Examination of the Transcriptional Regulation and ... · Examination of the transcriptional regulation and downstream targets of the transcription factor AtMYB61 Michael Prouse Doctor
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Examination of the Transcriptional Regulation and Downstream Targets of the Transcription Factor AtMYB61
by
Michael Prouse
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Department of Cell & Systems Biology University of Toronto
1.3.3 The DNA Targets of Single MYB Repeat Proteins .................................................. 14
1.4 The Nature of DNA-Binding by MYB Proteins .............................................................. 15
1.4.1 Relationship Between the MYB DNA-Binding Domain and DNA-Binding Specificity .......................................................................................................... 15
1.4.2 Involvement of MYB Repeats in DNA Binding ........................................................ 17
1.4.3 The Nature of DNA Binding By Animal MYB Proteins ............................................. 17
1.4.4 The Nature of DNA Binding By Plant MYB Proteins ............................................... 21
1.5 Future of Plant MYB-DNA Interaction Studies .............................................................. 24
vi
1.5.1 Determining the Breadth of MYB DNA Targets in vitro ........................................... 24
1.5.2 Emerging Approaches for Plant MYB Target Discovery and Analysis in vivo .......... 25
1.6 Transcriptional Regulation of MYB proteins ................................................................. 29
1.6.1 Regulators Effecting MYB Gene Expression in Networks ....................................... 29
1.6.2 The Role of Introns on MYB Transcriptional Regulation ......................................... 30
1.7 Research Hypotheses and Aims ............................................................................. 31
2 AtMYB61, an R2R3-MYB Transcription Factor, is a Pleiotropic Regulator of Plant Carbon Acquisition and Resource Allocation ....................................................................... 35
3 Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites ....................................................................................................................... 56
3.4 Results and Discussion ................................................................................................ 62
3.4.1 AtMYB61 Bound a Discrete Subset of DNA Target Sequences ......................... 62
3.4.2 AtMYB61 Bound to DNA Target Sequences with Varying Degrees of Affinity .... 66
3.4.3 The Affinity of AtMYB61 to Specific Target DNA Sequences Was Predicted by Molecular Interactions Determined in silico ....................................................... 69
3.4.4 The Affinity of AtMYB61 to Specific Target DNA Sequences Did Not Correlate with AtMYB61-Driven Transcriptional Activation with Each of the Target Sequences ........................................................................................................ 71
3.4.5 CASTing Target Sequences Were Found in the Promoter Regions of Three Putative Direct Downstream Targets of AtMYB61 ............................................. 76
4 Novel Regulation of an R2R3-MYB Transcription Factor, AtMYB61, by a Non-Hexokinase Sugar-Signalling Pathway ................................................................................ 84
4.3.8 Mass Spectrometry ............................................................................................ 91
4.4 Results and Discussion ................................................................................................ 91
4.4.1 AtMYB61 Expression is Regulated by Sugars .................................................... 91
4.4.2 AtMYB61 Acts in a Pathway Independent of the Hexokinase Sugar Signalling Pathway ............................................................................................................ 94
4.4.3 AtMYB61 Expression is Sugar Derepressed, Involving an Intragenic Sequence within the 5‘ Coding Region Containing Two Introns ......................... 97
4.4.4 Affinity Purification Coupled with Mass Spectrometry Uncovers a Suite of Putative AtMYB61 Repressor Proteins that Bind the Conserved Second Intron Motif in a Sucrose-Dependent Manner .................................................. 103
4.4.5 A Subset of Putative AtMYB61 Repressor Genes Are Sugar Sensitive ............ 106
A The Wound-, Pathogen-, and Ultraviolet B-Responsive MYB134 Gene Encodes an R2R3 MYB Transcription Factor that Regulates a Suite of Genes Involved in Proanthocyanidin Synthesis in Poplar ................................................................................ 141
35S Cauliflower Mosaic Virus 35S promoter 61P AtMYB61 promoter 61PN AtMYB61 promoter and 5‘ intragenic sequences 2-DG 2-deoxyglucose 3-OMG 3-O-methylglucose aba abscisic acid loss-of-function mutant abi abscisic acid insensitive loss-of-function mutant ABRC Arabidopsis Biological Resource Center AC-1 AtMYB61 preferred target sequence-ACCTAC AC elements adenosine and cytosine enriched sequences ACT ACTIN AMV avian myeloblastosis virus AGRIS Arabidopsis Gene Regulatory Information Server ANR2 ANTHOCYANIDIN REDUCTASE2 AtHXK Arabidopsis thaliana HEXOKINASE atmyb61 Arabidopsis thaliana MYB61 loss-of-function mutant BERF1 Barley Ethylene Response Factor1 BEIL1 Barley Ethylene Insensitive Like1 BGRF1 Barley Growth Regulating Factor1 bHTH basic helix-turn-helix bHLH basic helix-loop-helix C1 COLORED1 CAST cyclic amplification and selection of targets CCoAOMT7 caffeoyl-CoA 3-O-methyltransferase ChIP-chip chromatin immunoprecipitation on chip ChIP-seq chromatin immunoprecipitation followed by high throughput sequencing Col-0 wild-type Arabidopsis thaliana Columbia CPC CAPRICE DEPC diethylpyrocarbonate DFR1 DIHYDROFLAVONOL REDUCTASE1 DOF DNA binding with one Finger EMSA electrophoretic mobility shift assay FLP FOUR LIPS gin glucose insensitive loss-of-function mutant GL1 GLABRA1 GL3 GLABRA3 GR glucocorticoid receptor GS1b GLUTAMATE SYNTHETASE-1B GSNO S-nitrosoglutathione GTFs general transcription factors
GUS -glucuronidase hxk hexokinase loss-of-function mutant IBP indicator binding protein group IFN-g human interferon-g irx11 irregular xylem11/knat-7 loss-of-function mutant Kd dissociation constant KNAT7 KNOTTED1-like transcription factor LACC Local Animal Care Committee LC-MS/MS liquid chromatography tandem mass spectrometry LCR locus control region
