1987)
and Robi (2014) (Table 4.2). If the observer is unable to accurately estimate the size class,
the sightings will be recorded as “eyes only” (EO). For crocodile that were detected
swimming in the water, estimation of TL only can be made if the whole body (from the head
to end of the tail) is visible. If only the crocodile’s head and anterior neck are visible, the
Page 122
100
head length (HL) / total length (TL) ratio of 1:7 were used to estimate the size of the
crocodile, meaning that TL is around 7 times of HL (Fukuda et al., 2013b). Each location
of crocodile spotted during the survey were recorded using Global Positioning System
(Garmin GPSmap 60CSX, 2005).
Table 4.2: Size class for crocodile survey (Bayliss, 1987; Robi, 2014).
Class Approximate size
(total body length, m)
Cohort
Hatchling < 0.5 Hatchling
2 0.5 – 1.0 Yearling
3 1.0 – 1.5 Sub-adult
4 1.5 – 2.0 Sub-adult
5 2.0 – 3.0 Adult
6 > 3.0 Adult
EO Eyes only Eyes only
4.2.3 River characteristics and landscapes
River characteristic surveys were conducted during daylight involving both left and right
sides of the riverbank as in Table 4.1, using stream and habitat assessment data sheets
(Barbour et al., 1996; Iwata et al., 2003; Bolhen, 2017). Five habitat parameters which are
bank vegetation, verge vegetation, in-stream cover, bank erosion and stability and the
presence of riffles, pools and bends were scored from very poor to excellent for each river.
Related form used in the survey is as in Appendix A1. The guide for scoring is shown in
Table 4.3.
Page 123
101
Table 4.3: Field guide for river habitat assessment (modified from Barbour et al., 1996;
Iwata et al., 2003; Bolhen, 2017).
Habitat
parameter
Habitat Survey Field Guide
Excellent
(score = 10)
Good
(score = 8)
Fair
(score = 6)
Poor
(score = 4)
Very poor
(score = 2)
A1
(Bank
vegetation)
Mainly
undisturbed
nature
vegetation.
No sign of
site
alteration.
Mainly native
vegetation.
Little
disturbance or
no sign of
recent site
disturbance.
Medium
cover,
mixed
native/
introduced.
Or one side
cleared the
other
undisturbed.
Introduced
ground cover,
little native
under storey
or over storey,
predominantly
introduced
vegetation.
Introduced
ground cover
with lots of
bare ground
occasional
tree. Also
includes site
with concrete-
lined channels.
B1
(Verge
vegetation)
Mainly
undisturbed
nature
vegetation on
both sides
river. Verge
more than 30
m wide.
Well-vegetated
wide verge
corridor.
Mainly
undisturbed
native
vegetation on
both sides of
river; some
introduced or
reduced cover
of native
vegetation.
Wide-
corridor of
mixed
native and
exotic, or
one side
cleared, and
other wide
corridor of
native
vegetation.
Very narrow
corridor of
native or
introduced
vegetation.
Bare cover or
introduced
grass cover
such as pasture
land.
C1
(in-stream
cover)
Abundant
cover.
Frequent
snags, logs or
boulders with
extensive
areas of in-
stream,
aquatic
vegetation
and
overhanging
bank.
A good cover
of snags, logs
or boulders
with
considerable
areas of in-
stream and
overhanging
vegetation.
Some snags
or boulders
present
and/or
occasional
areas of in-
stream or
overhanging
vegetation.
Only slight
cover. The
river is largely
cleared, with
occasional
snags and
very little in-
stream
vegetation.
Generally, no
overhanging
vegetation.
No cover. No
snags, boulders
submerged or
overhanging
vegetation. No
undercut
banks. Site
may have rock
or concrete
lining.
Page 124
102
Table 4.3 continued
D1
(Bank
erosion
and
stability)
Stable, no
erosion/
sedimentation
evident. No
undercutting
of banks,
usually
gently bank
slopes, lower
banks
covered with
roots mat
grasses, reed
or shrubs.
Only spot
erosion
occurring.
Little
undercutting
of bank, good
vegetation
cover, usually
gently bank
slopes, no
significant
damage to
bank structure.
Localized
erosion
evident. A
relatively
good
vegetation
cover. No
continuous
damage to
bank
structure or
vegetation.
Significant
active erosion
evident
especially
during high
flows.
Unstable
extensive
areas of bare
banks, little
vegetation
cover.
Extensive or
almost
continuous
erosion. Over
50% of bank
have some
form of
erosion; very
unstable with
little
vegetation
cover.
E1
(Riffles,
pools and
bends)
Wide variety
of habitats.
Riffles and
pools present
of varying
depths. Bends
present.
Good variety
of habitat -
e.g., riffles and
pools or bends
and pools.
Variation in
depth of riffle
and pool.
Some
variety of
habitat- e.g.,
occasional
riffle or
bend. Some
variation in
depth.
Only slight
variety of
habitat. All
riffle or pool
with only
slight in
depth.
Uniform
habitat.
Straight
stream, all
shallow riffle
or pool of
uniform- e.g.,
channelled
stream or
irrigation
channel.
All scores then were sum up and each river was categorized according to the total score. The
stream habitat category is shown in Table 4.4.
Table 4.4: Scores for stream habitat category (modified from Barbour et al., 1996; Iwata et
al., 2003; Bolhen, 2017).
Scores Stream Habitat Category
36 – 40 Excellent – Site in natural or virtually natural condition; excellent
condition.
29 – 35 Good – Some alteration from natural state; good condition.
20 – 28 Fair – Significant alteration from the natural state but still offering
moderate habitat; stable.
12 – 19 Poor – Significant alteration from the natural state, with reduced habitat
value; may have erosion or sedimentation problems.
8 - 11 Very poor – Very degraded, often with severe erosion or sedimentation
problems.
Page 125
103
Other characteristics were observed and determined during the field sampling (Montague,
1983; Messel & Vorlicek, 1986) as in Table 4.5.
Table 4.5: Characteristics observed and recorded in each river during field sampling
(Montague, 1983; Messel & Vorlicek, 1986).
Characteristic Details
i. Type of river/
water
The river surveyed was categorized either as main river, tributary
or small stream. Water type of the river was also determined either
it is salt water, brackish water, black water or freshwater.
ii. Distance from
sea
Coordinates for the river/ tributary were recorded using GPS.
These coordinates were used to estimate the distance of the
river/tributary from sea.
iii. Width and depth
of the river
Width and depth of the rivers were measured using Bushnell Elite
1500 range finder and Hondex PS-7 portable depth sounder.
iv. Tidal influence Influence of tide toward the river was determined (tidal or non-
tidal).
v. Riverbank
characteristics
Riverbank characteristics include riparian vegetation and major
forest types (mangroves, peat swamp, limestone, Kerangas, Mixed
dipterocarp forest) along the riverbank of the river were
determined and recorded including dominant plants species.
Canopy covers of the river were also observed (shaded, open, or
partly shaded/open).
vi. Land use Activities which can directly and indirectly give impact upon river
habitats such as human settlements (city, small towns, villages,
longhouses, schools), agricultural areas (estates, farms,
aquaculture plots), industrial (factory, saw mill, logging site) and
developments (bridges, boat/ferry terminal or jetty, waterfronts,
shops) were recorded in each river.
Page 126
104
4.2.4 Selected water quality parameters
Salinity, water temperature and pH were measured in situ using portable equipment at all
study sites (rivers and tributaries) in the Rajang RB including the intersection of tributary
from the main river up to the upper stream of the tributary. In each river, five stations were
selected for water quality assessment. The temperature and pH were measured using Hanna
HI 8314 pH meter, and salinity was measured using Atago PAL-06S refractometer. Latitude
and longitude of the site for water sampling were recorded using Global Positioning System
(Garmin GPSmap 60CSX, 2005).
4.2.5 Potential aquatic food resources for crocodiles
The abundance of possible food resources for crocodile in the river was estimated via Catch
per Unit Effort (CPUE) approach (Hassan et al., 2016). Fish captured method used three-
layer gill net (length and drop: 15m x 1.5m; stretch mesh size: 1.2 cm and 7.5 cm;
deployment time: depends on tide) had been carried out accordingly in each studied river.
The gill net was deployed for 2 to 5 hours and the duration of deployment was recorded. The
samplings were repeated three times in all of the 8 studied rivers except for Ngemah and
Katibas River where the samplings were repeated twice. Locations of the gill nets deployed
were recorded using Global Positioning System (Garmin GPSmap 60CSX, 2005). The
coordinates of the location where the gill nets were deployed are as in Appendix A5 (see
page 236).
Page 127
105
Fish catch were examined and identified to species level using FishBase database
(http://www.fishbase.org) and other available references (Parenti & Lim, 2005). The value
of CPUE was calculated using formula:
Catch per unit effort, CPUE = Total catch (kg)
Sampling duration (hours)
4.2.6 Data analysis
Analysis of the crocodile density followed Bayliss (1987) and Fukuda et al. (2013). The
mean relative density was calculated using formula;
Mean relative Density = 𝑛
𝑑
Where,
n = total number of crocodiles
d = total linear distance of surveyed waterway
Comparison of crocodile density in Rajang RB was carried out between the data obtained
during this study and data surveys by Robi (2014). Robi (2014) had conducted surveys in
several rivers in Rajang RB covering the same six rivers with the present study, namely Igan,
Sarikei, Nyelong, Poi, Ngemah and Katibas Rivers.
Page 128
106
Maps of crocodile distribution in each surveyed river were generated using ArcMap in
ArcGIS 10.2 software (ESRI Inc, USA). Each GPS coordinates of crocodile sighting were
plotted into the maps along with the locations of human settlements (towns, villages and
longhouses), agricultural areas and riverbank land use developments, e.g., bridge,
constructions, ferry terminal, logging camps etc. observed during the survey.
All ecological data collected in this study were recorded in the Microsoft Excel and used in
generating descriptive statistics (mean and standard deviation). One-way ANOVA were
performed using Minitab version 17 (Minitab Inc., USA) to determine if there is any
significant difference of the mean of selected water quality parameters among the rivers and
tributaries in the Rajang RB. If significant different is found, post-hoc based on Tukey’s was
used in the analysis to compare the variation in selected water quality parameters among the
rivers.
The principal component analysis (PCA) was performed using OriginPro version 9
(OriginLab Corporation, USA) to assess the relationship between the density of crocodile
with selected environmental variables, habitat and food abundance. To determined which
combination of variables that could have influence on the density of crocodiles, General
Linear Model (GLM) analysis was performed using Minitab version 17 (Minitab Inc., USA).
The environmental variables were represented by three physicochemical parameters namely
salinity, pH and temperature. In addition, the potential food abundance and habitat for
crocodile used data CPUE and habitat scoring recorded in the surveys were also involved in
PCA and GLM analyses.
Page 129
107
4.3 Results
4.3.1 Crocodile density
A total of 100 crocodiles were spotted during the surveys in eight rivers and tributaries of
Rajang RB (Table 4.6). The crocodiles were found (at least one individual) in all surveyed
rivers except for the Kanowit River where no crocodile was spotted during the two night
surveys. The highest number of crocodiles spotted in the survey was in Igan and Sarikei
River both with 14 individuals, respectively.
The highest number of crocodiles belonged to size class ‘Hatchling’ (TL < 0.5m) with 33
individuals, significantly higher (p < 0.05) compared to other size class except for the ‘Eye
Only’ (EO) (p = 1.000) and ‘Class 2’ (p = 0.166) (Table 4.6). The EO was the second highest
with 31 individuals, followed by ‘Class 2’ (0.5m < TL < 1.0m) (n = 16 individuals), ‘Class
3’ (1.0m < TL < 1.5m) (n = 12 individuals) and ‘Class 4’ (1.5m < TL < 2.0m) (n = 4
individuals). The Crocodile in Class 5 with size (TL) from 2 m – 3 m was the lowest number
of individuals sighted in this study with 3 individuals. There is no crocodile found in the
surveys has the size (TL) more than 3 m (Class 6).
The mean relative density of crocodile in the surveyed rivers (except for Kanowit River) was
ranged from 0.06 to 1.32 individuals/km (Table 4.6). Igan River recorded the highest density
of crocodile with 1.32 ± 0.07 individuals/km and significantly different (p < 0.05) with other
rivers except for Belawai River (p = 0.087). While, the lowest density of crocodile recorded
in Katibas River with the value of 0.06 ± 0.00 individuals/km, significantly different (p <
0.05) with other rivers except for Ngemah River (p = 1.000) and Poi River (p = 0.832).
Page 130
108
Table 4.6: Relative density of C. porosus in eight tributaries of Rajang River Basin.
River
Survey
day
Number of crocodiles
according to size class*
Total
number of
individuals
Relative
density
(individual
s/km)
Average
density
(individual
s/km)
H 2 3 4 5 6 E
O
Igan 1 3 3 3 1 1 - 3 14 1.37 1.32 ± 0.07
2 4 2 1 1 - - 5 13 1.27
Belawai 1 4 2 1 - 2 - 3 12 1.17 1.07 ± 0.14
2 5 2 1 - - - 2 10 0.97
Sarikei 1 4 3 2 2 - - 3 14 1.01 0.94 ± 0.11
2 5 2 1 - - - 4 12 0.86
Nyelong 1 2 1 1 - - - 4 8 0.69 0.74 ± 0.06
2 4 1 2 - - - 2 9 0.78
Kanowit 1 - - - - - - - 0 0 0
2 - - - - - - - 0 0
Poi 1 1 - - 1 - - - 2 0.16 0.16 ± 0.00
2 1 - - - - - 1 2 0.16
Ngemah 1 - - - - - - 1 1 0.08 0.08 ± 0.00
2 - - - - - - 1 1 0.08
Katibas 1 - - - - - - 1 1 0.06 0.06 ± 0.00
2 - - - - - - 1 1 0.06
Total 33 16 12 5 3 0 31 100
Table 4.7 summarizes data of crocodile density in Rajang RB in 2014 and the density data
recorded in the present study.
Table 4.7: Comparison density of crocodile between survey in 2014 and 2017 (present
study).
River Crocodiles density (Individuals/km)
2014* 2017
Igan 0.53 1.32
Belawai NA 1.07
Sarikei 1.26 0.94
Nyelong 1.19 0.74
Kanowit NA 0
Poi 0 0.16
Ngemah 0.07 0.08
Katibas 0.04 0.06
*Data from survey done by Robi (2014). NA, data is not available.
Page 131
109
In general, the rivers in the study area recorded an increase in crocodile density from 2014
to 2017 except for Sarikei and Nyelong Rivers. Comparison between the density of crocodile
in 2014 and 2017 cannot be done in Belawai and Kanowit River as both rivers were not
included in the 2014 surveys. Igan River recorded the highest increase in crocodile density
(149%) among the rivers in the study area, changing from 0.53 individuals/km in 2014 to
1.32 individuals/km in 2017. While, the lowest increase is in Ngemah River with 14%,
changing from 0.07 individuals/km in 2014 to 0.08 individuals/km in 2017 (Table 4.7). The
two rivers surveyed in Sarikei district, Sarikei and Nyelong River, recorded a decline in
crocodile densities with a reduction for about 25% in Sarikei River, from 1.26
individuals/km in 2014 to 0.94 individuals/km in 2017, and 38% in Nyelong River, from
1.19 individuals/km in 2014 to 0.74 individuals/km in 2017.
The survey in 2014 in Poi River covered up to 10.3 km in distance had recorded zero
crocodile in the river. However, the 12.8 km survey in 2017 spotted 2 crocodiles in the river
with the density of 0.16 individuals/km. Meanwhile, surveys in 2014 covered 14.6 km
distance of Ngemah River and 25 km distance of Katibas River had recorded one crocodile
was spotted in both rivers, respectively. Similarly, after three years, the same observation
was recorded, one crocodile was spotted in both of the rivers, respectively. The two rivers
that were not included in 2014 surveys recorded a density of 1.07 individuals/km in Belawai
River, while, in Kanowit River, recent survey showed negative result (no crocodile spotted).
Page 132
110
4.3.2 Distribution of crocodile in selected rivers of Rajang River Basin
The distribution of crocodiles spotted during the surveys in eight rivers within the Rajang
RB were shown in maps in Figure 4.2 until Figure 4.8.
Figure 4.2: Map showing the survey area in Igan River. Each circle indicates the location
of crocodile sighted during the survey and different colours in the circle represent different
size class.
Majority of the crocodiles in Igan River were spotted in areas near to the river mouth (Figure
4.2). Two of them were sighted in the area near to a sandy beach at the mouth of the river.
Three crocodiles including a sub-adult were also spotted in the muddy bank adjacent to Igan
village, which is also located at the river mouth. In addition, an adult with a size of
approximately 2-3 m, was sighted swimming in the middle of the river, about less than a
hundred meters from Igan village.
Igan
Igan River Location where the
gill net was
deployed
Page 133
111
Figure 4.3: Map showing the survey area in Belawai River. Each circle indicates the
location of crocodile sighted during the survey and different colours in the circle represent
different size class.
In Belawai, crocodiles were found concentrated in various spots, primarily at the area near
to the mouth of smaller tributaries or streams (Figure 4.3). All of the crocodiles were spotted
at the river bank or in shallow water at the river’s edge except for the two adult crocodiles
who were sighted in the middle of the river. Crocodiles were spotted in close proximity to
each other, comprising of at least one mature (sub-adult and adult) and several young
crocodiles (hatchlings and yearlings) or just all young crocodiles.
Belawai
Location where the
gill net was
deployed
Page 134
112
Figure 4.4: Map showing the survey area in Sarikei River and Nyelong River. Each circle
indicates the location of crocodile sighted during the survey and different colours in the
circle represent different size class.
In Sarikei River, a crocodile was first sighted approximately three to four kilometers from
the river mouth and no crocodiles were found in the areas near to Sarikei town (Figure 4.4).
More crocodiles were found in less human populated and development areas further
upstream. Several sightings of young crocodiles close to each other were also recorded in
one or two areas during the survey. Meanwhile in Nyelong River, at least three crocodiles
comprising of two sub-adult and a hatchling were spotted in the area near to Nyelong Bridge,
about two kilometers from the river mouth (Figure 4.4). The rest of the crocodiles were
found in further upstream. Four crocodiles were spotted in area near to oil palm plantations.
Sarikei
Nyelong River
Batang Rajang
Sarikei River Location where the
gill net was
deployed
Page 135
113
Figure 4.5: Map showing the survey area in Kanowit River. No crocodile sighting was
recorded during the survey.
There was no crocodile sighted in Kanowit River during the survey period (Figure 4.5).
However, this could not mean that the Kanowit River is crocodile-free. After the survey
period, a sub-adult crocodile, size about 1.5m to 2.0 m, were spotted in the Batang Rajang,
about less than one kilometer distance from mouth of Kanowit River (Figure 4.5). According
to local fishermen, they had seen crocodiles in Kanowit River, thus their claims could
provide clues about the presence of crocodiles in the river. Local fishermen use the river in
regular basis, thus they know the river very well and the possibility for them to encounter
with crocodile (if it presents in the river) is high.
Kanowit
Kanowit River Location where the
gill net was
deployed
Page 136
114
Figure 4.6: Map showing the survey area in Poi River. Each circle indicates the location of
crocodile sighted during the survey and different colours in the circle represent different
size class.
In contrast to the Kanowit River, two crocodiles were recorded during the surveys in Poi
River. The two crocodiles found were a hatchling and a sub-adult, spotted in less than 5 km
from the mouth of the tributary (Figure 4.6). The local fishermen also claimed that crocodiles
in Poi River are commonly found in the downstream area, not far from the mouth. It was
also noted that the hatchling spotted in the survey was in the area near to a school and a
longhouse in Poi River (Figure 4.6).
Batang Rajang
Poi River
Location where the gill
net was deployed
Page 137
115
Figure 4.7: Map showing the survey area in Ngemah River. Each circle indicates the
location of crocodile sighted during the survey and different colours in the circle represent
different size class.
One crocodile was recorded in Ngemah River, approximately one kilometer from its river
mouth (Figure 4.7). The surveyor was unable to estimate the size or cohort of the crocodile,
thus the crocodile falls into ‘eyes only’ category. No other crocodile was detected further
deep into the upper section of the river before reaching to the end point of the survey.
Batang Rajang
Ngemah River
Location where the gill
net was deployed
Page 138
116
Figure 4.8: Map showing the survey area in Katibas River. Each circle indicates the
location of crocodile sighted during the survey and different colours in the circle represent
different size class.
Similar to Ngemah River, survey in Katibas River also recorded only one sighting of
crocodile (Figure 4.8). The crocodile, which was categorized as ‘eyes only’ was spotted near
to Katibas Bridge, about two kilometers from the river mouth. There was no sign of a
crocodile in further upstream areas.
Song
Batang Rajang
Katibas River
Location where the gill
net was deployed
Page 139
117
4.3.3 River characteristics and landscapes
Based on the stream habitat assessment, five out of eight studied rivers were categorized as
“Fair” habitat conditions and another three rivers assessed as “Good” habitat condition
(Table 4.8). Details of river characteristics are as in Appendix A2 until A3 (see page 224 -
227).
Table 4.8: Stream habitat assessment and its score for each river in study area of Rajang
River Basin.
River River Habitat Assessment
A1 B1 C1 D1 E1 Total Score Category
Igan 6 5 3 4 3 21 Fair
Belawai 6 5 3 4 3 21 Fair
Sarikei 6 5 4 5 3 23 Fair
Nyelong 5 5 4 5 3 22 Fair
Kanowit 6 5 4 5 5 25 Fair
Poi 8 6 6 6 7 33 Good
Ngemah 7 6 6 5 6 30 Good
Katibas 7 6 5 5 6 29 Good
*(A1, Bank vegetation; B1, Verge vegetation; C1, In-stream cover, D1, Bank erosion and stability;
E1, Riffles, pools and bends)
The three rivers that were categorized as “Good” condition, Poi, Ngemah and Katibas River,
were located at the middle and upper regions of the Rajang RB. These rivers scored between
29 to 33 points which indicated that the rivers have less alteration from their natural states.
Out of 8 studied rivers, Poi, Ngemah and Katibas River are not influenced by tidal. The
rivers are dominated by a variety of habitats (riffle, pool and runs) with various depth and
width. The depths of the rivers are ranging from 5.1 m to 7.8 m (average = 6.14 ± 1.36 m)
in Poi River, 5.8 m to 7.6 m (average = 6.50 ± 0.69 m) in Ngemah River and 2.0 m to 10.8
Page 140
118
m (average = 5.98 ± 3.35 m) in Katibas River. Meanwhile, the widths of the rivers are
ranging from 55 m to 20 m (average = 40 ± 12.75 m) in Poi River, 170 m to 30 m (average
= 66 ± 59.10 m) in Ngemah River and 145 m to 90 m (average = 118 ± 20.80 m) in Katibas
River. The rivers have brackish type of water about several kilometers near the river mouth
before reaching the fresh water further upstream. The bottom and riverbank substrates in
these three rivers are sands, gravels and pebbles especially for the area located upstream.
While at the downstream, it was dominated by sandy and muddy type of riverbank. Riparian
vegetation along riverbanks are dominated by trees, grasses and shrubs with the presence of
overhanging vegetation in certain areas. The canopy covers for the Poi, Ngemah and Katibas
River are partly shaded especially in upstream area.
Almost all of the rivers that were categorized as “fair” habitat located in lower region of
Rajang RB (Igan, Belawai, Sarikei and Nyelong River) except for Kanowit River (middle
region). The scores for habitat condition for these rivers varied in between 20 to 25 points.
Rivers fall into this category show notable alterations from natural state but still offering
moderate and stable habitat for surrounding organisms. The highest score in this category
was Kanowit River with 25 points. Similar to its neighbouring tributary Poi River, brackish
water can be found up to several kilometers from the mouth of Kanowit River before
reaching the fresh water further upstream. The river also has diverse habitats including riffle,
pools and runs with variation in depths, ranging from 8.1 m to 12.7 m (average = 10.86 ±
2.15 m) and widths, ranging from 265 m to 60 m (average = 118 ± 83.41 m). Riverbank
characteristics and riparian vegetation in the Kanowit River are almost similar with Poi
River, except more areas at the riverbank were cleared for residential and industrial purposes
as well as for agriculture. The Kanowit River is largely cleared with only certain areas were
Page 141
119
covered with canopy. There are also very little in-stream vegetation can be found along the
river.
Sarikei and Nyelong River scored 23 and 22 points in stream habitat assessment,
respectively. Located at the lower region of Rajang River, the water in the rivers is brackish
with slight variety of habitats like pools and runs. The depths of the rivers are ranging from
6.7 m to 12.5 m (average = 8.32 ± 2.38 m) in Sarikei River, while the depths of Nyelong
River are ranging from 5.6 m to 10.7 m (average = 8.36 ± 1.82 m). The widths of Sarikei
River are ranging from 210 m to 40 m (average = 94 ± 68.04 m) and in Nyelong River, the
widths are ranging from 240 m to 60 m (average = 122 ± 70.59 m). Large areas at the muddy
riverbank of Sarikei and Nyelong River are covered by Nypa trees. The rivers are largely
cleared, with occasional snags and very little in-stream vegetation. Generally, both rivers
have open type of canopy and no overhanging vegetation.
The rivers that have the lowest score in stream habitat assessment are Igan and Belawai
Rivers with 21 points. Both of the rivers are located at the estuary of Rajang RB, hence
saltwater and brackish water are abundant in the rivers. Igan and Belawai Rivers have
relatively large waterway and offer relatively low number of habitats includes riffles, runs
or pools with limited variations in depths and width of the rivers. The depths of the rivers
ranging from 13.3 m to 15.8 m (average = 14.28 ± 0.96 m) and 14.3 m to 16.2 m (average =
15.20 ± 0.71 m) for Igan and Belawai River, respectively. The widths of the rivers are
ranging from 1,670 m to 915 m (average = 1238 ± 335.20 m) in Igan River, while the depths
of Belawai River are ranging from 1,400 m to 560 m (average = 862 ± 356.82 m). Pine trees,
Casuarina equisetifolia, dominated the sandy beach areas at the mouth of both rivers, while
Page 142
120
further upstream the riverbank was covered by mangroves vegetation and Nypa trees. Both
of the rivers also have open type of canopy, low or absent of in-stream vegetation and no
overhanging vegetation.
Human activities such as human settlement, riverbank clearance and developments can cause
directly and indirectly impact on river habitats as well as the crocodile populations. Details
of riverbank development and land use recorded during field sampling in eight studied rivers
in Rajang RB as in Appendix A3 (See page 226 - 227). Based on observations, these human
activities vary among the rivers in the study area. Several towns can be found at the river
mouth of the studied rivers such as Sarikei in Nyelong and Sarikei River, Kanowit in
Kanowit River and Song in Katibas River (Figure 4.4, Figure 4.5 and Figure 4.8). Man-made
buildings such as waterfronts, jetties, houses, shops and factories in this area are typically
built near to the river. River traffics in this area are constantly high especially during the
daylight because people prefer to use water transportation to travel to and from the town.
