Facilitating the Evolution of Esterase Activity from a ...ma-Aldrich (Shanghai, People’s Republic of China). Methyl acetate, methyl 2-tetrahydrofuroate, 3-cyclohexene-1-carboxylic

Facilitating the Evolution of Esterase Activity from a PromiscuousEnzyme (Mhg) with Catalytic Functions of Amide Hydrolysis andCarboxylic Acid Perhydrolysis by Engineering the SubstrateEntrance Tunnel

Xiaodan Yan,a,b Jianjun Wang,a Yu Sun,a Junge Zhu,a Sheng Wua

State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing, People’s Republic of Chinaa; University of Chinese Academyof Sciences, Beijing, People’s Republic of Chinab

ABSTRACT

Promiscuous enzymes are generally considered to be starting points in the evolution of offspring enzymes with more specific oreven novel catalytic activities, which is the molecular basis of producing new biological functions. Mhg, a typical �/� fold hydro-lase, was previously reported to have both �-lactamase and perhydrolase activities. However, despite having high structural sim-ilarity to and sharing an identical catalytic triad with an extensively studied esterase from Pseudomonas fluorescens, this enzymedid not show any esterase activity. Molecular docking and sequence analysis suggested a possible role for the entry of the bindingpocket in blocking the entrance tunnel, preventing the ester compounds from entering into the pocket. By engineering the en-trance tunnel with only one or two amino acid substitutions, we successfully obtained five esterase variants of Mhg. The variantsexhibited a very broad substrate acceptance, hydrolyzing not only the classical p-nitrophenol esters but also various types of chi-ral esters, which are widely used as drug intermediates. Site 233 at the entrance tunnel of Mhg was found to play a pivotal role inmodulating the three catalytic activities by adjusting the size and shape of the tunnel, with different amino acid substitutions atthis site facilitating different activities. Remarkably, the variant with the L233G mutation was a very specific esterase without any�-lactamase and perhydrolase activities. Considering the amino acid conservation and differentiation, this site could be a keytarget for future protein engineering. In addition, we demonstrate that engineering the entrance tunnel is an efficient strategy toregulate enzyme catalytic capabilities.

IMPORTANCE

Promiscuous enzymes can act as starting points in the evolution of novel catalytic activities, thus providing a molecular basis forthe production of new biological functions. In this study, we identified a critical amino acid residue (Leu233) at the entry of thesubstrate tunnel of a promiscuous enzyme, Mhg. We found that substitution of this residue with smaller amino acids such asGly, Ala, Ser, or Pro endowed the enzyme with novel esterase activity. Different amino acids at this site can facilitate differentcatalytic activities. These findings exhibited universal significance in this subset of �/� fold hydrolases, including Mhg. Further-more, we demonstrate that engineering the entrance tunnel is an efficient strategy to evolve new enzyme catalytic capabilities.Our study has important implications for the regulation of enzyme catalytic promiscuity and development of protein engineer-ing methodologies.

Catalytic promiscuity refers to the ability of an enzyme to cata-lyze different substrates and different types of chemical reac-

tions in the same active center. Although high substrate specificityhas been well known, increasing evidence indicates that enzymecatalytic promiscuity exists widely in nature (1, 2, 3, 4). Recently,enzyme promiscuity has captured much attention because it isrelated to the diversity of metabolic pathways and natural prod-ucts, thereby contributing to the source of compounds for newdrug screening (5). More importantly, promiscuous enzymes canact as starting points in the evolution of more specific and evennovel activities. This serves as a molecular basis for producing newbiological functions in living organisms (6). According to Dar-win’s theory of evolution, ancestral enzymes present in the prime-val environment exhibited broad substrate scope and reactiontypes, but the level of their catalytic activities was low, indicatingthat they were highly promiscuous (7). After several million yearsof evolution involving gene duplications, mutations, and naturalselection, an ancestral enzyme gradually turned into multiplehighly differentiated progeny enzymes with diverse functions (6).

Thus, promiscuous enzymes are found at key branch points in theevolutionary process. In this sense, rather than being completelyspecific, promiscuous enzymes are ideal models of continuousevolution of novel catalytic activities.

Sometimes, wild-type enzymes may not exhibit promiscuous

Received 15 June 2016 Accepted 4 September 2016

Accepted manuscript posted online 9 September 2016

Citation Yan X, Wang J, Sun Y, Zhu J, Wu S. 2016. Facilitating the evolution ofesterase activity from a promiscuous enzyme (Mhg) with catalytic functionsof amide hydrolysis and carboxylic acid perhydrolysis by engineering thesubstrate entrance tunnel. Appl Environ Microbiol 82:6748 – 6756.doi:10.1128/AEM.01817-16.

Editor: V. Müller, Goethe University Frankfurt am Main

Address correspondence to Sheng Wu, [email protected].

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.01817-16.

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

crossmark

6748 aem.asm.org November 2016 Volume 82 Number 22Applied and Environmental Microbiology

on January 26, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

activities, but will gain those activities by “fine-tuning” of certainamino acid residues through protein engineering. Several meth-ods are used to achieve this in practical research. The first methodof choice is to engineer the active center, which is the main site forbinding and catalyzing substrates. For example, wild-type Pseu-domonas fluorescens esterase (PFE) does not catalyze perhydrolysisof acetic acid or does so with a very low catalytic rate, while itsvariants PFE-L29P and PFE-L29T show marked perhydrolase ac-tivity (8). The second method is to induce allosteric effects. Theenzyme activity is modified by altering residues at a site away fromthe binding pocket (even more than 10 Å). These residues canremotely influence the binding states between substrate and activecenter and then influence the enzyme catalytic activity (9, 10). Athird and very different approach is to engineer the substrate en-trance tunnel. Entry into the binding pocket is the prerequisite tocatalysis, and the residues at the entrance tunnel can influence itssize and polarity, thereby determining substrate specificity andhence catalytic activity. For example, Chaloupková et al. found acrucial site, Leu177, which is positioned at the tunnel opening ofthe haloalkane dehalogenase. Introducing a small and nonpolaramino acid at position 177 resulted in an increase in catalyticactivity (11). Kotik et al. found that saturation mutagenesis at site217 of the entrance tunnel of an epoxide hydrolase caused pro-found differences in activity and enantioselectivity toward variousepoxides (12).

