Expression of cytochrome P450 aromatase transcripts in buffalo (Bubalus bubalis)-ejaculated spermatozoa and its relationship with sperm motility

Page 1

Domestic Animal Endocrinology 34 (2008) 238–249

Available online at www.sciencedirect.com

Expression of cytochrome P450 aromatase transcripts inbuffalo (Bubalus bubalis)-ejaculated spermatozoa

and its relationship with sperm motility

Ashutosh Tiwari, Dheer Singh ∗, O. Suneel Kumar, M.K. SharmaMolecular Endocrinology Lab., Division of Animal Biochemistry, National Dairy Research Institute, Karnal 132001, Haryana, India

Received 11 March 2007; received in revised form 16 July 2007; accepted 20 July 2007

Abstract

The cytochrome P450 aromatase (aromP450) deficient mice are infertile due to an impairment of spermatogenesis associatedwith a decrease in sperm motility and inability to fertilize oocytes. The sperm analysis showed decreased sperm motility in humans,having Cyp19 gene mutations. Further, in human, it was hypothesized that aromatase could be used as marker of sperm quality,particularly in the acquisition of its motility. However, there is no information regarding the expression of aromP450 in spermatozoaof farm animals including cattle and buffalo. In the present study, the expression of aromP450 in ejaculated buffalo spermatozoaand its relationship with sperm motility of ejaculated spermatozoa was studied by RT-PCR using total RNA isolated from buffalo-ejaculated spermatozoa. The results showed that conventional RT-PCR could not amplify aromatase transcript, while a nested PCRdetected the presence of P450arom mRNA in buffalo-ejaculated spermatozoa. RT reaction followed by nested PCR was performedto compare the expression of aromatase transcripts in buffalo-ejaculated spermatozoa of two category semen graded on the basis ofmass motility and motile and non-motile spermatozoa separated by swim-up. A higher (P < 0.01) expression of aromP450 transcriptwas found in spermatozoa obtained from the good quality semen (higher mass motility) to that in spermatozoa of poor quality

semen (low mass motility). Similarly, higher (P < 0.01) expression of aromP450 mRNA was observed in the motile spermatozoaas compared to non-motile spermatozoa separated from good quality semen by swim-up. It is concluded that the present studydemonstrates a positive relation between aromatase transcript and mass motility of buffalo-ejaculated spermatozoa, which could bea putative marker for the quality of semen in farm animals, particularly the acquisition of sperm motility.© 2007 Elsevier Inc. All rights reserved.

tozoa; M

Keywords: Buffalo; Cytochrome P450 aromatase; Ejaculated sperma

1. Introduction

The estrogens are considered as specific female hor-

mones and the source of these hormones in the malegenital tract has been extensively investigated during lastdecade [1–3]. The generation of knockout mice for estro-

∗ Corresponding author. Tel.: +91 184 2259135;fax: +91 184 2250042.

E-mail address: [email protected] (D. Singh).

0739-7240/$ – see front matter © 2007 Elsevier Inc. All rights reserved.doi:10.1016/j.domaniend.2007.07.003

otility; RT-PCR

gen receptors (ER) � and � as well as for cytochromeP540 aromatase has provided evidence for a significantand crucial role of estrogens in maintaining normal sper-matogenesis [4]. Moreover, aromatase deficient mice(ArKO mice) are infertile due to an impairment of sper-matogenesis associated with a decrease in sperm motilityand inability to fertilize oocytes [5–7]. In rat testis, there

is an age-related change in the cellular localization ofthe aromatase activity, mainly in Sertoli cells in imma-ture animals, whereas it is located in Leydig cells inadults [8]. The P450arom mRNA is more abundant in

Page 2

al Endocrinology 34 (2008) 238–249 239

ltttacawpghelzcnPieum

2

2

fue4pMcsdlSsviaotaa

2

mrp

Table 1Criteria of mass motility grading on the basis of swirling current

0 No motility+ Less than 20%of sperm showing

progressive motion++ 20–40% showing progressive movement

with no wave+++ 40–60% showing progressive movement

with slow wave++++ 60–80% showing progressive movement

with more intense wave

A. Tiwari et al. / Domestic Anim

ess differentiated germ cell [5], whereas P450arom pro-ein and activity are higher in elongated spermatid andesticular spermatozoa [9]. In vitro studies have shownhat both Leydig and Sertoli cells produce estrogensnd Sertoli cell aromatase activity is under germ cellontrol [10]. It has also been claimed that spermatozoare able to convert pregnenolone into androgens, whichould in turn be metabolized into estrogens [11,12]. Theresence of mRNA encoding aromatase and the estro-en biosynthesis has been demonstrated in ejaculateduman spermatozoa [13]. More recent work of Aquilat al. further supported that a link exists among theocally produced estradiol (from ejaculated spermato-oa), sperm capacitation and the acrosome reaction andontain active P450 aromatse [14,15]. However, there iso information regarding the expression of cytochrome450 aromatase in spermatozoa of farm animals includ-

ng cattle and buffalo. Therefore, the present work wasnvisaged to study the expression of aromatase in ejac-lated buffalo spermatozoa and its relationship withotility of ejaculated spermatozoa.

. Material and methods

.1. Collection of semen samples

Semen samples were collected using artificial vaginarom test buffalo bulls, 3–4 years of age, (n = 6; 8 ejac-lates from 4 bulls with good quality semen and 4jaculates from 2 bulls with poor quality semen) afterdays of sexual abstinence, at Animal Breeding Com-

lex, NDRI, Karnal between the month of March anday as per the guidelines of the institute animal ethic

ommittee. The samples were immediately placed interile 15 ml tube (Tarson) at 37 ◦C and were graded asescribed below. All the samples were collected and ana-yzed on individual bull and individual ejaculates basis.ample of any category has not been pooled for analy-is. Human semen samples were obtained from men onolunteer basis by masturbation. Granulosa cells weresolated by aspiration from ovarian large follicles, sep-rated mechanically from buffalo ovaries, which werebtained from slaughterhouse. Both, human sperma-ozoa and granulosa cells are the abundant source ofromatase transcripts as described earlier and were useds positive control.

