Top Banner
Experiment 2 (Labs 4,5,6): Mouse Murder Myste Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? ate forms (alleles) of a chromosomal locus that dif leotide sequence or have variable numbers of repeat tide units Genetic variation in the population Used to identify different individual
28

Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Dec 17, 2015

Download

Documents

Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Experiment 2 (Labs 4,5,6): Mouse Murder Mystery

Using 3 autosomal polymorphic markersUsing 1 Y-chromosome marker

What is DNA Polymorphism?

Alternate forms (alleles) of a chromosomal locus that differ in nucleotide sequence or have variable numbers of repeated nucleotide units

Genetic variation in the population

Used to identify different individuals

Page 2: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Step 1: Isolate genomic DNA from mouse tissues (Suspects and Evidence)

Step 2: Perform PCR on ALL samples using 4 different primer pairs to determine the genotypes of suspects and evidence.

Step 3: Run all samples on a polyacrylamide gel using 100 bp DNA ladder.

Step 4: Analyze the gel and solve the mystery.

Experiment 2 (Labs 4,5,6): Mouse Murder Mystery

Read the mouse murder mystery story before doing the assignment or before coming to lab

Page 3: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Isolation of Genomic DNA using Commercial DNAzol

DNAzol

Homogenize

100%Ethanol

DNA

75%Ethanol

Precipitate Wash X2

dH2O

Store at 4 degrees

DNAzol: guanidine thiocyanate (strong protein denaturant)

Page 4: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

 Primer pair name  Sequence  Size of PCR fragments

3G5 For3G5 Rev

CTTTGGTCAGTCAGGATGGAACGCTCTTTGTGCTGTTACACTGG

 192 and 173

5G4 For5G4 Rev

AGTAGGCAGATAAGGGGTTTCCTACAGCATCTAGTGAATGGGGG

 188 and 161

6G2 For6G2 Rev

TTCTTCACCTGCCTTCTTCCACCCCTTTGCTTACCCAAGTTGCT

 158 and 140

MusY ForMusY Rev

TCCTTGGGCTCTTCATTATTCTTAACGAGAACCACGTTGGTTTGAGATG

 102

PCR for 30 cycles: 94°C for 30secs; 59°C for 30 secs and 73°C for 45 secs.

Page 5: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.
Page 6: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

5G4

1 2 3 4 5 6 7

6G2

1 2 3 4 5 6 7

3G5

1 2 3 4 5 6 7

MusY

1 2 3 4 5 6 7

Example from Previous Years

Page 7: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

 Primer pair name  Sequence  Size of PCR fragments

MUSY ForMUSY Rev

AGTAGGCAGATAAGGGGTTTCCTACAGCATCTAGTGAATGGGGG

 188 and 161

3G5 For3G5 Rev

CTTTGGTCAGTCAGGATGGAACGCTCTTTGTGCTGTTACACTGG

 192 and 173

PCR for 30 cycles: 94°C for 30secs; 59°C for 30 secs and 73°C for 45 secs.

Primer Pairs to be used this week

Lab 4: Mouse Murder Mystery

Page 8: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Sample 1- TerrySample 2- JamieSample 3- MelSample 4- RobinSample 5- Evidence 1 from glass 1Sample 6- Evidence 2 from glass 2Sample 7- Evidence 3 from glass 3

There are 15 wells in your polyacrylamide gel. You will load your gel in the following order: First lane will be 100 bp ladderSample 1-7 for 3G5 (lanes 2-8), Sample 1-7 for MusY (lanes 9-15)Sample 1-7 for 5G4 (lanes 2-8), Sample 1-7 for 6G2 (lanes 9-15)

Order of Samples: Very Important

Page 9: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Assigned Primer Pairs

1. Each group is to perform this experiment with ALL FOUR primer pairs. Each student is assigned a primer pair which is posted on the website. You will receive marks only for YOUR primer pair.

Please go to “Experiment 2” and click on “Click here to seewhich primer pair you have been assigned”.

2. Please make sure you do your assigned primer pair. If you have to switch primer pairs with someone then do so BEFORE the lab and more importantly you must inform me of the switch BEFORE the experiment.