Mhg, a (�)-�-lactamase with high stability and enantioselec-tivity, was first isolated and purified from Microbacterium hydro-carbonoxydans (13). Mhg can be utilized to prepare chiral �-lac-tam (14), which is an important chiral intermediate for thesynthesis of a series of antiviral drugs, such as abacavir (targetingHIV) and peramivir (targeting hepatitis and pandemic influenza

viruses). Recently, by performing structure similarity analysiscombined with classical enzyme assays, we have found that Mhghas perhydrolase activity (Fig. 1) and that its catalytic efficiency asa perhydrolase was 10-fold higher than as a �-lactamase. Activesite mutagenesis confirmed that the two reactions occur in thesame active center (15). Structure analysis revealed that Mhgshares high structural similarity with an aryl esterase from Pseu-domonas fluorescens and that both have the same Ser-His-Asp cat-alytic triad. Despite its potential as an esterase, Mhg cannot cata-lyze the hydrolysis of ester compounds. In this study, we describethe evolution of the esterase with high activity and wide substrateacceptance from promiscuous Mhg by engineering of the sub-strate entrance tunnel.

MATERIALS AND METHODSChemicals, reagents, bacterial strains, and culture medium. 4-Nitro-phenyl butyrate (pNPB), (�)-2-azabicyclo[2.2.1]hept-5-en-3-one [(�)-�-lactam], phenol red, and bromophenol blue were purchased from Sig-ma-Aldrich (Shanghai, People’s Republic of China). Methyl acetate,methyl 2-tetrahydrofuroate, 3-cyclohexene-1-carboxylic acid, methyl2-methylbutyrate, and methyl cyclopentanone-2-carboxylate were pur-chased from Adamas (Shanghai, People’s Republic of China). Methylphenyl glycidate, methyl-4-methoxyphenyl-oxiranecarboxylate, and1-naphthyl acetate were purchased from Aladdin (Shanghai, People’s Re-public of China).

Methanol, acetonitrile, n-hexane, and isopropanol were of high-per-formance liquid chromatography (HPLC) grade and were purchasedfrom Thermo Fisher Scientific (Waltham, MA, USA). Other reagents werepurchased from Sinopharm Chemical Reagent (Shanghai, People’s Re-public of China). Unless otherwise stated, all reagents were of analyticalgrade and used without any further purification.

Escherichia coli Top10 cells were used for both cloning studies and

FIG 1 Reaction schemes of (�)-�-lactamase (A) and perhydrolase (B).

Evolution of Esterase Activity from Promiscuous Mhg

November 2016 Volume 82 Number 22 aem.asm.org 6749Applied and Environmental Microbiology

on January 26, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

protein expression. The E. coli strains were routinely grown in LB medium(1% tryptone, 0.5% yeast extract, 1% NaCl) and on LB agar plates (1%tryptone, 0.5% yeast extract, 1% NaCl, 1.5% agar) at 37°C. To isolatebacterial strains carrying the appropriate recombinant plasmids, 50�g/ml ampicillin was added to the medium.

Gene, plasmids, and primers. The gene mhg (GenBank accessionnumber GU116480) was amplified from genomic DNA isolated fromMicrobacterium hydrocarbonoxydans (NBRC 103074). The plasmidpBAD/M, which derived from the commercial plasmid pBAD/Myc-HisA(Invitrogen, Carlsbad, CA, USA) with an NdeI restriction site introducedin it, was used for standard cloning and expression in E. coli. The gene mhgwas inserted into pBAD/M between the NdeI and HindIII restriction sites,resulting in plasmid pBAD-mhg. All primers used in this study were syn-thesized by BGI (Shenzhen, China) and are listed in Table 1.

Alanine-scanning mutagenesis of the substrate entrance tunnel. Allalanine-scanning mutants were constructed by PCR using primers con-taining the corresponding mutations and the QuikChange site-directedmutagenesis method (16). PCR was performed using KOD-Plus DNApolymerase (Toyobo, Osaka, Japan). The PCR mix (25-�l final volume)contained 10� KOD buffer (2.5 �l), MgCl2 (1 �l, 25 mM), deoxynucleo-side triphosphate (dNTP) (2.5 �l, 2 mM each), primers (0.5 �l, 2.5 �Meach), template plasmid (1 �l, 10 ng/�l), and 1 unit of KOD-Plus DNApolymerase. The PCR consisted of two rounds of cycles. Predenaturationwas performed at 94°C for 5 min, followed by the first round for 5 cycleswith the following conditions: 94°C for 35 s, 55°C for 35 s, and 68°C for 30s. The second round was for 30 cycles with the following conditions: 94°Cfor 35 s, 55°C for 35 s, and 68°C for 5 min. The final extension was at 68°Cfor 10 min. The PCR products were then digested by DpnI (ThermoFisher Scientific) to remove the methylated template DNA. The digestionmix (12 �l final volume) contained the PCR product (10 �l), 10� bufferTango (1.2 �l), and DpnI (0.8 �l, 10 U/�l). After 3 h of digestion at 37°C,the mix was transformed into E. coli Top10 cells and selected on LB agarwith 50 �g/ml ampicillin. The transformants obtained were verified tocontain the mutation of interest by gene sequencing.

Creation and screening of the mutant libraries. Saturation mutagen-esis at the Leu233 site was also performed by the QuikChange PCRmethod, using NNK codon degeneracy (N, adenine/cytosine/guanine/thymine; K, guanine/thymine) with pBAD-mhg as the template. Satura-tion mutagenesis of other sites at the entrance tunnel was performed usingmhg-L233A as the template. All reactions were carried out according tothe above-mentioned PCR procedures. For screening the mutant librar-ies, 10 �l of the PCR product was digested, transformed into E. coli Top10

cells, and selected on LB agar with ampicillin. The library clones were thentransferred to 96-well plates containing 200 �l of LB medium with 50�g/ml ampicillin and L-arabinose as inducers to a final concentration of0.01%. Assuming that when the library contains 200 samples, the coveragerate is greater than 95% (17), we used two 96-well plates for each site. Afterinoculation, the 96-well plates were incubated at 28°C for 16 h. The cells ineach well were then harvested by centrifugation at 2,800 � g for 30 minand resuspended in 200 �l of the NaH2PO4-Na2HPO4 buffer (50 mM, pH7.5) containing pNPB (0.6 mM final concentration) on a Thermo shakerat 30°C and 1,000 rpm for 15 min. To remove the cells after reaction, the96-well plates were centrifuged again, and the supernatants were trans-ferred onto fresh 96-well plates. Subsequently, the product, p-nitrophe-nol, was detected at 405 nm by a Bio-Rad 680 microplate reader (Bio-Rad,Shanghai, People’s Republic of China).