.1.1. Grading of semen

The semen was graded based on mass activity, initial

ass motility and other semen attributes according to theoutine procedure followed at Animal Breeding Com-lex, NDRI, Karnal [16]. In brief, one drop of neat semen

+++++ 80–100% showing progressivemovement with rapid waves

was placed on the preheated (37 ◦C) glass slide andobserved under microscope (10X). The graded semensamples based on the mass motility (swirling currents,Table 1) and other attributes of semen quality has beensummarized in Table 2. The semen sample with massmotility above 70% (i.e. more than 70% sperm showingprogressive motion) and low mass motility of almost 0(i.e. less than 10% sperm showing progressive motion)were taken in the present study to compare the aromatasetranscript in buffalo spermatozoa and was classified asgood quality semen and poor quality semen, respectively.

2.1.2. Isolation of motile and non-motilespermatozoa fractions by swim-up technique

The motile and non-motile spermatozoa fractionswere separated from the good quality semen sample byswim-up method. Whole semen (0.5 ml) was put at thebottom of the tube (Tarson) that contained modified sp-TALP (Tyrode’s Albumin Lactate Pyruvate) [17] mediain 1:5 ratio and the tube kept in CO2 incubator at 45◦angle, 5% CO2 and 37 ◦C for 60 min. After incubation,top fraction (3/4) containing motile spermatozoa (M)referred as motile fraction was separated in fresh tubeand the lower fraction (1/4) in the tube was consideredas non-motile fraction having non-motile spermatozoa(NM).

2.1.3. Isolation of spermatozoa from semen sampleThe spermatozoa from graded semen and motile and

non-motile fractions separated from good quality semenby swim-up techniques, as described above, were furtherisolated by centrifugation at 10,000 rpm (8944 × g) for10 min at room temperature.

2.2. Isolation of total RNA from sperm

Total RNA was isolated using TRI reagent (MolecularResearch Center, Inc. #TR-118) as per the manufac-

Page 3

240 A. Tiwari et al. / Domestic Animal Endocrinology 34 (2008) 238–249

Table 2Characteristics of graded semen of buffalo bull used in the present study

Semen quality Ejaculates Volume ofejaculates(ml)

Mass motility(mean ± S.E.)

Concentration (×106)(mean ± S.E.)

Non-eosinophiliccount concentration(×106) (mean ± S.E.)

Good 8 (n = 4) 3.0 ± 0.33 73.25 ± 2.06 862 ± 53.24 75.63 ± 1.75.05 ± 3

Poor 5 (n = 2) 2.08 ± 0.31 10

n = Number of buffalo bulls.

turer’s instructions and based on the original methodas described by Chomczynski and Sacchi [18]. In brief,the sperm pellet obtained from semen by centrifugationwas homogenized in TRI reagent. In general, 1 ml ofTRI reagent was added to the pellet of sperm obtainedfrom 2 ml of semen. The RNA pellet obtained afterthe extraction was resuspended in 20 �l of sterile water(sH2O) and stored at −70 ◦C for further use. Same pro-tocol has been used for RNA extraction from granulosacells.

2.2.1. RNA quantitation and purityThe RNA was quantified by diluting an aliquot of

5 �l of RNA (stock) in 995 �l of sterile DEPC-treatedwater (pH 8.0). The absorbance was measured at 260 and280 nm, using double beam spectrophotometer. TotalRNA content of sample was extrapolated using theequation: Total RNA = (A260 × 40 × 200)/1000, where,A260 is the absorbance at 260 nm, 40 is a constantfor RNA quantitation, 200 is the dilution factor anddivision by 1000 yields �g RNA/�l. The purity of

RNA was determined based on A260/A280 ratio, whichwas found as 1.7–2.0 for all RNA preparations. TheRNA preparations were stored at −70 ◦C for furtheruse.

Table 3Primers used in the present study

Primer name Primer sequence (5′ to 3′)

Outer G3PDH forward primer Control primers of supplied with RT-PCR kfrom Bangalore Genei Pvt. Ltd., IndiaOuter G3PDH reverse primer

CYP19 gene-specific outerforward primer

5′CATGGCAAGCTCTCCTTCTC3′

CYP19 gene-specific outerreverse primer

5′GCAGGGACTGACCAAACTTC3′

Inner G3PDH forward primer 5′AAACCCATCACCATCTTCCAG3′Inner G3PDH reverse primer 5′AGGGGCCATCCACAGTCTTCT3′

CYP19 gene-specific innerforward primer

5′ACTGGAGGGGTGAAGAAACC3′

CYP19 gene-specific innerreverse primer

5′TTGGCATGGATAGCACACAG3′

.15 456 ± 40.82 12.50 ± 2.50

2.3. Reverse transcription-polymerase chainreaction (RT-PCR)

Reverse transcription-polymerase chain reaction (RT-PCR) was performed using Ambion Retrosript kit (Cat.#1710). RT-PCR reaction was carried out in two steps:(a) first strand cDNA synthesis (RT reaction) and (b)PCR reaction, using gene-specific primers (Table 3).

2.3.1. Reverse transcription—first strand cDNAsynthesis

The first strand cDNA was synthesized in a sterileDNAse/RNAse-free Eppendorf tube by adding 1–2 �gof total RNA, 2 �l of random decamers and nuclease-free water up to 12 �l. The tube was incubated at70 ◦C for 3 min to denature secondary structure ofRNA. The final volume in the tube was made to 20 �lby further adding 4 �l of dNTP mix (2 mM), 2 �l of10× RT buffer, 1 �l of RNase inhibitor and 1 �l ofM-MuLV reverse transcriptase (200 IU). The contentwas mixed gently, spun briefly and incubated in ther-

mocycler (Biometra, Germany) at 42 ◦C for 1 h, at92 ◦C for 10 min and 4 ◦C pause. A RT-minus reac-tion mixture (without RT-enzyme) as negative controlwas always performed during each set of experiment

Length (nts) GC (%) Tm (oC) Amplification product (bp)

it500

20 55 62.45866

20 55 62.45

21 55 60.6136121 55 62.52

20 50 60.40302

20 57 60.40

Page 4

al End

at

2

DRs5(wccA67a

22Dtoa1www3fp4

2ufp(inTr91ea

2

apl

A. Tiwari et al. / Domestic Anim

nd we never observed amplification in our RT-minusube.