Remote areas especially in Kanowit (e.g., in Ulu Ngemah, Ulu Poi) and Song (e.g., in Ulu
Katibas) districts are not yet connected by roads, thus for these people boats are the only
mean of transportation to travel to another place or town. While in Sarikei, although most of
areas were connected by roads, some of the locals prefer to use boat as it is the quickest and
cheapest way to travel to the town. Boats can be seen moving in and out from jetty or boat
terminal in Kanowit, Song and Sarikei Town. In Igan River, ferries operate from early
morning until night, transporting people and vehicles crossing both sides the river.
In Igan and Belawai Rivers, several villages can be found along the rivers and fishing is
among the main activities in these villages (Figure 4.2 and Figure 4.3). Fishing activities in
Page 143
121
these rivers are relatively high and the fishermen typically used various types of fishing
vessels, from small single engine boats to big fishing vessels, to catch fish in the river and
coastal area. The fishermen use several methods of fishing including cast nets and gill nets,
which could be seen set up by the fishermen along the river.
Riverbank clearance for developments or agriculture activities were observed in several
rivers in the study area during the surveys. At least one concrete bridge was built across the
rivers in the study areas except for Igan and Belawai. In Kanowit, constructions of concrete
bridges occurred not far from the towns and at the time of the survey, the works had been
on-going for more than two years. The constructions of the bridges were completed at end
of 2017. There was also a logging camp sighted in Kanowit River during the survey and it
is believed that several more camps can be found further upstream. Logs from these camps
are usually transported to factories by towing boats using the river. A large-scale palm oil
plantations estate own by a private company were found in Nyelong. Several small-scale
agriculture plots planted with paddy, pepper, fruits, vegetables and other cash crops plants
could be seen near to residential areas at the bank of Sarikei, Kanowit, Poi, Ngemah and
Katibas Rivers.
Poi and Ngemah River is relatively quieter and less busy compared to other rivers in the
study area. There are less developments at the riverbanks and not many villages/longhouses
can be found along the rivers (Table Appendix A3, see page 227). In Poi River, two houses
were found about less than 5 km from river mouth, while in further upstream, not more than
6 villages/longhouses were found within the survey distance (Figure 4.6). Meanwhile in
Ngemah River, Ngemah village was located near to river mouth and not less than 5
Page 144
122
villages/longhouses can be found throughout the survey distance in the river (Figure 4.7).
There also one primary school located near to river in Poi and Ngemah River. The local
communities in Poi and Ngemah River are less dependent on the river for water sources and
transportation as they already have access to clean tap water and electricity and their houses
were connected to Kanowit Town and other areas via roads. Fishing activities in Kanowit,
Poi, Ngemah and Katibas Rivers are considered medium to low as the people who live near
these rivers are still depending on the river for food resources and incomes.
4.3.4 Selected water quality parameters
The detail measurements for water quality parameters and statistical analysis result are as in
Appendix A4 (see page 228 - 229). The mean values of salinity recorded for selected rivers
and tributaries of Rajang RB ranged from 19.80 ± 1.94 ppt to freshwater (no salinity reading
detected) (Table 4.9). The water in the two rivers, Ngemah and Katibas is freshwaters, which
indicated by the absence of saline water flow through the rivers. Both rivers are located at
the upper region of Rajang RB. Igan River recorded the highest salinity with mean reading
of 19.17 ppt and shows significant different (p < 0.05) with other rivers except for Belawai
River (p = 0.842).
Page 145
123
Table 4.9: Selected water quality parameters measured in-situ for rivers and tributaries of
Rajang River Basin.
River Salinity, ppt pH Temperature, ºC
Igan L 19.00 ± 2.54 6.42 ± 0.43 26.82 ± 0.34
Belawai L 16.26 ± 5.55 7.53 ± 0.11 29.70 ± 0.12
Sarikei L 6.06 ± 5.67 5.63 ± 0.22 29.72 ± 0.35
Nyelong L 1.99 ± 1.87 5.25 ± 0.16 29.26 ± 0.32
Kanowit M 0.88 ± 0.68 6.81 ± 0.21 27.36 ± 0.11
Poi M 0.47 ± 0.87 7.22 ± 0.15 27.24 ± 0.09
Ngemah U 0.00 ± 0.00 6.98 ± 0.07 25.44 ± 0.09
Katibas U 0.00 ± 0.00 7.02 ± 0.07 25.38 ± 0.11
*L=Lower region; M=Middle region; U=Upper region of Rajang River Basin
Five out of eight rivers showed slightly acidic condition (pH < 7) except for Belawai, Poi
and Katibas (Table 4.9). The mean value of pH for all the rivers ranged from 5.25 ± 0.16 to
7.53 ± 0.11, with the highest pH recorded at Belawai River with mean value of 7.53 and
significantly higher than pH value of other rivers (p < 0.05) except for Poi River (p = 0.300).
Meanwhile, Nyelong River is significantly more acidic than the other rivers with a mean pH
of 5.23 (p < 0.05) except for Sarikei River (p = 0.111).
The mean values of water temperature for selected rivers and tributaries of Rajang RB were
ranged from 25.38 ± 0.11 ºC to 29.72 ± 0.35 ºC (Table 4.9). Sarikei River recorded the
Page 146
124
highest mean of water temperature with 29.72 ºC, significantly higher compared to other
rivers (p < 0.05) except for Belawai River (p = 1.000). The mean value of water temperature
recorded at Katibas River (25.38 ºC) was significantly lower compared to other rivers (p <
0.05) except for Ngemah River (p = 1.000).
4.3.5 Aquatic food resources for crocodile
Based on Figure 4.9, the highest CPUE was recorded in Belawai River, with mean catch
0.97 ± 0.28 kg/hour and significantly higher (p < 0.05) compared to other rivers except for
Igan River (p = 0.919). In contrast, Sarikei River recorded the lowest mean catch with 0.12
± 0.07 kg/hour, but shows no significantly different (p > 0.05) with other rivers except for
Igan (p = 0.001) and Belawai (p = 0.000). The statistical analysis results as in Appendix A6
(see page 237 - 238).
Page 147
125
Belawai Igan Poi katibas Nyelong Ngemah Kanowit Sarikei
0.0
0.2
0.4
0.6
0.8
1.0
CP
UE
(k
g/h
ou
r)
River
Figure 4.9: Catch per unit effort (CPUE) at eight rivers in Rajang River Basin.
Table 4.9 summarizes the species list of fish and invertebrates caught during the surveys,
which were potential food sources of C. porosus in the study areas.
Page 148
126
Table 4.10: List of fish and invertebrates caught in Rajang River Basin that may be the potential food source of the C. porosus. (symbol +,
represent the species was caught in the river).
Family Species Local name River
Iga Bel Sar Nye Kan Poi Nge Kat
Ariidae Arius microcephalus Ikan belukang + Nemapteryx caelata Ikan duri + +
Bagridae Bagroides melapterus Ikan baung pisang + Carcharhinidae Carcharhinus borneensis Ikan yu + Chandidae Ambassis kopsii Ikan tibak belai + + + + + Cyprinidae Puntioplites bulu Ikan mengalan/ kepait + + +
Luciosoma setigerum Ikan nyua + + Engraulidae Setipinna breviceps Ikan empirang + +
Setipinna melanochir Ikan empirang sirip gelap + Setipinna taty Ikan empirang janggut + Coilia macrognathos Ikan gonjeng + +
Mugilidae Chelon subviridis Ikan belanak/kembura + Pangasiidae Pangasius micronemus Ikan buris + + + + + + Plotosidae Plotosus canius Ikan semilang + Polynemidae Eleutheronema tridactylum Ikan senangin + Pristigasteridae Ilisha elongata Ikan popot + + +
Ilisha megaloptera Ikan beliak mata + Sciaenidae Johnius spp. Ikan gelama + + + + Scatophagidae Scatophagus argus Ikan ketang + Siluridae Kryptopterus lais Ikan lais/ layah bongkok + Soleidae Archiroides melanorhynchus Ikan daun/ lidah/ sebelah + Stromateidae Pampus argenteus Ikan kilat + Trichiuridae Trichiurus lepturus Ikan timah selayur/layur + Penaeidae Penaeus spp. Udang + + + +
*Iga = kuala Igan, Bel = Belawai, Sar = Sarikei, Nye = Nyelong, Kan = Kanowit, Poi = Poi, Nge = Ngemah, Kat = Katibas River
Page 149
127
A total of 23 species of fishes and one type of invertebrate representing 18 different families
were caught from all the rivers in the study area in Rajang RB (Table 4.10). The highest
variety of fish species caught in a river was in Belawai River (13 species), followed by Igan
and Nyelong River where both of the rivers recorded six species of fish respectively.
Pangasius micronemus from Family Pangasiidae or locally known as “Ikan buris” have been
caught in six rivers (Sarikei, Nyelong, Kanowit, Poi, Ngemah and Katibas River) out of eight
rivers in the study area. Commercial fish species had also been caught in the surveys,
including from species Setipinna (“Ikan empirang”), Coilia macrognathos (“Ikan gonjeng”),
Ilisha elongata (“Ikan popot”) and Pampus argenteus (“Ikan kilat”). The only invertebrate
caught in the survey was from Family Penaeidae or locally known as “udang” and the prawn
was caught in Igan, Belawai, Kanowit and Poi River.
4.3.6 Relationship between crocodile density, habitat, water quality parameter and
the abundance of food resources for crocodiles
Pearson’s correlation analysis between crocodile density, water quality parameters and the
abundance of food resources for crocodile (CPUE) is shown in Table 4.11. The correlation
analysis shows that the crocodile density was significantly and positively correlated with
salinity of the river (p < 0.05). The analysis also shows positive correlation between
crocodile density with temperature and the abundant of food sources (CPUE) but not
significant. Meanwhile, habitat scoring shows significant negative correlations with the
crocodile density, while for pH the analysis was insignificantly and negatively correlated
with the crocodile density.
Page 150
128
Table 4.11: Pearson’s correlation between crocodile density, water quality parameters,
habitat and the abundance of food resources for crocodile (CPUE).
Salinity pH Temperature CPUE Habitat
Crocodile
Density
0.884*
(P = 0.003)
-0.350
(P = 0.395)
0.609
(P = 0.109)
0.613
(P = 0.106)
-0.816*
(P = 0.013)
*Correlation is significant at the 0.05 level (2-tailed test of significant)
The PCA analysis result of the crocodile density, water quality parameters and CPUE at all
river in the study area is best explained by principal component 1 and 2 with 59.22% and
28.71% of the variance respectively, totalling 87.95% (Table 4.12).
Table 4.12: Summary for PCA analysis for the crocodile density, water quality
parameters, habitat and CPUE.
Principal
component
Eigenvalue Percentage of
Variance
Cumulative Percentage
of Variance
1 3.553 59.22% 59.22%
2 1.722 28.71% 87.93%
Based on the PCA ordination bi-plot (Figure 4.10), salinity and CPUE have large positive
loading on principal component 1 alongside with the crocodile density, represented on the
right of the diagram. This could suggest that the salinity of the water and the abundance of
the food sources are among the main factors that influenced the density of crocodile in the
rivers. Rivers located at the mouth of Rajang RB, Belawai and Igan River, were mainly
loading close on salinity, CPUE and crocodile density (red circle).
Page 151
129
Figure 4.10: PCA ordination bi-plot of eight rivers of Rajang River Basin with crocodile
density, habitat, water quality parameters (Salinity, pH and Temperature) and food
resources for crocodile (CPUE).
-2 0 2
-2
0
2-0.5 0.0 0.5
-0.5
0.0
0.5
Kuala Igan
Belawai
Sarikei
Nyelong
Kanowit
Poi
Ngemah
Katibas
Crocodile Density
Salinity
pH
Temperature
CPUE
Habitat
Prin
cip
al C
om
po
ne
nt
2
Principal Component 1
Page 152
130
General Linear Model (GLM) analysis showed similar finding with the results in PCA
analysis. Two variables, salinity (F = 21.35, df = 1, P = 0.004) and habitat (F = 11.97, df =
1, P = 0.013) had significant influence on density of crocodile (Table 4.13). However, there
is no combination of variables that had significant influence on the density of crocodile. The
highest F-value was the combination between temperature and the abundant of food sources
(CPUE) but the value is statistically not significant (F = 7.42, df = 1, P = 0.053).
Table 4.13: Summary for GLM analysis for the water quality parameters, habitat and
CPUE in response with crocodile density.
Variables
(or combine)
F-value df P-value
Salinity 21.35 1 0.004*
Temperature 3.53 1 0.109
pH 0.84 1 0.395
CPUE 3.61 1 0.106
Habitat 11.97 1 0.013*
Salinity * Temperature 1.83 1 0.248
Salinity * pH 1.03 1 0.368
Salinity * CPUE 2.32 1 0.202
Salinity * Habitat 1.62 1 0.272
Temperature * pH 4.68 1 0.096
Temperature * CPUE 7.42 1 0.053
Temperature * Habitat 0.09 1 0.777
pH * CPUE 1.12 1 0.350
pH * Habitat 1.62 1 0.272
CPUE * Habitat 0.25 1 0.646
* Significant at P < 0.05.
Page 153
131
4.4 Discussion
The crocodile densities in the study areas recorded an increase between 14% to 149%
compared to Robi (2014), except for two rivers Sarikei and Nyelong. Sarikei and Nyelong
River recorded a decline in densities with a reduction between 25% to 38%. Meanwhile,
with no previous crocodile survey in Belawai and Kanowit River, density comparison could
not be done for both rivers. Therefore, the survey result for both rivers can be use as baseline
data for future survey. This study did not apply correction for visibility bias (correction
factor), therefore the results were only expressed as relative density rather than absolute
density which means that the figures only represent the number of crocodiles sighted within
the length of river surveyed, rather than the total number of crocodiles in the entire river
(Bayliss, 1987). However, relative density could help in assessing trend in crocodile
populations as the data can be compared with previous data in the same stretch of river. The
results in this study are coherent with the increasing densities recorded by SFC and FDS in
several others rivers in Sarawak such as Samunsam River, Samarahan River, Suai River,
Baram River and Limbang River (Sarawak Forestry Corporation, 2018). The rising densities
of crocodile in rivers in Sarawak are an indication of the recovery of the crocodile
populations (Fukuda et al., 2011).
The presence of crocodiles in almost all of surveyed rivers in the present study suggests that
crocodiles are well distributed throughout the Rajang RB including in the lower, middle and
upper region of the river basin. However, the density of crocodile differs according to the
regions; densities in rivers in the lower Rajang RB were ranging from 0.74 to 1.32
individuals/km, relatively higher compared to the densities of crocodile in rivers in the
Page 154
132
middle and upper regions (0.06 to 0.16 individuals/km). Similar results were recorded by
Robi (2014) in his survey in Rajang where density of crocodile in rivers in lower Rajang
were around 0.22 to 1.26 individuals/km, while in upper region, the densities were ranging
from 0.04 to 0.07 individuals/km. Saltwater crocodiles are typically live in saline waterways
near to the coastal areas (Webb et al., 2010), however the sighting of a crocodile in Katibas
River in Song districts, about 180 km away from the estuary of Rajang River in the present
survey, confirmed the presence of crocodiles in the tributaries of upper regions of Batang
Rajang. This scientific document confirms the local people’s claims about the presence of
crocodiles, therefore the relevant agencies should be cautious and be ready with the possible
HCC in the areas.
Recent survey in Kanowit River showed zero relative density (no crocodile spotted) and with
no survey was conducted in the river in 2014, it seems that the crocodile is probably either
absent or if present, the numbers are very low. However, this is not necessarily mean that
there are no crocodile population in Kanowit river. The result only represents the number of
crocodiles sighted within the length of river surveyed in that particular time, not the absolute
density or total population in the river. Several factors might influence the result. In addition,
based on the interviews with local fishermen, they insisted that although the crocodile is
rarely to be seen in Kanowit River lately, they believed that the crocodile is present in the
river. There is a possibility that the spotter missed out crocodiles during the survey or the
crocodiles regularly move in and out of the Kanowit River to the main river of Batang
Rajang. The crocodiles in the Kanowit River might have developed a high level or wariness,
thus they can avoid to be detected by the surveyor (Webb & Messel, 1979). The presence of
a sub-adult spotted in the main river of Batang Rajang, about one kilometer distance from
Page 155
133
the mouth of Kanowit River, further supported the possibility of crocodile movement in and
out of Kanowit River.
The distribution of crocodiles varies in each river. In Igan River, majority of the crocodiles
were spotted in areas near to the river mouth. According to local community in Igan village,
crocodiles were commonly found in Nypa palms areas just next to their village and they
believed that crocodiles were using that area as the resting place. The locals also claimed
that the crocodiles especially the larger ones are more likely to roam around the river near
to the village, sometimes scavenging foods leftover, animal carcasess or rubbish under
people’s houses and jetty. During the survey, a large adult was sighted in the middle of the
river approximately 50 meters from the village probably waiting for rubbish thrown by the
people (Figure 4.2). Similar situation where large adults living near human settlements were
also recorded in Bako River, western Sarawak (Hassan et al., 2018). A satellite tracking
study by Campbell et al. (2015) reveal that crocodile greater than 2.5 m in length are likely
to wander in area near to human settlement due to the curiosity or attracted to something,
possibly the smell of food leftovers or animal carcasses.
Several sightings of young crocodiles (yearlings and hatchlings) in close proximity to each
other or in clusters were recorded in Igan, Belawai, Sarikei and Nyelong River during the
surveys (Figure 4.2, Figure 4.3 and Figure 4.4). When a group of young crocodiles found in
one place, it could be a sign that nesting occurs in these particular areas and the cluster of
young crocodiles were probably from the same nest (Webb et al., 1977; Fukuda & Saalfeld,
2014). In addition, the presence of at least one adult crocodile in close proximity with the
Page 156
134
young crocodiles also supports the possibility that there could be a nesting area for crocodiles
in that particular area (Webb et al., 1983).
For a large rivers like Igan and Belawai, crocodiles prefer to build their nest at the riverbank
of a small tributary or stream compared to the main river to avoid their nest affected by
flooded water from the main river and also access to freshwater (Fukuda & Cuff, 2013;
Evans et al., 2016). After hatching, the hatchlings will live in the smaller tributary for few
months and when they grow bigger in size they will venture out to the main river. Along the
process, the mother stays close to guard the nest, besides assisting in excavating the nest
during hatching (Webb et al., 1983; Grigg & Gans, 1993; Evans et al., 2016). Thus, the adult
who was spotted near to the hatchlings is most likely to be a female crocodile.
In Sarikei River and Nyelong River, no crocodile was spotted in the proximity of Sarikei
town except for a group of sub-adults and hatchling roaming in the area near to a bridge in
Nyelong River. Instead, more crocodiles were found in less human populated and
development areas further upstream (Figure 4.4). The town of Sarikei, located at the mouths
of Sarikei and Nyelong River, is a high human populated area and the town is the center for
economic activities and transportation hub for the surrounding region. In this case,
disturbances from human activities along with the changes in riverbank habitat as the result
of development could hinder crocodiles from living in the waterway proximity of the town
(Fukuda et al., 2008; Shaney et al., 2017). In Nyelong River, a hatchling and yearling were
among the crocodiles spotted close to the oil palm plantations, suggesting that the crocodiles
are building nests near or inside the plantations area. This does suggest that riverbank land
Page 157
135
conversion into oil palm plantations is not necessarily a barrier for crocodile to nesting
(Evans et al., 2016).
It is also noted that the hatchlings spotted in the surveys were present in the area near to a
school and a longhouse in Poi River (Figure 4.6). The situation where the crocodiles are
present in areas near to schools or residential areas is common in Sarawak because the local
people and crocodiles had been sharing the rivers for centuries (Hassan & Abdul-Gani,
2013). Conflicts between human and crocodiles are rarely reported in this area, however
local communities in the area especially children need to be reminded about the danger of
crocodiles. This can be done through several initiatives by local authorities including putting
warning signboards in school and residential areas, conducting public awareness
programmes and also frequent sharing sessions between community leaders and local
authority so that any information about crocodile can be delivered in a more effective
manner.
During the surveys, there were crocodiles that have been detected through eye shine but their
body size were unable to be estimated as the crocodiles submerged quickly into the water
when the surveyors tried to approach them. The crocodiles might be alerted by the waves or
sound created by boat engine or noise from the people on the boat. The sightings were then
recorded as “Eyes only” (EO) (Bayliss, 1987). This behaviour is a sign of high wariness and
this level of wariness typically associates with larger crocodiles, mainly sub-adult and adult.
A mature crocodile develop the wariness through life experience, as an example learning
through frequent encounter with boat, escape from human harassment or hunting (Webb &
Page 158
136
Messel, 1979). Accordingly, the EO crocodiles seen in the Ngemah and Katibas River were
most likely mature crocodiles (sub-adult or adult).
The crocodiles found in Poi, Ngemah and Katibas Rivers shared a common pattern, all of
them were spotted in an area less than 5 km from the tributary mouth (Figure 4.6, Figure 4.7
and Figure 4.8). A sub-adult sighted in Poi River along with a small hatchling could suggest
that crocodiles in the middle and upper region of Rajang RB used tributaries along the main
river as the nesting ground. Similarly, a “eyes only” (assuming it as an adult or subadult
crocodile) found in Ngemah and Katibas River, respectively; are probably female crocodiles
and they are travelling into these tributaries for nesting. A typical mature crocodile would
prefer to live in a large river like Batang Rajang due to a large space area for living and more
foods available, but when nesting, a female crocodile prefers to choose an area with less
disturbance like in a smaller tributary or stream that have access to freshwater (Fukuda &
Cuff, 2013).
Saline characteristic of the waterway and the access to plentiful of foods area are among the
strong factors that influence the abundance of crocodiles. In Sarawak, saline mangroves
floodplains and large river systems around estuaries like Belawai and Igan Rivers in this
study are the most common habitat for C. porosus where the highest crocodile densities are
usually found in these areas (Stuebing et al., 1985; Hassan & Abdul-Gani, 2013; Abdul-
Gani, 2014; Zaini et al., 2014). Rivers in the middle and upper parts of Rajang RB (Kanowit,
Poi, Ngemah and Katibas River) show low value in salinity (Table 4.9). The hypo-saline
characteristic in these rivers is expected as they are located more than 100 km from the
mouth of Batang Rajang where there are less influence of sea water in the rivers.
Page 159
137
The low salinity and the absence of tidal influence could be the reason why there are less
number of crocodile found in the upper part of Batang Rajang compared to rivers in the
lower part of Rajang RB. According to Cramp et al. (2008), the estuarine crocodile, C.
porosus, displays broad euryhaline capabilities, where they could be found in waters ranging
in salinity from 0 to over 35 ‰. The presence of both freshwater and saltwater are important
to crocodiles as it influence their diet, nesting ground and behaviour, hence they regularly
move between different habitats, according to the wet and dry seasons changes (Grigg &
Gans, 1993; Fukuda & Cuff, 2013; Hanson et al., 2015; Evans et al., 2017). Tidal currents
are important to crocodiles especially for their movement in water as well as giving them
advantage when hunting for food (Grigg & Gans, 1993; Campbell et al., 2010).
The pH and water temperature readings for the Ngemah and Katibas Rivers in the present
study are similar with what have been recorded in Pelagus River (Ling et al., 2017) and
Balleh Rivers (Ling et al., 2016) in further upstream of Rajang RB. In Pelagus River, the pH
value of the streams ranged from 6.1 to 7.1, while in Balleh River the pH value was in
between 7.0 to 7.7. The temperature of water in Pelagus River and Balleh River ranged from
25.0 0C to 30.6 0C and 24.7 0C to 28.8 0C, respectively.
The river temperature could be influence by several factors including elevation, rainfalls and
seasons (Ling et al., 2016). The water temperature in rivers in the upper part of Rajang RB
(~25 0C) recorded lower reading compared to the rivers in middle (~27 0C) and lower (26 -
29 0C) part of Rajang RB (Table 4.9). During the sampling process, there was no rain were
recorded from an hour to a day prior to the sampling period except for samplings in Igan and
Katibas River. River temperature in Igan (26 0C) was recorded lower compare to the rest of
Page 160
138
rivers in lower region (29 0C) and the result could indicate that the rainfall event occurred a
day before sampling period had influence on the river temperature.
An estuarine crocodile can live in a wide range of water temperature, but the optimal
temperature for crocodile is ranging from 28 0C to 30 0C (Stuebing et al., 1985; Rodgers et
al., 2015). A crocodile is an ectothermic animal, thus the reptile depend on surrounding
temperature to regulate its body temperature (Grigg & Gans, 1993). Hence, the capacity of
a crocodile to dive and stay longer underwater is depending on the water temperature. The
body temperature also restricted mobility, therefore the reptile commonly seek to maintain
optimal body temperature through behaviour such as basking, moving in and out from water
or finding shade inland (Grigg & Gans, 1993).
The water temperature readings for five out of eight rivers in the study are below the optimal
temperature window for crocodile, but whether or not this condition could affect the sighting
of crocodile in those rivers is relatively unknown. Four of the rivers (Kanowit, Poi, Ngemah
and katibas) that have temperature below the optimal temperature for crocodile are in the
middle and upper region of Rajang RB and these rivers also recorded lower density of
crocodile compare to those in lower region. It seems to indicate that temperature had
influence on the distribution of crocodile in Sarawak, but yet, other factors including salinity,
habitat and the availability of food could also influence the crocodile distribution. Although
the river temperatures are below optimal, the readings are within the range that can be
tolerated by crocodile. According to Rodgers et al. (2015), estuarine crocodiles can tolerate
better to a lower temperature compared to a warmer temperature as they have the unique
capability of its organs in response to such environment.
Page 161
139
Out of 23 species of fishes caught in this study, 10 species were similar with what have been
recorded by Parenti and Lim (2005) and Bolhen (2017) in the Rajang RB. However, both
studies recorded fish species mainly from the upper Rajang area; Parenti and Lim (2005)
recoded fish species from Belaga, Baleh, Balui, Kapit and area around Sibu, while Bolhen
(2017) documented fish fauna from Pelagus area. Hence, this could explain why certain
species of fish caught in the present study especially the coastal water fish like Setipinna
breviceps, Coilia macrognathos, Pampus argenteus and few others, were not in the Parenti
and Lim (2005) and Bolhen (2017) fish species checklist. The species of fish caught in the
present study varies in each studied river, majorly influence by the river habitat and the type
of water in the rivers.
With the presence of crocodile in different habitats in Rajang RB, it could suggest that
crocodiles eat various species of fish or invertebrates that are available in the habitat area.
According to Hanson et al. (2015), range of prey (including fish species) for crocodiles could
vary among different habitats (e.g., coastal mangroves, freshwaters tributaries or swamps),
depends on the diversity of potential prey available in the area. A stomach contents study
by Sah and Stuebing (1996) found that C. porosus in Klias River, a river in coastal area of
Sabah, consume majorly on small fish from the Family Hemiramphidae and Engraulidae.
Both of the fish family group are common in estuarine and mangrove habitats, thus explained
why the fish species were taken frequently especially by the juvenile crocodiles. The fish
checklist data in the present study does not necessarily indicated the diet of crocodile, but it
could provide clues on potential food resources for crocodile in the various habitats. Further
studies are needed to understand the diet of crocodile in different river habitats including
study of fish and invertebrate composition as well as study of crocodile stomach contents.
Page 162
140
Mangroves waterways in lower Rajang (Belawai and Igan) offer more food sources for
crocodiles as compares to rivers in the other part of Rajang RB based on the CPUE results.