Gene expression and enzyme purification. The recombinant proteinMhg with a C-terminal His6 tag was expressed in E. coli Top10 cells. Theconstructed plasmid pBAD-mhg was transformed into E. coli Top10 com-petent cells, which were grown overnight at 37°C. Then 5 ml of the over-night culture was transferred into 100 ml of LB medium with 50 �g/mlampicillin. When the culture reached an optical density at 580 nm(OD580|nm) of 0.8, L-arabinose was added to a final concentration of0.01%, and the cells were then induced for another 20 h at 28°C.

Purification was conducted as follows. Briefly, 100 ml of induced cellswas harvested by centrifugation at 4,000 � g for 10 min and resuspendedin 30 ml of binding buffer (50 mM Tris, 100 mM NaCl, 10 mM imidazole[pH 8.0]). The cells were then disrupted by ultrasonication in an ice bathfor 20 min (work for 1 s and stay for 2 s) at 400 W. To remove the celldebris, the lysate was centrifuged at 15,000 � g for 30 min. Subsequently,the supernatant was filtered through a 0.22-�m membrane and then col-lected and loaded onto a 5-ml HisTrap FF crude column (GE Healthcare,Wauwatosa, WI, USA) equilibrated with binding buffer. Impurities wereremoved with washing buffer (50 mM Tris, 100 mM NaCl, 20 mM imi-dazole [pH 8.0]). Finally, the target protein was eluted by elution buffer(50 mM Tris, 100 mM NaCl, 500 mM imidazole [pH 8.0]). An AmiconUltra-15 10K centrifugal filter device (Merck KGaA, Darmstadt, Ger-many) was utilized to remove the imidazole present in the elution buffer.In the end, the target protein was dissolved in storage buffer (20 mM Tris,5 mM EDTA, 5% glycerol [pH 8.0]) and stored at �80°C to prevent loss ofactivity.

Quantification and SDS-PAGE analysis. The protein was quantifiedusing a standard BCA protein assay kit (Pierce, Rockford, IL, USA). SDS-PAGE with a 6% polyacrylamide stacking gel and a 12% polyacrylamideseparating gel was performed to confirm the purity.

Structure similarity analysis and molecular docking. Homologymodeling was performed using Swiss-Model. The Dali server (http://ekhidna.biocenter.helsinki.fi/dali_server) was used for a protein struc-ture similarity search in the Protein Data Bank (PDB). The Dali server is astructure alignment tool based on comparing the similarities of intramo-lecular distance matrices. The result was displayed with a Z-score, thevalue of which represents the similarity between two proteins (18, 19).The molecular docking of pNPB onto Mhg was performed by the Autod-ock plug-in (20) of PyMOL software (21), which performs an exhaustivesearch (based on a combination of simulated annealing and genetic algo-rithm optimizations) of orientation, position, and conformation of rotat-able bonds in the binding site (22).

Activity assay. Aryl esterase activity was detected according to theprotocol developed by Krebsfänger et al. (23). The substrate pNPB wasfirst dissolved in isopropanol (12 mM), and the reaction system contained200 �l of NaH2PO4-Na2HPO4 buffer (50 mM [pH 7.5]), 500 �l of in-duced cells (or 5 �g of purified enzyme), and 10 �l of dissolved substrateto a final concentration of 0.6 mM. The reaction system was then incu-bated at 30°C for 20 min on a Thermo shaker. Finally, the amount ofproduct (p-nitrophenol) was estimated at 405 nm using a DU800 spec-trophotometer (Beckman Coulter, Brea, CA, USA). As for other estercompounds, we used a final substrate concentration of 5 to 10 mM, and

TABLE 1 Primers used in this study

Primer Sequence (5= to 3=)a

Y32A-for ATCCACGGGGCACCGCTGAAY32ANNK-for ATCCACGGGNNKCCGCTGAAY32-rev CGGGCGAGTTCGCCGGTACCF144A-for CGCAGGAGGTCGCAGACGGCATF144NNK-for CGCAGGAGGTCNNKGACGGCATF144-rev CGCGGAAGTCCTCGATCCAF162A-for GGTTCACCGACGCATACAACF162ANNK-for GGTTCACCGACNNKTACAACF162-rev TCGATCGGCAGGATGTTGTCCTTCW204A-for TCGTCCCGACCGCAATCGAGGACTTW204NNK-for TCGTCCCGACCNNKATCGAGGACTTW204-rev TTCAGTGCGGCGTTGACCTCGTI232-for CTACGCCTGGTTCACCGACTTCTACAI232A-rev CGTCGATCGGCAGTGCGTTGTCCTTI232NNK-rev CGTCGATCGGCAGNNKGTTGTCCTTL233-for CTACGCCTGGTTCACCGACTTCTACAL233A-rev CGTCGATCGGTGCGATGTTGTCCTTL233NNK-rev CGTCGATCGGNNKGATGTTGTCCTTa Mutation sites are indicated in bold.

Yan et al.

6750 aem.asm.org November 2016 Volume 82 Number 22Applied and Environmental Microbiology

on January 26, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

the reaction times ranged from 30 min to 16 h for different substrates.Decreases in substrate and increases in product were determined by uti-lizing an Agilent gas chromatography (GC) 7890A system equipped witha HP-5 (30 m by 250 �m by 0.25 �m) column. The GC oven temperaturewas programmed from 60°C (held for 3 min) to 280°C at 15°C/min andthen held for another 10 min. Split injection was used with a split ratio of10:1, and the injector temperature was set at 280°C.