.3.2. Polymerase chain reaction (PCR)The amplification of cDNA was carried out in a

NA/RNA/pyrogen-free PCR tube containing 10 �l ofT product, 1 �l each of forward and reverse gene-pecific primers (10 �M), 1 �l of 10 mM dNTP mix,�l of 10× Taq buffer B, 1 �l of Taq DNA polymerase

1 U/�l) and volume made to 50 �l with nuclease-freeater. A brief spin was given for proper mixing of the

ontents and the reaction mixture was heated in thermo-ycler at 94 ◦C for 2 min (denaturation of RT enzyme).mplification was done for 32 cycles (94 ◦C for 1 min,0 ◦C for 1 min, 72 ◦C for 1 min). The final extension at2 ◦C was continued for 4 min and reaction was stoppedt 4 ◦C.

.3.3. Nested PCR

.3.3.1. Outer PCR. The outer PCR was performed in aNA/RNA/DNase/RNase/pyrogen-free PCR tube con-

aining 10 �l of RT product, 5 �l of 10X PCR buffer, 1 �lf dNTP mix (10 mM), 1 �l of 10 �M each of forwardnd reverse outer primers (aromatase and/or G3PDH),U of Taq DNA polymerase (1 U/�l) and nuclease-freeater to bring the reaction volume to 50 �l. The contentas mixed gently and spun briefly. The amplificationas done in thermocycler at 94 ◦C for 2 min followed by2 cycles (94 ◦C for 1 min, 60 ◦C for 1 min and 72 ◦Cor 1 min). A final extension at 72 ◦C for 4 min waserformed after last cycle and reaction was stopped at◦C.

.3.3.2. Inner PCR. The inner PCR was performedsing outer PCR product in a sterile DNAse/RNase-ree PCR tube. The tube contained 10 �l of outer PCRroduct, 5 �l of 10X PCR buffer, 1 �l of dNTP mix10 mM), 1 �l each of forward and reverse gene-specificnner primers (10 �M), 1 U Taq DNA polymerase anduclease-free water to bring the reaction volume to 50 �l.he content was mixed gently and spun briefly. PCR

eactions were performed in thermocycler by heating to4 ◦C for 2 min and followed by 32 cycles (94 ◦C formin, 60 ◦C for 1 min and 72 ◦C for 1 min). A finalxtension at 72 ◦C for was performed after last cyclend reaction was stopped at 4 ◦C.

.3.4. Polyacrylamide gel electrophoresis

The PCR products, which could not be detected on

garose (1.5%) gel electrophoresis, were analyzed usingolyacrylamide gel (6%) electrophoresis. The polyacry-amide gel was silver stained by keeping in fixing

ocrinology 34 (2008) 238–249 241

solution (10% acetic acid glacial) for 20 min on shakerfor proper fixing of PCR product in the gel. This was fol-lowed by washing for at least three times with distilledwater for 3 min each. The gel was kept in staining solu-tion (0.15% silver nitrate and 0.15% formaldehyde (37%purity) for 30 min followed by washing with distilledwater for 20 s. The gel was treated with the developer(3% sodium carbonate and 0.15% formaldehyde (37%purity) for developing the band and then developmentwas stopped with ice-cold fixative [19]. The gel wasphotographed with digital camera (Canon power shotA 32).

2.4. Gel quantification and statistical analyses

The bands of PCR products of target and control genesin the agarose and polyacrylamide gels were quantifiedby Gelquant software. The analysis of variance for theareas of these bands, was done by using MS excel soft-ware.

2.5. Sequencing of PCR products and BLASTanalyses

The PCR products were custom sequenced fromBangalore Genei Pvt. Ltd, India. Using T-Coffee mul-tiple alignment from http://www.expasy.org, the partialCyp19 cDNA sequence from ejaculated buffalo sperma-tozoa was blasted with ovarian Cyp19 cDNA sequencesof buffalo (acc. DQ407274), cattle (acc. NM 174305),sheep (acc. AJ012153), goat (acc. Y148883), pig (acc.NM 214429) and human (acc. Y07508).

3. Results

3.1. Detection of aromatase transcript in buffalospermatozoa

There was no detection of expression of cytochromeP450 aromatse mRNA (Fig. 1) in the total RNA isolatedfrom buffalo spermatozoa obtained from good qualitysemen on individual ejaculates basis (lane 2). However,its expression was found in human spermatozoa (lane 3)and buffalo granulosa cells aspirated from large ovarianfollicles, abundant source of aromatse transcripts (lane4; positive control).

In order to ascertain whether there was no expres-sion of cytochrome P450 aromatase mRNA in the

buffalo spermatozoa or its expression was very weak(no detection on 1.5% agarose gel, Fig. 1), nestedPCR experiment (Fig. 2) was performed as describedin Section 2. The nested PCR exhibited the expression

Page 5

242 A. Tiwari et al. / Domestic Animal End

Fig. 1. Expression of cytochrome P450 aromatase mRNA in buffalospermatozoa by conventional RT-PCR. Reaction was carried out in1.5 mM MgCl2 concentration at 60 ◦C (annealing temperature) for 32cycles. Lane1 represents 100 bp ladders. No expression was observedin lane 2 which represent RNA from buffalo spermatozoa from goodquality semen; lanes 3 and 4 represent RNA from human spermatozoaand buffalo granulosa cells of large ovarian follicles (positive control),respectively; lane 5, negative control (RT-minus).