Although the CPUE data were collected as one-off survey and the data do not necessarily
represent the abundance of food sources for crocodile in the rivers throughout the year, the
data could show variation in the level (abundance) of food sources between rivers. The
coastal mangroves floodplains are rich in fauna including fish, insects, crustaceans,
mammals and reptiles, thus providing a variety of foods for both matured and juveniles
crocodiles (Fukuda et al., 2008; Nagelkerken et al., 2008). Crocodiles eat various type of
food, ranging from the small aquatic animals including fish, crustaceans and insects to the
large terrestrial mammal, primates and reptiles such as pigs, dogs, chickens, goats, monkeys,
snake or any animals that come near to the water (Stuebing et al., 1985). The food preference
for crocodile usually differ depending on the developmental stage, where young crocodiles
prey on smaller animals while the adults hunts for larger animals, sometimes travel further
on land to fulfill its appetite (Hanson et al., 2015). However, despite the fact that they prey
on large animals, crocodiles are rarely been seen hunting for animals that have size much
bigger than their own.
Basically, crocodiles spend most of their time in water and they also move easily in water,
thus their main diet are aquatic animals. In addition, crocodiles have limited opportunity to
prey upon the terrestrial animals (Hanson et al., 2015). The opportunity only comes when
the animals approaching the river for a drink or try to cross the water body or at any chance
the primates and any other animals slip into the water. A study by Hanson et al. (2015)
suggested that small and young crocodiles feed mainly on herbivorous aquatic animals like
small fishes, invertebrates including insects while medium to large adult crocodile eats
Page 163
141
similarly, but supplement their diets with slightly higher trophic level of preys in riverine
habitats such as larger predatory fishes and marine vertebrates. This supports what have been
suggested by Stuebing et al. (1985) where hatchling crocodiles particularly in Lupar River,
Sarawak, feed mostly on Paneus prawns and small crabs captured near to the water edge
while larger crocodiles prey upon larger fish and vertebrates such as tortoise, monkey and
others inland animals.
Pearson’s correlation analysis and general linear model (GLM) analysis shows significant
negative correlations between the habitat scoring data and the crocodile density (Table 4.11
and Table 4.13), however, this is not necessarily depicting that crocodiles are more abundant
in low habitat condition. The habitat assessment scoring is based on five parameters which
are bank vegetation, verge vegetation, in-stream cover, bank erosion and stability and riffles,
pools and bends. Hence, for the rivers in lower part of Rajang RB where crocodile densities
are higher, the habitat assessment scores were a bit lower compared to other rivers in the
middle and upper part of the river basin. Human disturbance and habitat degradation seem
to have a weak influence on the abundance of crocodiles among the studied rivers. In several
studies (Fukuda et al., 2008; Evans et al., 2016), the variation in land use intensity and the
human presence show only a minimum influence in the abundance of crocodiles. However,
the pattern of crocodile distribution within the studied rivers showed that crocodiles are
avoiding high riverbank development and human populated areas, for example, none or a
small number of the crocodile sighting were recorded in town proximity (Sarikei and Song)
in Sarikei, Nyelong and Katibas River. Meanwhile in Kanowit, development and industrial
activities took place not just in town area only but also further upstream, such as the
construction of a concrete bridge and the logging activity. These anthropogenic disturbances
Page 164
142
could affect the population of crocodile in the river resulting in no crocodile was sighted in
18 km distance of survey. Constant encroachment into crocodile habitat and high impact
land use, typically occur in developing area like in Sarikei, Kanowit and Song towns, could
affected the crocodile population, as all the activities indirectly contributes to the potential
loss of quality habitat including their feeding and nesting area and it also could change the
nature of the waterways (Fukuda et al., 2008).
4.5 Conclusion
The present study showed that the estuarine crocodiles are distributed along the lower,
middle and upper region of Rajang River Basin and the animals were sighted as far as
Katibas River, approximately 180 km from mouth of the river basin. However, the density
and distribution of crocodile differ according to the regions where the crocodile density in
lower region was higher compare to the middle and upper regions. Four out of eight studied
rivers in Rajang RB namely Igan, Poi, Ngemah and Katibas recorded increase in crocodile
density compare to the previous survey suggesting that crocodile population are
experiencing recovery. The distribution of crocodiles in the upper region was restricted to
the area of several kilometers distance from the mouth of the tributaries, suggesting that the
crocodiles might frequently move in and out from the tributaries to the main river. The water
quality, river habitats and the abundance of food for crocodiles varied between the eight
studied rivers, yet the rivers support crocodile populations. This finding suggests that
crocodiles in Sarawak can live in a wide range of habitat, from the large tidal rivers in coastal
area to the small non-tidal freshwater tributary in the upper side. Saline characteristic and
the abundance of food sources for crocodile are the strong factors that influence the density
Page 165
143
and distribution of crocodile in Sarawak. The presence of crocodiles in rivers near to the
residential, development and agriculture areas indicated that moderate to high human
disturbances and riverbank land-use conversion are not a barrier for crocodiles to continue
to live in the area.
Page 166
144
CHAPTER 5
GENETIC RELATIONSHIP AMONG Crocodylus porosus FROM DIFFERENT
RIVER BASINS IN SARAWAK, MALAYSIAN BORNEO
5.1 Introduction
Human–wildlife conflict has become a huge problem in many parts of the world and
crocodilians are among the major groups involved in such situation. In Sarawak, conflict
between human and crocodile (HCC) as discussed in Chapter 3, showed a mark increased
especially in the past 20 years and this had concerned many people. Several actions have
been made by relevant agencies to tackle the problem, including culling and translocation of
problematic crocodiles from human populated areas to sanctuaries and inhabitant mangrove
areas (Tisen & Ahmad, 2010).
In the recent development, wild crocodile harvesting activities in Sarawak has been
permitted for those who have the licence, after the status of the animal, particularly the C.
porosus species, was transferred from Appendix I to Appendix II in CITES (Sarawak
Forestry Corporation, 2018). Local authority in Sarawak hopes that regulated harvest of C.
porosus could control the wild population as their numbers in rivers are on the rise (Abdul-
Gani, 2014). However, hasty actions without proper planning and supported by research data
could risk the population of the crocodiles and this could lead to the history of
overexploitation to be repeated.
Page 167
145
Understanding of genetic structure of wild crocodile populations could contribute to better
conservation management of the species especially when designing population
translocations or introducing sustainable harvest programs (Russello et al., 2007; Maltagliati
et al., 2010; Lapbenjakul et al., 2017). Any programmes involving the removal of individuals
from a population like translocations and harvesting could bring a risk of disrupting breeding
and social systems which may lead to negative impact to the population (Lewis et al., 2013).
Thus, genetic relationship information could help in understating the systems. In addition,
study on population genetics could also help in identifying key point to solve the conflicts
between human and crocodile in Sarawak by identifying potential demography expansion
and migrations of the animals.
Microsatellites or also known as short sequence repeats (SSRs) are repetitive sequences of
DNA, commonly from 2 to 6 bp in length, that are mostly found in non-coding regions of
eukaryotic genome. They are known to have high mutation rates that lead to higher allelic
variability and high levels of polymorphism, making them suitable for crocodile genetic
study (Bashyal et al., 2014). Microsatellite markers has been widely used in various genetic
studies of crocodile including populations genetics, paternity study and cross-species
hybridization (Lewis et al., 2013; Bashyal et al., 2014; Hekkala et al., 2015; Lapbenjakul et
al., 2017).
By using the microsatellite markers, researchers are able to shed lights on population
structure and also elucidate phylogeography in crocodilians species. Mauger et al. (2017)
studied on the population genetic structure of the American crocodile, C. acutus, in Pacific
Costa Rica, and from their study, they suggested that the C. acutus populations in the country
Page 168
146
were not panmictic as shown by moderate levels of genetic diversity. The crocodile
populations in Costa Rica were also identified experiencing genetic bottleneck, most likely
due to declined in number of crocodiles as a result of hunting and illegal poaching (Mauger
et al., 2017). Other studies utilising microsatellites have been able to identify genetic
differentiation in saltwater crocodile, C. porosus, populations from the Indo-Malay
Archipelago and the Western Pacific Ocean, with support from mtDNA markers (Gratten,
2003). Meanwhile, Russello et al. (2007) had found a separate haplotype for C. porosus
population in the Pacific island country of Palau compared to those that had been identified
by Gratten (2003) in Indo-Pacific region. A population genetic study of C. porosus from the
Northern Territory of Australia using mtDNA suggested that there is little to no genetic
structure within and between populations from the region, thus further studies looking at
other sensitive marker like microsatellite in combination with mtDNA to confirm the
findings (Luck et al., 2012).
Population genetic studies on crocodiles are still lacking in Malaysia especially in Sarawak.
Preliminary genetic studies by Shoon (2009), Abdullah (2010), Sulaiman (2011), Kasim
(2011) and Abdul-Gani (2014) had suggested a distinctive but close relationship among
crocodile populations from the coastal area of western, central and northern parts of Sarawak
through combined Cytochrome b and 12S Ribosomal gene, randomly amplified
polymorphic DNA (RAPD) and microsatellite data. However, Shoon (2009), Abdullah
(2010), Sulaiman (2011) and Kasim (2011) had used small number of samples, while Abdul-
Gani (2014) only used samples from one locality representing the western, central and
northern part of Sarawak. Furthermore, there is a possible expansion of wild crocodile
Page 169
147
populations in Sarawak with frequent movement occurs alongside the coastal region, based
on a high migration rate in the population genetic data (Abdul-Gani, 2014).
The previous genetic studies were focused on population from the coastal area (Shoon, 2009;
Kasim, 2011; Sulaiman, 2011; Abdul-Gani, 2014), but not much information known about
those in the upper region of the river within a large river basin. In the river basins like Rajang,
Lupar and Baram, crocodiles can be found up to hundred kilometers upstream of its main
river or tributaries as shown in the findings in Chapter 3 and Chapter 4. Hence, in this
chapter, genetic relationships among C. porosus from 13 locations across Sarawak including
from the middle or upper regions of river basins were investigated using three set of
microsatellite markers (Cj101, Cj105 and Cj131). Information on the genetic diversity,
population expansion and migrations (gene flow) between the populations were also
discussed in this chapter, so that the data could be used for conservation management of the
species and also to formulate ways to minimize HCC in Sarawak.
5.2 Materials and Methods
5.2.1 Sample collection
A total of 22 wild C. porosus from 13 locations in eight river basins in Sarawak were
captured in the present study (Figure 5.1). The crocodiles were caught manually by hand,
using scoop net or cast net (for animal less than 1.5 m) as described by Abdul-Gani (2014).
For large adult crocodiles (more than 1.5 m), samplings were accompanied by a group of
experienced personels in handling problematic crocodiles in Sarawak called Swift Wildlife
Action Team (SWAT), a unit in Sarawak Forestry Corporation (SFC). Cage traps were used
Page 170
148
for catching larger adult crocodiles. When a crocodile caught alive, the animal was restrained
properly before taking sample in order to prevent any incident to occur during the sampling
process. Samples MR002, MR003 and MR010 were collected from Miri crocodile farm
(MCF), while samples BN001 and BN002 were obtained from Tumbina Park, Bintulu
(TPB). Samples BN001 and BN002 are originated from Kemena River Basin (RB); they
were captured and relocated by the authority into the facility due to potential threat to local
people living along the river.
Samples were collected either in the form of tissue or blood. For tissue sample, a small piece
or the whole scute was cut from the crocodile’s tail using scalpel. The tail’s scute is most
commonly sampled for crocodile DNA. Besides scutes, tissue samples can also be collected
from other parts of the crocodile’s body such as from their tail, legs and body. For blood,
samples were collected using syringe with proper handling as techniques describe by Elsey
et al. (2008).
Samples that had been collected in the field were preserved using methods as follow:
i. Tissue samples
Tissue samples were put in sealed plastic bags (kept in cold condition and
immediately stored in -800C freezer when arrived at the laboratory) or in
preservation tube contain 70% ethanol solutions.
Page 171
149
ii. Blood samples
For blood samples, two methods of preservation recommended by Munson
(2000) were used. The first method was by dripping drops of blood on a thick
Whatman-type filter paper or touch the filter paper directly to the freshly opened
body cavity. Then the blood spots were dried in room temperature and stored in
sealed plastic bags. The second method was by mixing the blood with a buffer
solution contained 5% EDTA in the preservation tube.
All samples were then brought back to a laboratory in the Faculty of Resource Science and
Technology, UNIMAS and kept in -800C freezer until further molecular works. Information
on the sample’s area/tributaries location, species name, type of samples and date of sampling
were recorded and vouchered accordingly (Appendix B, see page 239 - 240). Each of the
samples were coded based on the origin of the crocodile or the location where the crocodile
was caught with the number of samples.
For example:
KP 001
Number of sample from sampling
area (eg.: 001= sample number 1)
Origin of the crocodile or the
location where the crocodile was
caught (eg.: KP= Kapit River)
Page 172
150
All the codes for place of sampling shown in the Table 5.1.
Table 5.1: Voucher codes for samples according to sampling area.
Area Code Sampling Area River Basin
(RB)
Number of Samples
(n)
1. BG Bintangor Rajang 2
2. BK Bako Sarawak River 2
3. BN Bintulu Kemena 2
4. DB Debak Saribas 2
5. KP Kapit Rajang 1
6. MR Miri Miri 3
7. PU Pusa Saribas 1
8. RO Roban Krian 1
9. SB Sibu Rajang 2
10. SJ Simunjan Sadong 1
11. SM Samarahan Samarahan 2
12. ST Santubong Sarawak River 2
13. TA Telaga Air Sarawak River 1
TOTAL 22
Page 173
151
Figure 5.1: Map of Sarawak showing locations of C. porosus samples collected in the present study.
Sibu
Kapit
Bako
Roban
Santubong
Telaga
Air
Debak
Pusa
Bintangor
Simunjan
Samarahan
Bintulu
Miri
Page 174
152
5.2.2 Total genomic DNA extraction and Polymerase Chain reaction (PCR)
amplification
Total genomic DNA was extracted from tissues and blood sample using 2%
cetyltrimethylammonium bromide (CTAB) protocols as described by Doyle and Doyle
(1987) with some modifications as suggested by Abdul-Gani (2014). For blood samples, the
bloods were subjected to few additional preparation steps suggested by Sambrook et al.
(1989) before proceed to CTAB protocols. The additional steps were including resuspended
the fresh or frozen blood, after thawing, in the phosphate-buffer saline followed by 15
minutes centrifuge at 15,000 rpm at 4 0C. The excess supernatant was discarded and nuclei
pellets were resuspended in 2% CTAB buffer before continued with the 2% CTAB DNA
extraction protocol. DNA extraction products then were assessed on 1% Agarose gel (AGE)
to determine the presence of total genomic DNA.
Polymerase Chain Reaction (PCR) was conducted using MyCyclerTM Thermal Cycler and
microsatellites analysis were follow Isberg et al. (2004) protocols. Three microsatellite
markers were used in this study namely Cj101, Cj105 and Cj131 as shown in the Table 5.2.
Page 175
153
Table 5.2: Microsatellite primers used in this study (Isberg et al., 2004).
Microsatellite
primer
Microsatellite Primer sequences (5’-3’)
Cj101 ACAGGAGGAATGTCGCATAATTG (forward)
GTTTATACCGTGCCATCCAAGTTAG (reverse)
Cj105 CAACAGAAAGTGCCACCTCAAG (forward)
GTTTGATTATGAGACACCGCCACC (reverse)
Cj131 GTTTGTCTTCTTCCTCCTGTCCCTC (forward)
AAATGCTGACTCCTACGGATGG (reverse)
For every microsatellite locus, the amplification reaction total volume was 25 μl which
comprised 5 unit/ μL of Taq DNA polymerase (1.5 μL), 10X Taq Buffer with KCl (5 μL),
10 mM dNTP mix (2 μL), 10 μM of forward and reverse primer (2 μL each), 25 mM MgCl2
(2.5 μL), 1 μL DNA template and approximately 9 μL sterile distilled water. Standard PCR
thermal conditions was used with preliminary denaturation at 94°C for 3 min; then 30 cycles
of strand denaturation at 94°C for 15 sec, annealing at 58°C for 30 sec, and extension at
72°C for 50 sec; followed by a final 4 minutes extension step at 720C and finally soaked at
4°C. A negative control was included in each batch of PCR amplification, consisting of all
of the amplification reaction components except for DNA template. Once the amplification
completed, the amplification products were detected by electrophoresis on 1% Agarose gel.
Page 176
154
5.2.3 DNA Sequencing and alignment
The nucleotide sequences of the PCR product were determined by the DNA sequencing
service of a private sequencing company Apical Scientific Sdn. Bhd., Seri Kembangan,
Selangor, Malaysia (formerly known as First Base Laboratories Sdn Bhd). The raw DNA
sequences were subjected to nucleotide Basic Local Alignment Search Tool or BLASTn
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) as suggested by Altschul et al. (1990) for
verification of the species. The raw sequence then was edited followed by alignment using
ClustalX version 2.1 (Larkin et al., 2007). The nucleotide base composition was also
calculated to estimate nucleotide richness using MEGA 7.0 (Kumar et al., 2016). The DNA
sequences of microsatellite genes using primer Cj101, Cj105 and Cj131 were tested for
analysis of compatibility of the combined data set using the Incongruence Length Difference
Test (ILD) or also known as Partition Homogeneity Test (PHT) implemented in PAUP 4.0a
162 software (Swofford, 2002).
5.2.4 Phylogenetic tree and NETWORK reconstruction analyses
Four methods of phylogenetic analysis were used in the present study namely (i) Neighbour-
Joining (NJ), (ii) Maximum-Parsimony (MP), (iii) Maximum-Likelihood (ML) implemented
in the PAUP 4.0a 162 software (Swofford, 2002) and (iv) Bayesian Inference (BI) analyses
using MR. BAYES 3.2.6 software (Huelsenbeck & Ronquist, 2001). Model test, calculated
using PAUP 4.0a 162 software (Swofford, 2002), had chosen TVM as the best substitution
model, based on the Akaike Information Criterion (AIC) and the substitution model was
used in the ML and Bayesian analyses. In Bayesian analysis, two simultaneous metropolis-
Page 177
155
coupled Monte-Carlo Markov Chains were ran for 380 000 generations before the
probability of splits frequencies (p) less than 0.01. Tree(s) were generated in the end of the
analysis along with posterior probabilities in each node. A sequence, Tomistoma schlegelii
clone 1008-63 microsatellite sequence (Accession no: KJ004636.1) was retrieved from The
National Center for Biotechnology Information (NCBI) GenBank database and used as
outgroup in the phylogenetic analyses.
Median-joining (MJ) network was generated by NETWORK 4.6.1.1 (Bandelt et al., 1999)
for C. porosus based on the microsatellite haplotype data generated using DNA Sequence
Polymorphism (DNASP) version 6.11.01 software (Rozas et al., 2017) to estimate the
dispersion of the species.
5.2.5 Population genetics analyses
Measures of population genetic parameters such as nucleotide diversity (π) and nucleotide
divergence (Da) were estimated from microsatellite data sequences using DNASP 6.11.01
(Rozas et al., 2017). To test relationship between the corrected genetic distances and
geographical distances, Matric Correlation Analysis (Mantel test) was performed with 1000
permutations in Arlequin version 3.5 (Excoffier & Lischer, 2010). Measures of Nucleotide
Subdivision (Nst), Population Subdivision (Fst) and Gene Flow (Number of Migrants, Nm)
among populations of C. porosus were generated using DNASP 6.11.01 (Rozas et al., 2017).
Nst value was estimated using lynch and Crease (1990), whereas estimation for Fst and Nm
value was using Hudson et al. (1992). In order to investigate demographic history and
geographical population’s differentiation, analysis of Molecular Variance (AMOVA) was
Page 178
156
performed. Neutrality tests by Tajima, D (Tajima, 1989) and Fu’s Fs (Fu, 1997) were carried
out to test for deviation of sequence variation from evolutionary neutrality as well as a
mismatch distribution analysis (Rogers & Harpending, 1992) to infer population expansion
event occur in the populations of C. porosus alongside Batang Rajang. All AMOVA,
neutrality test and mismatch distribution analyses were performed in Arlequin 3.5 (Excoffier
& Lischer, 2010), whereas statistical significant were tested using 1000 permutations.
5.3 Results
5.3.1 Sequences characterization and Basic Local Alignment Search Tool (BLAST)
analysis
Samples from 22 crocodiles were successfully sequenced using three microsatellite markers
(Cj101, Cj105 and Cj131), totalling 66 sequences. Amplifications using marker Cj105
showed multiple bands when viewed under 1% Agarose gel while the other two markers,
Cj101, and Cj131, show single band (Appendix C). Among the three markers, amplification
using Cj101 marker yield the longest sequence length with 312 bp, followed by Cj105 (262
bp) and Cj131 (176 bp) (Table 5.3).
Page 179
157
Table 5.3: Sequence characterization for the microsatellite markers.
Microsatellite
markers
Sequence
length
(base
pair, bp)
Variable
sites
Variable sites Repeat
Motif Singleton
sites
Parsimonious
informative
sites
Cj101 312 34
(10.9%)
16
(47.1%)
18
(52.9%)
CA12
Cj105 262 29
(11.1%)
13
(44.8 %)
16
(55.2 %)
CA16
Cj131 176 18
(10.2%)
9
(50.0 %)
9
(50.0 %)
CA16
Percentage of variable sites for the three markers were in the range of 11.1% to 10.2% with
the highest was Cj105 gene and the lowest was Cj131 gene (Table 5.3). Of the 34 variable
sites in Cj101 gene, 16 sites were singleton, leaving 18 or 52.9% potentially parsimoniously
informative sites. For Cj105 gene, 13 out 29 variables sites were singleton sites, while
another 16 sites (55.2%) were parsimoniously informative characters. Meanwhile, in Cj131
genes the number of sites were equal with 9 (50.0%) out 18 variable sites were singleton and
parsimoniously informative sites, respectively.
All of the genes obtained using the three microsatellite markers shared similar repetition
base, CA, but have different in number of repetition motif. Cj101 sequences have 12 times
repetition of base CA, while Cj105 and Cj131 sequences have 16 times repetition of base
CA (Table 5.3).
Page 180
158
The average nucleotide base composition at the 1st, 2nd and 3rd codon position for all three
genes used in this study are shown in table 5.4. Based on the nucleotide base composition,
proportion of A+T base was higher when compared to G+C base. As examples, the
proportion of nucleotide base A+T : G+C at the 1st codon position for Cj101 genes was
55.5% : 44.4%, while proportion at 2nd position was 61.5% : 38.0% and at 3rd position, the
proportion was 57.2% : 42.5%.
Table 5.4: Average nucleotide base composition at the 1st, 2nd and 3rd codon position for
the three microsatellite markers in this study. All frequencies are in percentage (%).
Codon
positions
1st 2nd 3rd
Nucleotide
base
T(U) A C G T(U) A C G T(U) A C G
Cj101 21.0 34.5 37.0 7.4 19.0 42.5 31.5 6.5 22.0 35.2 31.0 11.5
Cj105 27.0 26.2 29.6 17.6 29.0 22.6 35.3 13.5 27.0 31.6 27.4 14.0
Cj131 25.0 32.8 29.2 13.3 34.0 22.4 28.4 14.7 36.0 22.0 28.2 14.2
Species verification through BLASTn for all sequences hit at least one or several matches
in NCBI GenBank for each microsatellite genes (Table 5.5).
Page 181
159
Table 5.5: Basic Local Alignment Search Tool (BLAST) result.
Markers Description Accession
no.
Query
match site
E-
value
Identities
(%)
Cj101 Crocodylus porosus
clone CpDi07
microsatellite sequence
EU593280.1 Site 97 - 275 3e-17 70%
Cj105 Crocodylus porosus
isolate 7707cro ultra
conserved element locus
chr2_24748 genomic
sequence
JQ876520.1 Site 133- 184 2e-06 83%
Crocodylus porosus
isolate 8700cro ultra
conserved element locus
chr3_299 genomic
sequence
JQ877513.1 Site 117-136 8.0 95%
Cj131 Crocodylus porosus
clone CpDi54
microsatellite sequence
EU593305.1 Site 13-37 1.2 92%
Crocodylus porosus
clone CpP2201
microsatellite sequence
EU593442.1 Site 1-32 4.1 81%
For all microsatellite Cj101 genes, BLAST result showed one similar hits with a nucleotide
sequence, Crocodylus porosus clone CpDi07 microsatellite sequence (Accession no:
EU593280.1) with the bases identical up to 70% (Table 5.5). The E-value was recorded very
low with the value of 3e-17.
Meanwhile for Cj105 genes, BLAST result showed two matches with C. porosus sequences
(Table 5.5). The match sequences were Crocodylus porosus isolate 7707cro ultra conserved
element locus chr2_24748 genomic sequence (JQ876520.1) and Crocodylus porosus isolate
8700cro ultra conserved element locus chr3_299 genomic sequence (JQ877513.1) with 83%
and 95% of bases identities and E- value of 2e-06 and 8.0, respectively.
Page 182
160
Two matches in NCBI GenBank with microsatellite Cj131 genes in this study were recorded
and both are microsatellite sequences (Table 5.5). Crocodylus porosus clone CpDi54
microsatellite sequence (EU593305.1) is 92% identical with Cj131 genes and has a E-value
of 1.2. Another match, Crocodylus porosus clone CpP2201 microsatellite sequence
(EU593442.1), has lower identities percentage (81%) and higher E-value (4.1).
5.3.2 Combine genes and haplotype build
The three genes were combined in this following order, the Cj101 gene, base site from 1 to
312; the Cj105 gene, from base site 313 to 574 and end by the Cj131 gene, from base site
575 to 750. Prior to combining the genes, they were subjected to the Partition Homogeneity
Test (PHT) and the result showed high p-value (p = 1.00) or not significant, meaning that all
three microsatellites genes, Cj101, Cj105 and Cj131 have similar evolutionary rates (Farris
et al., 1994; Dolphin et al., 2000). Thus, the three genes can be combined for phylogenetic
reconstruction.
Using the combine genes, 21 haplotypes were identified from the 22 individuals of C.
porosus sequenced in this study (Table 5.6). Each individual of C. porosus have unique
haplotype except for samples from Sibu. Two samples from Sibu, SB001 and SB002, share
the same haplotype (Hap_1).
Page 183
161
Table 5.6: Haplotype identity for 22 microsatellite sequences of C. porosus.
Haplotype Haplotype
Frequency
Voucher
samples
Locality River Basin
(RB)
Hap_1 2 SB001 Sibu Rajang
SB002
Hap_2 1 KP001 Kapit
Hap_3 1 BG001 Bintangor
Hap_4 1 BG002
Hap_6 1 SM002 Samarahan Samarahan
Hap_7 1 SM001
Hap_8 1 SJ001 Simunjan Sadong
Hap_9 1 DB002 Debak Saribas
Hap_10 1 DB001
Hap_11 1 PU001 Pusa
Hap_12 1 RO001 Roban Krian
Hap_5 1 TA001 Telaga Air Sarawak River
Hap_13 1 BK001 Bako
Hap_14 1 BK005
Hap_15 1 ST001 Santubong
Hap_16 1 ST002
Hap_17 1 MR002 Miri Miri
Hap_18 1 MR010
Hap_19 1 MR003
Hap_20 1 BN002 Bintulu Kemena
Hap_21 1 BN001
Page 184
162
5.3.3 Phylogenetic analysis
All the four phylogenetic trees shared almost similar in topologies with slightly different in
clade positions as shown in Neighbour-joining (Figure 5.2), Maximum Parsimony (Figure
5.3), Maximum likelihood (Figure 5.4) and Bayesian (Figure 5.5). All trees revealed the
monophyl of C. porosus with the outgroup species, T. schlegelii with 100% (NJ), 100%
(MP), 100% (ML) bootstrap supports and 1.00 (Bayesian posterior probabilities, BPP).