We used a bromophenol blue assay for detection of perhydrolase ac-tivity (24). Each reaction was performed in the following reaction system:200 �l of buffer (1 M NaAc and 1 M NaBr in H2O [pH 5.5]), phenol red(final concentration of 0.056 mM), hydrogen peroxide substrate (finalconcentration of 50 mM), and purified enzyme (5 �g). The reaction mix-tures were incubated at 30°C for 15 min on a Thermo shaker. Finally, wedetermined the amount of bromophenol blue produced by perhydrolysisactivity at 595 nm using a DU800 spectrophotometer.

(�)-�-Lactamase activity was analyzed in a reaction assay in 300 �l ofNaH2PO4-Na2HPO4 buffer (50 mM [pH 7.5]) containing (�)-�-lactam(100 mM) and purified enzyme (5 �g). The reaction solution was incu-bated at 30°C for 10 min on a Thermo shaker and was then extracted with200 �l of ethyl acetate. The decreases in (�)-�-lactam were determinedvia an Acquity H-class ultraperformance liquid chromatograph (UPLC)(Waters, Milford, MA, USA) equipped with a Daicel Chiralpak AS-Hcolumn (250 by 4 mm; Daicel Chemical Industries, Tokyo, Japan). Amixture of acetonitrile and isopropanol with a volume ratio of 85:15 wasused as the mobile phase at a flow rate of 0.8 ml/min. In addition, the UVabsorbance of �-lactam was measured at 230 nm. (�)-�-Lactam and (�)-�-lactam had retention times of 8.55 and 11.05 min, respectively.

Chiral analysis methods. The decreases in (�)-�-lactam were deter-mined via an Acquity H-class UPLC equipped with a Daicel ChiralpakAS-H column, as described above.

The conversion rate and enantiomeric excess (ee) of the methyl phenylglycidate (MPG) and methyl-(�)-3-(4-methoxyphenyl) oxiranecarboxy-late were determined by an HPLC (Waters, MA, USA) equipped with aDaicel Chiralpak OD-H column (250 by 4 mm; Daicel Chemical Indus-tries). A mixture of hexane and isopropyl alcohol with a volume ratio of90:10 was used as the mobile phase at a flow rate of 1.0 ml/min. Theremaining substrate was detected by measuring the absorbance at 254 nmusing a UV-visible (UV-Vis) detector (486 series; Waters).

The conversion rate and ee of methyl 2-tetrahydrofuroate, 3-cyclohex-ene-1-carboxylic acid, and methyl 2-methylbutyrate were determined byan Agilent GC 7890A system equipped with a �-Dex 120 column(0.25-mm diameter, 30-m long; Supelco). Injection and detection weredone at 220°C, with the helium flow rate at 1.0 ml/min. The conditionswere different for the three substrates: for methyl 2-tetrahydrofuroate, thecolumn temperature was kept at 85°C for 5 min and then increased to95°C at a rate of 1°C per min and maintained for 3 min at 95°C; for3-cyclohexene-1-carboxylic acid, the column temperature was kept at30°C for 5 min and then raised to 90°C at 1°C per min and held for another5 min; for methyl 2-methylbutyrate, the column temperature was kept at40°C for 20 min.

Determination of kinetic constants. Kinetic constants for the hydro-lysis of pNPB were determined using the DU800 spectrophotometer asdescribed above. The substrate concentrations were altered from 10 to 400mM to give valid data points. Kinetic constants were then calculated byfitting the data to the Michaelis-Menten equation utilizing Origin 8.0software (OriginLab, Northampton, MA, USA).

Software and online services. The software Vector NTI 8.0 (Infor-max) was used for sequence alignments. Three-dimensional (3D) struc-ture analysis and generation of computer-aided simulation figures wereperformed by using PyMOL software (21).

RESULTSStructure similarity search and activity testing. The Mhg homol-ogy model was constructed by Swiss-Model using (�)-�-lacta-mase from Aureobacterium sp. (PDB code 1HKH) as the template.

Subsequently, a structure similarity search in PDB database wasperformed using the Dali server. The search results indicated that,apart from �-lactamase and perhydrolase, the enzyme most sim-ilar to Mhg was an aryl esterase from Pseudomonas fluorescens(PDB code 1VA4; Z-score of 43). Superimposition of the 1VA4and Mhg models showed that they had the same catalytic triad(Ser-His-Asp) in the same spatial location. Protein sequence anal-ysis showed that the two enzymes shared 52% similarity and 36%identity. Highly similar structures and the presence of the samecatalytic triad between Mhg and esterase 1VA4 hinted that Mhgmay have potential esterase activity. Subsequently, we used severalclassical esterase substrates, 4-nitrophenyl butyrate (pNPB), 4-ni-trophenylcaproate (pNPC), and 1-naphthyl acetate, to test thepossible aryl esterase activity of Mhg. Unfortunately, Mhg did notexhibit any detectable activity with these compounds.

Alanine-scanning mutagenesis at the substrate entrance tun-nel. Since wild-type Mhg exhibited no esterase activity, we rea-soned that it could be due to some crucial amino acid residuesnear to or distal from the active site influencing the binding orcatalysis of ester compounds. In order to find out how these com-pounds interacted with the residues of the binding pocket, wechose pNPB as the target molecule to be docked on the Mhg ho-mology model. As suggested by the docking pose (Fig. 2A), pNPBforms two hydrogen bonds with NH of Met99 and Tyr32, and itscarbonyl carbon is in close proximity to HO of Ser98. The catalyticmechanism of an esterase was reported to be similar to that of anamidase (25). In an amidase, the carbonyl oxygen atom of thesubstrate initially binds to the active site through the oxyanionhole, which is formed by nitrogen atoms of Tyr32 and Met99.Subsequently, the active site Ser98, deprotonated by His259 of thecatalytic triad, attacks the activated carbonyl group to form thetetrahedral intermediate, following which the reaction takes place(26). As shown by the docking result, pNPB binds directly in thebinding pocket with relatively proper positioning. The position ofserine on the ester carbonyl carbon and fixing of carbonyl oxygenby the oxyanion hole make it possible for the catalytic activity tooccur. Thus, there was an indication of catalytic activity of Mhg asan esterase. We then focused on the composition of the entrancetunnel to the binding pocket. There were six amino acid residues:Tyr32, Phe144, Trp204, Phe162, Ile232, and Leu233. We rea-soned that large amino acid side chains lie in the entrance and maypartially block the entrance tunnel of Mhg, thus making it difficultfor the substrate to enter (Fig. 2B). To find out the roles of theseamino acid residues, alanine-scanning mutagenesis was per-formed at the entrance tunnel. Six mutants (with mutations Y32A,F144A, F162A, W204A, I232A, and L233A) were generated by theQuikChange method. Initially, we used whole cells of the six mu-tants to catalyze the hydrolysis of pNPB and found that only theL233A mutant exhibited esterase activity. We then extracted thepurified enzymes and repeated the activity assays, which againdemonstrated that the L233A variant exhibited obvious esteraseactivity toward the classical substrate pNPB.