Fig. 2. Nested PCR amplification of cytochrome P450 aromatasemRNA using total RNA isolated from buffalo and human-ejaculatedspermatozoa. Nested PCR was carried out in 1.5 mM MgCl2 concen-tration at 60 ◦C (annealing temperature) for 32 cycles. Lane 1, 100 bpDNA ladder; lanes 2 and 3 represent expression of cytochrome P450aromatase in total RNA isolated from buffalo spermatozoa and humanspermatozoa, respectively.

ocrinology 34 (2008) 238–249

of cytochrome P450 aromatase mRNA in the buffalospermatozoa (lane 2) and human spermatozoa (lane 3)as positive control. The nested PCR was performedin subsequent experiments for comparative analysis ofexpression of cytochrome P450 aromatase mRNA inbuffalo-ejaculated spermatozoa.

3.2. Comparison of aromatase expression inbuffalo-ejaculated spermatozoa

The RT and nested PCR for cytochrome P450 aro-matase mRNA was performed using total RNA isolatedfrom motile and non-motile spermatozoa separated byswim-up technique using good quality semen ejacu-late. The results showed (Fig. 3) a higher expression ofcytochrome P450 aromatase mRNA in motile fraction ofspermatozoa (lane 3) as compared to that in non-motilefraction (lane 2). In order to compare further, RT reac-tion followed by nested PCR, was performed with orwithout G3PDH as control gene and PCR product was

analyzed on 1.5% agarose gel (Fig. 4). There was higherexpression of aromatase in spermatozoa obtained fromgood quality semen ejaculate (lane 7) as compared tospermatozoa of poor quality semen sample (lane 8). Sim-

Fig. 3. Expression of cytochrome P450 aromatase mRNA using nestedPCR in motile and non-motile buffalo spermatozoa. Total RNA wasisolated from motile and non-motile spermatozoa separated from goodsemen sample by swim-up. Nested PCR was carried out in 1.5 mMMgCl2 concentration at 60 ◦C (annealing temperature) for 32 cycles.Lane 2 shows the aromatase expression in non-motile spermatozoaand lane 3 shows the aromatase expression in motile spermatozoa.Experiments were performed at least three times. No band in RT-minusas described in Section 2 (not shown in picture).

Page 6

A. Tiwari et al. / Domestic Animal Endocrinology 34 (2008) 238–249 243

Fig. 4. Expression of cytochrome P450 aromatase mRNA in buffalo spermatozoa using total RNA isolated from respective spermatozoa by nestedPCR. Nested PCR was carried out in 1.5 mM MgCl2 concentration at 60 ◦C (annealing temperature) for 32 cycles as described in Section 2. Lanes1 im-up;s semena R ampl9 east thr

imnseGsodGif

3ew

bwvtiGmhcsm

G3PDH. The primers for aromatase and G3PDH genesworked best (Fig. 6) at 1.5 and 2.0 mM MgCl2 andtherefore, 1.5 mM MgCl2 was considered as optimal forfurther experiments.

Fig. 5. Polyacrylamide gel analysis of aromatase expression in motileand non-motile spermatozoa with or without G3PDH house keepinggene. Nested PCR was carried out in 1.5 mM MgCl2 concentration at

, 5, 9, motile spermatozoa separated from good quality semen by swemen by swim-up; lanes 3, 7, 11, total spermatozoa from good qualitymplification of aromatase with G3PDH (semi-quantitative nested PC–12, amplification of G3PDH only. Experiments were performed at l

larly, high expression of aromatase was also observed inotile spermatozoa (lanes 1 and 5) compared to that in

on-motile spermatozoa separated from good semen bywim-up. However, the competition was observed in thexpression of aromatase gene when amplified along with3PDH as house keeping gene (lanes 1–4). The expres-

ion of aromatase could not be detected in spermatozoabtained from semen ejaculates when amplification wasone with control gene (Fig. 4, lane 3). The bands of the3PDH (Fig. 4, lanes 9–12) had almost equal intensity

ndicating the presence of equal amount of RNA isolatedrom spermatozoa of different categories.

.3. Polyacrylamide gel analysis of aromatasexpression in motile and non-motile spermatozoaith or without G3PDH (control) gene

Since the some of aromatase transcripts could note detected on agarose gel, the nested PCR productsere analyzed on 6% native polyacrylamide gel by sil-er staining as described. The results (Fig. 5) showedhe similar pattern as obtained on agarose gel, support-ng that there was competition between aromatase and3PDH, when amplified together, particularly when aro-

atase transcript is low (lane 5). However, there was

igher expression of aromatase in motile spermatozoa asompared to that in non-motile spermatozoa. This furtherupported our finding that the expression of aromataseRNA was positively related with sperm motility.

lanes 2, 6, 10, non-motile spermatozoa separated from good quality; lanes 4, 8, 12, total spermatozoa from poor quality semen; lanes 2–5,ification); lanes 6–8, aromatase amplification without G3PDH; lanesee times.

3.4. Effect of MgCl2 concentration on amplificationusing nested PCR

Magnesium chloride (MgCl2) is an essential fac-tor for Taq polymerase function. But the efficiency ofamplification with specific primers is strictly sequencespecific. The varying concentration of MgCl2 werestudied for their effect on nested PCR for amplifica-tion of cytochrome P450 aromatase mRNA, along with

60 ◦C (annealing temperature) for 32 cycles. Lane1 shows 20 bp ladder.Lanes 2 and 3 show nested PCR product of aromatase without G3PDHin motile and non-motile, respectively. Lanes 4 and 5 show nested PCRproduct of aromatase when amplified with G3PDH in motile and non-motile spermatozoa, respectively. Experiments were performed at leastthree times.

Page 7

244 A. Tiwari et al. / Domestic Animal Endocrinology 34 (2008) 238–249

Fig. 6. Effect of MgCl2 concentration in nested PCR. Analysis wasperformed at standard conditions as mentioned in Section 2, withvarying concentration of MgCl2, the nested PCR was performed using

Fig. 7. (A) Representative of semi-quantitative analysis of aro-matase/G3PDH expression in buffalo spermatozoa isolated from goodand poor quality semen. The nested PCR was carried out in 1.5 mMMgCl2 concentration at 60 ◦C (annealing temperature) for 32 cycles.The products were analyzed in 1.5% agarose gel. Experiments wereperformed at least three times. Lane 1, 100 bp ladder; lane 4, RT-minus(negative control); lane 2, spermatozoa of good quality semen; lane3, spermatozoa of poor quality semen. (B) Summary of aromataseexpression in spermatozoa isolated from buffalo semen of two grades.A single factor ANOVA was done using five replicates of cytochromeP450 aromatase mRNA/G3PDH house keeping gene ratios. The means

RNA isolated from motile spermatozoa separated by swim-up. 1.5 mMMgCl2 (lane 3) show the optimum expression of both aromatase andG3PDH.