Bootstrap values ≥ 70% were considered significant, meaning the topologies of the nodes
were regarded as sufficiently resolved, while those of 50% to 70% showed tendencies
(Huelsenbeck & Ronquist, 2001). Meanwhile for posterior probabilities in Bayesian, values
≥ 0.98 or 98% were considered as significant.
All trees exhibited the existence of geographical clade. Samples from Telaga Air (TA001),
Santubong (ST001 and ST002) and Bako (BK001 and BK005) were in the same clade
namely Clade A with bootstrap value of 81% (NJ), 91% (MP), 90% (ML) and 0.98 (BPP).
These three localities are located in Sarawak RB, in the western side of Sarawak.
SM001 and SM002 from Samarahan RB and SJ001 from Sadong RB shared the same clade
(Clade B) in all trees with bootstrap value (81%, NJ; 91%, MP; 90%, ML and 0.98, BPP),
while samples from Saribas RB (PU001, DB001 and DB002) and Krian RB (RO001) were
grouped in the same sister clade (Clade C) with strong supports (54%, NJ; 70%, MP; 71%,
ML and 0.90, BPP), showing a close relationship among the crocodiles in those
neighbouring river basins.
Page 185
163
Clade D consists of BG001, BG002, SB001, SB002 and KP001 were originating from
Rajang RB particularly in middle and upper regions and the monophyletic relationship
between the samples were supported by strong bootstrap values (77%, NJ; 91%, MP; 82%,
ML and 0.98, BPP). Samples from Bintulu (BN001 and BN002) and Miri (MR002, MR003
and MR010) were grouped in a clade (Clade E) with bootstrap values of 77% (NJ), 90%
(MP), 96% (ML) and 0.93 (BPP).
Page 186
164
Figure 5.2: Microsatellite-based phylogenetic relationship for 22 C. porosus in Sarawak
inferred using Neighbour-joining (NJ) analysis. Support value next to the node are
bootstrap values.
MR002
MR010
MR003
BN002
BN001
BK001
BK005
ST001
ST002
TA001
SM001
SJ001
SM002
DB002
DB001
PU001
RO001
SB001
SB002
KP001
BG001
BG002
T.schlegelii
0.01 substitutions/site
77
77
76
81
90
77
54
57
100
54
E
a
A
a
B
a
C
a
D
a
Page 187
165
Figure 5.3: Microsatellite-based phylogenetic relationship for 22 C. porosus in Sarawak
inferred using Maximum Parsimony (MP) analysis. Support value next to the node are
bootstrap values.
MR002
MR010
MR003
BN002
BN001
SB001
SB002
KP001
BG001
BG002
BK001
BK005
ST001
ST002
TA001
SM002
SM001
SJ001
DB002
DB001
PU001
RO001
T.schlegelii
5 changes
83
90
77
91
79
87
91
70
100
E
a
D
a
A
a
B
a
C
a
Page 188
166
Figure 5.4: Microsatellite-based phylogenetic relationship for 22 C. porosus in Sarawak
inferred using Maximum likelihood (ML) analysis. Support value next to the node are
bootstrap values.
MR002
MR010
MR003
BN002
BN001
SB001
SB002
KP001
BG001
BG002
BK001
BK005
ST001
ST002
TA001
SM002
SM001
SJ001
DB002
DB001
PU001
RO001
T.schlegelii
0.01 substitutions/site
93
100
96
71
70
90
94
82
94
71
E
a
D
a
A
a
B
a
C
Page 189
167
Figure 5.5: Bayesian inference of the 50% majority rule consensus tree of Combine
microsattelite genes of C. porosus. Bayesian posterior probabilities are accordingly
indicated besides the branch nodes.
0.9
5
0.93
0.81
0.98
0.99
0.90
0.95
0.98
0.98
1.00
1.00
A
B
C
D
E
Page 190
168
5.3.4 NETWORK Analysis
The median-joining network for haplotypes of C. porosus showed distinct clusters based on
geographical areas, which indicates a high level of haplotype diversity (Figure 5.6). Five
groups of haplotypes clustered together or haplogroup were identified in the Network figure,
each representing different river basins and this was consistent with the topologies of the
phylogenetic trees (Figure 5.2 – 5.5). All C. porosus haplotypes from Sarawak RB (Hap_5,
Hap_13, Hap_14, Hap_15 and Hap_16) clustered in a group that was distinct from
haplotypes from Samarahan/Sadong RB (Hap_6, Hap_7 and Hap_8) by at least 5 mutational
steps. Meanwhile, Samarahan/Sadong haplotype cluster was separated with haplotypes from
Saribas/Krian RB (Hap_9, Hap_10, Hap_11 and Hap_12) in central region of Sarawak by at
least 5 mutational steps (Figure 5.6).
Saribas/Krian cluster of haplotypes were connected to a median vector (node A) by 2
mutation steps before the line connected to a cluster consist of haplotypes from C. porosus
sampled in middle part of Rajang RB with 3 mutational steps, totalling 5 mutational steps
differentiate between the two clusters (Figure 5.6). The node A could possibly infer the
missing haplotype representing population of C. porosus from lower region of Rajang RB,
which was unable unsampled in this study. A single haplotype from Kapit (Hap_2) was
isolated from the haplotypes of middle Rajang by 10 mutational steps, indicating high
genetic divergence between population in the middle and upper parts of Rajang RB (Figure
5.6).
Page 191
169
Haplotypes from Bintulu (Hap_20 and Hap_21) and Miri (Hap_17, Hap_18 and Hap_19) in
northern of Sarawak formed a cluster each, differentiated by 3 mutational steps (Figure 5.6).
Furthermore, distance between haplotype clusters represented the populations of C. porosus
in the northern of Sarawak (Bintulu and Miri clusters) and clusters in central region of
Sarawak (Saribas/Krian and Rajang clusters) were at least 11 mutational steps.
Page 192
170
Figure 5.6: The median-joining Network generated by NETWORK software version 5.0.0.3 illustrating the relationship of the saltwater
crocodile, C. porosus from different localities in Sarawak. Each circle represents a haplotype and the diameter of the circle is scale to the
haplotype frequency. Different colours in the circle represent different localities. Bold number next the lines connecting the haplotypes
indicate number of mutation step(s).
Miri Bintulu
Saribas/Krian
Samarahan/Sadong
Sarawak River
(Kuching)
Middle
Rajang
Upper
Rajang
Node A
Page 193
171
5.3.5 Population Genetic Analyses
Nucleotide diversity (π) among five populations of C. porosus in Sarawak were low with
values ranging from 1.0% to 2.7%, while net nucleotide divergence (Da) varies in between
0.7% to 3.3%, suggesting small genetic differentiation among the populations (Table 5.7).
Table 5.7: Measures of Nucleotide Diversity (π) and Net Nucleotide Divergence (Da)
among populations of C. porosus analysed by locations.
Locality Approx.
Distance
(km)
Nucleotide Diversity
(π)a,b
Net Nucleotide Divergence
(Da)
Sarawak River -
Samarahan/Sadong
69.4 0.01111 0.00795
Sarawak River -
Saribas/Krian
123.2 0.01763 0.01529
Sarawak River -
Rajang
271.0 0.02169 0.02246
Sarawak River –
Bintulu/Miri
532.3 0.02700 0.03358
Samarahan/Sadong
- Saribas/Krian
53.8 0.01044 0.00708
Samarahan/Sadong
– Rajang
201.6 0.01465 0.01454
Samarahan/Sadong
- Bintulu/Miri
462.9 0.01906 0.02517
Saribas/Krian -
Rajang
147.8 0.01268 0.00770
Saribas/Krian -
Bintulu/Miri
409.1 0.01917 0.02112
Rajang -
Bintulu/Miri
341.7 0.02035 0.02279
aEstimated using the Kimura 2-parameter distance (Kimura, 1980). bsites with gaps were
completely excluded.
Nucleotide diversity and net nucleotide divergence values were lower in populations from
western (Sg. Sarawak and Samarahan/Sadong) and central (Saribas/Krian and Rajang) of
Sarawak compare to population from northern (Bintulu/Miri). Between those populations
Page 194
172
and Bintulu/Miri population, Da values were much higher (2.1% - 3.3%). On the other hand,
Da values in between populations from western and central were ranging from 0.7% to 2.2%
(Table 5.7).
This information seems to indicate isolation by distance occurred to the populations of C.
porosus in Sarawak. However, mantel test showed a lack of significant relationship (only at
p < 0.5) between net nucleotide divergence (Da) and geographic distance among the five
populations of C. porosus in Sarawak (r = 0.957, p = 0.007, 1000 permutations). The mantel
test result revealed that isolation by distance was not applicable to the populations of C.
porosus in Sarawak, meaning that geographical distance is not necessarily influence the
migrations of the crocodile across the state.
The mismatch distribution of pairwise nucleotide among the microsatellite sequences data
for all the populations or each population, support population expansion hypotheses
following the expected distribution under the sudden expansion model and also the spatial
expansion model. This was indicated by the small sum of squared deviations (SSD) values
ranging from 0.05 – 0.16 for sudden expansion and 0.04 – 0.17 for spatial expansion with
lack of significance (sudden, p = 0.10 – 0.63; spatial, p = 0.28 – 0.86). In addition, values of
Harpending’s raggedness index (r) were also recorded low, ranging from 0.14 to 0.44 for
both expansion models and the analysis result showed lack of significant, p > 0.05 (Table
5.8), inferred as unimodal mismatch distribution in the C. porosus population. However,
scatterplots of mismatch distribution for each population (Figure 5.7a – Figure 5.7e) showed
multiple peaks in all populations, generally interpreted as multimodal mismatch distribution.
Page 195
173
Table 5.8: Summary statistics of Microsatellite Cj16 sequences variation in five
populations of C. porosus in Sarawak.
Populations N H D Fs Sudden expansion Spatial expansion
SSD r SSD r
Sarawak RB 5 5 -0.28
(p=0.50)
1.06
(p=0.15)
0.09
(p=0.10)
0.16
(p=0.82)
0.07
(p=0.36)
0.16
(p=0.83)
Samarahan/
Sadong RB
3 3 0.00
(p=1.00)
-0.08
(p=0.23)
0.16
(p=0.63)
0.44
(p=1.00)
0.17
(p=0.86)
0.44
(p=1.00)
Saribas /
Krian RB
4 4 -0.56
(p=0.43)
-0.36
(p=0.24)
0.08
(p=0.50)
0.22
(p=0.84)
0.08
(p=0.76)
0.22
(p=0.90)
Rajang RB 5 4 -0.78
(p=0.31)
0.78
(p=0.57)
0.13
(p=0.32)
0.39
(p=0.31)
0.13
(p=0.28)
0.39
(p=0.43)
Bintulu /
Miri RB
5 5 0.30
(p=0.66)
-1.51
(p=0.08)
0.05
(p=0.53)
0.14
(p=0.80)
0.04
(p=0.61)
0.14
(p=0.81)
N= number of sequences analyzed; H= number of haplotypes; D= Tajima’s statistic (P (Dsimul < Dobs),
Tajima 1989); Fs, Fu’s statistic (Fu 1997); SSD= sum of squared deviations of the observed and
expected mismatch with p values in parentheses; r, raggedness statistic (Harpending, 1994) with p
values in parentheses. ** Significance (p < 0.05) was determined using coalescent simulations in
Excoffier (2004). Sites with gaps were completely excluded.
Tajima ’s test of neutrality (D) for all populations of C. porosus resulted negative values
ranging from -0.28 to -0.78 except for Samarahan/Sadong (0.00) and Bintulu/Miri (0.30)
and lack of significance was observed (p = 0.31 to 1.00), indicating that the populations were
deviate from neutral and was evolved under non-random process (Table 5.8). Fu’s F
neutrality test gave non-significant negative values for Samarahan/Sadong (-0.08, p = 0.23),
Saribas / Krian (-0.36, p = 0.24) and Bintulu/Miri (-1.51, p = 0.08). Conversely, positive Fs
values were observed for Sarawak (1.06) and Rajang RB (0.78) with lack of significance (p
= 0.15 and 0.57, respectively) (Table 5.8).
Page 196
174
Figure 5.7: Mismatch distribution of C. porosus at (a) Sarawak RB, (b) Samarahan/Sadong RB, (c) Saribas/Krian RB, (d) Rajang RB and
(e) Bintulu/Miri RB population. The dark line represents the observed and light lines represent the expected distribution for each model.
-1
0
1
2
3
4
0 2 4 6 8 10
Fre
qu
ency
Pairwise Differences-1
0
1
2
3
4
0 2 4 6 8 10
Fre
qu
ency
Pairwise Differences
(b)
-1
0
1
2
3
4
0 2 4 6 8 10
Fre
qu
ency
Pairwise Differences
(c)
-1
0
1
2
3
4
0 2 4 6 8 10
Fre
qu
ency
Pairwise Differences
(d)
-1
0
1
2
3
4
0 2 4 6 8 10
Fre
qu
ency
Pairwise Differences
(e)
(a)
Page 197
175
The AMOVA analysis (Table 5.9) revealed that most of molecular variance was founded
among the populations (71.85%) than within the populations (28.51%), which both was
significantly differentiated (p = 0.00). This information possibly signified an unequal rate of
evolution occurs among lineages in the same populations.
Table 5.9: Measures of geographical population differentiation in Crocodylus porosus
based on an analysis of Molecular Variance approach using microsatellite sequences data.
Source of
variance
Variance
component
Percent (%)
variation
Fixation
index, ϕ
Pa
Among
populations
6.73 71.85
0.72 0.00*
Within
Populations
2.64 28.15
0.72 0.00*
Total 9.37 0.72 0.00±0.00
*Significant (p < 0.05). aProbability of finding a more-extreme variance component of the ϕ index
than that observed by chance alone after 1000 permutations.
Significant ϕST values were observed in the pairwise genetic differentiation among all the
populations (Table 5.9).
Table 5.10: Genetic differentiation matrix of populations calculated by ϕST. p values are
shown in parenthesis (below the diagonal).
Sarawak RB Samarahan
/ Sadong RB
Saribas /
Krian RB
Rajang RB Bintulu /
Miri RB
Sarawak RB -
Samarahan /
Sadong RB
0.52
(0.01±0.00)*
-
Saribas / Krian
RB
0.65
(0.01±0.00)*
0.52
(0.04±0.01)*
-
Rajang RB 0.73
(0.01±0.00)*
0.67
(0.01±0.00)*
0.50
(0.01±0.00)*
-
Bintulu / Miri
RB
0.82
(0.01±0.00)*
0.82
(0.01±0.00)*
0.74
(0.01±0.00)*
0.75
(0.01±0.00)*
-
*Significant (p < 0.05) with 1000 permutations.
Page 198
176
Low nucleotide Nucleotide (Nst) and population (Fst) subdivision with high number of
migrants per generation (Nm) were recorded in all five populations of C. porosus in Sarawak,
indicating there is gene flow occurs in the populations. Nst and Fst values were higher
between the population of Samarahan/Sadong and Bintulu/Miri (Nst = 0.83, Fst = 0.83)
compared to others, even more than Sarawak River – Bintulu/Miri populations although the
geographical distance between the areas are greater than Samarahan/Sadong - Bintulu/Miri
(Table 5.11). In addition, number of migrants per generation (Nm) for Samarahan/Sadong -
Bintulu/Miri was also lower compared to those in Sarawak River – Bintulu/Miri, further
indication that geographical distance is not necessarily influence the migrations of the
crocodile across Sarawak.
Table 5.11: Measures of Nucleotide Subdivision (Nst), Population Subdivision (Fst) and
Gene Flow (Number of Migrants, Nm) among populations of C. porosus analysed by
locations.
Locality Approx.
Distance
(km)
Nucleotide
Subdivision
(Nst)a
Estimate of
Population
Subdivision (Fst)b
Number of Migrants
per generation
(Nm)b
Sarawak River -
Samarahan/Sadong
69.4 0.55628 0.55414 0.40
Sarawak River -
Saribas/Krian
123.2 0.63199 0.62831 0.30
Sarawak River -
Rajang
271.0 0.71319 0.70911 0.21
Sarawak River –
Bintulu/Miri
532.3 0.80534 0.80096 0.12
Samarahan/Sadong
- Saribas/Krian
53.8 0.53648 0.53448 0.44
Samarahan/Sadong
– Rajang
201.6 0.69685 0.69432 0.22
Samarahan/Sadong
- Bintulu/Miri
462.9 0.82698 0.82410 0.11
Saribas/Krian -
Rajang
147.8 0.48104 0.47856 0.54
Saribas/Krian -
Bintulu/Miri
409.1 0.74098 0.73737 0.18
Rajang -
Bintulu/Miri
341.7 0.75127 0.74781 0.17
a Estimated using lynch and Crease (1990). b Estimated using Hudson et al. (1992).
Page 199
177
5.4 Discussion
Potentially parsimoniously informative sites found in the sequences of the microsatellite
genes Cj101, Cj105 and Cj131 are relatively high (50.0% - 55.2%), and this indicates that
the genes are reliable to infer genetic variations of C. porosus in Sarawak at the population
levels (Zainudin et al., 2010). The repeat base, CA, and number of repetition motif for each
markers gained in this study were consistent with what have been obtained by Hekkala et al.
(2015) using the same microsatellite markers. Most frequent repeat base among dinucleotide
in animal genomes is CA (Ellegren, 2004), which explain why many microsatellite markers
are constructed based on this repeat motif including for C. porosus. Higher proportion of
A+T base compared to G+C base found in the sequences in the present study, similar with
those reported by Li et al. (2007) who sequenced a complete genome of C. porosus. In their
study, Li et al. (2007) found out that A+T skew is higher than G+C skew in the C. porosus
genome, whereas the most abundant base is Adenine (A). In other animals like amphibian
and echinoderm, the similar bias was observed in their sequences where the frequencies of
A and T bases is higher than G and C bases (Maltagliati et al., 2010; Zainudin et al., 2010).
Generally, all sequences for each microsatellite genes in the present study matches with at
least one or several C. porosus sequences in NCBI GenBank with the high bases identical
range from 70% to 95% and relatively small E-value (except for one or two matches),
ranging from 3e-17 to 8.0. E-value equal to zero or closer to the value of zero show significant
match with the hit sequence (Karlin & Altschul, 1990). Thus, all of the matches with
microsatellite genes prove that sequences obtained in this study were from C. porosus.
Page 200
178
Altogether 21 microsatellite haplotypes were identified from the 22 individuals of C. porosus
sequenced in this study (Table 5.6), meaning that each individual of C. porosus have unique
haplotype except for samples from Sibu, where both SB001 and SB002 share the same
haplotype (Hap_1). This further support the reliability of microsatellite marker in inferring
genetic variation of C. porosus in Sarawak as different haplotype were identified from each
sample. The uniqueness of each haplotype in the presents study could also indicated high
genetic diversity among the C. porosus population of Sarawak. There are also different
haplotypes were identified in each sample from Miri (MR002, MR003 and MR010),
obtained from a crocodile farm (Miri Crocodile Farm, MCF), indicating the diversity of
crocodile populations is high for Miri population. MCF has been operating since 1992 and
the early brood stocks for crocodile ranching in the farm, were obtained from rivers in Miri
and Baram Rivers. In addition, the farm also has been used by the authority as holding
facility for captured crocodile that endanger local people in northern part of Sarawak. Thus,
mixture of adult crocodiles in MCF could best explained the high genetic diversity of C.
porosus from Miri.
Multimodal mismatch distribution shown in all populations scatterplots (Figure 5.7a –
Figure 5.7e) could depict a situation of general demographic stability in the populations
(Rogers & Harpending, 1992). There is a possibility that the crocodile populations are
experiencing demographic stability as the population still in the recovery process, due to
recent declining (Cox & Gombek, 1985). However, SSD and R values (Table 5.8) and
supported by gene flow (Nm) were consistent with the hypothesis of demographical
expansion model (Slatkin & Hudson, 1991; Rogers & Harpending, 1992; Ray et al., 2003;
Excoffier & Lischer, 2010). According to Maltagliati et al. (2010), population sub-
Page 201
179
structuring and mutation rate heterogeneity may account for multimodal mismatch
distribution, therefore rather than interpreted as demographic stability, the multimodal
mismatch distributions were the result of the presence of different haplogroups detected.
The negative D value in Tajima neutrality test for Sarawak River, Saribas/Krian and Rajang
populations (Table 5.8) could have indicated that the populations had experience a
bottleneck effect. About 30 to 40 years ago, the crocodile population in the wild were
dramatically decline due to overexploitation (Cox & Gombek, 1985), hence genetic
bottleneck could possibly happen in the population. Intensive harvesting of crocodiles and
their eggs during the exploitation era were recorded in those rivers especially in the Sarawak
and Rajang River (Cox & Gombek, 1985). Meanwhile, negative Fs values in
Samarahan/Sadong, Saribas/Krian and Bintulu/Miri would have inferred population
expansion or genetic hitchhiking in the populations (Zainudin et al., 2010), but not
significant enough (p > 0.05) to support the claim. Therefore, further investigation need be
done in the future to resolve this matter.
The data from the population genetic analysis also reveal that populations from Bintulu/Miri
in northern of Sarawak appeared to be slightly isolated with populations from the central
(Saribas/Krian and Rajang) and western part (Sarawak River and Samarahan/Sadong) based
on the low level of migrants per generation (Nm = 0.11 – 0.18) as well as Nst and Fst values
> 0.8, consistent with phylogenetic trees and Network topologies. High number of migrants
per generation (Nm) indicated frequent migration rate or gene flow among the populations
of C. porosus and further supporting the population expansion hypothesis.
Page 202
180
Population genetic data analysis suggest that there is the population expansion due to the
frequent migrations of C. porosus in Sarawak. Complex river systems and massive web-like
shape in several major river basins in Sarawak play major role influencing the expansion of
C. porosus across the state. Sarawak has 22 major river basins connected to several hundred
tributaries, plus peat swamp and mangroves areas that are associated with the river basins,
throughout 12 million hectares area of the state (Tisen & Ahmad, 2010). Crocodiles are
found in all of those river basins based on the HCC data (Chapter 3) and other reports (Tisen
& Ahmad, 2010; Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Robi, 2014; Zaini et al.,
2014; Sarawak Forestry Corporation, 2018) and the animals were found travel frequently in
between the river basins.
In several neighbouring river basins in Sarawak, the distance between the mouth of the rivers
are small (closed to each other). As example, in Saribas/Krian and Samarahan/Sadong RB
the distance between the mouth of each rivers is approximately less than 60 km, thus it is
very possible for the crocodiles to travel across the sea to the next river basin. The ability to
swim across sea could also explained closed genetic relationship among crocodile in Bintulu
and Miri although both area have distance about 200 km. Sea barriers do not appear to pose
a significant obstruction for C. porosus to migrate since the reptiles can migrate across the
sea for a distance of more than 800 km (Gratten, 2003). Several movements of crocodiles
along the coastal area of Australia for hundreds kilometers had been recorded using
telemetry and GPS transmitter (Campbell et al., 2010; Campbell et al., 2013). River basins
are also connected to each other at some points, for instance Sarawak RB and Samarahan
RB, both were connected via several tributaries, one of them is a tributary call Loba Batu
Belat River. This could facilitate the migrations of the crocodile between the river basins. In
Page 203
181
addition, during NEM where rainfalls are relatively higher throughout the season period,
water level in the rivers are elevated and many areas like swamps and mangroves are flooded
with water (Sa’adi et al., 2017), and this situations are believed had facilitated the crocodile
to travel to other areas or moving from one waterway to another that were previously
disconnected by dry land . Crocodiles also use the water surface current during this monsoon
season to travel longer distance (Campbell et al., 2010). Furthermore, monsoon season in
Sarawak typically coincide with the breeding season of crocodile (Stuebing et al., 1985) and
the females can travel up to 50 km river distance from their original habitat to a another place
for nesting (Campbell et al., 2013).
Migrations of C. porosus in Sarawak are not only occur across the river basins, but the
expansion of the animal populations could also occur further upstream in a large river basin,
based on the high Nm values for Rajang populations (Table 5.8). In the present study, Rajang
populations were represented by samples that had been collected from middle (Bintangor
and Sibu) and upper (Kapit) region of the river basin. Saribas/Krian population are the
closest with Rajang RB with low Fst and high Nm (Table 5.8) indicating frequent migration
in both populations. Geographical distance between the Saribas/Krian and the mouth of
Rajang is estimated around 50 km, while the distance between the mouth with the middle
region of Rajang is approximately 100 km. According to Campbell et al. (2013), ‘nomadic’
crocodiles especially males prefer to foraging into new territory and travel long distances
including toward freshwater upstream looking for the best site to stay.
Page 204
182
5.5 Conclusion
Five distinct clades representing five C. porosus populations based on the different
geographical areas in Sarawak obtained in the phylogenetic and Network analysis indicating
that DNA microsatellite is a good gene marker to infer relationship among C. porosus in the
state. Furthermore, population genetic analyses showed that there is gene flow amongst the
five populations suggesting that frequent migrations occur between the populations of C.
porosus in Sarawak. Mismatch distribution shows multimodal pattern in the scatterplot
which is common for populations at demographic equilibrium. However, based on sudden
and spatial expansion SSD and R values, the populations are experiencing expansion. In
addition, neutrality tests support the population expansion hypothesis particularly in
Samarahan/Sadong, Saribas/Krian and Bintulu/Miri populations.
Page 205
183
CHAPTER 6
GENERAL DISCUSSION
The historical data (Chapter 3), ecological data (Chapter 4) and genetic data (Chapter 5)
collected in the present study are providing valuable information about the populations of C.
porosus in Sarawak. Data on conflicts between human and crocodile for over 118 years
period revealed that the crocodiles are dispersed in almost all major river basins in Sarawak,
even at the time when Sarawak was ruled by the colonial government prior to the year
1940’s. Indeed, it is believed that the crocodile has been long living in the rivers of Sarawak
based on the stories told by explorers who came to Sarawak (Wallace, 1869; Hornaday,
1885; Bartlett, 1895; Beccari, 1904) and the findings of crocodile earthen in several places
across Sarawak (Datan et al., 2012). The earthen crocodile replicas or known as ‘Baya tanah’
was built by indigenous people in Sarawak more than hundreds of years ago, portraying the
respect of the people towards crocodile, living in the nearby rivers at that period of time
(Datan et al., 2012).
A theory by Gratten (2003) suggested that estuarine crocodile have been migrated across
Indo-pacific region including in Borneo Island since Pleistocene glacial periods about 2
million years ago. During the Pleistocene periods, water level was about 120 m lower
compare to present day, hence reduced the distance between land and facilitate crocodile
migration between islands (Gratten, 2003). Afterward, the increasing water level since the
Pleistocene periods could allowed crocodile to disperse into wider area within Borneo Island.