Page 10: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Each person does 1 (their own assigned primer pair) autosomal marker:

Eg, Group 1-1 Student #1……….3G5Student#2………..6G2Student#3………..5G4All together as a group………MusY

Lab 4: Student#1….3G5… Setting up PCR reactionAll together….MusY…Setting up PCR reaction

Lab 5: Student#1….3G5… Running PCR product on PAGE All together….MusY…. Running PCR product on PAGE Student#2…..6G2….Setting up PCR reactionStudent#3…..5G4….Setting up PCR reaction

Lab 6: Student#2…6G2… Running PCR product on PAGE Student#3…5G4…Running PCR product on PAGE All together….Start Experiment 3 (Labs 6, 7, 8, 9, 10, 11)

From start to finish on your own

Same Gel

Same Gel

Page 11: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Rules for Switching Assigned Primer Pairs

Please make sure you do your assigned primer pair. If you have to switch primer pairs with someone (due to attendance) then you mustdo so BEFORE the lab and more importantly you must inform me of the switch BEFORE the experiment, otherwise you will receivemarks for a primer pair which you may not have performed.

Page 12: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

IMPORTANT: Saving Your Images for Experiment 2 (Mouse Murder Mystery)

You should have 2 gels:

1. Gel 1 with 3G5 and MUSY primer

Please save as “3G5_MUSY.tif”

2. Gel 2 with 5G4 and 6G2 primers

Please save as “5G4_6G2.tif”

(LAB 5)

(LAB 6)

Page 13: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Polyacrylamide Gel ElectrophoresisTo separate PCR products differing in only a few bp in length (for example, microsatellite markers), 6-10% PA gels are used.

Mixture of DNA molecules

Page 14: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Step by Step Instructions on how to assemble the polyacrylamide gel apparatus is posted on the course website

The TAs will be providing a demonstration in this week’s lab

Please make sure you view the movie demonstrating the assembly and running of PAGE.

Page 15: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Polyacrylamide Gels are made through the process of free radical polymerization

Initiation: The “initiator” is an unstable molecule that decomposes into a free radical and thereby attacks double bonds.

Propagation:

Termination:

* Also need a crosslinker and a catalyst Initiating Free radicalMonomerCrosslinkerCatalyst

Page 16: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

The role of the components in the gel

Component Volume

30% acrylamide/bisacrylamide 4ml5X TBE 3ml10% APS 45μlTEMED 15 μlWater 7.9 mlTotal 15ml

• What agent is the monomer?

• What is the function of bisacrylamide?

• What is the source of free radicals?

• Which agent is the catalyst?

Page 17: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Chemical Reactions Occurring in the Gel

Temed

Page 18: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Not all colonies on LB-Ampplate are of interest. Why?

What types of Ampr plasmids can be produced?

Page 19: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

DIRECTIONAL VS NON-DIRECTIONAL CLONING

EcoRI

EcoRI

5’

3’

NotI

EcoRI

5’

3’

How would you check if fragment was inserted?How would you check if fragment is in right orientation?

Page 20: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

DIRECTIONAL VS NON-DIRECTIONAL INSERTIONS

EcoR1

EcoR1

Nar INde I

5’

3’

Page 21: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

DIRECTIONAL VS NON-DIRECTIONAL INSERTIONS

EcoR1

EcoR1

Nar INde I

1 K

b La

dder

Nar

I

Nar

I

5’

3’

Page 22: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.
Page 23: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

β-galactosidase is an enzyme encoded by the bacterial gene lacZ.

β-galactosidase cleaves the colorless substrate X-gal (5-bromo-4-chloro-3-indolyl-β-galactopyranoside) into galactose and a blue insoluble product of the cleavage.

X-GAL

The LacZ Reporter Gene

You will be using this in Expts 3 and 4

Page 24: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Why are the cloning sites within lacz gene?

Page 25: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

White = RecombinantBlue = Non-recombinant

lacZ is used as a reporter gene

Blue/White Selection

Page 26: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Cloning Strategy for Experiment 3 will be discussed next week

Page 27: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

Next week: Discussion of Article 1

Please read article and answer questions before coming to class.

I will not be collecting answers to this article.

Page 28: Experiment 2 (Labs 4,5,6): Mouse Murder Mystery Using 3 autosomal polymorphic markers Using 1 Y-chromosome marker What is DNA Polymorphism? Alternate forms.

The End