Expression profiles of Arabidopsis thaliana in mineral deficiencies reveal novel transporters involved in metal homeostasis

Expression Profiles of Arabidopsis thaliana in Mineral DeficienciesReveal Novel Transporters Involved in Metal Homeostasis*□S

Received for publication, August 22, 2003, and in revised form, September 12, 2003Published, JBC Papers in Press, September 16, 2003, DOI 10.1074/jbc.M309338200

Henri Wintz‡§, Tama Fox‡¶, Ying-Ying Wu‡, Victoria Feng‡, Wenqiong Chen�, Hur-Song Chang�,Tong Zhu�, and Chris Vulpe‡

From the ‡Department of Nutritional Sciences and Toxicology, University of California, Berkeley, California 94720and the �Torrey Mesa Research Institute, Inc., San Diego, California 92121

Plants directly assimilate minerals from the environ-ment and thus are key for acquisition of metals by allsubsequent consumers. Limited bio-availability of cop-per, zinc and iron in soil decreases both the agronomicproductivity and the nutrient quality of crops. Under-standing the molecular mechanisms underlying metalhomeostasis in plants is a prerequisite to optimizingplant yield and metal nutrient content. To absorb andmaintain a balance of potentially toxic metal ions,plants utilize poorly understood mechanisms involvinga large number of membrane transporters and metal-binding proteins with overlapping substrate specifici-ties and complex regulation. To better understand thefunction and the integrated regulation, we analyzed inArabidopsis the expression patterns in roots and inleaves of 53 genes coding for known or potential metaltransporters, in response to copper, zinc, and iron defi-ciencies in Arabidopsis. Comparative analysis of geneexpression profiles revealed specific transcriptionalregulation by metals of the genes contrasting with theknown wide substrate specificities of the encoded trans-porters. Our analysis suggested novel transport roles forseveral gene products and we used functional comple-mentation of yeast mutants to correlate specific regula-tion by metals with transport activity. We demonstratethat two ZIP genes, ZIP2 and ZIP4, are involved in cop-per transport. We also present evidence that AtOPT3, amember of the oligopeptide transporter gene familywith significant similarities to the maize iron-phyto-siderophore transporter YS1, is regulated by metals andheterologous expression AtOPT3 can rescue yeast mu-tants deficient in metal transport.

All organisms require metal prosthetic groups for theirunique catalytic and structural properties. In proteins, copper

and iron catalyze reduction-oxidation reactions, while zincplays an essential structural or enzymatic role. Yet most metalions are very reactive and can be toxic to cells when present inexcess. Thus, it is important for organisms to maintain ade-quate levels of metals in tight homeostasis using complex andoften evolutionarily conserved mechanisms for the uptake andtransport of low solubility metals and storage of metal ions ina non-toxic form. Despite rapid progress in recent years of ourunderstanding of metal homeostasis in yeast, (1) our knowl-edge of metal metabolism in plants is still rudimentary (2).

A large number of cation transporters potentially involved inmetal ion homeostasis have been identified on the genome ofthe model plant Arabidopsis thaliana (3). Several members ofthe 15 ZIP gene family (4) and of the 6 NRAMP family oftransporters (3) have been characterized and shown to be in-volved in metal uptake and transport in plants (5–10). ABCtransporters (11) and P-type ATPase pumps (12, 13) are alsoknown to be involved in metal ions trafficking metals intoorganelles. Since metals are cytotoxic as free ions, they arechelated for both intracellular storage and long-distance trans-port. These chelators are either enzymatically synthesizedsmall molecular weight compounds, such as nicotianamine(NA)1 and phytochelatin, or proteins, such as metallothionein(MT) and metal chaperones. Four NA synthase genes, NAS1–3(14), two phytochelatin synthase (PCS) genes (15), and sevenMT genes (16–18) have been identified. AtCCH, a homologue tothe copper chaperone Atx1p of Saccharomyces cerevisiae, playsa role in intracellular copper transport (19, 20), while thefunction of 29 additional proteins containing an Atx1p-likeheavy metal binding site (HMA) is unknown (21, 22). Further-more, four genes encoding ferritin subunits have been identi-fied (23), which form iron storage complexes within chloro-plasts. The individual analysis of components of copper, zinc,and iron metabolism has provided important but limited in-sight into metal homeostasis in plants (for recent reviews, seeRefs. 3 and 24). These findings do not provide a cohesive inte-grated model of the metabolism of multiple metals. First, thereare large numbers of genes encoding proteins known or likelyto play a role in metal transport. Second, the plant transportersthat have been studied in heterologous systems exhibit lowselectivity in the metal species transported.

Functional studies using yeast complementation have re-vealed wide substrate specificities but failed to identify thespecific in planta function for most of the transporters. Thetranscriptional patterns in response to metal deficiencies could

* This work was supported by a grant from the Hellmann Familyfund, a Faculty Research Grant (University of California, Berkeley), bythe Syngenta Agricultural Discovery Institute, and by the InternationalCopper Association. The costs of publication of this article were de-frayed in part by the payment of page charges. This article musttherefore be hereby marked “advertisement” in accordance with 18U.S.C. Section 1734 solely to indicate this fact.

□S The on-line version of this article (available at http://www.jbc.org)contains Supplemental Table S1.

§ Supported in part by the Centre National de la Recherche Scientifiqueand by an Organization for Economic Cooperation and Development fellow-ship “Cooperative Research Programme: Biological Resource ManagementFor Sustainable Agricultural Systems.” To whom correspondence should beaddressed: Dept. of Nutritional Sciences and Toxicology, University of Cal-ifornia, 119 Morgan Hall, Berkeley, CA 94720. Tel.: 510-642-7386; Fax:510-642-0535; E-mail: [email protected].

¶ Current address: Agronomy and Range Science, One Shields Ave.,University of California, Davis, CA 95616-8515.

1 The abbreviations used are: NA, nicotianamine; MT, metallothi-onein; MES, 4-morpholineethanesulfonic acid; HEDTA, hydroxyethyl-ethylenediaminetriacetate; ICP, inductively coupled plasma; ADI, av-erage difference intensity; RT, reverse transcription; SOD, superoxidedismutase; PC, phytochelatin; PS, phytosiderophore.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 48, Issue of November 28, pp. 47644–47653, 2003© 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org47644

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

by guest on D

ecember 1, 2016

http://ww

w.jbc.org/

Dow

nloaded from

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

by guest on D

ecember 1, 2016

http://ww

w.jbc.org/

Dow

nloaded from

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

yield useful information bearing on the function of the genes.We have therefore undertaken a large-scale analysis of geneexpression profiles in Arabidopsis plants subjected to nutri-tional deficiencies in three essential metals using AffymetrixDNA microarrays containing 8,300 Arabidopsis genes. The re-sponse of plants to mineral deficiencies likely involves a com-plex regulatory cascade ultimately resulting in changes in ex-pression of key transporters and metal homeostasis proteins aswell as by inducing changes in their growth patterns. In thisreport, we focus on the changes in expression of genes codingfor transporters and metal homeostasis proteins that are pres-ent on the 8.3K Arabidopsis DNA chip and were shown previ-ously or in this study to be regulated in response to copper,zinc, and iron deficiency. The very specific transcriptional reg-ulation observed, in contrast to the wide substrate specificity ofmany metal transporters, suggests primarily transcriptionalregulatory control of metal homeostasis in plants. In addition,our expression analysis and confirmatory functional comple-mentation studies revealed previously unsuspected roles forseveral trans-membrane transporters in metal homeostasis.