Genetic diversity as inferred by microsatellite data in Chapter 5 further supports the long
Page 206
184
history of crocodile migration particularly in Sarawak as distinctive subpopulations were
identified according to the demographic area.
The attacks data suggest that crocodiles had been living in the upstream areas far from the
sea, since more than 100 years ago, for example two cases of crocodile attack has been
recorded as far as in Belaga and Palagus in 1920’s. Belaga and Pelagus are located more
than 200 km from the mouth of Rajang River. Crocodile surveys in the Rajang River Basin
(RB) (Chapter 4) had spotted crocodiles in tributaries at the middle and upper regions of the
river basin. The farthest tributary surveyed in the present study at Rajang RB is at Katibas
River in Song, Kapit, approximately more than 180 km distance from estuary, with possible
adult crocodiles were detected in the tributary.
The presence of crocodile in different regions (lower, middle and upper) of Rajang RB
indicated that C. porosus in Sarawak live in a wide range of habitats; from large salt water
river system and small tidal tributaries (near to estuary) in the lower region to hypo-saline
or fresh water non-tidal tributaries in the middle and upper regions. The crocodiles were
abundance in mangroves and Nypa areas near to the river mouth as well as their presences
were detected in riverbank areas dominated by mix plants in freshwater rivers. In the
crocodile surveys, there were crocodiles found in about 5 km deep into up- river of non-tidal
freshwater tributaries in the upper region of Rajang. Although C. porosus typically occur at
very low densities in the upstream reaches of freshwater rivers, their presence has or may
have a significant impact on the use of rivers and riparian areas by local people and livestock
(Lading, 2013; Tisen et al., 2013). Similar problem has been faced by other countries
including Australia and Indonesia whereas crocodiles were found in the upstream reaches
Page 207
185
(areas upstream of tidal influence) of freshwater rivers and their numbers has been increasing
into worrying figures (Letnic et al., 2011; Shaney et al., 2017).
Human activities and riverbank land use assessment in the surveyed rivers (Chapter 4) varies
among rivers, where the data reflected that anthropogenic pressures have impacts on the
crocodile distributions. In the surveys, the crocodile was not seen or only small number of
individuals were spotted in river areas within town proximity such as in Nyelong River and
Sarikei River near to Sarikei Town. Meanwhile, in Kanowit River near to Kanowit Town,
the crocodile was absent throughout the entire 18 km survey distance. Sarikei and Kanowit
Town, which are located at the river mouths, are experiencing rapid developments on its
riverbank areas and river usages for activities like fishing and boating are constantly high.
All these activities could impact the distribution of crocodile in the rivers and the distribution
pattern in those areas showed that crocodiles are avoiding high human populated areas.
Similarly, Shaney et al. (2017) who studied crocodile population in Indonesia found negative
correlation between the abundance of crocodiles with proximity to humans, meaning that
less crocodiles are found in areas close to humans, consistent with the result of the present
study.
However, this situation is not necessarily depicting that the crocodiles are avoiding all
human populated areas. There are studies elsewhere suggested that human disturbances may
not affect or have a weak influenced on crocodile distributions in the river (Fukuda et al.,
2008; Evans et al., 2016). In river areas near to villages or longhouses where human
disturbances and habitat degradation are considered moderate to low, crocodiles were still
found in close proximity with humans like in Igan and Belawai River in the present study.
Page 208
186
The crocodiles in the area might have tolerated with the level of disturbance and adapted
with the river conditions. In certain villages where proper garbage disposal areas are
unavailable, foods leftover or rubbish are thrown into the river and this could attract
crocodiles to come near the villages (Bernama, 2017; Hassan et al., 2018). Crocodiles have
well developed olfaction or sense of smell, hence odours from things like animal carcasses
and leftover bones that had been thrown into the river can be detected by the reptiles miles
away (Grigg & Gans, 1993). If the act of throwing garbage into the river is not stopped, it
feared that the garbage could attract crocodiles to come and stay in the areas near to the
people’s house and consequently could lead to potential risk of crocodile attacks.
Frequent migrations and on-going expansion occur within the population of C. porosus in
Sarawak as evidently shown by population genetic analyses in Chapter 5. This could explain
why their presence are detected in areas that were not known to have the reptiles before or
the crocodile were found reappear again in rivers where previously the animals had been
absent for years in the areas. Lately, riverine communities in Sarawak have rise their concern
about the matter and they hope the relevant agencies could take proper actions to prevent
conflicts with the crocodile (Hassan & Abdul-Gani, 2013). To elaborate further, in the
present study, two crocodiles were spotted in Poi River while in previous survey in 2014, no
crocodile was found in the river (Robi, 2014). Among the two crocodiles spotted in Poi
River, a hatchling was detected about 5 km upriver indicating the possibility of nesting
occurred in further reach of the tributary. Hatchling, with size less than 0.5 meter of body
length, are normally age less than six months (Webb et al., 1991) and the young crocodile
usually did not travel far from the place where it was hatched. At the young age, crocodile
hatchlings have short movement range, usually confine in waterway area near to their nest
Page 209
187
(Webb et al., 1977; Hanson et al., 2015). Female crocodiles might find secluded area like in
Poi River as suitable nesting ground, thus they frequently travel into the river.
The expansion of crocodile populations including into the new areas is most likely
influenced by a number of factors. First of all, crocodile populations in Sarawak are on the
road of recovery after severe decline in 1980’s and their densities in several rivers across
Sarawak are increasing (Tisen & Ahmad, 2010; Hassan & Abdul-Gani, 2013; Abdul-Gani,
2014; Sarawak Forestry Corporation, 2018), thus larger areas are needed to support the
growing populations. At the same time, with limited spaces and food sources found in a
particular river, crocodiles have to compete for the resources not just among themselves, but
also with other animals and human too. The dominant crocodiles, typically very large adults,
would take control of specific parts in the river that have the most abundant key resources
like aquatic foods, riverbank spaces for basking and ambushing terrestrial animal. Other
smaller adult crocodiles, on the other hand, would not be able to access the areas guarded by
the dominant crocodiles, therefore they had to forage into new areas (Hanson et al., 2015).
Successful conservation programs supported by the law protecting the crocodiles in Sarawak
may have resulting low fatality among young crocodiles, hence more crocodiles survive into
adulthood (Fukuda et al., 2014). The increasing number of young adult crocodiles could
contribute to the expanding population as what have been mentioned before, this group of
cohorts are the ones that travel long distances and foraging wider areas.
Human could be one of the contributing factors in the migration of crocodile. Sarawak is a
fast developing state in Malaysia, thus developments are rapid across the state. The
developments are influenced by the increasing number of human populations in Sarawak.
Page 210
188
The population of Sarawak is estimated to be around 1.72 million in 1991 with population
density of 14 persons/km2 then increased to 2.07 million in 2000, and the population rose to
2.47 million in 2010 with density of 20 persons/km2 (Department of Statistics Malaysia,
2017). With the average annual population growth rates in Sarawak are around 0.8% to 1.4%
from 2014 to 2017, it is expected that the population of people in Sarawak will reach 3
million by the year 2020. The surge of population in Sarawak can be seen in major cities and
towns throughout Sarawak as developments on those areas would attract more people to
come and stay in the urban areas.
Developing towns in Sarawak like Sarikei, Kanowit and Kapit are situated in area close to
rivers, thus land use for developments are expanding towards the riverbank. To support the
growing human population area, more residentials areas are built as well as business and
industrial buildings, leading to more riverbanks being cleared to give ways for the
development. In addition, demands for food sources are also increase, hence more
agriculture lands are opened near to the rivers and fishing activities are booming along the
waterway. As the center of economic activities for the surrounding area, the towns will
become hub for transportations and as the town situated next to a river, water transportation
is still a popular choice among the locals to travel and transport the goods.
These human activities and riverbank developments would affect the habitat and nesting
ground of the crocodiles and also change the ecology of the river, resulting less space area
habitable for crocodile and food sources are also becoming limited (Fukuda et al., 2008;
Shaney et al., 2017). Loud noise from activities in the city and high boat traffic in the river
could also affect the behavior of the crocodile in the river as the crocodile might have
Page 211
189
experience bad situation like collision with boat or sound from the city or boat engine
disturbs their feeding or basking activity (Grant & Lewis, 2010). Booming fishing activities
are not just depleting the food abundance for the crocodile, it could also have influence on
crocodile behavior in the river as the animal could have been injured or trap into net or hooks
that were setup by the fishermen. The changing in ecology of the river and all the
anthropogenic disturbance faced by the crocodiles are making harder for them to live in the
area, forcing them to migrate into new areas.
6.1 Management Implication
Managing crocodiles in Sarawak is a big challenge for the local authority. Sarawak has a
very vast area of waterways (about 124,449.51 km2), comprising 22 major rivers that stretch
from centre of Borneo into the sea, with plenty of tributaries, mangroves areas and peat
swamps which are associated to the major rivers and also a number of nature-form
waterholes such as Logan Bunut (Tisen & Ahmad, 2010). Therefore, monitoring crocodiles
in every corner of the waterways would be hard as it will cost a lot of money and manpower
as well as time consuming.
Since the time when the law was introduced to protect the crocodile in 1990’s, crocodile
management in Sarawak focused on conservation of the animal and efforts to recover the
wild population of the crocodiles. After almost three decades, the crocodile populations in
Sarawak are recovering and several rivers show increasing trend in density of the reptiles
(Tisen & Ahmad, 2010; Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Sarawak Forestry
Page 212
190
Corporation, 2018). However, recovering population of wild crocodile in Sarawak has led
to rising conflicts between human and crocodile (HCC). Now, crocodile management needs
to find solutions that can help in mitigating HCC in the state and at the same time continue
with the efforts for conservation of crocodile and its habitat. With the current situation in
Sarawak where crocodile populations are expanding and also increasing in conflicts between
human and crocodile, formulating plans and making decision for crocodile management that
create a ‘win-win’ situation for both human and crocodile will not be an easy task. Hasty
decision made without proper studies and insufficient information known about the crocodile
are fear to have adverse effect on the crocodile population. Hence, information collected in
the present study could be useful in many ways to help the authority to manage the crocodiles
in Sarawak.
The data about crocodile’s population and habitat in Rajang RB collected in the present study
could provide clues about crocodile’s population in the rest of the river basins in Sarawak.
Rajang River is the longest river in Sarawak and from the present study, a variety of river
habitat that supports crocodile population from lower into upper region of the river were
documented. Similar habitats can be found in other river basins, therefore the data can be
used as reference to predict the dispersion and abundance of crocodile in other river basins.
The data also suggest the possibility of crocodile expansion that could reach the fresh water
sections hundreds of kilometers away from the estuary. The crocodile management agencies
can make early preparation if there are reports of crocodile sighting in freshwater section in
upriver and to warn not just the community in that area but also communities who live further
upstream about the potential risk of attack. Constant reminder and reliable information from
Page 213
191
the crocodile management agencies could also help communities to take further precaution
when using the river.
The removal of problematic or potentially threat crocodile from human populated area is
among the quickest options to mitigate HCC. This can be done through translocating the
animal into other places or through culling. In Sarawak, crocodiles culling and translocation
has been started even since the animal population started to make a comeback in 1990’s. At
that time, the removal activities, mostly culling, were carried out only when there were
crocodile attacks occurred and it involved the area or river where the attack occurred only
(Ritchie & Jong, 2002). However, in 2012, public sentiment on crocodile has reached boiling
point as series of attacks across Sarawak claimed human life and the number of attacks
reported increasing from previous year thus as the response, state-wide culling and
translocating of crocodiles were conducted across the state (Tisen et al., 2013).
From 2013 to 2017, there are at least 101 operations to remove problematic crocodiles from
human populated area were conducted by Swift Wildlife Action Team (SWAT) of SFC
throughout Sarawak (Sarawak Forestry Corporation, Unpublished data). In the operations,
about 46 crocodiles were killed (some were found dead in the traps) while another 47
crocodiles were captured alive and transferred into nearest holding facilities (eg: Matang
Wildlife Centre, Benaya Crocodile Farm) or wildlife sanctuaries / national parks (eg:
Similajau National Park). Most of the operations were conducted as a response to the
crocodile attacks incidents or reports by local peoples that concerned about their safety.
During the operations, the SWAT team only targeted crocodile that possess danger to the
human (size above 2.1m) and the team was using traps to captured or if needed, they will
Page 214
192
kill the crocodile by shooting (Sarawak Forestry Corporation, 2018). The carcass of
crocodile that had been killed during the operation were buried in strategic locations.
Culling and translocating of crocodiles from rivers might not fully effective in handling
problematic crocodiles in Sarawak and it could only act as temporary measures, mostly to
ease public anger and political demands. The removal programs can be very expensive and
time-consumptive, while in the long run it would not solve the problem as crocodiles are
elusive animals (Fukuda et al., 2014). In addition, homing instinct and the ability of crocodile
to travel long distance might become problems to the management as removal of the
crocodile from a river could end up fill by other crocodile or the translocated crocodile could
find way to return back to the particular river (Campbell et al., 2010; Campbell et al., 2013).
The removal activities could also give rise to some other issues including issues related to
ethical value and conservation.
However, despite all the reasoning, the culling and translocating of crocodile could help in
the management of the animal and the same time mitigate HCC especially with the current
state of recovery population in Sarawak. More systematic and efficient plans on conducting
culling and translocation activities can be formulated with the support of scientific data from
researches. For instance, data on crocodile attack collected in the present study could be used
to narrow down areas that have high records of attacks or areas that have potential risk of
HCC problems, includes area with a high population of residents; recreational areas or
resorts that organise water activities like bathing, boating and jet-skiing; schools, clinics and
places of worship. Crocodile monitoring need to focus on those areas and if crocodile pose
threats to human, the animals need to be removed.
Page 215
193
In the present study, an adult crocodile with size more than 2 m has been detected in area
close to a village in Igan and Belawai River, while a sub-adult, size 1.5 m to 2 m were spotted
approximately less 1 km distance from a school in Poi River. The presence of adult
crocodiles potentially possess a risk of attack to the community that live in that area
especially young children as the adult crocodiles are aggressive and they are perpetrator for
most of attacks (Caldicott et al., 2005; Fukuda et al., 2014; Fukuda et al., 2015). Therefore,
the adult crocodile should be removed from those areas before any attacks occur. ‘Crocodile
Removal Zones (CRZ)’ had been introduced by the crocodile management in Sarawak at
major population centres like Kuching City, Miri City, Sibu, Bintulu, Sri Aman, Limbang,
Niah and popular recreation areas such as Pasir Panjang, Damai Beach, Siar Beach, Wind
Cave. The presence of crocodiles in these areas will not be tolerated and will be culled or
captured and removed (Sarawak Forestry Corporation, 2018).
Among concerns when carrying out the removal programs are the translocated animal could
not adapt to the new environment due to distinctive habitat, social awkwardness and
inbreeding depression (Fukuda et al., 2014). This can be minimized through information
provided through researches as the data from studies can be used to decide the areas that best
suit for the translocated crocodile. The data could also be used as reference when deciding
areas that can be act as sanctuary for the crocodile, so that any nuisance crocodile can be
transferred into there. A total of 10 totally protected areas (TPAs) exists in Sarawak, where
crocodiles are found in the area, therefore these areas could be good sanctuaries for the
crocodiles. Crocodile habitats are well preserved in those areas, thus can help with the
conservation of the animal. Pulau Seduku, an island in Batang Lupar is being proposed as a
totally protected areas dedicated to the conservation of crocodiles (Tisen et al., 2013). State-
Page 216
194
wide culling and translocating of crocodiles that had been carried out in Sarawak since 2012
(Tisen et al., 2013) seems to have a minimal effect on genetic structure of C. porosus
populations in the state as there is no indications of population fragmentation occurred within
the C. porosus populations of Sarawak based on genetic data (Chapter 5).
In 2016, C. porosus in Malaysia was successfully transferred from Appendix I to Appendix
II, with wild harvest restricted to the state of Sarawak and a zero quota for wild specimens
for the other states of Malaysia (Sabah and Peninsular Malaysia) (Sarawak Forestry
Corporation, 2018). The purpose of transferring C. porosus to CITES Appendix II is to
enable the sustainable utilization of the wild population in Sarawak. The authority in
Sarawak has seen potential in utilizing crocodiles to generate incomes for local communities
and also for the state government in general, and at the same could help in reducing HCC
problems. With the current status of C. porosus in CITES Appendix II, local communities
could be able to involved in the harvesting of wild C. pososus and its eggs, crocodile’s
farming and ranching and also international and domestic trade. As C. porosus is a protected
species under state’s law, every individual or company who are interested in harvesting wild
crocodiles and their eggs need to acquire licence from the authority (Sarawak Forestry
Corporation, 2018).
Allowing harvesting of wild crocodiles in Sarawak would have pros and contras and it
potentially have positive and negative impacts towards the population in the state.
Conservationists feared that allowing harvesting would lead to the history of
overexploitation of crocodiles in Sarawak will repeat and it will cause extinction of the wild
crocodiles. The crocodile management in Sarawak need to take lessons from the past where
Page 217
195
the crocodile population in the wild once in the brink of extinction due to uncontrolled
hunting and over harvesting (Cox & Gombek, 1985) to formulate a master plan for
sustainable harvesting. On the genetic level, harvesting will reduce genetic variation in
crocodile population as when a number of crocodiles were taken out from the population,
the rest will have small circle of mating companion. Low genetic variation at low population
size may lead to inbreeding depression that could cause reduction in survival and
reproductive output and thus increase the probability of extinction (Bradshaw et al., 2006).
On the bright side, harvesting would help in reducing the number of crocodiles especially in
rivers that have high density of crocodiles. Large crocodiles that pose risk to local people
are typically targeted by hunters as it can be sold at a good price, thus this could ease the
burden of works for crocodile management team. Harvesting of large adult crocodiles could
also benefit smaller crocodiles particularly young adults as this will give them higher chance
of survival in area that previously dominated by the large crocodile (Bradshaw et al., 2006).
The most important advantage of harvesting of crocodile is that it could potentially reduce
HCC in Sarawak as the number of large crocodiles in the river will be decreased (Webb,
2008).
In the surveys by Sarawak Forestry Corporation (2018), it the estimated that the population
of C. porosus in Sarawak are around 13,507 (non-hatchling). Corrections for visibility bias
or correction factor adapted from Baylis (1987) was used in calculating the population
estimation from the relative density. According to Bayliss (1987), correction factor varies
between different size of crocodile due to the behaviour and wariness. The correction of
Page 218
196
visibility biases might also be increase in different habitats or river width (Fukuda et al.,
2011). Therefore, there is possibility that the population estimation is underestimated.
A quota of no more than 500 non-hatchlings and less than 2,500 eggs per year has been
proposed by the Sarawak state for the first three years of the harvesting program (Sarawak
Forestry Corporation, 2018). The annual harvest quota only takes less than 5% from 13,507
individuals of non-hatchling that has been estimated to exist in the rivers in Sarawak and it
is considered to have a high probability of being sustainable. After three years, surveys will
be conducted to assess the impact of the harvesting programmes and harvest rates will then
be adjusted up or down, based on the results. Relatively small off take of crocodiles from
the population could have minimum negative impact on the genetic diversity of the
population especially if the harvest programmes is likely to spread among several major
rivers in Sarawak (Bradshaw et al., 2006). Genetic data in the present study (Chapter 5) also
show relatively high genetic variation within population, hence chance for high reduction of
genetic diversity in crocodile population in Sarawak as the result of the propose quota of
harvesting is probably small.
The people in Sarawak has been long living in fear of crocodiles as many had become the
victims of crocodile attacks. Because of this, crocodile has been viewed negatively by the
local people, thinking that crocodiles are as animals that can only bring troubles, thus need
to be killed (Hassan & Abdul-Gani, 2013). Managing crocodile for conservations would be
not an easy task if the efforts are not supported by the people. Throughout the history people
have never conserved anything that they did not value positively (Webb, 2008), therefore it
is essential to change the negative perspective of people towards crocodile through
Page 219
197
awareness programmes. Local people need to know about the benefits of conservation of
crocodile and its habitat by explaining to them the important roles of crocodiles in
environment, socio-economy and cultures.
Potential contribution of crocodiles towards local economy through harvesting and
ecotourism activities, like what have been done in Australia (Ryan, 1998; Corey et al., 2018),
can be introduced to the people of Sarawak as this kind of benefits would attract more people
to involve in conservation efforts. The information on historical exploitation of crocodile
collected in the present study (Chapter 3) could be used in explaining to the people about the
risk of extinction, once almost occur to the crocodile population in Sarawak, if the crocodile
is not been managed in a sustainable manner and no effort is done to conserve the reptile and
its habitat. People may not have particularly liked crocodiles, but when they learn about the
positive values of crocodile, neither did they like the idea of the reptile going extinct and
being lost from the river forever (Webb, 2008).
Reducing HCC in Sarawak would also help in changing negative perspective of local people
towards crocodile. Every time case of crocodile attack on human or livestock reported in the
news, it will rise fear among the community and at the same time people will be mad at the
crocodile and will continue to consider it as a pest. The data collected in the present study
will become in handy, help in the assessing risk of crocodile attacks so that actions can be
taken to prevent more attacks occurred in Sarawak (Pooley, 2015). For instance, crocodile
attacks data especially for the last 20 years (Chapter 3) could be used as a reference to
identify ‘hotspot’ rivers or locations. The Lupar river, Saribas, Samarahan, Sarawak River
and Sadong are among the top five river basins that have high number of crocodile attacks
Page 220
198
from 2000 until 2017, therefore, awareness programmes need to be focused to the riverine
communities in these river basins. The awareness programmes are including educational
talks, information sharing and exhibitions, not just related to crocodile but also about the
importance of keeping the river clean for benefit of wildlife as well as human being. In
addition, placing warning signboard in strategic areas along the river is among the effective
way to remind locals and outsiders about the potential risk of crocodile attack.
Relevant agencies who are conducting awareness programmes could use the data and
findings in the present study to share with the locals about when crocodile attacks were
mostly happened and could be used to remind them to take extra precaution when using river
at the particular time. As an example, majority of the attacks occurred from evening to
midnight (Chapter 3, Figure 3.8), therefore, those who are commonly use river for bathing
or other activities at this time need to be extra careful. Furthermore, crocodile attacks were
also high in the months of March and April, during the Northeast monsoon and at the time
of high tide. The awareness programmes need to be focused on specific group of people
especially those who are utilizing river as a source of income and food such as fishermen,
crab collectors and others as they are vulnerable to crocodile attacks. Meanwhile, several
attacks involving workers in the plantation areas need serious attention by relevant agencies.
The awareness programmes should engage the plantation workers too and the authority
concern can advise plantations owners to provide proper bathing and toilet facilities for their
workers so that they will minimize using river for daily chores.
From the attacks data (Chapter 3), it is realized that high percentage of crocodile attacks
occurred when victims are in the water or at the riverbank, doing activities like bathing,
Page 221
199
washing clothes or tools and fishing. These activities pose the highest risks of attack in
Sarawak, hence people need to be reminded about the risk when doing the mentioned
activities in the rivers so that they will more alert with their surrounding. In hotspot areas,
community can be advised to minimize activities in the rivers or build fences (or enclosures)
in the water around places where they normally carry out the activities or landing stages to
prevent crocodile to come near to them when using the water body.
In Sri Lanka, the crocodile exclusion enclosures or locally known as ‘kimbula kotuwa’ are
made of thick palm or hard wood poles driven into the river bed, with each end of the
enclosure meeting the river bank (Stevenson et al., 2014). These traditional enclosures
typically built by local villagers to prevent crocodiles from entering the river area where the
people are using water for daily chores like bathing and washing tools. With the support
from the Sri Lanka government and public sectors, more solid and safer enclosures are
constructed using metal and wire to replace the traditional enclosures. The enclosures had
successfully lowered the risk of crocodile attack in Sri Lanka as there was no attacks reported
in area that have the facilities (Stevenson et al., 2014). The similar enclosures could also be
used in Sarawak especially in areas with high density of crocodiles and areas where peoples
are still using river for water sources. Local authority and public sectors also can contribute
by funding the construction of the enclosures, while the villagers can work together in
maintaining the enclosures if there is any damage and ensuring the enclosure free from river
debris.
Concerning behaviour of the large crocodiles wandering in the area near to the local people
houses, scavenging food leftover and rubbish that had been thrown into the river as in Igan
Page 222
200
River in the present study, has to be taken seriously by the community and the local authority.
This situation possesses risk of crocodile attacks toward the people who live in the area, thus
actions need to be taken to prevent any loss of life. Awareness programmes should
emphasize on the importance of proper waste disposal, while the local authority could
provide garbage collecting services for the community. The crocodile distribution data in the
present study could also be used to explain to the local community about the potential risk
of crocodile attacks if they do not stop throwing garbage into the rivers.
All cases of crocodile attacks involving children below 10 years old were resulting death to
the victims (Chapter 3, Figure 3.11). This showed how much vulnerable this age group when
they were attacked by the crocodile. Children usually unaware about the danger they will
face when they come near to the water body and also when they were attacked by the
crocodile, they are powerless to escape from even with a small crocodile (Fukuda et al.,
2015). Therefore, awareness programmes can be used to remind communities about the
importance of monitoring their children carefully and keep them away from waterways,
especially from river that are known to have crocodiles in it. Starting from 2012, awareness
campaigns called “3M Buaya” aiming to educate children on crocodiles had been carried out
by SFC. 3M stands for “Mengenali, Memahami and Memulihara” which means to Know,
Understand and Conserve while Buaya is the Malay word for crocodile (Tisen et al., 2013).
“3M Buaya” programs now had been expanded state-wide with the involvement of more
target groups and other relevance agencies such as Resident and District Offices, Police, Fire
and Rescue Department and Civil Defence. Although attacks still happen to children, it
shows some improvement in the number of attacks and severity of the attacks.
Page 223
201
CHAPTER 7
CONCLUSION AND RECOMMENDATIONS
In general, this study implies that the human-crocodile conflicts in Sarawak are influenced
by a number of factors, among them are the distribution of crocodiles in wide range of
habitats and the increasing crocodile populations. Analysing crocodile attacks data from
1900 until 2017 had provided essential information that can help in understanding the
patterns of HCC as well as distribution of crocodiles throughout the river basins in Sarawak.
From the data, it was noted that the trend of crocodile attacks on human in the Sarawak was
associated with the exploitation trend and recovery of the crocodiles in the state.
Furthermore, HCC had occurred in 22 river basins in Sarawak, thus this mean that the animal
has been populated all river basins throughout the state. The present study showed that the
C. porosus was distributed along the lower, middle and upper region of Rajang River Basin
suggesting that crocodiles in Sarawak can live in a wide range of habitat, from the large tidal
rivers in coastal area to the small non-tidal freshwater tributaries in the upper side of river
basin. Variation in the water quality, river habitats, riverbank developments and the
abundance of food influenced the density of crocodiles in the eight studied rivers in Rajang
River Basin. DNA microsatellite successfully infer the relationship among C. porosus in
Sarawak as five distintive clades based on the geographical areas (river basins), which can
be seen in the phylogenetic trees and Network. Furthermore, there is gene flow among the
five populations indicating frequent migrations occurs between the populations of C.
porosus in Sarawak. Populations of C. porosus in Sarawak are generally experiencing
expansion as support by the mismatch distribution and evolutionary neutrality test data,
suggesting that populations of crocodile in Sarawak are panmictic population.