3.5. Quantification of cytochrome P450 aromatasemRNA expression in spermatozoa from good andpoor quality semen ejaculates

The cytochrome P450 aromatase and G3PDH cDNAsfor spermatozoa of good and poor quality semen sampleswere amplified by nested PCR. The amplified prod-ucts were analyzed on agarose (Fig. 7A). The bandintensity was quantified by GelQuant software andresults were presented as ratios of cytochrome P450aromatase mRNA and G3PDH mRNA. The statisticalanalysis was done using a single factor ANOVA for fivereplicates. There was significantly higher expression ofcytochrome P450 aromatase mRNA (Fig. 7B) in sper-matozoa obtained from good quality semen sample ascompared to spermatozoa of poor quality semen.

3.6. Quantification of cytochrome P450 aromataseexpression in motile and non-motile spermatozoaseparated from good quality semen by swim-up

Aromatase expression was analyzed by semi-quantitative nested PCR using RNA isolated from motileand non-motile spermatozoa separated from good qual-ity semen sample by swim-up. The nested PCR productswere analyzed on polyacrylamide gel (8A) and bandintensity was quantified by GelQuant software. Theratios of cytochrome P450 aromatase mRNA/G3PDHwere determined. The statistical analysis was done using

a single factor for five replicates of cytochrome P450 aro-matase mRNA/G3PDH mRNA ratios. There was higher(P < 0.05) expression of cytochrome P450 aromatase(Fig. 8B) in motile (M) as compared to non-motile (NM)spermatozoa.

of these ratios were plotted as bar graph. The graph indicated that therewas higher (P < 0.01) expression of cytochrome P450 aromatase inspermatozoa obtained from the good quality semen sample as com-pared to spermatozoa from the poor quality semen.

3.6.1. BLAST analysisThe partial Cyp19 cDNA sequence from buffalo-

ejaculated spermatozoa showed (Fig. 9) homology of100, 99, 98, 98, 91 and 90% with that of buffaloovary (acc. DQ407274), cattle (acc. NM 174305), sheep(acc. AJ012153), goat (acc. AY148883), pig (acc.NM 214429) and human (acc. Y07508), respectively.

4. Discussion

The expression of cytochrome P450 aromatase gene

in buffalo-ejaculated spermatozoa was demonstrated forthe first time, using semi-quantitative RT-PCR tech-nique. While choosing quantitative or semi-quantitativeRT-PCR protocol to determine mRNA expression, many

Page 8

A. Tiwari et al. / Domestic Animal End

Fig. 8. (A) Representative of semi-quantitative analysis of aro-matase/G3PDH expression in motile and non-motile buffalospermatozoa separated from good quality semen by swim-up. Thenested PCR was carried out in 1.5 mM MgCl2 concentration at 60 ◦C(annealing temperature) for 32 cycles. The products were analyzed in6% polyacrylamide gel by silver staining. Lane1 shows 20 bp ladder.Lanes 2 and 3 show nested PCR product of aromatase or G3PDH inmotile and non-motile spermatozoa, respectively. Experiments wereperformed at least three times. (B) Summary of aromatase expressionin motile and non-motile spermatozoa separated from good qualityby swim-up. A single factor ANOVA was done using five replicatesof cytochrome P450 aromatase mRNA/G3PDH house keeping generatios. The means of these ratios were plotted as bar graph. The graphiPs

piceolpc

ndicated that there was higher (P < 0.05) expression of cytochrome450 aromatase in motile spermatozoa as compared to non-motilepermatozoa.

arameters must be taken into consideration [20–23]ncluding MgCl2 concentration, cycle numbers, primeroncentration, competition analysis with control gene,tc. Likewise, standardization was done for detection

f expression of cytochrome P450 aromatase mRNAevels in semen of different grades. Glyceraldehyde-3-hosphate dehydrogenase (G3PDH) was used as internalontrol gene to normalize the sample variation in total

ocrinology 34 (2008) 238–249 245

RNA content and for reaction efficiency. G3PDH hasbeen used as an internal control because it is ubiquitouslyexpressed, in moderately abundant levels in almost allcell types and in general, its expression is not influencedby any hormonal treatment [24]. In present system, theexpression pattern of control gene in all samples studiedwas found normal.

The cytochrome P450 aromatase mRNA could notbe detected in the RNA isolated from buffalo spermato-zoa (Fig. 1), whereas its expression was found in humanspermatozoa and buffalo granulosa cells of ovarian largefollicle. This indicated that either there is no expressionof aromatase in buffalo-ejaculated spermatozoa or tran-scripts are in low amount, which could not be detected byconventional RT-PCR on agarose gel. The present find-ings are in agreement with the results of Levallet et al. [7]who could not detect the signal regarding the expressionof aromatase in rat sperm due to very low number of tran-scripts in spermatozoa. These results suggested that theabsence of bands of cytochrome P450 aromatase in buf-falo spermatozoa in the RT-PCR experiment of presentstudy could be due to lesser cytochrome P450 aromatasetranscripts present in buffalo spermatozoa.

The nested PCR experiment was performed to ascer-tain whether there was no expression of cytochromeP450 aromatase in the buffalo spermatozoa or theexpression is too low, as it could not be detected on1.5% agarose gel. The results showed the expressionof cytochrome P450 aromatase in the buffalo sper-matozoa which are in agreement with the findings ofLambard et al. [13], who found the aromatase tran-scripts in human spermatozoa only by nested PCR andworked on individual human sample to amplify aro-matase transcript. In the present study also, experimentswere done on individual buffalo sample to amplify aro-matase transcript rather than pooling of different semensamples.