EXPERIMENTAL PROCEDURES

Plant Growth—Arabidopsis thaliana Columbia were asepticallygrown on hydroponics at 20 °C under a 16-h light/8-h dark cycle. Con-trol plants were grown on a modified Gamborg’s B-5 medium containingfull-strength Gamborg’s B-5 salts, 1 � Gamborg’s vitamins, and 2 mM

MES-KOH, pH 5.50. All chemical were purchased from Sigma. Toinduce copper deficiency, plants were first germinated on the samemedium lacking copper. These plants remain healthy due to tracecopper contamination, since the free copper activity must be kept below�1 � 10�14 M to induce copper deficiency. After 5 weeks of growth, thenutrient solution was replaced by a chelate-buffered medium (25) toinduce copper deficiency, in which HEDTA (hydroxyethylethylenedi-aminetriacetate) was added to copper-free medium at a level 25 �M inexcess of the sum of the divalent metal concentrations (iron, zinc,manganese, and nickel). The speciation program Geochem-PC was em-ployed to calculate free metal activities to design a hydroponics solutionthat was specific for copper deficiency while ensuring sufficiency inother metals. Zinc was accordingly increased to 0.7 mM to keep itsactivity above �1 � 10�11 M. The copper-deficient chelate buffer thusconsisted of Gamborg’s B-5 salts lacking copper, 0.7 mM ZnSO4, 0.88 mM

HEDTA, 2 mM MES-KOH, pH 5.50, and Gamborg’s vitamins. Plantswere grown for 5 days on HEDTA-buffered copper-deficient mediumbefore the roots and the leaves were harvested for RNA extraction. Asimilar approach was used to induce zinc deficiency as in Grotz et al.(26), except we employed an HEDTA buffer instead of an EDTA buffer.Plants were germinated and grown on control growth medium (contain-ing zinc). After 5 weeks, the medium was replaced by a HEDTA-buffered zinc-deficient medium (calculated using Geochem-PC to en-sure copper sufficiency). The zinc-deficient chelate buffer consisted ofGamborg’s B-5 salts without zinc, 10 �M CuSO4 (to keep copper activ-ities above �1 � 10�14 M), 0.2 mM HEDTA, 2 mM MES-KOH, pH 5.50,and Gamborg’s vitamins. Plants were grown for 5 days on the HEDTA-buffered zinc-deficient medium before the roots and leaves were har-vested for RNA extraction. For iron deficiency, plants were germinatedand grown for 5 weeks on control growth medium, after which themedium was replaced by control medium lacking FeSO4/EDTA butcontaining 50 �M ferrozine to capture trace iron contamination. Rootsand leaves were harvested after 5 days of growth in the ferrozine-containing medium. Tissues were frozen in liquid nitrogen and stored at�80° C until the RNA was extracted. The biological replicates consistedof plants that were grown independently for RNA extraction. For ICPanalysis plants were washed twice in 50 mM EDTA and twice in deion-ized water, dried, and digested in 50% metal grade nitric acid using amicrowave digestor.

Dataset Collection, Data Processing, and Data Analysis—Arabidop-sis GeneChips (Affymetrix, Santa Clara, CA) containing 8,300 genes(27) were employed. RNA extractions, cDNA synthesis, array hybrid-ization, and overall intensity normalization were performed as de-scribed previously (28). All GeneChip hybridization were performed induplicate (technical replicates) to extract an average difference inten-sity (ADI) value for all of the genes tested. To process the data, any ADIthat was less than 5 was brought up to 5. False positives were identifiedas those genes which averaged technical replicate ADIs were greater

than 25 and which exhibited 2-fold difference between the two biologicalreplicates. The false positive genes were excluded from further analysis.A two-sample t test was then performed (separately for leaves or forroots) to obtain genes which ADI statistically differed between thetreatments and their corresponding controls (p � 0.15). Since the metaldeficiency experiments were done twice at different times, only thosegenes that were present in both lists of t tests were kept for further dataprocessing. Finally, fold changes were calculated by dividing the aver-age ADI values of the replicated samples from each nutritional defi-ciency treatment by the average ADI values from their correspondingreplicated controls. Only those genes with fold changes greater than 2or less than 0.5 in both experimental replicates were considered. TheADI was used as a measure of the expression levels of genes in Figs. 4and 5. Actin (At2g37620), �-tubulin (At5g09810), and actin7(At5g09810) represented controls for low, medium, and highly ex-pressed genes, respectively. Complete data sets are available by requestfrom corresponding author.

RNA Blots and Reverse Transcription (RT)-PCR—For Northern blots10 �g of RNA were run in a 1.2% agarose-formaldehyde gel and trans-ferred onto nylon membrane (Amersham Biosciences). Hybridization to(29)dCTP-labeled DNA probes was carried out at 42 °C in 50% form-amide, 6 � SSC, 0.1%SDS, 2 � Denharts solution. For RT, 5 �g of RNAwere reverse-transcribed using Superscript reverse transcriptase (In-vitrogen) according to the manufacturer’s instructions. QuantitativeRT-PCR was carried out using Taq DNA polymerase as directed by thesupplier (Takara Shuzo Co., Shiga, Japan). Between 20 and 27 cycles(30 s at 94 °C, 60 s at 50 °C, and 60 s at 72 °C) were performed in a 50-�lvolume. 5 �l of the reaction were analyzed on a 1% agarose � ethidiumbromide gel that was photographed using a digital imager (ChemilIm-ager 4400, Alpha Innotech Corp., San Leandro, CA) and analyzed usingimage analysis software (AlphaEaseTM, Alpha Innotech Corp.). Ampli-fied �-tubulin gene was used to normalize the data. Oligonucleotideswere designed to amplify 500–600 bp of the 5� end of the genes (ZIP-2F,TAGCAGCCGCTGGATATTGC; ZIP-2R, GAGATGGTTAACCGCAAC-GTACA; ZIP4-F, GCTGCTGGTAGTGAAGAGAT; ZIP4-R, ATCAGCT-GCGATGAGGTCCA; ZIP5-F, GAGTTTCCGTTCACAGGCTT; ZIP5-R,GACATATAGATGAGGATGCC; ZIP6-F, GATTTAACGGCGAGTGAA-CA; ZIP6-R, TTGAGGCGAGAACCCGATTC; ZIP9-F, TCTGAGAGAT-CAAGAAGATGG; ZIP9-R, CACTCATCTTCTTGCTCAAG; OPT3-F,ACCAGGATATGATATAATAGGGCAG; OPT3-R, CACCATTTGAGGT-CGTGTCC; B-TUBULIN-F, GTTGGGTTGCACCACTCAC; B-TUBUL-IN-R, ACCCTTCTTCCTCATCAGCC.

Yeast Work—The S. cerevisiae KO strains used in this study arederived from BY4741 and were obtained from Research Genetics (ww-w.resgen.com). The fet3fet4 mutant was in the DEY1453 background(5). For yeast functional complementation studies, cDNAs were ampli-fied using ex Taq polymerase (Takara Bio Inc.), cloned into the yeastvector pFL61, sequence-verified, and transformed into yeast mutantsusing standard procedures. Yeast growth media were purchased fromQbiogen (Carlsbad, CA). Nicotianamine was purchased from HasegawaCo. (Tokyo, Japan).

Yeast mutants were grown in SD medium lacking divalent ionssupplemented with the appropriate amino acids and metal salts con-taining either glucose (2%) or glycerol (2%). Manganese and iron-lim-ited medium were obtained by omitting manganese and iron salts fromthe synthetic defined medium. Growth curves were performed in 96-well plates (150-�l culture volume) using a SpectraMax®190 platereader (Molecular Devices, Sunnyvale, CA). OD600 was measured every20 min over 48 h.

For elemental analysis of yeast, cells were grown to exponential logphase in SD medium containing 2% glucose. 50 ml of cells at OD600 �1 were centrifuged and washed twice in 20 mM EDTA followed by twowashings in deionized water. The cell pellet was dried and digested in500 �l of 100% HNO3 at 70 °C for 18 h. Copper content was analyzed byICP-atomic emission spectrometry at 224 nm.

RESULTS

Regulation of ZIP Genes by Copper, Zinc, and Iron—Sixmembers of the 15-member ZIP family of genes coding forzinc/iron permeases are present on the DNA microarrays usedin this work (Table I). The gene coding for IRT1, the major ironuptake transporter in Arabidopsis, is not present in the chipsand thus not included in this analysis. Our results showed thatZIP genes can be regulated by zinc (ZIP4, ZIP5, ZIP9), iron(IRT2), and copper (ZIP2 and ZIP4) both in the roots and in theleaves (Table IIA and Figs. 1 and 2).