Page 224
202
More research data are required to provide information for the authority to solve problems
related to crocodile in Sarawak and also in assisting the management of crocodile in the
state. Areas that can be further improved or study are;
1. Monitoring surveys need to be carried out regularly to determine the current
population status and distribution of crocodiles in Sarawak, e.g., survey in every year
for high HCC areas or major tributaries that recorded high crocodile density in
previous surveys or once in every two to three years for large rivers.
2. There is also a need to have a comprehensive study on the size of crocodile
populations in Sarawak as well as their seasonal behaviour and movement together
with the environmental event (drought, floods) and anthropogenic intervention
(pollution, river development, land use), in which affect the distribution of crocodiles
in the state. Human components can also be included in the study such as human
population expansion and human activities in/near waterways.
3. More DNA samples need to be collected from C. porosus populations in different
localities (or from different river order) in Sarawak including from freshwater
sections in upper reach of the rivers to further understand the genetic structure and
expansion of C. porosus in the state.
The limitations of the data set in the present study must be considered before using the
information. Human-crocodile conflicts (HCC) data used in the present study were based on
the reports of attacks collected from the available sources. Thus, there is a possibility that
some cases had not been reported to the authority. There were also limited available sources
related to crocodile attacks incidents within the period from 1946 to 1999. Cases of crocodile
Page 225
203
attack during that period of time could be higher than what had been collected in the present
study but without proper records on the matter, it would difficult to access the information.
Data on crocodile densities and distributions in eight rivers of Rajang RB had shed some
lights on the population of crocodiles in the river basin and also provides baseline
information on various aspect of the reptile which is lacking in Sarawak. However, data
collected in the present study only based on one-period survey in Southwest Monsoon season
(SWM), from the month of March to September 2017. Additional surveys including in
different season (Northeast Monsoon, NEM) and years would provide more substantial field
data on the crocodile population for better understanding of the species ecology and
behavior.
In the genetic study, although DNA microsatellite had successfully inferred the relationship
among C. porosus from 13 areas in Sarawak, it might not depict the whole genetic structure
of the species in the state. Samples from other areas or river basins could not be collected
during the study due to time constraints. DNA samples collected from different areas or river
basin will provide more information especially on the movement and expansion of
crocodiles in Sarawak.
Page 226
204
REFERENCES
Abdul-Gani, M. I. Z. (2014). Population Density, Human-Crocodile Conflict and Genetic Variation
among Saltwater Crocodile, Crocodylus porosus in Sarawak. (Unpublished Master's thesis).
Universiti Malaysia Sarawak, Sarawak, Malaysia.
Abdullah, N. S. S. (2010). Molecular Phylogeny of Saltwater Crocodiles (Crocodylus porosus) from
Sarawak based on Combined Cyt b and 12S rRNA Gene Analysis. (Unpublished Master's
thesis). Universiti Malaysia Sarawak, Sarawak, Malaysia.
Ali, H., Adenan, R., & Wan Abu Bakar, W. I. (2014). Saltwater Crocodile (Crocodylus porosus)
Survey in Miri and Bintulu Region. Paper presented at the Borneo Crocodile Forum, Sibu,
Sarawak, Malaysia.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic Local Alignment
Search Tool. Journal of Molecular Biology, 215(3), 403-410.
Amarasinghe, A. T., Madawala, M. B., Karunarathna, D. S., Manolis, S. C., de Silva, A., &
Sommerlad, R. (2015). Human-Crocodile Conflict and Conservation Implications of
Saltwater Crocodiles Crocodylus porosus (Reptilia: Crocodylia: Crocodylidae) in Sri Lanka.
Journal of Threatened Taxa, 7(5), 7111-7130.
Ardiantiono, A., Sheherazade, Karta Atmadja, R., & Wardhani, A. (2015). Analisis Serangan Buaya
Muara (Crocodylus porosus) di Indonesia melalui eksplorasi Database CrocBITE
Berbasiskan Citizen Science (An Analysis of Saltwater Crocodile (Crocodylus porosus)
Attack in Indonesia using Citizen Science CrocBITE Database Exploration). Inovasi Online,
24(3), 8-16.
Axelsson, M., & Franklin, C. E. (2011). Elucidating the Responses and Role of the Cardiovascular
System in Crocodilians during Diving: Fifty Years on from the Work of C.G. Wilber.
Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology,
160(1), 1-8.
Page 227
205
Azreen, A. (2015). Assessment of Saltwater Crocodiles along Bako River during Three Monsoon
Seasons. (Unpublished Final Year Project Report). Universiti Malaysia Sarawak, Sarawak,
Malaysia.
Balaguera-Reina, S. A., Espinosa-Blanco, A. S., Morales-Betancourt, M. A., Seijas, A. E., Lasso, C.
A., Antelo, R., & Densmore, L. D. (2017). Conservation Status and Regional Habitat
Priorities for the Orinoco Crocodile: Past, Present, and Future. PLOS ONE, 12(2), 1-20.
Bandelt, H. J., Forster, P., & Röhl, A. (1999). Median-Joining Networks for Inferring Intraspecific
Phylogenies. Molecular Biology and Evolution, 16(1), 37-48.
Barbour, M. T., Gerritsen, J., Griffith, G. E., Frydenborg, R., McCarron, E., White, J. S., & Bastian,
M. L. (1996). A Framework for Biological Criteria for Florida Streams Using Benthic
Macroinvertebrates. Journal of the North American Benthological Society, 15(2), 185-211.
Baring-Gould, S., & Bampfylde, C. A. (1909). A History of Sarawak under its Two White Rajahs,
1839-1908. London: H. Sotheran & Company.
Bartlett, E. (1895). The Crocodiles and Lizards of Borneo in the Sarawak Museum, with Descriptions
of Supposed New Species and the Variation of Colours in the Several Species during Life.
Journal of the Straits Branch of the Royal Asiatic Society, 28, 73-97.
Bashyal, A., Gross, B., Venegas-Anaya, M., Lowrance, F., & Densmore, L. (2014). Assessment of
Microsatellites in Estimating Inter-and Intraspecific Variation among Neotropical
Crocodylus Species. Genetics and Molecular Research, 13(3), 5492-5502.
Bayliss, P. (1987). Survey Methods and Monitoring within Crocodile Management Programmes. In
G. J. W. Webb, C. Manolis & P. J. Whitehead (Eds.), Wildlife Management: Crocodiles and
Alligators (pp. 157-175). Sydney: Surrey Beatty & Son and The Conservation Commission
of The Northern Territory.
Beccari, O. (1904). Wanderings in The Great Forests of Borneo: Travels and Researches of A
Naturalist in Sarawak. London: Archibald Constabale & Co Ltd.
Page 228
206
Bernama. (2017, April 3). SWAT Team Handles Rogue Crocs in Sarawak. New Straits Time.
Retrieved from https://www.nst.com.my/news/2017/04/226826/swat-team-handles-rogue-
crocs-sarawak.
Bolhen, H. (2017). Composition of Fish Fauna and Fishieries at Pelagus Area, Batang Rajang,
Sarawak. (Unpublished Master's thesis). Universiti Malaysia Sarawak, Sarawak, Malaysia.
Bradshaw, C. J. A., Fukuda, Y., Letnic, M., & Brook, B. W. (2006). Incorporating Known Sources
of Uncertainty to Determine Precautionary Harvests of Saltwater Crocodiles. Ecological
Applications, 16(4), 1436-1448.
Brazaitis, P. (1969). The Occurrence and Ingestion of Gastroliths in Two Captive Crocodilians.
Herpetoligica, 25, 63-64.
Brazaitis, P., & Watanabe, M. E. (2011). Crocodilian Behaviour: A Window to Dinosaur Behaviour?
Historical Biology, 23(1), 73-90.
Brien, M. L., Gienger, C. M., Browne, C. A., Read, M. A., Joyce, M. J., & Sullivan, S. (2017).
Patterns of Human–Crocodile Conflict in Queensland: A Review of Historical Estuarine
Crocodile (Crocodylus porosus) Management. Wildlife Research, 44(4), 281-290.
Brooke, M. (1913). My Life in Sarawak, by The Ranee of Sarawak. London: Methuen & Co. Ltd.
Caldicott, D. G. E., Croser, D., Manolis, C., Webb, G., & Britton, A. (2005). Crocodile Attack in
Australia: An Analysis of Its Incidence and Review of the Pathology and Management of
Crocodilian Attacks in General. Wilderness & Environmental Medicine, 16(3), 143-159.
Campbell, H. A., Watts, M. E., Sullivan, S., Read, M. A., Choukroun, S., Irwin, S. R., & Franklin,
C. E. (2010). Estuarine Crocodiles Ride Surface Currents to Facilitate Long-distance Travel.
Journal of Animal Ecology, 79(5), 955-964.
Campbell, H. A., Dwyer, R. G., Irwin, T. R., & Franklin, C. E. (2013). Home Range Utilisation and
Long-Range Movement of Estuarine Crocodiles during the Breeding and Nesting Season.
PLOS ONE, 8(5), 1-9.
Page 229
207
Campbell, H. A., Dwyer, R. G., Wilson, H., Irwin, T. R., & Franklin, C. E. (2015). Predicting the
Probability of Large Carnivore Occurrence: A Strategy to Promote Crocodile and Human
Coexistence. Animal Conservation, 18(4), 387-395.
CITES. (2018). Appendices I, II and III. Retrieved 22 March 2018, from
https://www.cites.org/eng/app/appendices.php.
Cooper-Preston, H., & Jenkins, R. W. G. (1993). Natural History of The Crocodylia. In C. G. Glasby,
J. Ross & P. L. Beesley (Eds.), Fauna of Australia Vol 2A: Amphibia and Reptilia (pp. 1-
15). Canberra: Australian Government Publishing Service.
Corey, B., Webb, G. J. W., Manolis, S. C., Fordham, A., Austin, B. J., Fukuda, Y., . . . Saalfeld, K.
(2018). Commercial Harvests of Saltwater Crocodile Crocodylus porosus Eggs by
Indigenous People in Northern Australia: Lessons for Long-term Viability and Management.
Oryx, 52(4), 697-708.
Cox, J. H., & Gombek, F. (1985). A preliminary survey of the crocodile resources in Sarawak, East
Malaysia. Kuala Lumpur: World Wildlife Fund (WWF) Malaysia.
Cozzi, G., Broekhuis, F., McNutt, J. W., Turnbull, L. A., Macdonald, D. W., & Schmid, B. (2012).
Fear of the Dark or Dinner by Moonlight? Reduced Temporal Partitioning among Africa's
Large Carnivores. Ecology, 93(12), 2590-2599.
Cramp, R. L., Meyer, E. A., Sparks, N., & Franklin, C. E. (2008). Functional and Morphological
Plasticity of Crocodile (Crocodylus porosus) Salt Glands. Journal of Experimental Biology,
211(9), 1482-1489.
Das, C. S., & Jana, R. (2018). Human–Crocodile Conflict in the Indian Sundarban: An Analysis of
Spatio-Temporal Incidences in Relation to People's Livelihood. Oryx, 52(4), 661-668.
Das, I. (2004). Collecting in the “Land below the Wind”, Herpetological Explorations of Borneo.
Bonner Zoologische Beiträge, 52(3/4), 231-243.
Datan, I., Stephen, C., & Nicholas, D. (2012). Earthen Crocodile Effigies (Buaya Tanah) of the Iban
of Sarawak: A Preliminary Study. Sarawak Museum Journal (New Series), LXX(9), 145-160.
Page 230
208
De Silva, A. (2013). The Crocodiles of Sri Lanka (Including Archeology, History, Folklore,
Traditional Medicine, Human-Crocodile Conflicts and a Bibliography of the Literature on
Crocodiles of Sri Lanka). Gampola: De Silva, Anslem.
Department of Statistics Malaysia. (2017). Statistic Yearbook of Sarawak 2016. Jabatan Perangkaan
Malaysia, Negeri Sarawak. Retrieved from https://newss.statistics.gov.my/newss-
portalx/ep/epDownloadContentSearch.seam?cid=131467.
Dolphin, K., Belshaw, R., Orme, C. D. L., & Quicke, D. L. J. (2000). Noise and Incongruence:
Interpreting Results of the Incongruence Length Difference Test. Molecular Phylogenetics
and Evolution, 17(3), 401-406.
Doyle, J. J., & Doyle, J. L. (1987). A Rapid DNA Isolation Procedure for Small Quantities of Fresh
Leaf Tissue. Phytochemical Bulletin, 19, 11-15.
Dunham, K. M., Ghiurghi, A., Cumbi, R., & Urbano, F. (2010). Human–wildlife Conflict in
Mozambique: A National Perspective, with Emphasis on Wildlife Attacks on Humans. Oryx,
44(2), 185-193.
Ellegren, H. (2004). Microsatellites: Simple Sequences with Complex Evolution. Nature Reviews
Genetics, 5, 435-445.
Elsey, R., Tracy, C. R., Lance, V., & Manolis, C. (2008). Collecting Blood from Crocodilians.
Crocodile Specialist Group Newsletter, 21(1), 21-22.
Emerling, C. A. (2017). Archelosaurian Color Vision, Parietal Eye Loss, and the Crocodylian
Nocturnal Bottleneck. Molecular Biology and Evolution, 34(3), 666-676.
Erickson, G. M., Gignac, P. M., Steppan, S. J., Lappin, A. K., Vliet, K. A., Brueggen, J. D., . . .
Webb, G. J. W. (2012). Insights into the Ecology and Evolutionary Success of Crocodilians
Revealed through Bite-force and Tooth-pressure Experimentation. PLOS ONE, 7(3), 1-12.
Evans, L. J., Jones, T. H., Pang, K., Saimin, S., & Goossens, B. (2016). Spatial Ecology of Estuarine
Crocodile (Crocodylus porosus) Nesting in a Fragmented Landscape. Sensors (Switzerland),
16(9), 1-10.
Page 231
209
Evans, L. J., Davies, A. B., Goossens, B., & Asner, G. P. (2017). Riparian Vegetation Structure and
the Hunting Behavior of Adult Estuarine Crocodiles. PLOS ONE, 12(10), 1-12.
Excoffier, L. (2004). Patterns of DNA Sequence Diversity and Genetic Structure after a Range
Expansion: Lessons from the Infinite-island Model. Molecular Ecology, 13(4), 853-864.
Excoffier, L., & Lischer, H. E. L. (2010). Arlequin Suite Ver 3.5: A New Series of Programs to
Perform Population Genetics Analyses under Linux and Windows. Molecular Ecology
Resources, 10(3), 564-567.
Farris, J. S., Källersjö, M., Kluge, A. G., & Bult, C. (1994). Testing Significance of Incongruence.
Cladistics, 10(3), 315-319.
Fu, Y.-X. (1997). Statistical Tests of Neutrality of Mutations Against Population Growth,
Hitchhiking and Background Selection. Genetics, 147(2), 915-925.
Fukuda, Y., Whitehead, P., & Boggs, G. (2008). Broad-scale Environmental Influences on the
Abundance of Saltwater Crocodiles (Crocodylus porosus) in Australia. Wildlife Research,
35(2), 167-176.
Fukuda, Y., Webb, G., Manolis, C., Delaney, R., Letnic, M., Lindner, G., & Whitehead, P. (2011).
Recovery of Saltwater Crocodiles Following Unregulated Hunting in Tidal Rivers of the
Northern Territory, Australia. The Journal of Wildlife Management, 75(6), 1253-1266.
Fukuda, Y., & Cuff, N. (2013). Vegetation Communities as Nesting Habitat for the Saltwater
Crocodiles in the Northern Territory of Australia. Herpetological Conservation and Biology,
8(3), 641-651.
Fukuda, Y., Saalfeld, K., Webb, G., Manolis, C., & Risk, R. (2013a). Standardised Method of
Spotlight Surveys for Crocodiles in the Tidal Rivers of the Northern Territory, Australia.
Northern Territory Naturalist, 24(1), 14-32.
Fukuda, Y., Saalfeld, K., Lindner, G., & Nichols, T. (2013b). Estimation of Total Length from Head
Length of Saltwater Crocodiles (Crocodylus porosus) in the Northern Territory, Australia.
Journal of Herpetology, 47(1), 34-40.
Page 232
210
Fukuda, Y., Manolis, C., & Appel, K. (2014). Management of Human-Crocodile Conflict in the
Northern Territory, Australia: Review of Crocodile Attacks and Removal of Problem
Crocodiles. The Journal of Wildlife Management, 78(7), 1239-1249.
Fukuda, Y., & Saalfeld, K. (2014). Abundance of Saltwater Crocodile Hatchlings is Related to
Rainfall in the Preceding Wet Season in Northern Australia. Herpetologica, 70(4), 439-448.
Fukuda, Y., Manolis, C., Saalfeld, K., & Zuur, A. (2015). Dead or Alive? Factors Affecting the
Survival of Victims during Attacks by Saltwater Crocodiles (Crocodylus porosus) in
Australia. PLOS ONE, 10(5), 1-12.
Gehring, P.-S., Pabijan, M., Randrianirina, J. E., Glaw, F., & Vences, M. (2012). The Influence of
Riverine Barriers on Phylogeographic Patterns of Malagasy Reed Frogs (Heterixalus).
Molecular Phylogenetics and Evolution, 64(3), 618-632.
Grant, P. B., & Lewis, T. R. (2010). High Speed Boat Traffic: A risk to Crocodilian Populations.
Herpetological Conservation and Biology, 5(3), 456-460.
Gratten, J. (2003). The Molecular Systematics, Phylogeography and Population Genetics of Indo-
Pacific Crocodylus. (Unpublished Doctoral dissertation). University of Queensland,
Australia.
Grigg, G. C., & Gans, C. (1993). Morphology and Physiology of the Crocodylia. In C. G. Glasby, J.
Ross & P. L. Beesley (Eds.), Fauna of Australia Vol 2A: Amphibia and Reptilia (pp. 326-
336). Canberra: Australian Government Publishing Service.
Grigg, G. C., & Seebacher, F. (2000). Crocodilian Thermal Relations. In G. C. Grigg, F. Seebacher
& C. E. Franklin (Eds.), Crocodilian Biology and Evolution (pp. 297-309). Sydney: Surrey
Beatty and Sons Pty Ltd.
Gunn, J., Hawkins, D., Barnes, R. F. W., Mofulu, F., Grant, R. A., & Norton, G. W. (2014). The
Influence of Lunar Cycles on Crop-raiding Elephants; Evidence for Risk Avoidance. African
Journal of Ecology, 52(2), 129-137.
Page 233
211
Hanson, J. O., Salisbury, S. W., Campbell, H. A., Dwyer, R. G., Jardine, T. D., & Franklin, C. E.
(2015). Feeding Across the Food Web: The Interaction between Diet, Movement and Body
Size in Estuarine Crocodiles (Crocodylus porosus). Austral Ecology, 40(3), 275-286.
Hassan, R., & Abdul-Gani, M. I. Z. (2013). Crocodiles in Western of Sarawak, Malaysia. Pp 90-94.
In World Crocodile Conference. Proceedings of the 22nd Working Meeting of the IUCN-SSC
Crocodile Specialist Group. Gland, Switzerland: IUCN.
Hassan, R., Ahmad, R., Md Adzhar, M. A. A., Abdul-Gani, M. I. Z., Ayob, A., & Zainudin, R.
(2016). Notes on the Wild Tomistoma Populations in Western Sarawak, Malaysian Borneo.
International Journal of Ecology, 2016, 1-7.
Hassan, R., Md Adzhar, M. A. A., Abdul-Gani, M. I. Z., & Ahmad, R. (2018). Assessment of Wild
Saltwater Crocodile Population in Bako River, Western Sarawak, Malaysian Borneo for
Potential Ecotourism Industry. Malaysian Applied Biology, 47(1), 131-138.
Hekkala, E. R., Platt, S. G., Thorbjarnarson, J. B., Rainwater, T. R., Tessler, M., Cunningham, S. W.,
. . . Amato, G. (2015). Integrating Molecular, Phenotypic and Environmental Data to
Elucidate Patterns of Crocodile Hybridization in Belize. Royal Society Open Science, 2(9),
1-15.
Hornaday, W. T. (1885). Two Years in the Jungle. The Experiences of A Hunter and Naturalist in
India, Ceylon, the Malay Peninsula and Borneo. New York: Charles Scribner’s Sons.
Hudson, R. R., Slatkin, M. & Maddison, W. P. (1992). Estimation of Levels of Gene Flow from
DNA Sequence Data. Genetics, 132, 583-589.
Huelsenbeck, J. P., & Ronquist, F. (2001). MRBAYES: Bayesian Inference of Phylogenetic Trees.
Bioinformatics, 17(8), 754-755.
Isberg, S. R., Chen, Y., Barker, S. G., & Moran, C. (2004). Analysis of Microsatellites and Parentage
Testing in Saltwater Crocodiles. Journal of Heredity, 95(5), 445-449.
Isberg, S. R., Thomson, P. C., Nicholas, F. W., Webb, G. J., Manolis, S. C., Barker, S. G., & Moran,
C. (2006). Quantitative Analysis of Production Traits in Saltwater Crocodiles (Crocodylus
Page 234
212
porosus): IV. Number of Scale Rows. Journal of Animal Breeding and Genetics, 123(1), 48-
55.
Iwata, T., Nakano, S., & Inoue, M. (2003). Impacts of past Riparian Deforestation on Stream
Communities in a Tropical Rain Forest in Borneo. Ecological Applications, 13(2), 461-473.
Jalden, D. (2004). Crocodilians and the Convention on International Trade in Endangered Species of
Wild Fauna and Flora (CITES). Pp 66-68. In Crocodiles. Proceedings of the 17th Working
Meeting of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland: IUCN.
Jet, O., Palaniappan, P. M., & Hussein, M. A. S. (2011). Population Ecology and Potential Food
Sources of The Saltwater Crocodiles in Kawang River, Sabah. Borneo Science, 28, 57-65.
Kanwatanakid-Savini, C., Pliosungnoen, M., Pattanavibool, A., Thorbjarnarson, J. B.,
Limlikhitaksorn, C., & Platt, S. G. (2012). A Survey to Determine The Conservation Status
of Siamese Crocodiles in Kaeng Krachan National Park, Thailand. Herpetological
Conservation and Biology, 7(2), 157–168.
Karlin, S., & Altschul, S. F. (1990). Methods for Assessing the Statistical Significance of Molecular
Sequence Features by using General Scoring Schemes. Proceedings of the National
Academy of Sciences, 87(6), 2264-2268.
Kasim, N. Y. (2011). Genetic Diversity of Saltwater Crocodiles (Crocodylus porosus) from Sarawak
Using Microsatellite Approach. (Unpublished Final Year Project Report). Universiti
Malaysia Sarawak, Sarawak, Malaysia.
Kaur, T. (2006). Segama River Survey. Crocodile Specialist Group Newsletter, 25(1), 14-15.
Keats, B. J. B., & Sherman, S. L. (2013). Chapter 13 - Population Genetics. In D. Rimoin, R. Pyeritz
& B. Korf (Eds.), Emery and Rimoin's Principles and Practice of Medical Genetics (pp. 1-
12). Oxford: Academic Press.
Kemmerer, E. W. (1904). A Gold Standard for Straits Settlements. Political Science Quarterly,
33(4), 636-649.
Page 235
213
Kimura, M. (1980). A Simple Method for Estimating Evolutionary Rate of Base Substitutions
through Comparative Studies of Nucleotide Sequences. Journal of Molecular Evolution, 16,
111-120.
Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis
Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33(7), 1870-1874.
Lading, E. (2013). Crocodile Attacks in Sarawak. Pp 96. In World Crocodile Conference.
Proceedings of the 22nd Working Meeting of the IUCN-SSC Crocodile Specialist Group.
Gland, Switzerland: IUCN.
Lamichhane, B. R., Persoon, G. A., Leirs, H., Poudel, S., Subedi, N., Pokheral, C. P., . . . de Iongh,
H. H. (2018). Spatio-temporal Patterns of Attacks on Human and Economic Losses from
Wildlife in Chitwan National Park, Nepal. PLOS ONE, 13(4), 1-18.
Langley, R. L. (2010). Adverse Encounters With Alligators in the United States: An Update.
Wilderness & Environmental Medicine, 21(2), 156-163.
Lapbenjakul, S., Thapana, W., Twilprawat, P., Muangmai, N., Kanchanaketu, T., Temsiripong, Y., .
. . Srikulnath, K. (2017). High Genetic Diversity and Demographic History of Captive
Siamese and Saltwater Crocodiles Suggest the First Step toward the Establishment of a
Breeding and Reintroduction Program in Thailand. PLOS ONE, 12(9), 1-21.
Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., . . .
Higgins, D. G. (2007). Clustal W and Clustal X Version 2.0. Bioinformatics, 23(21), 2947-
2948.
Letnic, M., Carmody, P., & Burke, J. (2011). Problem Crocodiles (Crocodylus porosus) in the
Freshwater, Katherine River, Northern Territory, Australia. Australian Zoologist, 35(3),
858-863.
Lewis, J. L., FitzSimmons, N. N., Jamerlan, M. L., Buchan, J. C., & Grigg, G. C. (2013). Mating
Systems and Multiple Paternity in the Estuarine Crocodile (Crocodylus porosus). Journal of
Herpetology, 47(1), 24-33.
Page 236
214
Li, Y., Wu, X., Ji, X., Yan, P., & Amato, G. (2007). The Complete Mitochondrial Genome of Salt-
water Crocodile (Crocodylus porosus) and Phylogeny of Crocodilians. Journal of Genetics
and Genomics, 34(2), 119-128.
Ling, T.-Y., Soo, C.-L., Sivalingam, J.-R., Nyanti, L., Sim, S.-F., & Grinang, J. (2016). Assessment
of the Water and Sediment Quality of Tropical Forest Streams in Upper Reaches of the Baleh
River, Sarawak, Malaysia, Subjected to Logging Activities. Journal of Chemistry, 2016, 1-
13.
Ling, T.-Y., Soo, C.-L., Phan, T.-P., Nyanti, L., Sim, S.-F., & Grinang, J. (2017). Assessment of
Water Quality of Batang Rajang at Pelagus Area, Sarawak, Malaysia. Sains Malaysiana,
46(3), 401-411.
Low, H. (1848). Sarawak: its Inhabitants and Productions: being Notes during A Residence in that
Country with HH the Rajah Brooke. London: Richard Bentley.
Luck, N. L., Thomas, K. C., Morin-Adeline, V. E., Barwick, S., Chong, A. Y., Carpenter, E. L., . . .
Gongora, J. (2012). Mitochondrial DNA Analyses of the Saltwater Crocodile (Crocodylus
porosus) from the Northern Territory of Australia. Australian Journal of Zoology, 60(1), 18-
25.
Lynch, M. & Crease, T. J. (1990). The Analysis of Population Survey Data on DNA Sequence
Variation. Molecular Biology and Evolution, 7, 377-394.
Mahyan, N. R., & Selaman, O. S. (2016). Water Supply Resources and Management Practices in
Sarawak and Other Countries. Journal of Civil Engineering, Science and Technology, 7(2),
50-56.