The nested PCR was performed in all subsequentexperiments to compare the expression of aromatasegene in motile and non-motile buffalo-ejaculated sper-matozoa. The results showed that there was a significantincrease in the expression of cytochrome P450 aromatasemRNA in motile spermatozoa compared to non-motilespermatozoa, separated from good quality semen byswim-up. Similarly, there was high expression of aro-matase in spermatozoa isolated from good quality ofsemen sample as compared to spermatozoa obtainedfrom poor quality semen sample. However, the compe-

tition was observed during amplification of aromatasegene along with G3PDH (control) gene and expressionof aromatase gene could not be detected in total sper-matozoa obtained directly from semen sample without

Page 9

246 A. Tiwari et al. / Domestic Animal Endocrinology 34 (2008) 238–249

Fig. 9. Comparison of the partial Cyp19 cDNA sequence (302 bp) from buffalo-ejaculated spermatozoa with Cyp 19 cDNA sequences of otherd from), sheefrom b

90% wi

species. Sequence of partial cDNA of buffalo aromatase mRNA isolatecDNA sequences of buffalo (acc. DQ407274), cattle (acc. NM 174305human (acc. Y07508). The partial cDNA amplified using total RNA(bGC), 99% with cattle, 98% with sheep and goat, 91% with pig and

swim-up. The bands of control gene with almost equalintensity indicated the presence of equal amount of RNA

isolated from spermatozoa of different categories. Thesimilar type of observation was also described by Lam-bard et al. [13] in human spermatozoa. Furthermore,Roudebush and Purnell [25] reported a five-fold increase

ejaculated spermatozoa was compared with corresponding aromatasep (acc. AJ012153), goat (acc. AY148883), pig (acc. NM 214429) anduffalo-ejaculated spermatozoa showed 100% homology with buffaloth human.

of total RNA in the non-motile sperm population but theconcentration of the cytochrome transcripts was more

in motile spermatozoa. The level of specific aromatasetranscript was significantly lower in non-motile cells, asalso reported for PAF-receptor mRNA [26]. Further, theexpression of aromatase was quantified in two different

Page 10

al End

cs

(shlmatirmiecaposem

tmeqaiempesd[Ttnpoictafamwhnu

A. Tiwari et al. / Domestic Anim

ategories of spermatozoa preparation using GelQuantoftware.

This result showed that the higher expressionP < 0.01) of cytochrome P450 aromatase was found inpermatozoa obtained from good quality semen (withigher mass motility) as compared to spermatozoa iso-ated from poor quality semen (having lower mass

otility). Similarly, the higher (P < 0.05) expression ofromatase was found in motile spermatozoa as comparedo non-motile spermatozoa separated from good qual-ty semen by swim-up. The present findings, as well aseports of previous workers [27] strongly suggested thatore expression of aromatase in motile spermatozoa,

rrespective of species, indicated that the aromatase isssential for the acquisition of motility. It has also beenlaimed that spermatozoa contain estrogens [28] and areble to convert androgen into estrogens [14] due to theresence of aromatase [13]. However, the possible rolesf aromatase transcripts are still not completely under-tood. They may represent a good marker of motility andstrogen exerts its non-genomic mechanisms of action onotility of spermatozoa.Several explanations may be proposed for the exis-

ence of aromatase transcripts in spermatozoa: (i) theyay be remnants of spermatogenesis or spermiogen-

sis and thus represent a marker of the spermatozoauality, (ii) it has been shown that transcriptionalnd translational activities could occur during capac-tation and acrosome reaction [29], (iii) the putativexistence of translationally repressed mRNAs in sper-atozoa has been reported [30]. In search of these

roposed explanations, various transcripts in human-jaculated spermatozoa have already been describeduch as those encoding for �1-integrins [31], phospho-iesterase subtypes [32], calcium channel �-1c subunit33], N-cadherins [34] and progesterone receptor [35].he presence of mRNAs encoding for transition pro-

eins or protamines has been shown in the human spermucleus [30]. In addition, these authors suggested theresence of sperm-specific mRNAs, such as cyclin B1riginating from a low transcriptional activity. In sim-lar lines, aromatase transcripts in buffalo spermatozoaould be a putative marker of sperm quality with respecto the acquisition of motility. Even though the role ofromatase in ejaculated spermatozoa is a good subjector present day research, it is now well established thatromatase plays a role in male reproduction. Since aro-atase has been detected in Sertoli and Leydig cells as

ell as in germ cells of various mammalian testes [1], itas been shown that the recrudescence of spermatoge-esis in rodents and some steps in spermatogenesis arender estrogen control [36,37]. The administration of an

ocrinology 34 (2008) 238–249 247

aromatase inhibitor in rat [38] and monkey [39] led tothe reduction of round and elongated spermatid numbers.In addition, in bank voles, treated with estradiol duringthe resting season, a recrudescence of spermatogenesiswas demonstrated [40]. In rat, whereas the amount ofP450arom mRNA decreases according to the stage ofgerm cell maturation, the aromatase activity increasesand is highest in testicular spermatozoa [7,9]. Therefore,in rodents, the aromatase activity decreases during theepididymal transit, which could be due to the shedding ofthe cytoplasmic droplet [9,41]. The cytoplasmic dropletmigrates along the sperm tail as the sperm crosses theepididymis (this does not, however, exclude a residualaromatase in mature sperm). In humans, it has been notedthat the cytoplasmic droplet disappearance is achievedprior to the beginning of the sperm epididymal trans-port and the acquisition of sperm motility. In fact, thepresence of cytoplasmic droplets seems to be associ-ated with a default of spermatogenesis and/or a defectiveremodeling of the sperm plasma membrane [42]. Resultssuggested that the levels of aromatase are higher inspermatozoa with cytoplasmic droplets. In that context,Janulis et al. [41] have reported an alteration of fluid reab-sorption in the proximal parts of the epididymis leadingto an accumulation of fluid within seminiferous tubules,which in turn induces an atrophy of germ cells in the�ERKO mice. Moreover, in the epididymis of monkey,aromatase activity has been demonstrated and this isincreased in the proximal parts of the epididymis, com-pared to corpus and cauda regions [43]. A decrease insperm motility has been reported in ArKO mice as wellas in man with an aromatase deficiency [27].