Metal Homeostasis in Arabidopsis 47645

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

A Role for ZIP2 and ZIP4 in Copper Transport—Microarrayand RT-PCR results indicated that ZIP2 and ZIP4 are inducedin copper deficiency and repressed in copper excess (Table IIAand Fig. 2). However, they were not responsive to the samelevels of copper deficiency; we observed a sharp increase inexpression of ZIP4 only in plants subjected to 3 weeks ofgrowth on a copper-deficient HEDTA buffered medium (Fig. 2)but not after the 5-day treatment used in the microarray ex-periments. Copper deficiency was confirmed by measuring ofcopper content in whole plants using ICP-EAS. Copper levels indeficient plants were 2.5 �g/g of dry weight compared with 7�g/g of dry weight in control plants. The response of ZIP5 to

copper deficiency observed in the microarray experiment couldnot be confirmed by RT-PCR, suggesting that the induction weobserved in our microarray analysis may not be significant.These results imply that ZIP2 and ZIP4 are involved in coppertransport. To confirm this, we have cloned ZIP2 and ZIP4cDNAs in the yeast expression vector pFL61 (30) and expressedit in yeast lacking high affinity copper uptake (�ctr1). BothZIP2 and ZIP4 can restore growth of �ctr1 on a non-ferment-able medium (1% yeast extract, 2% peptone, 2% glycerol(YPG)), indicating that both genes can function as coppertransporter in yeast (Fig. 3A). Measurement of copper contentof ZIP2 expressing �ctr1 cells harvested in log phase of growth

TABLE IGenes analyzed in this work

Metal Homeostasis in Arabidopsis47646

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

on fermentable SD medium (Fig. 3B) indicate that ZIP2-ex-pressing cells have a higher content of copper compared withthe �ctr1 mutant transformed with the vector alone (Fig. 3B).Our results and previous work (26) suggest and are consistentwith a role for ZIP2 in root copper and zinc homeostasis and arole for ZIP4 in copper and zinc transport in roots and in shoots.

Most Transporters Regulated by Copper Are Also Regulatedby Other Metals—Although we found copper deficiency-regu-lated transporters, we did not identify metal transporters spe-cifically induced by copper deficiency in the 8,300 genes tested.In addition to ZIP2, ZIP4, and possibly ZIP5, two other poten-

tial copper transporter genes also appeared to be regulated byzinc, namely COPT2, a homologue of a yeast copper transporter(31) in leaves, and Zn/Cd pATPase3, a putative Zn/Cd-trans-porting P-type ATPase in roots (Table IIA and Fig. 1). BothCOPT2 and the Zn/Cd p-ATPase3 showed up-regulation inzinc deficiency. COPT1, a known copper transporter (31), ap-peared not to be regulated by copper deficiency, and its expres-sion was higher in leaves than in roots (Fig. 1). CHX17, codingfor a potential Na�/H� exchange protein, is the only trans-porter gene that appears to be specifically regulated by copper(Table IIB, Fig. 1). Six other members of the cation/protonantiporter family present on the array (CHX13, CHX15,CHX21, KEA3, NHX1, and NHX17) do not appear to be regu-lated in response to any of the metal deficiencies tested. Ouranalysis indicates that RAN1, a known copper-transportingP-ATPase that plays a role in copper assembly into the ethyl-ene receptor ETR1 (12, 13), is expressed constitutively at com-paratively high levels, and its expression is higher in the rootsthan in the leaves (Fig. 1).

Coordinated Transcriptional Regulation of Copper-bindingProteins—AtCCS, a homologue to the yeast copper chaperoneCCS, and both cytosolic and chloroplast Cu,Zn-SODs tran-script levels fall in copper and in zinc deficiency (Table IIC, Fig.4). Two other SOD coding genes, the iron-SOD3 gene (accessionnumber AAC24834) and a SOD-like gene (accession numberAAC2483), do not respond to metal deficiencies (Fig. 4). Threegenes coding for AtCCS-related metal-binding proteins (21, 22)are expressed only at very low levels and do not appear to beregulated by any of the metal deficiencies tested (see Supple-mentary Table S1). In contrast, steady-state RNA levels ofMT2a, MT2b, and MT3 in normal growth conditions are veryhigh and remained unchanged in all deficiencies, except for aslight decrease in expression of MT2a in copper deficiency (Fig.5). Finally AtCutA, a homologue to a bacterial copper-bindingprotein (32), is not regulated by copper and does not showtissue specific expression (Table S1).

Inter-relationship of Zinc and Iron Transport—Zinc and Irondeficiency led to specific changes in ZIP gene expression. Tran-scription profiles showed that ZIP5 and ZIP9 are expressed atvery low levels in normal growth conditions, suggesting thatthey play a specific role in root and shoot zinc transport inresponse to zinc deficiency. Only IRT2 of the ZIP family, whichwas previously shown to be involved in iron uptake (9), wasspecifically increased in iron deficient roots. It is not induced iniron-deficient shoots or in zinc and copper deficiency. None ofthe ZIP genes studied appears to be co-regulated by zinc andiron. However, iron deficiency led to down-regulation of zinc-regulated ZIP4 and ZIP5 (Table IIA and Fig. 2). This down-regulation could reflect an increase in cellular zinc levels prob-ably via IRT1, an iron-regulated transporter that is known toalso transport zinc (8). Similarly, we have observed a sharpincrease in expression of iron-regulated IRT2 in zinc excess(Fig. 2), indicating that plants exposed to excess zinc becomeiron-deficient, probably because zinc and iron are competing forthe same transporters. The expression of ZIP6 was not affectedby any of the metal deficiencies and excess tested (Figs. 1 and2), suggesting either that this permease is constitutively ex-pressed or is regulated by other metals.

Up-regulation of Iron Reductases and IRT2 and Down-regu-lation of Ferritins in Iron Deficiency—The FRO2 ferric reduc-tase gene, controlling the rate-limiting step of root iron uptake(33), is strongly induced by iron deficiency. Fig. 1 shows thatthe induction was specific to iron deficiency, and the absolutelevel of FRO2 transcripts in iron-deficient roots was higherthan all other metal-regulated genes assayed. While FRO2 wasnot expressed in leaves, FRO3 was increased under iron defi-

TABLE IIFold change in gene expression in response to nutritional deficiencies

in copper, zinc and ironFold change in expression levels of genes coding for known (A) and

potential (B) Arabidopsis metal transporters and genes involved inmetal chelation (C) in response to nutritional deficiencies in copper,zinc, and iron. Columns R1 and R2 are the calculated fold change in twobiological replicates, respectively. Column A is the average of columnsR1 and R2. Shaded boxes in column A denote genes that are up-regulated (black) and down-regulated (gray) by a factor of at least twoin each replicate.

Metal Homeostasis in Arabidopsis 47647

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

ciency both in the roots and in the leaves. The increase inleaf-localized FRO3 shows that reduction of ferric iron to fer-rous is also a component of metal transport in the leaves (TableIIA) (34). Iron deficiency also led to decreased expression offerritin genes in roots (AtFer1) and leaves (AtFer1 and AtFer4)(Table IIC). Decreased expression in iron deficiency is consist-

FIG. 2. RT-PCR analysis of ZIP gene expression. RT-PCR wasused to analyze roots transcript levels for ZIP2, ZIP4, ZIP5, ZIP6, ZIP9,and IRT2 in control (Ctl), copper (-Cu), zinc (-Zn), and iron (-Fe) defi-ciency and 100� copper (�Cu) and zinc (�Zn) excess. The graph rep-resents the relative levels of expression as assessed by the fluorescenceintensity of the fragments specific to each gene in the linear range ofamplification. Data was normalized to the fluorescence intensity of�-tubulin (�TUB).

FIG. 3. Functional characterization of ZIP2 and ZIP4. A, growthof �ctr1 expressing ZIP2 and ZIP4 on YPG plates supplemented with 10�M CuSO4 compared with the mutant transformed with the vectoralone. 1, 0.1, 0.01, and 0.001 OD600 of cells were plated from left to right.B, relative copper content in �ctr1 expressing ZIP2, AtOPT3, or thevector alone (Control). Copper content of ZIP2 expressing �ctr1 was setto 100%.

FIG. 1. Expression levels of selected genes involved in metal transport. ADIs were used to compare expression levels of selected metaltransporter genes from control plants and plants grown under copper, zinc, or iron deficiencies. ADI calculated for each replicate (Table S1) wereaveraged and plotted. Lane 1, FRO3; lane 2, FRO2; lane 3, ZIP2; lane 4, ZIP4; lane 5, ZIP5; lane 6, ZIP6; lane 7, ZIP9; lane 8, IRT2; lane 9, Cd/ZnpATPase3; lane 10, CHX17; lane 11, OPT3; lane 12, OPT2; lane 13, RAN1; lane 14, COPT1; lane 15, ZAT1; lane 16, AtMTPb; lane 17, NRAMP1;lane 18, NRAMP5. L and R denote roots and leaves, respectively. Actin 7 (lane 19), actin (lane 20), and �-tubulin (lane 21) probes were used ascontrols for low, medium, and high expression levels, respectively. Error bars represent S.D.

Metal Homeostasis in Arabidopsis47648

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

ent with previous observations of increased ferritin transcrip-tion in iron overload (23).