Maltagliati, F., Di Giuseppe, G., Barbieri, M., Castelli, A., & Dini, F. (2010). Phylogeography and
Genetic Structure of the Edible Sea Urchin Paracentrotus lividus (Echinodermata:
Echinoidea) Inferred from the Mitochondrial Cytochrome b Gene. Biological Journal of the
Linnean Society, 100(4), 910-923.
Page 237
215
Martin, S. (2008). Global Diversity of Crocodiles (Crocodilia, Reptilia) in Freshwater.
Hydrobiologia, 595(1), 587-591.
Mauger, L. A., Velez, E., Cherkiss, M. S., Brien, M. L., Mazzotti, F. J., & Spotila, J. R. (2017).
Conservation Genetics of American Crocodile, Crocodylus acutus, Populations in Pacific
Costa Rica. Nature Conservation, 17, 1-17.
Mazzotti, F. J., Brandt, L. A., Moler, P., & Cherkiss, M. S. (2007). American Crocodile (Crocodylus
Acutus) in Florida: Recommendations for Endangered Species Recovery and Ecosystem
Restoration. Journal of Herpetology, 41(1), 122-132.
Messel, H., & Vorlicek, G. C. (1986). Population Dynamics and Status of Crocodylus porosus in the
Tidal Waterways of Northern Australia. Australia Wildlife Research, 13(1), 71-111.
Miles, L. G., Isberg, S. R., Moran, C., Hagen, C., & Glenn, T. C. (2009a). 253 Novel Polymorphic
Microsatellites for the Saltwater Crocodile (Crocodylus porosus). Conservation Genetics,
10(4), 963-980.
Miles, L. G., Lance, S. L., Isberg, S. R., Moran, C., & Glenn, T. C. (2009b). Cross-species
Amplification of Microsatellites in Crocodilians: Assessment and Applications for the
Future. Conservation Genetics, 10(4), 935-954.
Mohd-Azlan, J., Zulaiha, J., Lading, E., Nuriza, A. A., & Das, I. (2016). Employing Camera Traps
for Studying Habitat Use by Crocodiles in a Mangrove Forest in Sarawak, Borneo.
Herpetological Review, 47(4), 579-583.
Montague, J. (1983). Influence of Water Level, Hunting Pressure and Habitat Type on Crocodile
Abundance in the Fly River Drainage, Papua New Guinea. Biological Conservation, 26(4),
309-339.
Moritz, C. (1999). Conservation Units and Translocations: Strategies for Conserving Evolutionary
Processes. Hereditas, 130(3), 217-228.
Munson, L. (2000). Necropsy Procedures for Wild Animals. In W. B. Karesh, M. F. McEntee, L. J.
Lowenstine, M. E. Roelke-Parker, E. Williams & M. H. Woodford (Eds.), Conservation
Page 238
216
Research in the African Rainforests: A Technical Handbook (pp. 203-224). New York:
Wildlife Conservation Society.
Nagelkerken, I., Blaber, S. J. M., Bouillon, S., Green, P., Haywood, M., Kirton, L. G., . . . Somerfield,
P. J. (2008). The Habitat Function of Mangroves for Terrestrial and Marine Fauna: A
Review. Aquatic Botany, 89(2), 155-185.
Nagloo, N., Collin, S. P., Hemmi, J. M., & Hart, N. S. (2016). Spatial Resolving Power and Spectral
Sensitivity of the Saltwater Crocodile, Crocodylus porosus, and the Freshwater Crocodile,
Crocodylus johnstoni. The Journal of Experimental Biology, 219(9), 1394-1404.
National Research Council of United State of America. (1983). Crocodiles as a Resource for the
Tropics. The National Academies Press. Retrieved from
https://www.nap.edu/catalog/18531/crocodiles-as-a-resource-for-the-tropics.
Nazli, M. F., Hashim, N. R., & Zakaria, M. (2009). Distribution, Abundance and Habitat
Conservation of Crocodylus porosus in Rembau-Linggi Estuary, Peninsular Malaysia. Pp
130-135. In Postgraduate Qolloquium First Semester 2009/2010. Selangor, Malaysia:
Universiti Putra Malaysia.
O'Shea, M., & Halliday, T. (2002). Reptiles and Amphibians. New York: Dorling Kindersley.
Official Website of Department of Irrigation and Drainage Sarawak. (2017). Sarawak Major River
Basin. Retrieved 18 May 2016, from http://www.did.sarawak.gov.my/page-0-314-315-
Resource-Centre-IRBM-22-Basins.html.
Packer, C., Swanson, A., Ikanda, D., & Kushnir, H. (2011). Fear of Darkness, the Full Moon and the
Nocturnal Ecology of African Lions. PLOS ONE, 6(7), 1-4.
Parenti, L. R., & Lim, K. K. (2005). Fishes of the Rajang Basin, Sarawak, Malaysia. Raffles Bulletin
of Zoology, 13, 175-208.
Platt, S. G., & Thorbjarnarson, J. B. (2000). Population Status and Conservation of Morelet's
Crocodile, Crocodylus moreletii, in Northern Belize. Biological Conservation, 96(1), 21-29.
Page 239
217
Pooley, S. (2014). An Historical Overview of Human Crocodile Conflict in South Africa and
Swaziland, 1949-2014. Pp 236-245. In Crocodiles. Proceedings of the 23rd Working Meeting
of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland and Cambridge, UK:
IUCN.
Pooley, S. (2015). Using Predator Attack Data to Save Lives, Human and Crocodilian. Oryx, 49(4),
581-583.
Ray, N., Currat, M., & Excoffier, L. (2003). Intra-Deme Molecular Diversity in Spatially Expanding
Populations. Molecular Biology and Evolution, 20(1), 76-86.
Read, M. A., Miller, J. D., Bell, I. P., & Felton, A. (2004). The Distribution and Abundance of the
Estuarine Crocodile, Crocodylus porosus, in Queensland. Wildlife Research, 31, 527-534.
Read, M. A., Grigg, G. C., Irwin, S. R., Shanahan, D., & Franklin, C. E. (2007). Satellite Tracking
Reveals Long Distance Coastal Travel and Homing by Translocated Estuarine Crocodiles,
Crocodylus porosus. PLOS ONE, 2(9), 1-5.
Ritchie, J., & Jong, J. (2002). Man-eating Crocodiles of Borneo. Kota Kinabalu, Sabah: Natural
History Publications (Borneo).
Robi, N. J. (2014). Estuarine Crocodile Distribution in Sibu Region, Sarawak. Paper presented at the
Borneo Crocodile Forum Sibu, Sarawak, Malaysia.
Rodgers, E. M., Schwartz, J. J., & Franklin, C. E. (2015). Diving in a Warming World: The Thermal
Sensitivity and Plasticity of Diving Performance in Juvenile Estuarine Crocodiles
(Crocodylus porosus). Conservation Physiology, 3(1), 1-9.
Rogers, A. R., & Harpending, H. (1992). Population Growth Makes Waves in the Distribution of
Pairwise Genetic Differences. Molecular Biology and Evolution, 9(3), 552-569.
Rozas, J., Ferrer-Mata, A., Sánchez-DelBarrio, J. C., Guirao-Rico, S., Librado, P., Ramos-Onsins,
S. E., & Sánchez-Gracia, A. (2017). DnaSP 6: DNA Sequence Polymorphism Analysis of
Large Data Sets. Molecular Biology and Evolution, 34(12), 3299-3302.
Page 240
218
Russello, M. A., Brazaitis, P., Gratten, J., Watkins-Colwell, G. J., & Caccone, A. (2007). Molecular
Assessment of the Genetic Integrity, Distinctiveness and Phylogeographic Context of the
Saltwater Crocodile (Crocodylus porosus) on Palau. Conservation Genetics, 8(4), 777-787.
Ryan, C. (1998). Saltwater Crocodiles as Tourist Attractions. Journal of Sustainable Tourism, 6(4),
314-327.
Sa’adi, Z., Shahid, S., Ismail, T., Chung, E.-S., & Wang, X.-J. (2017). Distributional Changes in
Rainfall and River Flow in Sarawak, Malaysia. Asia-Pacific Journal of Atmospheric
Sciences, 53(4), 489-500.
Sah, S. A. M., & Stuebing, R. B. (1996). Diet, Growth and Movements of Juvenile Crocodiles
Crocodylus porosus Schneider in the Klias River, Sabah, Malaysia. Journal of Tropical
Ecology, 12(5), 651-662.
Sambrook, J., Fritsch, E., & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Sarawak Forestry Corporation. (2018). Management Plan for Estuarine Crocodile (Crocodylus
porosus) in Sarawak 2016-2020. Kuching: Sarawak Forestry Corporation.
Sarawak Gazette. (June 1, 1933). Government Printing Service, Kuching, Sarawak.
Sarawak Gazette. (July 1, 1929). Government Printing Service, Kuching, Sarawak.
Sarawak Gazette. (November 1, 1927). Government Printing Service, Kuching, Sarawak.
Sarawak Gazette. (May 2, 1908). Government Printing Service, Kuching, Sarawak.
Schneider, J. G. (1801). Historiae Amphibiorum naturalis et literariae. Fasciculus secundus
continens Crocodilos, Scincos, Chamaesauras, Boas. Pseudoboas, Elapes, Angues.
Amphisbaenas et Caecilias. Jena: Sumtibus F. Frommanni.
Seymour, R. S., Bennett‐Stamper, C. L., Johnston, S. D., Carrier, D. R., & Grigg, G. C. (2004).
Evidence for Endothermic Ancestors of Crocodiles at the Stem of Archosaur Evolution.
Physiological and Biochemical Zoology, 77(6), 1051-1067.
Page 241
219
Shafiei-Astani, B., Ong, A. H. K., Valdiani, A., Tan, S. G., Yien, C. Y. S., Ahmady, F., . . . Kuar, T.
(2015). Molecular Genetic Variation and Structure of Southeast Asian Crocodile
(Tomistoma schlegelii): Comparative Potentials of SSRs versus ISSRs. Gene, 571(1), 107-
116.
Shaney, K. J., Hamidy, A., Walsh, M., Arida, E., Arimbi, A., & Smith, E. N. (2017). Impacts of
Anthropogenic Pressures on the Contemporary Biogeography of Threatened Crocodilians in
Indonesia. Oryx, 2017, 1-12.
Shoon, A. (2009). Sequencing of Cytochrome b and 12S mtDNA Genes of Saltwater Crocodiles,
Crocodylus porosus from Sarawak. (Unpublished Final Year Project Report). Universiti
Malaysia Sarawak, Sarawak, Malaysia.
Sideleau, B. M., & Britton, A. (2013). An Analysis of Crocodilian Attacks Worldwide for the Period
of 2008 - July 2013. Pp 110-113. In World Crocodile Conference. Proceedings of the 22nd
Working Meeting of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland: IUCN.
Sideleau, B. M., Edyvane, K. S., & Britton, A. R. C. (2016). An Analysis of Recent Saltwater
Crocodile (Crocodylus porosus) Attacks in Timor-Leste and Consequences for Management
and Conservation. Marine and Freshwater Research, 68(5), 801-809.
Slatkin, M., & Hudson, R. R. (1991). Pairwise Comparisons of Mitochondrial DNA Sequences in
Stable and Exponentially Growing Populations. Genetics, 129(2), 555-562.
Stevenson, C., De Silva, A., Vyas, R., Nair, T., Mobaraki, A., & Aleem Chaudhry, A. (2014).
Human-Crocodile Conflict in South Asia and Iran. Pp 209-226. In Crocodiles. Proceedings
of the 23rd Working Meeting of the IUCN-SSC Crocodile Specialist Group. Gland,
Switzerland and Cambridge, UK: IUCN.
Stuebing, R., Ismail, G., & Kusuadi, S. (1985). The Ecology of Crocodile Attacks in Batang Lupar,
Sarawak. Sarawak Museum Journal, 34, 195-215.
Stuebing, R., Ismail, G., & Ching, L. H. (1994). The Distribution and Abundance of the Indo-Pacific
Crocodile Crocodylus porosus Schneider in the Klias River, Sabah, East Malaysia.
Biological Conservation, 69, 1-7.
Page 242
220
Sulaiman, M. K. (2011). Genetic Diversity of Sarawak Saltwater Crocodile (Crocodylus porosus)
using PCR-RAPD. (Unpublished Final Year Project Report). Universiti Malaysia Sarawak,
Sarawak, Malaysia.
Sulaiman, N. A. S. (2018). Fisherman's Knowledge of the Moon Phenomenon in Fishing Activities.
International Journal of Academic Research in Business and Social Sciences, 8(11), 941-
949.
Swofford, L. D. (2002). PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods).
Version 4.0b10. Sunderland, Massachusetts: Sinauer Associates.
Taigor, S. R., & Rao, R. J. (2014). Assessments of Potential Suitable Habitats Stretch of Fresh Water
Crocodile, Gharial Gavialis gangeticus (Gmelin 1789) in the Chambal River, Madhya
Pradesh, India. International Journal of Environmental Sciences, 4(4), 544-550.
Tajima, F. (1989). Statistical Method for Testing the Neutral Mutation Hypothesis by DNA
polymorphism. Genetics, 123(3), 585-595.
Thorbjarnarson, J. (1999). Crocodile Tears and Skins: International Trade, Economic Constraints,
and Limits to the Sustainable Use of Crocodilians. Conservation Biology, 13(3), 465-470.
Tisen, O., & Ahmad, R. (2010). Crocodylus porosus in Sarawak: Status and Management. Paper
presented at the IUCN-SSC crocodile specialist group (CSG) Workshop on Human-
crocodile conflict, Sabah, Malaysia.
Tisen, O., Gombek, F., Ahmad, R., & Ubang, C. K. (2013). Human-Crocodile Issues: Sarawak
Report. Pp 115. In World Crocodile Conference. Proceedings of the 22nd Working Meeting
of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland: IUCN.
UK Office for National Statistics. (2019). How to Calculate Inflation Rate for £1, 1900 to 2017.
Retrieved 16 April, 2019, from https://www.officialdata.org/1900-GBP-in-2017?amount=1.
Wallace, A. R. (1869). The Malay Archipelago: The Land of the Orang-utan and the Bird of Paradise
: A Narrative of Travel, with Studies of Man and Nature. London: Macmillan and Co.
Page 243
221
Webb, G. J. W., Messel, H., & Magnusson, W. (1977). The Nesting of Crocodylus porosus in
Arnhem Land, Northern Australia. Copeia, 1977(2), 237 - 249.
Webb, G. J. W., & Messel, H. (1979). Wariness in Crocodylus porosus (Reptilia : Crocodilidae).
Wildlife Research, 6(2), 227-234.
Webb, G. J. W., Manolis, S., Buckworth, R., & Sack, G. (1983). An Examination of Crocodylus
porosus Nests in Two Northern Australian Freshwater Swamps, with an Analysis of Embryo
Mortality. Wildlife Research, 10(3), 571-605.
Webb, G. J. W., Hollis, G. J., & Manolis, S. C. (1991). Feeding, Growth and Food Conversion Rates
of Wild Juvenile Saltwater Crocodiles (Crocodylus porosus). Journal of Herpetology, 25(4),
462-473.
Webb, G. J. W. (2008). Wicked Problems with Wicked Crocodiles. Pp 241-249. In Crocodile.
Proceedings of the 19th Working Meeting of the IUCN-SSC Crocodile Specialist Group.
Gland, Switzerland: IUCN.
Webb, G. J. W., Manolis, C., & Brien, M. L. (2010). Saltwater Crocodile, Crocodylus porosus. In C.
Manolis & C. Stevenson (Eds.), Crocodile. Status Survey and Conservation Action Plan.
Third Edition (pp. 99-113). Darwin: Crocodile Specialist Group.
Whitaker, R. (1984). Preliminary survey of crocodiles in Sabah, East Malaysia. Kuala Lumpur:
World Wildlife Fund (WWF) Malaysia.
Woodward, A. R., Franklin Percival, H., Heath Rauschenberger, R., Gross, T. S., Rice, K. G., &
Conrow, R. (2011). Abnormal Alligators and Organochlorine Pesticides in Lake Apopka,
Florida. In J. Elliott, C. Bishop & C. Morrissey (Eds.), Wildlife Ecotoxicology. Emerging
Topics in Ecotoxicology (Principles, Approaches and Perspectives) (Vol. 3, pp. 153-187).
New York, NY: Springer.
Woodward, A. R., Leone, E. H., Dutton, H. J., Hord, L., & Waller, J. E. (2014). Human Alligator
Conflict in Florida, USA. Pp 182-199. In Crocodiles. Proceedings of the 23rd Working
Meeting of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland and Cambridge,
UK: IUCN.
Page 244
222
Zaini, M. K., Ripot, S., Ubang, C. K., Francis, R., & Simon, A. M. (2014). Crocodile Survey at
Kuching, Samarahan and Sri Aman division, Sarawak, Malaysia. Paper presented at the
Borneo Crocodile Forum, Sibu, Sarawak, Malaysia.
Zainudin, R., Nor, S. M., Ahmad, N., Md-Zain, B. M., & Rahman, M. A. (2010). Genetic Structure
of Hylarana erythraea (Amphibia: Anura: Ranidae) from Malaysia. Zoological Studies,
49(5), 688-702.
Page 245
223
APPENDICES
Appendix A1 (habitat assessment data sheet)
Page 246
224
Appendix A2
Table appendix A2: Summary of river characteristics observed and recorded during field sampling in eight studied rivers in Rajang River
Basin.
River Type of river Distance from
Sea
Tidal
Influence
Riverbank characteristic
Type of river Water type Riverbank Forest type Canopy cover
1) Igan Large tributary
in estuary area,
located in
lower Rajang
Saltwater
and
brackish
Lower region
of Rajang
River Basin.
Tidal At estuary, sandy
riverbank for about
few hundred meters
and then followed by
muddy riverbank
At the mouth of the river,
riverbank dominated by
pine trees (Casuarina
equisetifolia), then
riverbank dominated by
mangroves and Nypa trees
Open canopy
in most area of
river mouth
2) Belawai Large tributary
in estuary area,
located in
lower Rajang
delta
Saltwater
and
brackish
Lower region
of Rajang
River Basin.
Tidal At estuary, sandy
riverbank for about 1
kilometer and then
followed by muddy
riverbank
At the mouth of the river,
riverbank dominated by
pine trees (Casuarina
equisetifolia). After a few
kilometers riverbank
majorly dominated by
mangroves vegetation
Open canopy
in most area of
river mouth
3) Sarikei Tributary of
Batang Rajang
in lower region
Brackish Lower region
of Rajang
River Basin.
Tidal Muddy riverbank Nypa trees dominated
vegetations in the
riverbanks
Open canopy
in most area of
river mouth
4) Nyelong Tributary of
Batang Rajang
in lower region
Brackish Lower region
of Rajang
River Basin.
Tidal Muddy riverbank Nypa trees dominated
vegetations in the
riverbanks
Open canopy
in most area of
river mouth
Page 247
225
Table Appendix A2 continue…
5) Kanowit Tributary of
Batang Rajang
in the middle
region
Brackish
few
kilometres
from mouth
of the river,
freshwater
further
upstream
Middle region
of Rajang
River Basin.
Approx. 125
km from
mouth of
Rajang
Tidal Sandy and muddy
riverbank at
downstream. In the
upstream area,
riverbank substrates
are sandy, gravels and
pebbles.
Mixed Dipterocarp Forest
(MDF). In some areas of
the river, riverbank
vegetations are dominated
by grass and ferns
Open canopy
in most area of
river mouth
6) Poi Tributary of
Batang Rajang
in the middle
region
Brackish
few
kilometres
from mouth
of the river,
freshwater
further
upstream
Middle region
of Rajang
River Basin.
Approx. 135
km from
mouth of
Rajang
Not
influence
by tidal
Sandy and muddy
riverbank at
downstream. In the
upstream area,
riverbank substrates
are sandy, gravels and
pebbles.
Mixed Dipterocarp Forest
(MDF). In some areas of
the river, riverbank
vegetations are dominated
by grass and ferns
Partly shaded
especially
towards
upstream
7) Ngemah Tributary of
Batang Rajang
in the upper
region
Brackish
few
kilometres
from mouth
of the river,
freshwater
further
upstream
Middle region
of Rajang
River Basin.
Approx. 155
km from
mouth of
Rajang
Not
influence
by tidal
Sandy and muddy
riverbank at
downstream. In the
upstream area,
riverbank substrates
are sandy, gravels and
pebbles.
Mixed Dipterocarp Forest
(MDF). In some areas of
the river, riverbank
vegetations are dominated
by grass and ferns
Partly shaded
especially
towards
upstream
8) Katibas Tributary of
Batang Rajang
in the upper
region
Brackish
few
kilometres
from mouth
of the river,
freshwater
further
upstream
Middle region
of Rajang
River Basin.
Approx. 180
km from
mouth of
Rajang
Not
influence
by tidal
Sandy and muddy
riverbank at
downstream. In the
upstream area,
riverbank substrates
are sandy, gravels and
pebbles.
Mixed Dipterocarp Forest
(MDF). In some areas of
the river, riverbank
vegetations are dominated
by grass and ferns
Partly shaded
especially
towards
upstream
Page 248
226
Appendix A3
Table appendix A3: Riverbank development and land use recorded during field sampling in eight studied rivers in Rajang River Basin.
River Riverbank development and land use
Residential /schools near
riverbank
Agriculture and fishing
activity
Transportation and Industrial
1) Igan Igan village located at the
mouth of the river.
Fishing activities are relatively high in the
river. Various types of fishing vessels were
found along the river, ranging from small
boats to big fishing vessels. Fishermen use
several methods of fishing including gill
nets and cast nets, which could be seen set
up by the fishermen along the river.
One or two ferries operate in daytime,
transporting peoples and vehicles crossing both
sides of the river. River traffics in the river are
relatively low, as the villagers rarely use the
river to travel to another place. Most of boating
activities in the river are involving fishing
vessels.
2) Belawai Belawai Village located near
to the mouth of the river.
Another village can be found
approx. 15 km from the river
mouth.
Fishing activities are relatively high in the
river. Various types of fishing vessels were
found along the river, ranging from small
boats to big fishing vessels. Fishermen use
several methods of fishing including gill
nets and cast nets, which could be seen set
up by the fishermen along the river.
River traffics in the river are relatively low, as
the villagers rarely use the river to travel to
another place. Most of boating activities in the
river are involving fishing vessels.
3) Sarikei Sarikei Town located near to
the mouth of the river. Several
villages can be found further
upstream.
Several small-scale farms planted with
fruits and vegetables could be seen near to
residential areas. Fishing activities are
relatively high especially in areas near to
Sarikei town,
Buildings including shops and offices,
manmade waterfront and express boat’s jetty
were built near to the mouth of the river. Two
bridges can be found in the survey distance, one
of the bridges situated about less than 1 km from
the river mouth. River traffics are relatively
high especially in areas near to the town.
4) Nyelong Sarikei Town located near to
the mouth of the river. Further
upstream, no other residentials
were found near to riverbank
area during the survey period.
Palm oil estates located approx. more than
10 km in upstream. Fishing activities are
relatively high especially in areas near to
Sarikei Town
Buildings including shops and offices,
manmade waterfront and express boat’s jetty
were built near to the mouth of the river. A
bridge across the river approx. 2 km from the
river mouth. River traffics are relatively high
especially in area near to the town.
Page 249
227
Table Appendix A3 continue…
5) Kanowit Kanowit town is located at the
mouth of the river. Approx. 13
to 15 villages/longhouses can
be found throughout the river.
Two schools located near to
riverbank.
Several agriculture plots planted with
paddy and pepper could be seen near to
residential areas. Fishing activities are
relatively are relatively high especially in
areas near to Kanowit Town.
Shops, manmade waterfront and express boat’s
jetty were built near to the mouth of the river. A
logging camp can be found approx. 7 km from
river mouth and use the river to transport logs.
During the time of the survey, construction of a
concrete bridge is on-going, located approx. 2
km from river mouth. Heavy machineries were
used in the construction. River traffics are
relatively high especially in areas near to the
town.
6) Poi Only 1 or 2 houses can be
found less than 5 km from
river mouth. While further
upstream, not more than 6
villages/longhouses can be
found. One school located
near to riverbank.
Several agriculture plots planted with
paddy and pepper could be seen near to
residential areas. Fishing activities are
relatively medium to low throughout the
river.
Abandoned logging camp can be found approx.
less than 2 km from the river mouth. River
traffics are relatively low. Villages/longhouses
were connected to each other and to Kanowit
Town via roads, thus most of the local people
travel using land transportations.
7) Ngemah Ngemah villages located near
to river mouth. Not less than 5
villages/longhouses can be
found throughout the survey
distance in the river. A school
located near to riverbank.
Several agriculture plots planted with
paddy and pepper could be seen near to
residential areas. Fishing activities are
relatively medium to low throughout the
river.
A bridge across the river can be found approx.
6 km from river mouth. River traffics are
relatively low. Majority of local people use land
transportations to travel to other
villages/longhouses or to Kanowit Town as the
areas are connected via roads.
8) Katibas Song town is located at the
mouth of the river. Approx. 8
villages / longhouses and a
school can be found
throughout the survey distance
in the river.
Several agriculture plots planted with
paddy and pepper could be seen near to
residential areas. Fishing activities are
relatively medium to low throughout the
river.
Buildings including shops and offices,
manmade waterfront and express boat’s jetty
were built near to the mouth of the river. River
traffics are relatively high especially in areas
near to the town.
Page 250
228
Appendix A4
Table appendix A4: Water quality measurement for each station in eight studied rivers in Rajang River Basin.