Further, in the present study, there was a decrease(P < 0.05) in aromatase transcripts in non-motile sper-matozoa versus motile spermatozoa. Lambard et al.[13] have been unable to amplify aromatase mRNA bynested PCR in one asthenospermic spermatozoa sample.Together with these data, it is suggested that aromatasecould be involved in the acquisition of sperm motility.The possible link between locally produced estradiol byejaculated spermatozoa and effects on sperm motilityand sperm capacitation, although attractive, currentlyrelies on indirect evidence, for example, testosterone inseminal plasma prevents premature capacitation [44].Thus, it is possible that aromatization of testosteronewould remove this inhibition. Whether the ability ofspermatozoa to synthesize estrogens influences theirfertilizing capacity, such as capacitation and acrosome

reaction, remains an intriguing issue to be clarified. Thisprobably opens a new era of investigation to give empha-sis on aromatase in ejaculated spermatozoa in farmanimals.

Page 11

al End

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

248 A. Tiwari et al. / Domestic Anim

5. Conclusion

Expression of cytochrome P450 aromatase in buffalospermatozoa was analyzed by semi-quantitative nestedPCR. The nested PCR and gel quantitation data showedhigher (P < 0.01) expression of cytochrome P450 aro-matase in spermatozoa obtained from the good semensample (higher mass motility) as compared to sperma-tozoa obtained from the poor quality semen (low massmotility). Similarly, the significantly higher expressionof cytochrome P450 aromatase was found in motilespermatozoa as compared to non-motile spermatozoaseparated from good quality semen by swim-up. Fromour present findings as well as reports of previous work-ers, it can be strongly suggested that higher expressionof aromatase mRNA in motile spermatozoa, may haveimportant role in sperm function, particularly for theacquisition of motility. These observations indicatedabout a clue that expression of aromatase in ejaculatedspermatozoa could be a putative marker for the qualityof semen with respect to acquisition of sperm motility infarm animals.

Acknowledgements

We thank Dr. T.K. Mohanty Sr Scientist, AnimalBreeding Centre, NDRI Karnal for bull selection, semencollection and informative discussion. The authors aregrateful to Director NDRI, Karnal for providing neces-sary facilities for this work. The NDRI–JRF to AshutoshTiwari is thankfully acknowledged.

References

[1] Carreau S, Genissel C, Bilinska B, Levallet J. Sources of oestro-gen in the testis and reproductive tract of the male rat. Int J Androl1999;22:211–23.

[2] Hess RA, Bunick D, Lee KH, Bahr J, Taylor JA, Korach KS,et al. A role for estrogens in the male reproductive tract. Nature1997;390:509–12.

[3] Simpson ER, Mahendroo MS, Means GD, Kilgore MW, Hin-shelwood MM, Graham-Lorence S, et al. Aromatase cytochromeP450, the enzyme responsible for estrogen biosynthesis.Endocrinol Rev 1994;15:342–55.

[4] Eddy EM, Washburn TF, Bunch DO, Goulding EH, Gladen BC,Lubahn DB, et al. Target disruption of the estrogen receptor genein male mice causes alteration in spermatogenesis and infertility.Endocrinology 1996;137:4796–805.

[5] Robertson KM, O’Donnell L, Jones ME, Meacham SJ, Boon WC,Fisher CR, et al. Impairment of spermatogenesis in mice lacking

a functional aromatase (cyp 19) gene. Proc Natl Acad Sci USA1999;96:7986–91.

[6] Robertson KM, Simpson ER, Lacham-Kaplan O, Jones MEE.Characterization of the fertility of male aromatase knockout mice.J Androl 2001;22:825–30.

[

ocrinology 34 (2008) 238–249

[7] Levallet J, Mittre H, Delarue B, Carreau S. Alternative splicingevents in the coding region of the cytochrome P450 aromatasegene in male rat germ cells. J Mol Endocrinol 1998;20:305–12.

[8] Papadopoulos V, Carreau S, Szerman-Joly E, Drosdowsky MA,Dehennin L, Scholler R. Rat testis 17 beta-estradiol: identifica-tion by gas chromatography–mass spectrometry and age relatedcellular distribution. J Steroid Biochem 1986;24:1211–6.

[9] Janulis L, Bahr JM, Hess RA, Jansen S, Osawa Y, Bunick D. Rattesticular germ cells and epididymal sperm contain active P450aromatase. J Androl 1998;19:65–71.

10] Carreau S. Paracrine control of human Leydig cell and Sertoli cellfunctions. Fol Histochem Cytobiol 1996;34:111–9.

11] Chew PCT, Loganath A, Peh KL, Chow WP, Gunasegaram R,Ratnam SS. Concentrations of intracellular sex steroids in humanspermatozoa. Arch Androl 1993;30:165–70.

12] Gunasegaram R, Chew PCT, Loganath A, Peh KL, Ratnam SS.A D4-3-keto pathway for testosterone synthesis in the humanspermatozoa. Arch Androl 1998;40:49–57.

13] Lambard S, Galeraud-Denis I, Bouraıma H, Bourguiba S, ChocatA, Carreau S. Expression of aromatase in human-ejaculatedspermatozoa: a putative marker of motility. Mol Hum Reprod2003;9:117–24.

14] Aquila S, Sisci D, Gentile M, Middea E, Siciliano L, Ando S.Human-ejaculated spermatozoa contain active P450 aromatase. JClin Endocrinol Metab 2002;87:3385–90.

15] Aquila S, Sisci D, Gentile M, Carpino A, Middea E, Catalano S, etal. Towards a physiological role for cytochrome P450 aromatasein ejaculated human sperm. Hum Reprod 2003;18:1650–9.

16] Benergee GC. A text book of animal husbandry. 8th ed. NewDelhi: Oxford and IBH Publishing Co. Pvt. Ltd; 1998. pp.286–339.