Increased Nicotianamine Synthase Gene Expression in Re-sponse to Iron and Zinc Deficiency—Enzymatically synthesizedsmall molecular weight compounds such as NA and phyto-chelatins (PCs) bind metals in cells. NA plays an unidentifiedrole in long distance metal transport, possibly related to entryof iron into the phloem and/or xylem (35) and in cellular trans-port of iron (36). Three nicotianamine synthase genes(AtNAS1–3) of the four known Arabidopsis nictotianamine syn-thase genes are present on the DNA chips. AtNAS1 and At-NAS3 transcripts were increased by both zinc and iron defi-ciencies in the roots. AtNAS2 transcript levels appeared to beincreased by zinc deficiency rather than iron deficiency in bothroots and leaves. In leaves, copper deficiency may also increaseAtNAS2 transcript levels slightly (Table IIC, Fig. 5). In con-trast to the NAS genes, the PC synthase gene (PCS-1) was notaffected by any of the deficiencies studied (Fig. 5), which is

consistent with the known role of PCs in detoxifying excessmetals rather than involvement in metal deficiencies (37).

Members of Oligopeptide Transporters Family OPT Are Reg-ulated by Metals—Our results indicate that AtOPT2 andAtOPT3, two members of an oligopeptide transporter family(38), are regulated in response to metal deficiencies. AtOPT2and AtOPT3 are highly induced in iron deficiency (Table IIB),and in fact, transcript levels of AtOPT3 in roots are nearly ashigh as the ferric reductase transcript FRO2 (Fig. 1). Northernblot hybridizations confirmed increased expression of AtOPT3in iron deficiency and also suggested increased expression incopper and revealed a dramatic expression increase in manga-nese deficiency (Fig. 6A).

Functional Complementation Demonstrates That AtOPT3 Isa Metal Transporter—To test the ability of OPT3 to transportmetals we expressed the AtOPT3 cDNA in three different yeastmutants fet3fet4, �ctr1, and �smf1 (39), which are deficient iniron, copper, and manganese transport, respectively. Expres-sion of AtOPT3 could restore growth of �ctr1 on a non-ferment-able medium (Fig. 6B). ICP measurements of copper content in�ctr1 expressing AtOPT3 revealed a higher copper contentthan the cells transformed with the vector alone supporting arole of AtOPT3 in copper transport (Fig. 3B). Fig. 6C showsthat AtOPT3 can restore growth of �smf1 on manganese-lim-ited medium and that this growth can be reduced by addition ofEGTA to the medium. We noted that AtOPT3 shares sequencesimilarities with YS1, a gene involved in transport of iron-phytosiderophore complexes in maize roots, and with the Ara-bidopsis genes of the YSL (YS1-like) family (59). In our exper-iments, AtYSL1 is not detectably expressed in roots and hasvery low levels of expression in leaves. AtYSL1, if regulated,appears to be down-regulated, not up-regulated, in iron andcopper deficiency and unaffected by zinc deficiency (Table S1).Monocotyledonous plants such as Arabidopsis do not synthe-size phytosiderophes; however, they synthesize NA an imme-diate precursor of the phytosiderophore mugineic acid. To testwhether AtOPT3 can transport iron or NA/iron chelates, we

FIG. 4. Co-regulation of AtCCS and Cu,Zn-SOD genes. ADIs ofAtCCS, Cu,Zn-SOD, chloroplast Cu,Zn-SOD (cpSOD), an SOD-likegene, and a FeSOD gene in control plants and plants grown undercopper, zinc, or iron deficiency. R and L denote roots and leaves, respec-tively. ADIs of individual replicates (shown in Table S1) were averaged,and error bars represent S.D.

FIG. 5. Expression levels of genes involved in metal bindingand chelation. ADIs were used to assess and compare expressionlevels of genes involved in metal binding and chelation. ADI for genesencoding ferritin (AtFer1 and AtFer4), nicotianamine synthase (NAS1–3), phytochelatin synthase (PCS-1), and metallothioneins (Mt2a, MT2,MT3) from control plants, and plants grown under copper, zinc, or irondeficiencies were plotted. R and L denote roots and leaves, respectively.Actin is used as a control. ADI of individual replicates (shown in TableS1) were averaged, and error bars represent S.D. The scale of the y axisis different in the two graphs.

FIG. 6. Functional characterization of AtOPT3. A, hybridizationof an 600-bp AtOPT3 cDNA probe, corresponding to the 3�-terminalexon, to RNA extracted from Arabidopsis roots of plants grown incontrol conditions (Ctl), copper (-Cu), manganese (-Mn), zinc (-Zn), andiron (-Fe) deficiency. The ethidium bromide-stained RNA gel is shownfor quantification. B, growth of �ctr1 expressing AtOPT3 on YPG-Uraplates supplemented with 10 �M CuSO4 compared with the mutanttransformed with the vector alone. C, growth of �smf1 expressingAtOPT3 on manganese-limited medium, with and without 1 mM EGTAcompared with the growth of the mutant transformed with the vectoralone.

Metal Homeostasis in Arabidopsis 47649

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

have expressed the gene in the yeast mutant fet3fet4 deficientin iron uptake. We observed improved growth in iron-limitedmedium of the mutant expressing AtOPT3 (Fig. 7) in liquidcultures; however, the addition of NA did not affect the growthsignificantly. Similarly we did not observe a significant differ-ence in the growth of the yeast mutant �ctr1 expressingAtOPT3 in the presence or in the absence of NA (Fig. 7).

Iron Regulation of a Chloroplast ABC Transporter—Wefound nine membrane transporters in addition to the onesdiscussed above that showed regulation by at least one metal(Table IIB, Fig. 1). One gene, similar to a large number ofbacterial and cyanobacterial ABC transporters was down-reg-ulated by iron deficiency in leaves and is a particularly inter-esting candidate for iron transport into chloroplasts. This gene,named AtSBL (SufB-like), is similar to SufB, is an Escherichiacoli iron-regulated gene that encodes a NifS-like protein re-quired for the assembly of iron sulfur clusters (40, 41). AtSBLis predicted to reside in chloroplasts and thus could play aparallel role in chloroplasts as the yeast ATM1 (42) and theArabidopsis STA1 (11) genes play in mitochondria (iron trans-port and iron-sulfur assembly). Three other Nif-like genes pres-ent on the GeneChip, two mitochondrial NifS and NifU likegenes and a chloroplast NifU like gene, are not affected by anyof the deficiencies tested (Table S1). The fact that AtSBL isdown-regulated in iron deficiency like ferritin genes suggeststhat it could be involved in transporting iron into chloroplastsfor storage into ferritin.

Regulation of Multidrug Resistance Proteins—Two membersof the large family of MRP multi-drug resistance proteins,AtMRP4 and a tetracycline transporter AtTCR1, were down-regulated in iron and zinc deficient roots, respectively (TableIIB). AtMRP4 is closely related to YCF1, a yeast glutathione-Sconjugate transporter that detoxifies cadmium by transporting

its glutathione conjugate into the vacuole. The decreased ex-pression of AtMRP4 in iron deficiency suggests a possible rolein iron transport into the vacuole, which is known to store iron(36). AtTCR1 belongs to a small gene family in Arabidopsisthat is homologous to the bacterial TCR tetracycline resistancegene present on the Tn10 transposon (43). Interestingly thisbacterial protein in known to function as a metal-tetracy-cline/H� antiporter, suggesting that the regulation of AtTCR1in zinc deficiency in plants is not fortuitous.

Involvement of Aquaporins in Metal Homeostasis—Finally,three potential members of the aquaporin/MIPS (major inte-gral membrane proteins) family of genes (44) were regulated inthe roots in response metal deficiency (Table IIB). NIP9 wasup-regulated by zinc, iron, and possibly copper deficiency,whereas PIP2d was down-regulated by copper deficiency. BothNIP9 and PIP2d are potential plasma membrane aquaporins.TIP�, a potential tonoplast aquaporin gene, was down-regu-lated by iron and possibly zinc. These results suggest thatcoordinate regulation of channels and transporters in theplasma membrane, and the tonoplast is required for metalhomeostasis. The connection of metal homeostasis with cellularwater potential needs to be explored.

No Evidence of Metal-specific Regulation of Several MetalTransporters—We found multiple metal transporters that werenot regulated by the metal deficiencies tested though transcriptlevels appear to be tissue specific. Two zinc efflux genes (ZAT1and AtMTPb), COPT1, RAN1 (a copper transporting P-typeATPase), AtNRAMP1, and AtNRAMP3 all showed tissue-spe-cific, but not metal-regulated, expression. COPT1 is expressedat higher levels in the leaves, while ZAT1, RAN1, and At-Nramp1 are more highly expressed in the roots. AtNRAMP3expression was very low in both roots and leaves. Finally,AtMTPb, a potential zinc efflux gene, and two Ferroportin1/IREG1 homologues were not expressed at detectable levels inour experiments (Fig. 5, Table S1), contrasting with results inanimal cells in which IREG1/Ferroportin1 is highly induced byiron deficiency (45).