Saturation mutagenesis. Since the substitution of Leu233 withalanine conferred esterase activity, this residue might offer func-tional plasticity. In order to determine the effects of different res-idues on the esterase activity, saturation mutagenesis was thenperformed at site 233 of Mhg. Nineteen mutants were con-structed, and the purified enzymes were used to perform esteraseactivity assays. Four variants, including the L233A variant andthree others (L233G, L233S, and L233P variants), showed various

Evolution of Esterase Activity from Promiscuous Mhg

November 2016 Volume 82 Number 22 aem.asm.org 6751Applied and Environmental Microbiology

on January 26, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

levels of esterase activity. The specific activities for hydrolyzingpNPB by these variants are listed in Table 2. The fact that the sidechains of each of these four residues are relatively shorter thanleucine possibly highlights the effect of steric hindrance in block-ing the entrance tunnel, thereby preventing the substrates fromentering the binding pocket. These results were consistent withour prediction. The smaller the side chain at site 233, the higherwas the catalytic activity. Notably, substitution with glycine exhib-ited the highest activity, while substitution with proline with apyrrole ring at site 233 was the least active among the four variants.

Since engineering the substrate entrance tunnel successfullyendowed Mhg with ester hydrolysis activity, to further improvethe catalytic efficiency, we performed saturation mutagenesis atother sites (Y32, F144, F162, W204, and I232) lying at the entrancetunnel with the L233A protein as the template. Five libraries wereconstructed by the QuikChange method, and 200 mutants foreach library were screened for the catalytic capability of hydrolyz-ing pNPB. After screening about 1,000 mutants, the L233A-F144Rvariant was found to have the highest specific activity to pNPB at2,953 U/mg, a value 4.2-fold higher than that of the L233A pro-tein. To test whether mutations need to occur in any order forimprovement of activity, an F144R mutant was constructed. Ac-tivity assays showed that the F144R variant, like the F144A variant,could not hydrolyze pNPB to produce p-nitrophenol. This decon-volution experiment argued for the existence of an order of mu-tagenesis for optimization of activity. Subsequently, we coupledF144R with L233S, L233P, or L233G, but unlike the case withL233A-F144R, none of the three variants exhibited an obviousincrease in activity beyond that of their counterparts with singlemutations.

Measurement of kinetics constants. In order to precisely eval-uate the catalytic capabilities of the five variants in hydrolyzingester compounds, their kinetic constants toward pNPB were mea-sured. The kcat and Km values were determined using purified en-zymes with an excess of substrate. The data are listed in Table 2.Consistent with whole-cell and purified enzyme activity assays,the L233G variant displayed the highest esterase activity amongthe four variants owing to its high turnover number (kcat), al-though the smallest-size side chain of glycine led to the weakestsubstrate affinity. The specific activities of the L233P and L233Svariants with pNPB were 206 U/mg and 372 U/mg, respectively,and kinetic data showed that the L233S variant had higher cata-lytic efficiency because of its higher kcat value. The L233A-F144Rvariant exhibited the highest catalytic capability among the fiveactive variants, and its catalytic efficiency (kcat/Km) was 6,439M�1·s�1, which indicated that this variant possessed excellent es-terase activity. Compared to L233A, the newly introduced muta-tion F144R increased the values of kcat and kcat/Km 4.3- and 2.6-fold, respectively.

Activity of the variants toward a series of ester compounds.To test the substrate acceptance of the active variants, a series ofdiverse structural ester compounds was selected and examined bythe esterase assay (Fig. 3). Different from the classical substratepNPB (1a), many compounds were important intermediates inthe synthesis of chiral drugs. For example, the chiral enantiomerof methyl phenyl glycidate (rac-5a) is the precursor of the widelyused anticancer drug paclitaxel. The chiral enantiomer of methyl2-tetrahydrofuroate (rac-10a), a pharmaceutical intermediate,can be used for synthesis of cephalosporin antibiotics. The cata-lytic activities of the five active variants toward ester compoundsare shown in Fig. 4. The five variants exhibited different activitiestoward the 10 different esters tested, and the activity profile foreach variant was substrate dependent. The classical substrates 1a,2a (pNPC), and rac-7a could be hydrolyzed by all five variants toproduce corresponding hydroxyl compounds. The specific activ-ities of the five variants to these three substrates ranged from 45U/mg to 2,953 U/mg, with the L233A-F144R and L233G variantsexhibiting much higher activities than the other three variants.However, for the compounds rac-5a and rac-9a, the specific activ-ities ranged from 1 U/mg to 4.5 U/mg, with the L233S variant

FIG 2 Illustration of the substrate binding state of Mhg by docking of the pNPB molecule. (A) Detailed view of the interaction of pNPB with an oxyanion holeand active site. (B) Surface representation of the entry of the binding pocket bound to pNPB.

TABLE 2 Kinetic constants for hydrolysis of pNPB

Catalyst(mutation) Km (mM) kcat (s�1)

kcat/Km

(M�1·s�1)Specific activity(U/mg)

L233A 14.7 � 1.2 36.0 � 0.2 2,444 696 � 25L233S 18.5 � 1.9 19.2 � 0.5 1,037 372 � 18L233P 13.3 � 0.3 10.6 � 0.3 799 206 � 37L233G 27.4 � 2.0 137 � 1.7 5,017 2,665 � 58L233A-F144R 23.7 � 1.7 153 � 1.2 6,439 2,953 � 39

Yan et al.