17] Bavister BD, Yanagimachi. The effects of sperm extracts andenergy sources on the motility and acrosome reaction of hamsterspermatozoa in vitro. Biol Reprod 1977;16:228–37.

18] Chomczynski P, Sacchi N. Single step method for RNA isolationby acid guanidium thiocyanate –phenol–chloroform extraction.Anal Biochem 1987;162:156–9.

19] Anolles GC, Gresshoff PM. Staining nucleic acids with silver:an alternative to radioisotopic and fluorescent labeling. Promeganotes magazine, no. 45; 1994. p. 13.

20] Erlich HA. PCR technologies: principles and applications forRNA amplification. Oxford, UK: IRL Press; 1989.

21] Carding SR, Lu D, Botomly KA. A polymerase chain reactionassay for detection and quantification of cytokine gene expressionin small number of cells. J Immunol Methods 1992;151:277–87.

22] Ali SA, Sarto I, Steinkasserer A. Production for PCR mim-ics for any semi-quantitative PCR application. Biotechniques1997;22:1060–2.

23] Freeman WM, Walker SJ, Vrema KE. Quantitative RT-PCR: pit-falls and potential. Biotechniques 1999;26:112–25.

24] Foss DL, Baarsch MJ, Murtaugh MP. Regulation of hypoxanthinephosphoribosyl transferase, glyceraldehyde 3-phosphate dehy-drogenase and �-actin mRNA expression in porcine immune cellsand tissues. Anim Biotechnol 1998;9:67–78.

25] Roudebush WE, Purnell ET. Ribonucleic acid content inspermatozoa: motile versus nonmotile. Proceedings of the

VIIth International Congress of Andrology. Montreal J Androl2001;35(Suppl.):162 [Abstract].

26] Roudebush WE, Wild MD, Maguire EH. Expression of platelet-activating factor receptor in human spermatozoa: differencesin messenger ribonucleic acid content and protein distribu-

Page 12

al End

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

A. Tiwari et al. / Domestic Anim

tion between normal and abnormal spermatozoa. Fertil Steril2000;73:967–71.

27] Carani C, Qin K, Simoni M, Faustini-Fustini M, Serpente S, BotdJ, et al. Effect of testosterone and estradiol in a man with aromatasedeficiency. N Engl J Med 1997;337:91–5.

28] Galeraud-Denis I, Lambard S, Carreau S. Expression of P450aromatase transcripts in ejaculated human spermatozoa. Proceed-ings of the VIIth International Congress of Andrology. MontrealJ Androl 2001;123(Suppl.):88 [Abstract 026].

29] Naz RK. Effect of catinomycin D and cycloheximide on humansperm function. Arch Androl 1998;41:135–42.

30] Siffroi JP, Dadoune JP. Accumulation of transcripts in the maturehuman sperm nucleus: implication of haploid genome in a func-tional role. Ital J Anat Embryol 2001;106:189–97.

31] Rohwedder A, Liedigk O, Schaller J, Glander HJ, Werchau H.Detection of mRNA transcripts of �1 integrins in ejaculatedhuman spermatozoa by nested reverse transcription-polymerasechain reaction. Mol Hum Reprod 1996;2:499–505.

32] Richter W, Dettmer D, Glander HJ. Detection of mRNAtranscripts of cyclic nucleotide phosphodiesterase subtypes inejaculated human spermatozoa. Mol Hum Reprod 1999;5:732–6.

33] Goodwin LO, Karabinus DS, Pergolizzi RG. L-Type volt-age dependent calcium channel �-1C subunit mRNA ispresent in ejaculated human spermatozoa. Mol Hum Reprod2000;6:127–36.

34] Goodwin LO, Karabinus DS, Pergolizzi RG. Presence of N-

cadherin transcripts in mature spermatozoa. Mol Hum Reprod2000;6:487–97.

35] Sachdeva G, Shah CA, Kholkute SD, Puri CP. Detection of pro-gesterone receptor transcript in human spermatozoa. Biol Reprod2000;62:1610–4.

[

ocrinology 34 (2008) 238–249 249

36] O’Donnell L, Robertson KM, Jones ME, Simpson ER. Estrogenand spermatogenesis. Endocr Rev 2001;22:289–318.

37] Carreau S, Bourguiba S, Lambard S, Galeraud-Denis I, GenisselC, Levallet J. Reproductive system: aromatase and estrogens. MolCell Endocrinol 2002;193:137–43.

38] Tsutsumi I, Fugimori K, Nakamura RM, Mather JP, Ono T, diZ-erega GS. Disruption of semeniferous epithelial function in therat by ovarian protein. Biol Reprod 1987;36:451–61.

39] Shetty G, Krishnamurthy H, Krishnamurthy HN, BhatnagarAS, Moudgal NR. Effect of longterm treatment with aromataseinhibitor on testicular function of adult male bonnet monkeys (M.radiata). Steroids 1998;63:414–20.

40] Bilinska B, Gancarczyk M, Kotula- Balak M, Carreau S, Slom-czynska M. Effect of 17 beta-estradiol on spermatogenesis inimmature bank voles. In: International Conference: Aromatase2002—The New Millenium. 2002.

41] Janulis L, Hess RA, Bunick D, Nitta H, Janssen S, Asawa Y,et al. Mouse epididymal sperm contain active P450 aromatasewhich decreases as sperm traverse the epididymis. J Androl1996;17:111–6.

42] Huszar G, Patrizio P, Vigue L, Willets M, Wilker C, Adhoot D, etal. Cytoplasmic extrusion and the switch from creatine kinase b toisoform are completed by commencement of epidydimal trans-port in human and stallion spermatozoa. J Androl 1998;19:11–20.

43] Pereyra-Martinez AC, Roselli CE, Stadelman HL, Resko JA.

Cytochrome P450 aromatase in testis and epididymis of malerhesus monkeys. Endocrine 2001;16:15–9.

44] Chan SY, Tang LC, Tang G, Chan PH. Effect of androgenon fertilizing capacity of human spermatozoa. Contraception1983;28:481–8.