Comparison with Previously Reported Regulation Patterns ofTransporter Genes—The expression profiles for 9 genes out ofthe 53 analyzed are available in the literature for comparison.Our array results were consistent with published data (TableIII) with the exception of two NRAMP genes. The expression ofNRAMP1 and NRAMP3 results contrasted with previous re-ports showing that members of this family are induced by irondeficiency in roots (10, 46). Differences in the growth condi-tions, treatment, and developmental stage could be reasons forthe difference in expression patterns observed with NRAMP3.These factors may also account for the differences in the pub-lished expression patterns for NRAMP1. While expression ofNRAMP1 in the roots under normal growth conditions is ob-served in one report (10), no expression of NRAMP1 is seen inthe roots in normal growth conditions in an independent report(46). In addition, the results for NRAMP1 may be affected bythe fact that NRAMP1 and NRAMP6 mRNAs have 85% se-quence similarity over their entire length which could be suf-ficient for cross-hybridization on northern blots. For the me-tallothionein gene MT2a we observed the same tissue specificityas published. Based on our results, MT2a is among the mosthighly transcribed gene in Arabidopsis. Because of this, wewere likely beyond the dynamic range of the DNA chips (47)and thus could not see a robust regulation by copper for thisgene despite its known regulation by copper (48).

DISCUSSION

Genome-wide Analysis Provides Insight into Metal Trans-port—We have used Affymetrix Arabidopsis DNA chips con-taining �8,300 genes (which cover about one-third of the ge-

FIG. 7. Growth of yeast mutants expressing AtOPT3 in thepresence of nicotianamine. Growth of �ctr1/AtOPT3 (top graph) inYPG (open symbols) and YPG � 10 �M NA (filled symbols) and fet3fet4/AtOPT3 (bottom graph) in iron-limited medium (open symbols) contain-ing 10 �M NA. The growth of each mutant was compared with thegrowth of the mutant transformed with the vector alone in the sameconditions.

Metal Homeostasis in Arabidopsis47650

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

nome), to begin to address the question of specific responses ofplants to metals by providing the first extensive side-by-sidecomparison of transporter gene expression profiles in Arabi-dopsis in response to deficiencies in three different transitionmetals. The large 500� dynamic range of the Affymetrix chipsused in this study (47) not only allows one to identify changesin gene expression in response to metal stimuli but also tocompare expression levels between genes. By doing two biolog-ical and two technical replicates for each condition (four repli-cates for each condition) and applying stringent selection cri-teria, we have identified only genes that have a robust responseto these deficiencies. Many of the genes belong to families witheach member being regulated according to different metal- ortissue-specific patterns. Since many of the proteins that areinvolved in metal transport and homeostasis have wide andoverlapping metal specificities in transport assays, the eluci-dation of the transcriptional regulation in planta is necessaryto understand their physiologic role. Comparison with the ex-pression patterns of previously characterized genes and con-firmatory studies using complementation of yeast mutants in-dicate that the expression patterns we observed are biologicallysignificant.

Strict and Multilevel Transcriptional Regulation by Metals—The robust regulation we identified suggests an important rolefor transcription in metal homeostasis. Previous functionalstudies indicate that plant metal transporters have wide sub-strate specificities with limited ion selectivity. Overlappingspecificities do not provide an obvious mechanism for plants todifferentially regulate uptake of specific metals. One possibilityis that specificity observed in heterologous systems utilized donot accurately reflect the in planta situation and additionalproteins such as reductases may provide specificity. Alterna-tively, we suggest that the unique transcriptional response toeach individual metal deficiency results in the expression of aspecific mix of transporters with limited selectivity, which to-gether provide effective combinatorial control of metal trans-port. Our results confirm that transporters of the ZIP family ofgenes play a fundamental role in regulating metal uptake asthey appear to be the most highly regulated genes in responseto metals deficiencies. Heterologous expression studies of ZIPproteins in yeast mutants (5, 6, 26), supported by work inArabidopsis (7, 8), suggest wide substrate specificities for theZIP proteins. This wide substrate specificity appears to be

compensated for by a strict transcriptional regulation of thegenes. Transcription of the genes is regulated in a way toprevent excessive uptake of the most toxic metal (copper) whileensuring proper zinc (the least toxic metal) uptake and trans-port. This is particularly striking for ZIP4, which is highlyinduced in zinc deficiency but is completely turned off in copperexcess. Our results confirm that transcriptional regulationplays an important role in regulating the expression of themetal transporters and we have shown that knowledge of thetranscriptional regulation patterns can yield information onthe function of the protein encoded. However, post-transcrip-tional regulation should be taken into consideration when an-alyzing regulation of metal homeostasis, as shown for IRT1 aniron transporter of the ZIP genes family (7).

The Plant Copper Pathways—Very little is known aboutcopper uptake and homeostasis and transport in plants. Inparticular the transporters responsible for copper uptake fromthe soil are not known. We have determined that ZIP2 andZIP4 are transcriptionally regulated by copper, and both pro-teins can transport copper into yeast. ZIP2 and ZIP4 could bemajor points of entry for copper into the plant. Both genes arealso regulated by zinc and ZIP2 was shown to transport zincinto yeast cells, while excess copper significantly inhibitedZIP2-mediated zinc transport in yeast (26). We have also pre-sented evidence that AtOPT3, a potential oligopeptide trans-porter, is regulated in copper deficiency and that it can restoregrowth of the yeast �ctr1 mutant on non-fermentable substratesuggesting that it could be a component of the copper transportmachinery in Arabidopsis. High expression of OPT3 in thevascular tissues in plants (49) further suggests that OPT3could be involved in long distance transport of copper.

High levels of expression of RAN1 (compared with the ZIPgenes) suggests that this transporter may play a general role incopper transport possibly into the secretory pathway for assem-bly into copper containing proteins, similar to the roles of Ccc2p(50) and ATP7A and ATP7B (50–52), homologues in yeast andmammals, respectively. Comparison of expression profiles ofAtCCS and Cu,Zn-SODs indicates that there is a tight co-regulation of the chaperone gene and the cytosolic and chloro-plast SODs genes, suggesting that they belong to the samepathway and that the expression of these genes is adjusted tothe levels of metal co-factors available for assembly into apo-SOD. The assumed function of copper chaperones such as

TABLE IIIComparison of microarray results with published work

GeneRegulation by metals Tissue-specific expression

Ref.This work Published This work Published

FRO2 Iron-regulated Iron-regulated (Northern) Root-specific Root-specific (Northern) 65ZIP4 Zinc-regulated Zinc-regulated (Northern) Leaves and roots Leaves and roots

(Northern)26

AtFer1 Iron-regulated Iron-regulated (Northern) Leaves and roots Leaves and roots(Northern)

23

AtFer4 Iron-regulated Iron-regulated (Northern) Leaves roots Leaves not roots (Northern) 23IRT2 Iron-regulated Iron-regulated Root-specific Root-specific (Northern,

reporter gene fusion)9

ZAT1 No regulationby metalsdeficiencies

Not affected by high zinc(Northern)

Leaves roots N/Aa 66

MT2a Possiblecopperregulationin shoots

Up-regulated by copperin cotyledon (RT-PCR)

Leaves roots High expression in leaves(RT-PCR Northern)

48

NRAMP3 No metalregulation

Iron-regulated (Northern) Very lowexpressionin roots andin leaves

Low expression in leavesand roots (Northern)

10

NRAMP1 No metalregulation

Iron-regulated (Northern) Roots leaves Roots leaves (Northern) 10, 46

a N/A, not available.

Metal Homeostasis in Arabidopsis 47651

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

Atx1p and Ccsp in yeast is to overcome the high thermody-namic capacity for nonspecific binding of copper in the cell toensure proper delivery of copper to metalloproteins and or-ganelles while minimizing toxic free copper levels (53, 54).Interestingly, we have observed a decrease in the expression ofthe AtCCS in copper deficiency, which raises the questionabout whether AtCCS is down-regulated to shunt copper intoother pathways.