6752 aem.asm.org November 2016 Volume 82 Number 22Applied and Environmental Microbiology

on January 26, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

showing the highest activity. The other esters, rac-4a, rac-8a, andrac-10a, could be catalyzed by all five variants, but the specificactivities were lower than 1 U/mg, while rac-3a and rac-6a couldnot be hydrolyzed by the L233G or L233A-F144R variant. TheL233P variant exhibited highest activity toward the latter five es-ters. To summarize, among all five variants, the L233A, L233S, andL233P variants could catalyze the hydrolysis of each of the 10esters tested, while the L233G and L233A-F144R variants couldcatalyze the hydrolysis of eight. In addition, between the classicalesterase substrates 1a and 2a, all five variants showed a 10-foldhigher activity for 1a than for 2a, which indicated that the activevariants we created were aryl esterases rather than lipases.

The enantiomeric excesses (ee) of the racemic substrates afterthe reactions were determined by chiral HPLC and GC as de-scribed in Materials and Methods. For each racemic substrate,only the data for the highest activities and ee values among the fivevariants are listed in Table 3. Unfortunately, the four esterase vari-ants did not exhibit excellent enantioselectivity. The highest eevalue was 46% when the L233S variant catalyzed rac-5a. In thisstudy, we did not make any further efforts to improve their enan-tioselectivities. In this regard, several strategies, such as iterativesaturation mutagenesis (ISM) and inducing allostery, etc., couldpotentially be employed (9, 27).

�-Lactamase and perhydrolase activities of the variants. Inview of the multiple effects of mutations on enzyme properties,the original �-lactamase and perhydrolase activities of the fivevariants were analyzed (Fig. 5). The results showed that none ofthe five variants retained their perhydrolase activity. The L233A,

L233S, and L233P variants retained their �-lactam-hydrolyzingcapability but showed an obvious decrease in activity. The L233Gand L233A-F144R variants lost �-lactamase as well as perhydro-lase activities and exhibited esterase activity exclusively. These ob-servations indicated that we successfully evolved a promiscuousMhg to a novel specific enzyme, an esterase.

DISCUSSION

Increasing evidence suggests that promiscuous enzymes are notrare exceptions but are rather widespread (28). Promiscuous en-zymes are considered to be the starting points for the evolution ofnew activities. In this study, we chose the promiscuous enzymeMhg as a model, which showed both �-lactamase and perhydro-lase activities but did not possess any esterase activity. Moleculardocking and sequence analysis suggested a possible role for thesubstrate entrance tunnel in preventing the esterase activity ofMhg. In this study, we validated this hypothesis and successfullyconstructed esterase activity in Mhg by engineering the entrancetunnel. Through alanine-scanning mutagenesis and saturationsite-directed mutagenesis, we successfully obtained five variantsthat exhibited esterase activity, illustrating the effect of steric hin-drance in blocking the entrance tunnel of wild-type Mhg. The fiveesterases could catalyze not only the classical substrates but also avariety of diversely structural chiral ester substrates.

The L233 site is located at the rim of the entrance tunnel (Fig.2B) and can significantly influence the size and shape of the tun-nel. In Mhg, substitution of leucine at this site with amino acids(glycine, alanine, serine, and proline) that have relatively shorter

FIG 3 Ester compounds chosen to assay the hydrolytic activities of the Mhg variants.

Evolution of Esterase Activity from Promiscuous Mhg

November 2016 Volume 82 Number 22 aem.asm.org 6753Applied and Environmental Microbiology

on January 26, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

side chains successfully conferred esterase activity since the obsta-cle at the entrance was removed. Among the four active variants,the L233G variant exhibited the highest esterase activity withpNPB as the substrate, although its affinity was the lowest. Thisfact may due to a “slipping off” effect of the substrate. Glycine hasthe shortest carbon chain, leading to a cavity in which substratecan not only enter but also easily slip off. Similarly, the five-mem-bered pyrrole ring in proline and the relatively complex structuremay cause the substrate to fix to the binding pocket, which couldaccount for its highest affinity. The L233A-F144R variant exhib-

FIG 5 Relative activities of wild-type (WT) Mhg and its esterase variantsfor perhydrolase, (�)-�-lactamase, and esterase activities. Data are shownas logarithmic values in the histogram, and reactions were performed un-der standard enzyme assay conditions. Hydrogen peroxide, (�)-�-lactam,and 4-nitrophenyl butyrate (pNPB) were used to determine the specificactivities of perhydrolase, (�)-�-lactamase, and esterase, respectively. Thespecific perhydrolase activity of the wild type (6,040 U/mg) was taken as100%. Relative activity �0.01 U/mg is shown as 0.012 U/mg for legibility.Error bars represent standard deviations from three independent experi-ments.

FIG 4 Overview of the performance of the Mhg variants in hydrolysis of various esters. Data are shown as logarithmic values in the radar map, and the unit isunits per milligram. Activities �0.01 U/mg are depicted as 0.01 U/mg. The original data are provided in the supplemental material.

TABLE 3 Enantioselectivity of racemic esters catalyzed by the Mhgvariants

SubstrateVariant(mutation)

Reactiontime (h) Conversion (%)a ee (%)

rac-3a L233P 16 53 25rac-4a L233P 16 67 21rac-5a L233S 2 51 46rac-6a L233P 16 71 NDb

rac-7a L233G 0.25 70 NDrac-8a L233P 16 80 NDrac-9a L233S 2 45 27rac-10a L233P 16 72 25a Conditions: 10 mM substrate, 100 �g of enzyme in phosphate buffer (50 mM, pH7.5), 30°C for varying time intervals ranging from 15 min to 16 h. Conversion rateswere adjusted for proper determination of ee values.b ND, not determined.

Yan et al.

6754 aem.asm.org November 2016 Volume 82 Number 22Applied and Environmental Microbiology

on January 26, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

ited the highest activity, which may result from the synergisticeffects of the two sites (9).

Esterase is predicted to be the ancestor of a number of differenttypes of enzymes (25). In the research of evolutionary analysis,Devamani and his coworkers found that the predicted ancestralenzymes of hydroxyl nitrile lyases shared the Ser-His-Asp catalytictriad and that they had a conserved function of hydrolysis of esters(29). We found that the members of the �-lactamase family alwayshave characteristics that are more or less similar to those of theesterase family. Almost all of the �-lactamases discovered so farbelong to the /� hydrolase family, which also includes the es-terase family (30). Therefore, we presumed that the ancestral en-zymes from which Mhg evolved probably possessed esterase ac-tivity and that �-lactamase and perhydrolase activities may bemodern activities that gradually evolved from the esterase activitythough divergent evolution.