River Station GPS Coordinates Depth (m) Width (m) Salinity (ppt) pH Temperature
(oC)
1) Igan 1 2°49'58.83"N, 111°40'47.36"E 15.80 1500 22.00 6.71 26.50
2 2°49'0.95''N, 111°41'20.95''E 14.50 1670 21.00 6.72 26.50
3 2°48'46.76''N, 111°42'58.67''E 14.10 1155 19.00 6.77 26.80
4 2°48'10.46''N, 111°43'45.77''E 13.30 950 17.00 5.96 27.30
5 2°48'05.39"N, 111°44'43.05"E 13.70 915 16.00 5.94 27.00
Mean 14.28 1238 19.00 6.42 26.82
Standard deviation 0.96 335.20 ± 2.54 ± 0.43 ± 0.34
2) Belawai 1 2°11'39.87"N, 111°15'55.24"E 16.20 730 25.33 7.68 29.60
2 2°11'55.83''N, 111°16'38.94''E 14.30 580 17.33 7.56 29.90
3 2°13'20.51''N, 111°17'11.60''E 15.10 1040 14.33 7.47 29.70
4 2°14'51.72''N, 111°16' 41.49''E 14.90 1400 13.33 7.39 29.60
5 2° 16'5.88"N, 111°17'03.34"E 15.50 560 11.00 7.53 29.70
Mean 15.20 862 16.26 7.53 29.70
Standard deviation 0.71 356.82 ± 5.55 ± 0.11 ± 0.12
3) Sarikei 1 2°8'0.16"N, 111°30'50.51"E 7.90 210 14.00 5.86 30.20
2 2°6'38.36''N, 111°30'56.75''E 12.50 90 8.67 5.76 29.90
3 2°5'47.85''N, 111°30'41.64''E 7.30 80 6.33 5.65 29.70
4 2°4'33.40'' N, 111°30'54.16''E 7.20 50 1.33 5.61 29.30
5 2°2'55.13"N, 111°29'37.70"E 6.70 40 0 5.27 29.50
Mean 8.32 94 6.06 5.63 29.72
Standard deviation ± 2.38 68.04 ± 5.67 ± 0.22 ± 0.35
4) Nyelong 1 2°8'4.97"N, 111°31'30.73"E 8.70 240 5.30 5.51 29.50
2 2°6'38.67''N, 111°32'19.77''E 10.70 130 1.33 5.28 28.70
3 2°5'59.36'' N, 111°33'15.44''E 8.60 95 1.33 5.18 29.30
4 2°5'23.08'' N, 111°34' 17.54''E 8.20 85 1.33 5.15 29.40
5 2° 4'5.69"N, 111°35'11.32"E 5.60 60 0.67 5.13 29.40
Mean 8.36 122 1.99 5.25 29.26
Standard deviation ± 1.82 70.59 ± 1.87 ± 0.16 ± 0.32
Page 251
229
Table appendix A4 continue…
5) Kanowit 1 2°5'53.16"N, 112°9'28.99"E 12.50 265 2.00 6.87 27.40
2 2°5'13.18''N, 112°9'1.17''E 12.70 100 1.00 6.79 27.50
3 2°3'33.06''N, 112°9'9.46''E 8.10 85 0.37 6.54 27.40
4 2°2'34.18''N, 112°8'21.50''E 10.50 80 0.67 6.72 27.30
5 2°1'7.70"N, 112°4'28.40"E 8.50 60 0.37 7.12 27.20
Mean 10.86 118 0.88 6.81 27.36
Standard deviation ± 2.15 83.41 ± 0.68 ± 0.21 ± 0.11
6) Poi 1 2°3'31.79"N, 112°16'50.19"E 7.10 55 2.00 6.99 27.30
2 2°2'40.49''N, 112°16'9.05''E 7.80 40 0.37 7.16 27.20
3 2°1'44.12''N, 112°15'50.24''E 6.20 50 0 7.25 27.10
4 2°0'29.96''N, 112°15'51.28''E 4.50 30 0 7.30 27.30
5 1°59'20.00"N, 112°15'27.70"E 5.10 25 0 7.38 27.30
Mean 6.14 40 0.47 7.22 27.24
Standard deviation ± 1.36 12.75 ± 0.87 ± 0.15 ± 0.09
7) Ngemah 1 2°1'28.40"N, 112°23'52.57"E 7.60 170 0 6.94 25.50
2 2°0'19.11'' N, 112°23'42.54''E 6.70 55 0 6.88 25.40
3 1°59'30.09'' N, 112°23'51.18''E 6.20 45 0 7.05 25.30
4 1°58'59.61''N, 112°24'17.09''E 6.20 30 0 7.01 25.50
5 1°57'41.48"N, 112°23'53.65"E 5.80 30 0 7.02 25.50
Mean 6.50 66 0 6.98 25.44
Standard deviation ± 0.69 59.10 0 ± 0.07 ± 0.09
8) Katibas 1 2°0'36.13"N, 112°33'14.10"E 10.80 145 0 7.00 25.40
2 1°59'58.43''N, 112°33'15.55''E 3.80 115 0 6.98 25.20
3 1°58'24.32''N, 112°32'55.95''E 7.00 130 0 6.94 25.40
4 1°56'36.10''N, 112°32'52.69''E 6.30 90 0 7.05 25.50
5 1° 54'32.78"N, 112°33'37.92"E 2.00 110 0 7.13 25.40
Mean 5.98 118 0 7.02 25.38
Standard deviation ± 3.35 20.80 0 ± 0.07 ± 0.11
Page 252
230
Statistical analysis:
One-way ANOVA: Salinity versus River
Method
Null hypothesis All means are equal
Alternative hypothesis At least one mean is different
Significance level α = 0.05
Equal variances were assumed for the analysis.
Factor Information
Factor Levels Values
River 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi,
Sarikei
Analysis of Variance
Source DF Adj SS Adj MS F-Value P-Value
River 7 2088.8 298.407 32.12 0.000
Error 32 297.3 9.289
Total 39 2386.1
Model Summary
S R-sq R-sq(adj) R-sq(pred)
3.04787 87.54% 84.82% 80.53%
Means
River N Mean StDev 95% CI
Belawai 5 16.26 5.55 ( 13.49, 19.04)
Kanowit 5 0.882 0.677 ( -1.894, 3.658)
Katibas 5 0.000000 0.000000 (-2.776438, 2.776438)
Kuala Igan 5 19.00 2.55 ( 16.22, 21.78)
Ngemah 5 0.000000 0.000000 (-2.776438, 2.776438)
Nyelong 5 1.992 1.871 ( -0.784, 4.768)
Poi 5 0.474 0.868 ( -2.302, 3.250)
Sarikei 5 6.07 5.68 ( 3.29, 8.84)
Pooled StDev = 3.04787
Tukey Pairwise Comparisons
Grouping Information Using the Tukey Method and 95% Confidence
River N Mean Grouping
Kuala Igan 5 19.00 A
Belawai 5 16.26 A
Sarikei 5 6.07 B
Nyelong 5 1.992 B
Kanowit 5 0.882 B
Poi 5 0.474 B
Ngemah 5 0.000000 B
Katibas 5 0.000000 B
Page 253
231
Means that do not share a letter are significantly different.
Tukey Simultaneous Tests for Differences of Means
Difference SE of Adjusted
Difference of Levels of Means Difference 95% CI T-Value P-Value
Kanowit - Belawai -15.38 1.93 (-21.62, -9.14) -7.98 0.000
Katibas - Belawai -16.26 1.93 (-22.51, -10.02) -8.44 0.000
Kuala Igan - Belawai 2.74 1.93 ( -3.51, 8.98) 1.42 0.842
Ngemah - Belawai -16.26 1.93 (-22.51, -10.02) -8.44 0.000
Nyelong - Belawai -14.27 1.93 (-20.51, -8.03) -7.40 0.000
Poi - Belawai -15.79 1.93 (-22.03, -9.55) -8.19 0.000
Sarikei - Belawai -10.20 1.93 (-16.44, -3.96) -5.29 0.000
Katibas - Kanowit -0.88 1.93 ( -7.12, 5.36) -0.46 1.000
Kuala Igan - Kanowit 18.12 1.93 ( 11.88, 24.36) 9.40 0.000
Ngemah - Kanowit -0.88 1.93 ( -7.12, 5.36) -0.46 1.000
Nyelong - Kanowit 1.11 1.93 ( -5.13, 7.35) 0.58 0.999
Poi - Kanowit -0.41 1.93 ( -6.65, 5.83) -0.21 1.000
Sarikei - Kanowit 5.18 1.93 ( -1.06, 11.43) 2.69 0.163
Kuala Igan - Katibas 19.00 1.93 ( 12.76, 25.24) 9.86 0.000
Ngemah - Katibas 0.00 1.93 ( -6.24, 6.24) 0.00 1.000
Nyelong - Katibas 1.99 1.93 ( -4.25, 8.23) 1.03 0.966
Poi - Katibas 0.47 1.93 ( -5.77, 6.72) 0.25 1.000
Sarikei - Katibas 6.07 1.93 ( -0.18, 12.31) 3.15 0.062
Ngemah - Kuala Igan -19.00 1.93 (-25.24, -12.76) -9.86 0.000
Nyelong - Kuala Igan -17.01 1.93 (-23.25, -10.77) -8.82 0.000
Poi - Kuala Igan -18.53 1.93 (-24.77, -12.28) -9.61 0.000
Sarikei - Kuala Igan -12.93 1.93 (-19.18, -6.69) -6.71 0.000
Nyelong - Ngemah 1.99 1.93 ( -4.25, 8.23) 1.03 0.966
Poi - Ngemah 0.47 1.93 ( -5.77, 6.72) 0.25 1.000
Sarikei - Ngemah 6.07 1.93 ( -0.18, 12.31) 3.15 0.062
Poi - Nyelong -1.52 1.93 ( -7.76, 4.72) -0.79 0.993
Sarikei - Nyelong 4.07 1.93 ( -2.17, 10.32) 2.11 0.428
Sarikei - Poi 5.59 1.93 ( -0.65, 11.83) 2.90 0.106
Individual confidence level = 99.72%
Page 254
232
One-way ANOVA: pH versus River
Method
Null hypothesis All means are equal
Alternative hypothesis At least one mean is different
Significance level α = 0.05
Equal variances were assumed for the analysis.
Factor Information
Factor Levels Values
River 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi,
Sarikei
Analysis of Variance
Source DF Adj SS Adj MS F-Value P-Value
River 7 21.982 3.14035 72.09 0.000
Error 32 1.394 0.04356
Total 39 23.376
Model Summary
S R-sq R-sq(adj) R-sq(pred)
0.208710 94.04% 92.73% 90.68%
Means
River N Mean StDev 95% CI
Belawai 5 7.5260 0.1078 (7.3359, 7.7161)
Kanowit 5 6.8080 0.2128 (6.6179, 6.9981)
Katibas 5 7.0200 0.0731 (6.8299, 7.2101)
Kuala Igan 5 6.420 0.430 ( 6.230, 6.610)
Ngemah 5 6.9800 0.0689 (6.7899, 7.1701)
Nyelong 5 5.2500 0.1564 (5.0599, 5.4401)
Poi 5 7.2160 0.1494 (7.0259, 7.4061)
Sarikei 5 5.630 0.224 ( 5.440, 5.820)
Pooled StDev = 0.208710
Tukey Pairwise Comparisons
Grouping Information Using the Tukey Method and 95% Confidence
River N Mean Grouping
Belawai 5 7.5260 A
Poi 5 7.2160 A B
Katibas 5 7.0200 B
Ngemah 5 6.9800 B
Kanowit 5 6.8080 B C
Kuala Igan 5 6.420 C
Sarikei 5 5.630 D
Nyelong 5 5.2500 D
Means that do not share a letter are significantly different.
Page 255
233
Tukey Simultaneous Tests for Differences of Means
Difference SE of Adjusted
Difference of Levels of Means Difference 95% CI T-Value P-Value
Kanowit - Belawai -0.718 0.132 (-1.145, -0.291) -5.44 0.000
Katibas - Belawai -0.506 0.132 (-0.933, -0.079) -3.83 0.012
Kuala Igan - Belawai -1.106 0.132 (-1.533, -0.679) -8.38 0.000
Ngemah - Belawai -0.546 0.132 (-0.973, -0.119) -4.14 0.005
Nyelong - Belawai -2.276 0.132 (-2.703, -1.849) -17.24 0.000
Poi - Belawai -0.310 0.132 (-0.737, 0.117) -2.35 0.300
Sarikei - Belawai -1.896 0.132 (-2.323, -1.469) -14.36 0.000
Katibas - Kanowit 0.212 0.132 (-0.215, 0.639) 1.61 0.743
Kuala Igan - Kanowit -0.388 0.132 (-0.815, 0.039) -2.94 0.098
Ngemah - Kanowit 0.172 0.132 (-0.255, 0.599) 1.30 0.891
Nyelong - Kanowit -1.558 0.132 (-1.985, -1.131) -11.80 0.000
Poi - Kanowit 0.408 0.132 (-0.019, 0.835) 3.09 0.070
Sarikei - Kanowit -1.178 0.132 (-1.605, -0.751) -8.92 0.000
Kuala Igan - Katibas -0.600 0.132 (-1.027, -0.173) -4.55 0.002
Ngemah - Katibas -0.040 0.132 (-0.467, 0.387) -0.30 1.000
Nyelong - Katibas -1.770 0.132 (-2.197, -1.343) -13.41 0.000
Poi - Katibas 0.196 0.132 (-0.231, 0.623) 1.48 0.810
Sarikei - Katibas -1.390 0.132 (-1.817, -0.963) -10.53 0.000
Ngemah - Kuala Igan 0.560 0.132 ( 0.133, 0.987) 4.24 0.004
Nyelong - Kuala Igan -1.170 0.132 (-1.597, -0.743) -8.86 0.000
Poi - Kuala Igan 0.796 0.132 ( 0.369, 1.223) 6.03 0.000
Sarikei - Kuala Igan -0.790 0.132 (-1.217, -0.363) -5.98 0.000
Nyelong - Ngemah -1.730 0.132 (-2.157, -1.303) -13.11 0.000
Poi - Ngemah 0.236 0.132 (-0.191, 0.663) 1.79 0.632
Sarikei - Ngemah -1.350 0.132 (-1.777, -0.923) -10.23 0.000
Poi - Nyelong 1.966 0.132 ( 1.539, 2.393) 14.89 0.000
Sarikei - Nyelong 0.380 0.132 (-0.047, 0.807) 2.88 0.111
Sarikei - Poi -1.586 0.132 (-2.013, -1.159) -12.02 0.000
Individual confidence level = 99.72%
Page 256
234
One-way ANOVA: Temperature versus River
Method
Null hypothesis All means are equal
Alternative hypothesis At least one mean is different
Significance level α = 0.05
Equal variances were assumed for the analysis.
Factor Information
Factor Levels Values
River 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi,
Sarikei
Analysis of Variance
Source DF Adj SS Adj MS F-Value P-Value
River 7 110.239 15.7484 316.55 0.000
Error 32 1.592 0.0497
Total 39 111.831
Model Summary
S R-sq R-sq(adj) R-sq(pred)
0.223047 98.58% 98.27% 97.78%
Means
River N Mean StDev 95% CI
Belawai 5 29.7000 0.1225 (29.4968, 29.9032)
Kanowit 5 27.3600 0.1140 (27.1568, 27.5632)
Katibas 5 25.3800 0.1095 (25.1768, 25.5832)
Kuala Igan 5 26.820 0.342 ( 26.617, 27.023)
Ngemah 5 25.4400 0.0894 (25.2368, 25.6432)
Nyelong 5 29.260 0.321 ( 29.057, 29.463)
Poi 5 27.2400 0.0894 (27.0368, 27.4432)
Sarikei 5 29.720 0.349 ( 29.517, 29.923)
Pooled StDev = 0.223047
Tukey Pairwise Comparisons
Grouping Information Using the Tukey Method and 95% Confidence
River N Mean Grouping
Sarikei 5 29.720 A
Belawai 5 29.7000 A B
Nyelong 5 29.260 B
Kanowit 5 27.3600 C
Poi 5 27.2400 C D
Kuala Igan 5 26.820 D
Ngemah 5 25.4400 E
Katibas 5 25.3800 E
Means that do not share a letter are significantly different.
Page 257
235
Tukey Simultaneous Tests for Differences of Means
Difference SE of Adjusted
Difference of Levels of Means Difference 95% CI T-Value P-Value
Kanowit - Belawai -2.340 0.141 (-2.797, -1.883) -16.59 0.000
Katibas - Belawai -4.320 0.141 (-4.777, -3.863) -30.62 0.000
Kuala Igan - Belawai -2.880 0.141 (-3.337, -2.423) -20.42 0.000
Ngemah - Belawai -4.260 0.141 (-4.717, -3.803) -30.20 0.000
Nyelong - Belawai -0.440 0.141 (-0.897, 0.017) -3.12 0.066
Poi - Belawai -2.460 0.141 (-2.917, -2.003) -17.44 0.000
Sarikei - Belawai 0.020 0.141 (-0.437, 0.477) 0.14 1.000
Katibas - Kanowit -1.980 0.141 (-2.437, -1.523) -14.04 0.000
Kuala Igan - Kanowit -0.540 0.141 (-0.997, -0.083) -3.83 0.012
Ngemah - Kanowit -1.920 0.141 (-2.377, -1.463) -13.61 0.000
Nyelong - Kanowit 1.900 0.141 ( 1.443, 2.357) 13.47 0.000
Poi - Kanowit -0.120 0.141 (-0.577, 0.337) -0.85 0.988
Sarikei - Kanowit 2.360 0.141 ( 1.903, 2.817) 16.73 0.000
Kuala Igan - Katibas 1.440 0.141 ( 0.983, 1.897) 10.21 0.000
Ngemah - Katibas 0.060 0.141 (-0.397, 0.517) 0.43 1.000
Nyelong - Katibas 3.880 0.141 ( 3.423, 4.337) 27.50 0.000
Poi - Katibas 1.860 0.141 ( 1.403, 2.317) 13.19 0.000
Sarikei - Katibas 4.340 0.141 ( 3.883, 4.797) 30.77 0.000
Ngemah - Kuala Igan -1.380 0.141 (-1.837, -0.923) -9.78 0.000
Nyelong - Kuala Igan 2.440 0.141 ( 1.983, 2.897) 17.30 0.000
Poi - Kuala Igan 0.420 0.141 (-0.037, 0.877) 2.98 0.090
Sarikei - Kuala Igan 2.900 0.141 ( 2.443, 3.357) 20.56 0.000
Nyelong - Ngemah 3.820 0.141 ( 3.363, 4.277) 27.08 0.000
Poi - Ngemah 1.800 0.141 ( 1.343, 2.257) 12.76 0.000
Sarikei - Ngemah 4.280 0.141 ( 3.823, 4.737) 30.34 0.000
Poi - Nyelong -2.020 0.141 (-2.477, -1.563) -14.32 0.000
Sarikei - Nyelong 0.460 0.141 ( 0.003, 0.917) 3.26 0.048
Sarikei - Poi 2.480 0.141 ( 2.023, 2.937) 17.58 0.000
Individual confidence level = 99.72%
Page 258
236
Appendix A5
Table appendix A5: The coordinates of locations where the gill nets were deployed.
River Coordinates of the gill nets
1 2 3
1) Igan 2°49'44.03" N,
111°41'22.13" E
2°48'23.93" N,
111°42'22.83" E
2°48'12.98" N,
111°44'22.89" E
2) Belawai 2°11'40.80" N,
111°15'59.21" E
2°12'46.30 " N,
111°16'56.23" E
2°17'14.47" N,
111°16'44.79" E
3) Sarikei 2°6'38.44" N,
111°30'55.07" E
2°4'59.01" N,
111°30'52.15" E
2°3'23.47" N,
111°29'38.97" E
4) Nyelong 2°6'48.65" N,
111°32'16.26" E
2°5'59.99" N,
111°33'17.14" E
2°5'16.42" N,
111°34'22.66" E
5) Kanowit 2°4'23.88" N,
112°9'4.40" E
2°3'28.40" N,
112°9'8.19" E
2°2'52.49" N,
112°7'6.60" E
6) Poi 2°3'29.20" N,
112°16'48.69" E
2°1'57.19" N,
112°15'32.60" E
2°0'28.93" N,
112°15'55.85" E
7) Ngemah 2°0'33.51" N,
112°23'45.20" E
1°58'40.80" N,
112°24'33.62" E
-
8) Katibas 1°58'23.22" N,
112°32'46.63" E
1°56'4.01" N,
112°32'23.21" E
-
Page 259
237
Appendix A6
Statistical analysis results for the abundant of aquatic food resources for crocodile (CPUE):
One-way ANOVA: CPUE versus RIver
Method
Null hypothesis All means are equal
Alternative hypothesis At least one mean is different
Significance level α = 0.05
Equal variances were assumed for the analysis.
Factor Information
Factor Levels Values
RIver 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi,
Sarikei
Analysis of Variance
Source DF Seq SS Contribution Adj SS Adj MS F-Value P-Value
RIver 7 1.9674 85.98% 1.9674 0.28105 12.27 0.000
Error 14 0.3207 14.02% 0.3207 0.02291
Total 21 2.2881 100.00%
Model Summary
S R-sq R-sq(adj) PRESS R-sq(pred)
0.151357 85.98% 78.97% 0.747065 67.35%
Means
RIver N Mean StDev 95% CI
Belawai 3 0.970 0.280 ( 0.783, 1.157)
Kanowit 3 0.2483 0.0629 ( 0.0609, 0.4358)
Katibas 2 0.1685 0.0205 (-0.0610, 0.3980)
Kuala Igan 3 0.8217 0.1472 ( 0.6342, 1.0091)
Ngemah 2 0.2590 0.1188 ( 0.0295, 0.4885)
Nyelong 3 0.308 0.199 ( 0.121, 0.495)
Poi 3 0.3750 0.0676 ( 0.1876, 0.5624)
Sarikei 3 0.1220 0.0700 (-0.0654, 0.3094)
Pooled StDev = 0.151357
Page 260
238
Tukey Pairwise Comparisons
Grouping Information Using the Tukey Method and 95% Confidence
RIver N Mean Grouping
Belawai 3 0.970 A
Kuala Igan 3 0.8217 A
Poi 3 0.3750 B
Nyelong 3 0.308 B
Ngemah 2 0.2590 B
Kanowit 3 0.2483 B
Katibas 2 0.1685 B
Sarikei 3 0.1220 B
Means that do not share a letter are significantly different.
Tukey Simultaneous Tests for Differences of Means
Difference SE of Adjusted
Difference of Levels of Means Difference 95% CI T-Value P-Value
Kanowit - Belawai -0.722 0.124 (-1.158, -0.286) -5.84 0.001
Katibas - Belawai -0.802 0.138 (-1.289, -0.314) -5.80 0.001
Kuala Igan - Belawai -0.148 0.124 (-0.584, 0.288) -1.20 0.919
Ngemah - Belawai -0.711 0.138 (-1.199, -0.223) -5.15 0.003
Nyelong - Belawai -0.662 0.124 (-1.098, -0.226) -5.36 0.002
Poi - Belawai -0.595 0.124 (-1.031, -0.159) -4.81 0.005
Sarikei - Belawai -0.848 0.124 (-1.284, -0.412) -6.86 0.000
Katibas - Kanowit -0.080 0.138 (-0.567, 0.408) -0.58 0.999
Kuala Igan - Kanowit 0.573 0.124 ( 0.137, 1.009) 4.64 0.007
Ngemah - Kanowit 0.011 0.138 (-0.477, 0.498) 0.08 1.000
Nyelong - Kanowit 0.060 0.124 (-0.376, 0.496) 0.48 1.000
Poi - Kanowit 0.127 0.124 (-0.309, 0.563) 1.02 0.962
Sarikei - Kanowit -0.126 0.124 (-0.562, 0.310) -1.02 0.963
Kuala Igan - Katibas 0.653 0.138 ( 0.166, 1.141) 4.73 0.006
Ngemah - Katibas 0.091 0.151 (-0.444, 0.625) 0.60 0.998
Nyelong - Katibas 0.140 0.138 (-0.348, 0.627) 1.01 0.965
Poi - Katibas 0.207 0.138 (-0.281, 0.694) 1.49 0.799
Sarikei - Katibas -0.046 0.138 (-0.534, 0.441) -0.34 1.000
Ngemah - Kuala Igan -0.563 0.138 (-1.050, -0.075) -4.07 0.019
Nyelong - Kuala Igan -0.514 0.124 (-0.950, -0.078) -4.16 0.016
Poi - Kuala Igan -0.447 0.124 (-0.883, -0.011) -3.61 0.043
Sarikei - Kuala Igan -0.700 0.124 (-1.136, -0.264) -5.66 0.001
Nyelong - Ngemah 0.049 0.138 (-0.439, 0.537) 0.35 1.000
Poi - Ngemah 0.116 0.138 (-0.372, 0.604) 0.84 0.987
Sarikei - Ngemah -0.137 0.138 (-0.625, 0.351) -0.99 0.968
Poi - Nyelong 0.067 0.124 (-0.369, 0.503) 0.54 0.999
Sarikei - Nyelong -0.186 0.124 (-0.622, 0.250) -1.51 0.793
Sarikei - Poi -0.253 0.124 (-0.689, 0.183) -2.05 0.488
Individual confidence level = 99.67%
Page 261
239
Appendix B
Table Appendix B: Information on the vouchered samples collected during samplings.
Collection
No.
UNIMAS
Voucher No.
Species Origin/
Sampling site
River Basin (RB) Description of
Samples
Collection
Date
1. SB001 C. porosus Sibu Rajang RB Tissue 02/01/2008
2. SM001 C. porosus Samarahan Samarahan RB Blood 27/08/2008
3. SB002 C. porosus Sibu Rajang RB Blood 27/08/2008
4. BN001 C. porosus Bintulu
(TPB)
Kemena RB Blood 27/08/2008
5. BN002 C. porosus Bintulu
(TPB)
Kemena RB Blood 27/08/2008
6. BG001 C. porosus Bintangor Rajang RB Blood 27/08/2008
7. BK001 C. porosus Sg. Bako Sg. Sarawak RB Blood 29/01/2009
8. MR002 C. porosus Miri
(MCF)
Miri RB Blood 18/03/2009
9. MR003 C. porosus Miri
(MCF)
Miri RB Blood 18/03/2009
10. MR010 C. porosus Miri
(MCF)
Miri RB Blood 18/03/2009
11. BK005 C. porosus Sg. Bako Sg. Sarawak RB Blood 10/03/2010
12. TA001 C. porosus Kuching Wetland NP
(Telaga air)
Sg. Sarawak RB Tissue 02/12/2011
Page 262
240
Table Appendix B continue…
Collection
No.
UNIMAS
Voucher No.
Species Origin/
(Sampling site)
River Basin Description of
Samples
Collection
Date
13. RO001 C. porosus Sg. Seblak, Roban Krian RB Tissue 03/2013
14. KP001 C. porosus Kapit Rajang RB Tissue 18/10/2013
15. ST001 C. porosus Sg. Santubong Sg. Sarawak RB Tissue & Blood 04/03/2016
16. SM002 C. porosus Sg. Pinang,
Samarahan
Samarahan RB Tissue & Blood 9/10/2016
17. ST002 C. porosus Semariang,
Santubong
Sg. Sarawak RB Tissue 8/12/2016
18. PU001 C. porosus Sg. Pelasau, Pusa Saribas RB Scute tissue 26/7/2017
19. BG002 C. porosus Sg. Kawi, Bintangor Rajang RB Tissue 30/9/2017
20. SJ001 C. porosus Simunjan Sadong RB Tissue 28/12/2017
21. DB001 C. porosus Sg. Dit, Debak Saribas RB Scute tissue 3/2/2018
22. DB002 C. porosus Sg. Dit, Debak Saribas RB Scute tissue 3/2/2018
*TTB, Tumbina Park, Bintulu; MCF, Miri Crocodile Farm
Page 263
241
Appendix C
L 1 2 3 4 5 6
Figure Appendix C1: An example of 1% agarose gel picture of microsatellites
amplification using Cj131 primer showing single band.
Lane L: GeneRuler 100bp Plus DNA ladder (Fermentas); Lane 1: Sample SB001; Lane
2: Sample SB002; Lane 3: Sample KP001; Lane 4: Sample BG001; Lane 5: Sample
BG002; Lane 6: Sample RO001.
200bp
300bp
Page 264
242
L 1 2 3 4
Figure Appendix C2: An example of 1% agarose gel picture of microsatellites
amplification using Cj105 primer showing multiple bands.
Lane L: GeneRuler 100bp Plus DNA ladder (Fermentas); Lane 1: Sample SM001;
Lane 2: Sample SM002; Lane 3: Sample SJ001; Lane 4: Sample PU001.
300bp
400bp
500bp