Independent Systems of Copper and Iron Homeostasis inArabidopsis—Copper plays a pivotal role in mammalian andyeast iron transport. These organisms rely on the activity ofmulticopper oxidases, such as ceruloplasmin (55, 56) and hep-haestin (57) in mammals and Fet3p (58) in yeast, for irontransport. Copper-dependant iron assimilation is also found inthe green algae Chlamydomonas reinhardtii (59). In contrast,copper deficiency did not have a major effect on the expressionof any iron regulated transporter or metal homeostasis gene inArabidopsis (Table II) or on any other genes tested that areaffected by iron deficiency (data not shown). Of the 8,300 genestested, only 5 genes were co-regulated in response to both ironand copper deficiencies. More overlap was found between cop-per and zinc deficiencies (29 genes co-regulated), and zinc andiron deficiencies (32 genes co-regulated). This suggests thatiron transport in plants may not depend on the activity ofmulti-copper oxidases like in yeast and in mammals.

Role of Nicotianamine Synthase and Oligopeptide Transport-ers in the Metal Deficiency Response—Arabidopsis, and dicoty-ledonous plants in general, differs from grasses in iron uptakestrategy. Grasses such as corn, (“Strategy II” plants) convertNA into phytosiderophores (PSs) such as mugineic acid thatare excreted into the soil to bind ferric iron. In maize, Fe(III)-PS complex are transported the into the roots by YS1 (60). Allnon-grass plants (“Strategy I” plants like Arabidopsis and to-mato) lack the ability to synthesize and secrete PS and further-more do not take up iron as the Fe(III)-PS complex. Instead,trans-membrane ferric reductases reduce and presumably re-lease iron from Fe(III)-chelates (including phytosiderophores)for subsequent uptake by Fe2� ion transporters. Despite this,the phenotype of the NA-less tomato chloronerva demonstratesthat NA plays an important role in iron/metal homeostasis inStrategy I plants (61). Our results suggest that NAS genes areactivated in metal deficiencies, and thus, NA participates inthe response to metal deficiency (our data) as well as to irontoxicity (36). Induction of NAS in iron deficiency is also ob-served in monocots (62), suggesting that the regulation patternof NAS genes has been conserved in monocots and dicots. It hasbeen postulated that Arabidopsis homologues of YS1, the8-member YSL (YS-like) family, may be involved in transport-ing NA-metal chelates within the plant (60). OPT and YSL aretwo divergent families of proteins (63) with homology to ISP4,a fungal oligopeptide transporter (64). Our yeast complemen-tation experiments have shown that AtOPT3 can transportcopper, manganese, and possibly iron as it was suggested bythe transcriptional regulation pattern. However, we have noevidence that these metals are transported into yeast viaAtOPT3 as a complex with nicotianamine. The potential role ofNA in metal transport via AtOPT3 will have to be furtheraddressed in planta. Interestingly, recent work by Koh et al.(38) has demonstrated that all member of the Arabidopsis OPTfamily can transport leu tetra- and pentapeptides with theexception of OPT2 and OPT3. It was also shown that OPT3 isrequired for embryo development and that it is expressed invascular tissues consistent with a role in long distance trans-port of metals (49). Our results indicate that YSL1, the onlyYSL gene present on the chip, is not involved in the response tometal deficiency. Thus, both YLS and OPT could be involved in

different aspects of metal transport.Conclusion—Transcriptional regulation of genes plays an

important role in metal homeostasis. By using transcriptionprofiling we have been able to identify novel components ofthe metal transport machinery and an intricate pattern ofregulation.

Acknowledgments—We thank Tariq Gazipura, Allen Joo, and JeffreyChen for their excellent technical support. We also thank Caroline Kanefor the BY4741 yeast mutants used in this study.

REFERENCES

1. De Freitas, J. M., Wintz, H., Kim, J. H., Poynton, H., Fox, T., and Vulpe, C.(2003) Biometals 16, 185–197

2. Clemens, S., Palmgren, G., and Kramer, U. (2002) Trends Plant Sci. 7,309–315

3. Maser, P., Thomine, S., Schroeder, J. I., Ward, J. M., Hirschi, K., Sze, H.,Talke, I. N., Amtmann, A., Maathuis, F. J. M., Sanders, D., Harper, J. F.,Tchieu, J., Gribskov, M., Persans, M. W., Salt, D. E., Kim, S. A., andGuerinot, M. L. (2001) Plant Physiol. 126, 1646–1667

4. Guerinot, M. L. (2000) Biochim. Biophys. Acta 1465, 190–1985. Eide, D., Broderus, M., Fett, J., and Guerinot, M. L. (1996) Proc. Natl. Acad.

Sci. U. S. A. 93, 5624–56286. Korshunova, Y. O., Eide, D., Clark, W. G., Guerinot, M. L., and Pakrasi, H. B.

(1999) Plant Mol. Biol. 40, 37–447. Connolly, E., Fett, J., and Guerinot, M. L. (2002) Plant Cell 14, 1347–13538. Vert, G., Grotz, N., Dedaldechamp, F., Gaymard, F., Guerinot, M. L., Briat,

J. F., and Curie, C. (2002) Plant Cell 14, 1223–12339. Vert, G., Briat, J.-F., and Curie, C. (2001) Plant J. 26, 181–189

10. Thomine, S., Wang, R., Ward, J. M., Crawford, N., and Schroeder, J. I. (2000)Proc. Natl. Acad. Sci. U. S. A. 97, 4991–4996

11. Kushnir, S., Babiychuk, E., Storozhenko, S., Davey, M. W., Papenbrock, J., DeRycke, R., Engler, G., Stephan, U. W., Lange, H., Kispal, G., Lill, R., andVan Montagu, M. (2001) Plant Cell 13, 89–100

12. Woeste, K. E., and Kieber, J. J. (2000) Plant Cell 12, 443–45513. Hirayama, T., Kieber, J. J., Hirayama, N., Kogan, M., Guzman, P.,

Nourizadeh, S., Alonso, J. M., Dailey, W. P., Dancis, A., and Ecker, J. R.(1999) Cell 97, 383–393

14. Suzuki, K., Higuchi, K., Nakanishi, H., Nishizawa, N. K., and Mori, S. (1999)Soil Sci. Plant Nutr. 45, 993–1002

15. Cazale, A. C., and Clemens, S. (2001) FEBS Lett. 507, 215–21916. Zhou, J., and Goldsbrough, J. (1995) Mol. Gen. Genet. 248, 318–32817. Fujiwara, T., Takahashi, K., Kawashima, I., Horiguchi, T., Akahoshi, E., and

Chino, M. (1994) J. Cell. Biochem. Suppl., 9318. Cobbett, C., and Goldsbrough, P. (2002) Annu. Rev. Plant Biol. 53, 159–18219. Mira, H., Vilar, M., Perez-Paya, E., and Penarrubia, L. (2001) Biochem. J. 357,

545–54920. Himelblau, E., and Amasino, R. M. (2001) J. Plant. Physiol. 158, 1317–132321. Dykema, P. E., Sipes, P. R., Marie, A., Biermann, B. J., Crowell, D. N., and

Randall, S. K. (1999) Plant Mol. Biol. 41, 139–15022. Wintz, H., and Vulpe, C. (2002) Biochem. Soc. Trans. 30, 235–23823. Petit, J.-M., Briat, J.-F., and Lobreaux, S. (2001) Biochem. J. 359, 575–58224. Rogers, E. E., and Guerinot, M. L. (2002) in Molecular and Cellular Iron

Transport (Templeton, D., ed) Marcel Decker AG, New York25. Parker, D. R., Chaney, R. L., and Norvell, W. A. (1995) in Chemical Equilib-

rium and Reaction Models (Loeppert, R. H., Schwab, A. P., and Goldberg, S.,eds) pp. 163–200, Soil Society of America, Madison, WI

26. Grotz, N., Fox, T., Connolly, E., Park, W., Guerinot, M. L., and Eide, D. (1998)Proc. Natl. Acad. Sci. U. S. A. 95, 7220–7224

27. Zhu, T., Budworth, P., Han, B., Brown, D., Chang, H. S., Zou, G., and Wang,X. (2001) Plant Physiol. Biochem. 39, 221–242

28. Chen, W., Provart, N., Glazebrook, J., Katagiri, F., Chang, H., Eulgem, T.,Mauch, F., Luan, S., Zou, G., Whitham, S., Budworth, P., Tao, Y., Xie, Z.,Chen, X., Lam, S., Kreps, J., Harper, J., Si-Ammour, A., Mauch-Mani, B.,Heinlein, M., Kobayashi, K., Hohn, T., Dangl, J., Wang, X., and Zhu, T.(2002) Plant Cell 14, 559–574

29. Bertoncini, C. R., and Meneghini, R. (1995) Nucleic Acids Res. 23, 2995–300230. Minet, M., Dufour, M. E., and Lacroute, F. (1992) Plant J. 2, 417–42231. Kampfenkel, K., Kushnir, S., Babiychuk, E., Inze, D., and Van Montagu, M.