Previous studies indicate that in many promiscuous enzymes,there is a trade-off between acquired and original activities (11,31). In this study, the trade-off relationship between the threeactivities was also observed. Mutations have a great impact on theenzyme, leading to a sharp decline in original activities. In ourresearch, the L233 site is crucial because a single point mutation atthis site turns Mhg into an esterase. Combined with previous re-search by our team, we developed a histogram that displayed therelationship of the different L233 site variants with their respectiveenzyme activities (Fig. 6). Consistent with the trade-off men-tioned above, we did not recover any variant that has all threeenzyme activities simultaneously. We believe that the new activityis obtained at the expense of the original activity. Additionally,three variants only retain one kind of activity: the L233M varianthas only perhydrolase activity; the L233T variant has only �-lac-tamase activity; and the L233G variant has only esterase activity.Thus, we obtained variants with single activity from promiscuousMhg through saturation mutagenesis at the L233 site.

The L233 site is crucial for Mhg because it differentiates be-tween the three possible activities: perhydrolase, (�)-�-lacta-mase, and esterase. Subsequently, in the process of computational

analysis of a series of promiscuous enzymes that share high struc-tural similarities with Mhg, such as PDB entries 1BRO, 1VA4, and1M33, we found that the corresponding site was a conserved leu-cine or valine. Our results indicate that the Leu/Val site has auniversal significance for determining the catalytic activities inthis correlative /� hydrolase family. As proven by our study,single activities are expected to be easily separated through satu-ration mutagenesis at this site.

In the present study, we demonstrate that engineering of thesubstrate entrance tunnel is an effective strategy to regulate thecatalytic activities and substrate specificities. Although not com-monly used, this method is important for engineering enzymes intheir binding pocket. Moreover, enzyme promiscuity plays an im-portant role in evolving new catalytic activities, and fine-tuning ofprotein engineering might influence enzyme performance. Forexample, mutagenesis at one single point could dramatically reg-ulate several activities of a promiscuous enzyme.

ACKNOWLEDGMENT

This work was supported by a grant from National Natural Science Foun-dation of China (31570077 to S.W.).

FUNDING INFORMATIONThis work, including the efforts of Sheng Wu, was funded by NationalNatural Science Foundation of China (NSFC) (31570077).

REFERENCES1. van Loo B, Jonas S, Babtie AC, Benjdia A, Berteau O, Hyvönen M,

Hollfelder F. 2010. An efficient, multiply promiscuous hydrolase in thealkaline phosphatase superfamily. Proc Natl Acad Sci U S A 107:2740 –2745. http://dx.doi.org/10.1073/pnas.0903951107.

2. Afriat L, Roodveldt C, Manco G, Tawfik DS. 2006. The latent promis-cuity of newly identified microbial lactonases is linked to a recently di-verged phosphotriesterase. Biochemistry 45:13677–13686. http://dx.doi.org/10.1021/bi061268r.

3. Anandarajah K, Kiefer PM, Jr, Donohoe BS, Copley SD. 2000. Recruit-ment of a double bond isomerase to serve as a reductive dehalogenaseduring biodegradation of pentachlorophenol. Biochemistry 39:5303–5311. http://dx.doi.org/10.1021/bi9923813.

4. Lamble HJ, Heyer NI, Bull SD, Hough DW, Danson MJ. 2003.

FIG 6 Relative activities of all Mhg variants at the L233 site for perhydrolase, (�)-�-lactamase, and esterase. Data are shown as logarithmic values in thehistogram, and reactions were performed under standard enzyme assay conditions. Hydrogen peroxide, (�)-�-lactam, and pNPB were used to determine thespecific activities of perhydrolase, (�)-�-lactamase, and esterase, respectively. The other 12 variants lost all three activities or totally formed inclusion bodies.The specific perhydrolase activity of wild-type Mhg (6,040 U/mg) was taken as 100%. Relative activity �0.01 U/mg is shown as 0.012 U/mg for legibility. Errorbars represent standard deviations from three independent experiments.

Evolution of Esterase Activity from Promiscuous Mhg

November 2016 Volume 82 Number 22 aem.asm.org 6755Applied and Environmental Microbiology

on January 26, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Metabolic pathway promiscuity in the archaeon Sulfolobus solfataricusrevealed by studies on glucose dehydrogenase and 2-keto-3-deoxygluconate aldolase. J Biol Chem 278:34066 –34072. http://dx.doi.org/10.1074/jbc.M305818200.

5. Yoshikuni Y, Ferrin TE, Keasling JD. 2006. Designed divergent evolu-tion of enzyme function. Nature 440:1078 –1082. http://dx.doi.org/10.1038/nature04607.

6. Khersonsky O, Tawfik DS. 2010. Enzyme promiscuity: a mechanistic andevolutionary perspective. Annu Rev Biochem 79:471–505. http://dx.doi.org/10.1146/annurev-biochem-030409-143718.

7. Ouzounis CA, Kunin V, Darzentas N, Goldovsky L. 2006. A minimalestimate for the gene content of the last universal common ancestor–exobiology from a terrestrial perspective. Res Microbiol 157:57– 68. http://dx.doi.org/10.1016/j.resmic.2005.06.015.

8. Yin DL, Bernhardt P, Morley KL, Jiang Y, Cheeseman JD, Purpero V,Schrag JD, Kazlauskas RJ. 2010. Switching catalysis from hydrolysis toperhydrolysis in Pseudomonas fluorescens esterase. Biochemistry 49:1931–1942. http://dx.doi.org/10.1021/bi9021268.

9. Wu S, Acevedo JP, Reetz MT. 2010. Induced allostery in the directedevolution of an enantioselective Baeyer-Villiger monooxygenase. ProcNatl Acad Sci U S A 107:2275–2280. http://dx.doi.org/10.1073/pnas.0911656107.