(1995) J. Biol. Chem. 270, 28479–2848632. Fong, S. T., Camakaris, J., and Lee, B. T. O. (1995) Mol. Microbiol. 15,

1127–113733. Saleeba, J. A., and Guerinot, M. L. (1995) Biometals 8, 297–30034. Brueggemann, W., Maas-Kantel, K., and Moog, P. R. (1993) Planta 190,

151–15535. Scholz, G., Becker, R., Pich, A., and Stephan, U. W. (1992) J. Plant. Nutr. 15,

1647–166536. Pich, A., Manteuffel, R., Hillmer, S., Scholz, G., and Schmidt, W. (2001) Planta

213, 967–97637. Clemens, S., Kim, E. J., Neumann, D., and Schroeder, J. I. (1999) EMBO J. 18,

3325–333338. Koh, S., Wiles, A. M., Sharp, J. S., Naider, F. R., Becker, J. M., and Stacey, G.

(2002) Plant Physiol. 128, 21–2939. Supek, F., Supekova, L., Nelson, H., and Nelson, N. (1996) Proc. Natl. Acad.

Sci. U. S. A. 93, 5105–511040. Baldet, P., Alban, C., and Douce, R. (1997) FEBS Lett. 419, 206–21041. Patzer, S. I., and Hantke, K. (1999) J. Bacteriol. 181, 4179–418242. Kispal, G., Csere, P., Guiard, B., and Lill, R. (1997) FEBS Lett. 418, 346–35043. Noumi, T., Yamaguchi, A., Ono, N., Akasaka, T., and Sawai, T. (1990) J. Biol.

Chem. 265, 15525–15530

Metal Homeostasis in Arabidopsis47652

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

44. Quigley, F., Rosenberg, J. M., Shachar-Hill, Y., and Bohnert, H. J. (2001)Genome Biol. 3, 1.1–1.17

45. Anderson, G. J., Frazer, D. M., McKie, A. T., Wilkins, S. J., and Vulpe, C. D.(2002) Cell Biochem. Biophys. 36, 137–146

46. Curie, C., Alonso, J. M., Le Jean, M., Ecker, J. R., and Briat, J.-F. (2000)Biochem. J. 347, 749–755

47. Zhu, T., and Wang, X. (2000) Plant Physiol. 124, 1472–147648. Garcia-Hernandez, M., Murphy, A., and Taiz, L. (1998) Plant Physiol. 118,

387–39749. Stacey, M. G., Koh, S., Becker, J., and Stacey, G. (2002) Plant Cell 14,

2799–281150. Yuan, D. S., Dancis, A., and Klausner, R. D. (1997) J. Biol. Chem. 272,

25787–2579351. Vulpe, C., B., L., Whitney, S., Packman, S., and Gitschier, J. (1993) Nat. Genet.

3, 7–1352. Petrukhin, K., Lutsenko, S., Chernov, I., Ross, B. M., Kaplan, J. H., and

Gilliam, T. C. (1994) Hum. Mol. Genet. 3, 1647–165653. O’Halloran, T. V., and Culotta, V. C. (2000) J. Biol. Chem. 275, 25057–2506054. Huffman, D. L., and O’Halloran, T. V. (2001) Annu. Rev. Biochem. 70, 677–70155. Mukhopadhyay, C. K., Attieh, Z. K., and Fox, P. L. (1998) Science 279,

714–71756. Harris, Z. L., Klomp, L. W., and Gitlin, J. D. (1999) Am. J. Clin. Nutr. 67,

972S–977S57. Vulpe, C. D., Kuo, Y.-M., Murphy, T. L., Cowley, L., Askwith, C., Libina, N.,

Gitschier, J., and Anderson, G. J. (1999) Nat. Genet. 21, 195–19958. Dancis, A., Yuan, D. S., Haile, D., Askwith, C., Eide, D., Moelme, C., Kaplan,

J., and Klausner, R. D. (1994) Cell 76, 393–40259. La Fontaine, S., Quinn, J. M., Nakamoto, S. S., Page, M. D., Gohre, V.,

Moseley, J. L., Kropat, J., and Merchant, S. (2002) Eukaryot. Cell 1,736–757

60. Curie, C., Panaviene, Z., Loulergue, C., Dellaporta, S. L., Briat, J. F., andWalker, E. L. (2001) Nature 409, 346–349

61. Becker, R., Fritz, E., and Manteuffel, R. (1995) Plant Physiol. 108, 269–27562. Higuchi, K., Watanabe, S., Takahashi, M., Kawasaki, S., Nakanishi, H.,

Nishizawa, N. K., and Mori, S. (2001) Plant J. 25, 159–16763. Yen, M. R., Tseng, Y. S., and Saier, M. H. (2001) Microbiology 147, 2881–288364. Lubkowitz, M. A., Barnes, D., Breslav, M., Burchfield, A., Naider, F., and

Becker, J. M. (1998) Mol. Microbiol. 28, 729–74165. Robinson, N. J., Procter, C. M., Connolly, E. L., and Guerinot, M. L. (1999)

Nature 397, 694–69766. van der Zaal, B. J., Neuteboom, L. W., Pinas, J. E., Chardonnens, A. N., Schat,

H., Verkleij, J. A. C., and Hooykaas, P. J. J. (1999) Plant Physiol. 119,1047–1055

Metal Homeostasis in Arabidopsis 47653

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from

Averaged ADI Standard deviation control Cu zinc iron control Cu zinc iron

L 106.75 94.25 63.00 357.75 26.85 24.30 3.92 102.91 FRO3

R 94.50 118.00 128.50 646.50 8.70 26.98 9.98 85.00 L 19.50 10.00 12.75 34.75 4.65 4.24 1.50 4.57 FRO2

R 130.25 124.75 152.00 1444.00 37.39 64.99 9.42 388.19 L 6.00 14.00 18.00 5.25 1.15 4.69 6.78 1.71 ZIP2

R 107.75 554.25 646.25 86.25 33.27 80.90 151.19 47.00 L 34.00 39.50 846.75 12.25 26.99 15.18 25.88 5.56 ZIP4

R 48.50 46.00 337.50 18.25 7.77 9.49 13.48 6.29 L 16.25 30.25 353.50 6.25 9.18 3.77 15.11 4.19 ZIP5

R 14.00 33.25 245.75 5.00 4.62 4.03 29.49 0.00 L 37.75 37.75 34.00 33.25 4.27 8.81 7.48 4.92 ZIP6

R 47.50 59.50 70.00 69.00 5.20 18.38 9.02 2.83 L 7.75 6.75 304.25 9.25 4.43 3.50 70.23 4.92 ZIP9

R 32.25 48.25 220.75 66.75 15.04 17.80 15.37 22.23 L 4.50 3.75 5.00 4.00 1.00 1.50 0.00 1.41 IRT2

R 11.00 4.75 8.75 297.25 7.07 1.26 4.99 61.23 L 23.75 75.75 53.25 11.75 15.95 9.32 14.52 2.50 pATPase3

R 6.00 16.75 61.75 5.25 4.16 6.08 14.50 0.50 L 133.00 163.50 404.50 113.75 19.98 33.37 128.15 13.25 COPT2

R 189.75 529.75 437.00 333.25 77.40 68.94 52.33 138.29

L 366.00 389.75 390.00 49.75 281.32 110.33 45.46 18.46 AtFer1

R 230.50 259.50 276.25 21.00 57.31 43.31 49.14 6.22 L 254.25 335.25 342.25 71.00 40.55 15.20 81.03 16.35 Atfer4