10. Goodey NM, Benkovic SJ. 2008. Allosteric regulation and catalysisemerge via a common route. Nat Chem Biol 4:474 – 482. http://dx.doi.org/10.1038/nchembio.98.

11. Chaloupková R, Sýkorová J, Prokop Z, Jesenská A, Monincová M,Pavlová M, Tsuda M, Nagata Y, Damborský J. 2003. Modification ofactivity and specificity of haloalkane dehalogenase from Sphingomonaspaucimobilis UT26 by engineering of its entrance tunnel. J Biol Chem278:52622–52628. http://dx.doi.org/10.1074/jbc.M306762200.

12. Kotik M, Stepánek V, Kyslík P, Maresová H. 2007. Cloning of an epoxidehydrolase-encoding gene from Aspergillus niger M200, overexpression inE. coli, and modification of activity and enantioselectivity of the enzyme byprotein engineering. J Biotechnol 132:8 –15. http://dx.doi.org/10.1016/j.jbiotec.2007.08.014.

13. Wang JJ, Guo XY, Zheng GJ, Wen C. 2009. Purification and characteriza-tion of a novel (�) gamma-lactamase from Microbacterium hydrocarbon-oxydans. Ann Microbiol 59:345–348. http://dx.doi.org/10.1007/BF03178337.

14. Singh R, Vince R. 2012. 2-Azabicyclo[2.2.1]hept-5-en-3-one: chemicalprofile of a versatile synthetic building block and its impact on the devel-opment of therapeutics. Chem Rev 112:4642– 4686. http://dx.doi.org/10.1021/cr2004822.

15. Sun Y, Zhao HT, Wang JJ, Zhu JG, Wu S. 2015. Identification andregulation of the catalytic promiscuity of (�)-�-lactamase from Micro-bacterium hydrocarbonoxydans. Appl Microbiol Biotechnol 99:7559 –7568. http://dx.doi.org/10.1007/s00253-015-6503-7.

16. Hogrefe HH, Cline J, Youngblood GL, Allen RM. 2002. Creating ran-domized amino acid libraries with the QuikChange multi site-directedmutagenesis kit. Biotechniques 33:1158 –1160.

17. Reetz MT, Wu S. 2008. Greatly reduced amino acid alphabets in directedevolution: making the right choice for saturation mutagenesis at homol-

ogous enzyme positions. Chem Commun (Camb) 43:5499 –5501. http://dx.doi.org/10.1039/b813388c.

18. Holm L, Rosenström P. 2010. Dali server: conservation mapping in 3D.Nucleic Acids Res 38(Web Server issue):W545–W549. http://dx.doi.org/10.1093/nar/gkq366.

19. Holm L, Kääriäinen S, Rosenström P, Schenkel A. 2008. Searchingprotein structure databases with DaliLite v.3. Bioinformatics 24:2780 –2781. http://dx.doi.org/10.1093/bioinformatics/btn507.

20. Seeliger D, de Groot BL. 2010. Ligand docking and binding site analysiswith PyMOL and Autodock/Vina. J Comput Aided Mol Des 24:417– 422.http://dx.doi.org/10.1007/s10822-010-9352-6.

21. DeLano W. 2002. The PyMOL molecular graphics system. http://www.pymol.org.

22. Zhao H, Caflisch A. 2014. Discovery of dual ZAP70 and Syk kinasesinhibitors by docking into a rare C-helix-out conformation of Syk. BioorgMed Chem Lett 24:1523–1527. http://dx.doi.org/10.1016/j.bmcl.2014.01.083.

23. Krebsfänger N, Zocher F, Altenbuchner J, Bornscheuer UT. 1998.Characterization and enantioselectivity of a recombinant esterase fromPseudomonas fluorescens. Enzyme Microb Technol 22:641– 646. http://dx.doi.org/10.1016/S0141-0229(98)00004-0.

24. Song JK, Ahn HJ, Kim HS, Song BK. 2006. Molecular cloning andexpression of perhydrolase genes from Pseudomonas aeruginosa and Burk-holderia cepacia in Escherichia coli. Biotechnol Lett 28:849 – 856. http://dx.doi.org/10.1007/s10529-006-9016-8.

25. Rauwerdink A, Kazlauskas RJ. 2015. How the same core catalytic ma-chinery catalyzes 17 different reactions: the serine-histidine-aspartate cat-alytic triad of /�-hydrolase fold enzymes. ACS Catal 5:6153– 6174. http://dx.doi.org/10.1021/acscatal.5b01539.

26. Line K, Isupov MN, Littlechild JA. 2004. The crystal structure of a (�)gamma-lactamase from an Aureobacterium species reveals a tetrahedralintermediate in the active site. J Mol Biol 338:519 –532. http://dx.doi.org/10.1016/j.jmb.2004.03.001.

27. Reetz MT. 2004. Controlling the enantioselectivity of enzymes by directedevolution: practical and theoretical ramifications. Proc Natl Acad SciU S A 101:5716 –5722. http://dx.doi.org/10.1073/pnas.0306866101.

28. Chakraborty S, Rao BJ. 2012. A measure of the promiscuity of proteinsand characteristics of residues in the vicinity of the catalytic site that reg-ulate promiscuity. PLoS One 7:e32011. http://dx.doi.org/10.1371/journal.pone.0032011.

29. Devamani T, Rauwerdink AM, Lunzer M, Jones BJ, Mooney JL, TanMA, Zhang ZJ, Xu JH, Dean AM, Kazlauskas RJ. 2016. Catalytic pro-miscuity of ancestral esterases and hydroxynitrile lyases. J Am Chem Soc138:1046 –1056. http://dx.doi.org/10.1021/jacs.5b12209.

30. Holmquist M. 2000. Alpha/beta-hydrolase fold enzymes: structures,functions and mechanisms. Curr Protein Pept Sci 1:209 –235. http://dx.doi.org/10.2174/1389203003381405.

31. Rowe LA, Geddie ML, Alexander OB, Matsumura I. 2003. A com-parison of directed evolution approaches using the beta-glucuronidasemodel system. J Mol Biol 332:851– 860. http://dx.doi.org/10.1016/S0022-2836(03)00972-0.

Yan et al.

6756 aem.asm.org November 2016 Volume 82 Number 22Applied and Environmental Microbiology

on January 26, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from