R 71.00 84.75 76.00 22.75 26.23 17.23 1.83 7.80 L 75.00 89.00 183.25 94.50 23.61 27.29 3.77 15.15 NAS1

R 64.25 104.25 156.50 208.50 31.44 39.53 30.16 79.31 L 5.00 11.25 43.50 3.25 2.94 3.86 26.15 2.36 NAS2

R 71.50 51.00 239.75 31.00 57.15 4.08 49.30 10.55 L 48.25 17.25 98.75 39.00 15.33 2.87 34.72 12.75 NAS3

R 7.75 13.25 39.50 37.00 4.86 9.39 7.85 11.63 L 51.75 27.75 13.50 38.50 18.46 7.23 7.14 14.25 AtCCS

R 135.50 41.50 17.00 141.00 61.02 20.62 6.63 26.85 L 4.25 5.00 5.00 5.00 1.50 0.00 0.00 0.00 CHX17

R 27.25 122.50 21.50 5.00 17.15 2.65 19.07 0.00 L 10.50 4.50 8.50 75.50 6.40 1.00 2.38 30.60 AAP

R 7.00 5.00 5.00 5.00 4.00 0.00 0.00 0.00 L 390.25 256.00 323.75 853.75 91.37 37.31 49.85 174.20 AtOPT3

R 123.25 138.50 162.50 1094.75 73.06 28.45 35.93 66.21 L 98.25 48.75 114.75 43.75 44.60 13.96 19.31 16.66 AtOPT2

R 54.75 36.00 65.00 41.25 27.65 5.72 15.12 17.61 L 100.25 138.75 141.00 18.00 25.66 21.08 10.49 6.06 AtSBL

R 38.75 43.25 48.50 6.25 8.81 9.98 7.85 0.96 L 5.25 4.00 5.00 5.00 0.50 2.00 0.00 0.00 AtGLR2.3

R 31.75 22.75 46.25 129.75 26.39 15.92 22.35 26.06 NIP9 L 5.00 5.00 5.00 5.00 0.00 0.00 0.00 0.00

R 23.00 83.00 106.75 126.75 10.52 70.46 38.53 55.89 L 73.75 84.75 92.00 100.00 2.22 11.62 4.24 19.63 PIP2d

R 112.25 40.00 138.75 148.25 31.00 9.63 17.31 33.86 L 6.00 5.00 6.25 5.00 1.41 0.00 1.50 0.00 AtTCR1

R 101.25 80.00 40.00 67.50 11.93 27.72 4.32 22.88 L 83.50 70.25 74.50 61.75 19.16 1.89 7.77 5.19 MIPepsilon

R 207.00 213.00 137.25 79.25 39.84 17.07 29.96 9.74 L 89.25 49.25 84.75 78.00 16.58 9.29 6.34 11.34 AtMRP4

R 107.25 97.75 112.50 37.25 19.50 12.58 20.42 2.63 L 5.00 5.00 5.00 5.00 0.00 0.00 0.00 0.00 CHX17

R 27.25 122.50 21.50 5.00 17.15 2.65 19.07 0.00 L 701.25 576.38 611.75 602.88 231.04 51.26 131.35 62.68 RAN1

R 1714.88 2447.00 1563.75 2110.63 104.91 955.63 173.90 295.89 L 328.00 401.50 490.25 284.75 23.92 30.23 114.63 18.66 COPT1

R 60.25 63.75 84.25 43.50 7.59 10.28 7.27 9.26 L 122.50 129.00 114.75 146.00 28.59 5.23 6.13 11.40 ZAT-1

R 254.25 286.25 248.00 348.50 43.48 18.84 20.54 41.62 L 5.50 5.00 5.75 5.00 1.00 0.00 1.50 0.00 ZAT-2

R 7.25 7.25 5.25 5.25 2.63 4.50 0.50 0.50 L 1676.75 1142.25 1899.50 1593.75 161.11 152.88 458.98 131.65 MT2A

R 177.00 258.50 114.50 101.00 12.38 54.93 17.71 17.17 MT2b L 4725.50 4586.00 4845.25 3240.50 863.92 479.84 587.54 442.32 R 3388.50 2909.75 2865.25 2874.75 1141.03 357.71 260.15 321.60 MT3 L 2935.25 3295.75 3857.00 2726.75 304.81 178.88 609.56 173.98 R 712.00 670.50 570.75 849.25 223.79 74.32 20.85 141.67 ECPH3 L 28.25 18.50 18.50 29.25 12.66 3.70 1.29 2.63 R 39.50 32.00 32.75 29.25 20.29 6.00 3.50 5.32

L 5.00 5.00 5.00 5.00 0.00 0.00 0.00 0.00 ECPH2

R 5.50 5.00 5.00 5.00 1.00 0.00 0.00 0.00 L 180.50 153.25 185.25 138.75 12.71 6.24 11.12 21.00 NRAMP1

R 426.00 410.00 491.00 526.75 20.31 19.44 23.38 48.68 L 57.50 43.25 43.00 48.25 8.81 6.29 1.41 3.77 NRAMP3

R 67.25 52.75 62.00 69.50 5.12 20.07 5.35 6.03 L 484.38 297.50 258.38 636.00 260.40 127.03 116.80 235.63 PCS-1

R 236.13 179.50 135.50 346.88 73.69 41.29 34.08 153.21 L 563.75 454.00 578.00 540.00 7.14 112.45 198.33 30.08 PCS-2

R 754.25 640.75 759.25 692.25 194.71 69.39 102.21 113.13 L 1575.75 1606.00 1552.25 1366.25 86.63 97.04 213.25 55.43 Actin7

R 1858.25 1696.25 1944.25 1563.50 94.13 218.84 158.47 106.80 L 49.00 47.00 43.25 45.75 19.88 7.26 8.96 5.38 Actin R 40.75 36.75 49.00 19.50 14.52 12.04 4.69 4.20 L 881.75 852.00 667.75 926.75 125.54 80.09 125.09 45.18 b tub.

R 968.75 967.00 991.00 857.00 87.37 119.90 99.77 83.09 L 552.00 161.25 86.50 393.75 264.33 8.62 3.51 103.14 cpSOD

R 743.50 429.50 103.75 445.00 72.66 111.82 17.61 55.26 L 683.50 242.25 171.50 692.50 137.12 57.67 8.10 177.12 SOD

R 1589.00 868.75 160.00 1669.50 213.21 139.49 17.26 81.09 SOD-like L 66.00 70.25 76.00 59.50 12.88 14.80 6.16 10.54

R 31.75 30.75 38.50 35.50 8.88 5.91 3.32 3.70 L 48.00 38.25 42.25 47.50 26.78 4.86 4.65 11.56 Fe-SOD

R 9.25 7.50 15.00 9.25 5.06 4.36 2.94 3.77 L 61.25 84.50 90.50 69.50 5.06 8.74 5.07 3.87 CutA

R 58.00 71.75 96.50 76.25 10.52 23.70 11.73 10.56 L 66.50 81.00 91.75 61.75 11.50 12.36 10.18 4.99 NifU1

R 6.75 11.25 10.00 5.00 2.06 5.85 1.63 0.00 L 87.75 75.50 93.50 74.50 12.04 5.32 5.45 14.06 AtcpNIFU

R 36.50 29.00 34.75 26.25 3.11 6.06 0.96 8.66 NHX1 L 0.00 3.50 4.25 0.00 4.97 5.92 2.06 2.65 R 3.00 -0.50 0.75 2.50 2.83 3.11 2.22 4.20 NHX7 L 31.25 25.50 18.75 34.75 10.69 4.43 4.50 6.70 R 21.50 43.50 36.00 22.75 3.87 8.54 4.97 3.30 CHX13 L 0.00 0.00 0.00 0.00 8.81 2.16 3.92 5.12 R 0.00 0.00 0.00 0.00 2.87 1.41 3.86 6.02 KEA3 L 1.00 48.50 24.50 3.50 1.41 9.75 5.20 0.58 R 29.75 2.25 1.00 34.00 8.14 4.27 3.92 3.83 CHX15 L 0.00 0.00 0.00 0.00 5.91 2.50 3.70 3.27 R 0.00 0.00 0.00 0.00 2.38 2.50 2.65 2.94 CHX21 L 0.00 1.50 0.75 3.25 6.06 5.69 0.50 4.27 R 0.00 0.00 0.00 0.00 3.59 5.16 2.58 3.86

Chang, Tong Zhu and Chris VulpeHenri Wintz, Tama Fox, Ying-Ying Wu, Victoria Feng, Wenqiong Chen, Hur-Song

Transporters Involved in Metal Homeostasis in Mineral Deficiencies Reveal NovelArabidopsis thalianaExpression Profiles of

doi: 10.1074/jbc.M309338200 originally published online September 16, 20032003, 278:47644-47653.J. Biol. Chem. 

  10.1074/jbc.M309338200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2003/10/02/M309338200.DC1.html

  http://www.jbc.org/content/278/48/47644.full.html#ref-list-1

This article cites 63 references, 26 of which can be accessed free at

by guest on Decem

ber 1, 2016http://w

ww

.jbc.org/D

ownloaded from