xi
MBS MYB binding site MIAME minimum information about a microarray experiment MEME Multiple Em for Motif Elicitation MHL mannoheptulose MS Murashige Skoog MSA M phase-specific activator element MUG methylumbelliferone-glucuronide NASC Nottingham Arabidopsis Stock Centre NBS non-binding site of AtMYB61 PA proanthocyanidins PAL1 PHENYLALANINE AMMONIA-LYASE1
PHYRE Protein Homology/analogY Recognition Engine PLACE PLAnt Cis-Element datatbase qRT-PCR Quantitative, real-time, reverse transcriptase polymerase chain reaction R MYB repeat RAmy1a RICE ALPHA-AMYLASE rmx repressor of myb expression loss-of-function mutant RMX REPRESSOR OF MYB EXPRESSION SBEI STARCH-BRANCHING ENZYME I SELEX systematic evolution of ligands by exponential enrichment SMH single MYB histone group SNP sodium nitroprusside Sus3 sucrose synthase 3 TAIR The Arabidopsis Information Resource TRANSFAC Transcription Factor Database TRFL TRF1/2-LIKE genes UACC University of Toronto Animal Care Committee UTR untranslated regions WBS WER-binding site WER WEREWOLF WT wild-type
xii
List of Tables
1 Introduction
1.1 DNA binding specificities of members of the MYB superfamily ..................................... 12
2 AtMYB61, an R2R3-MYB transcription factor, is a pleiotropic regulator of plant carbon acquisition and resource allocation
2.1 Genes that share transcript abundance profiles with AtMYB61 determined by Pearson correlation coefficient, across the AtGenExpress developmental baseline dataset. ......................................................................................................................... 44
2.2 Genes that share transcript abundance profiles with AtMYB61 determined by Pearson correlation coefficient, across the AtMYB61 microarray dataset ..................... 46
2.3 AC elements within the promoters of putative downstream targets. .............................. 50
3 Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites
3.1 Alignment of AtMYB61 binding sites ............................................................................. 64
3.2 AtMYB61 consensus sequence was derived from a comparison of 89 sequences recovered from 5 cycles of CASTing ............................................................................. 65
3.3 Dissociation constants (Kd) in mol/L and associated errors of CASTing targets ........... 67
3.4 Dissociation constants (Kd) in mol/L and associated errors of mutated ACCTAC (AC1 element) sequences ............................................................................................ 68
S3.1 Relative binding of CASTing targets and mutated AC1 sequences to AtMYB61 .......... 80
4 Novel regulation of an R2R3-MYB transcription factor, AtMYB61, by a non-hexokinase sugar-signalling pathway
4.1 List of putative repressors of AtMYB61 expression (RMX) that bound AtMYB61 second intron repeat ................................................................................................... 105
S4.1 AtMYB61 second intron repeat motif identified within all Arabidopsis thaliana genes 118
S4.2 AtMYB61 second intron repeat motif identified within all Arabidopsis thaliana intergenic regions ....................................................................................................... 127
S4.3 AtMYB61 second intron repeat motif identified within all Arabidopsis thaliana introns and corresponding transcript response to sugar ......................................................... 129
xiii
List of Figures
1 Introduction
1.1 Schematic representation of an R2R3-MYB transcription factor...................................... 5
1.2 Phylogenetic relationships and subgroup designations for 87 MYB superfamily members ...................................................................................................................... 10
2 AtMYB61, an R2R3-MYB transcription factor, is a pleiotropic regulator of plant carbon acquisition and resource allocation
2.1 Transcript abundance of a subset of genes in the Arabidopsis thaliana transcriptome is influenced by the presence or absence of AtMYB61 activity ..................................... 43
2.2 AtMYB61 binds to the promoters of putative downstream targets, to motifs that are over-represented in these promoters and is sufficient to activate transcription from these motifs .................................................................................................................. 48
2.3 AtMYB61 binding to the 5‘ non-coding sequences of the three putative target genes as determined by EMSA ............................................................................................... 51
2.4 AtMYB61 downstream target genes have an impact on secondary wall formation and xylem formation in secondary thickened hypocotyls ...................................................... 53
3 Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites
3.1 Cylic amplification and selection of targets (CASTing) recovered a suite of hexamer target sequences that bound to AtMYB61 ..................................................................... 63
3.2 Relative binding affinities of AtMYB61 to CASTing targets and to mutated ACCTAC motif determined by nitrocellulose filter-binding assays are confirmed by electrophoretic mobility shift assays (EMSAs) ............................................................... 70
3.3 Molecular modelling of AtMYB61 with target sequences confirm binding preferences determined by nitrocellulose filter-binding assays and EMSAs ..................................... 72
3.4 AtMYB61-mediated activation of promoter activity in Saccharomyces cerevisiae in an AC dependent fashion .................................................................................................. 74
3.5 Sequences recovered from the CASTing assay were found in all three promoter regions of predicted direct downstream targets of AtMYB61, namely KNOTTED1-like transcription factor (KNAT7, At1g62990); caffeoyl-CoA 3-O-methyltransferase (CCoAOMT7, At4g26220), and pectin-methylesterase (PME, At2g45220) ................... 77
S3.1 AtMYB61 antibody generation and validation .............................................................. 79
4 Novel regulation of an R2R3-MYB transcription factor, AtMYB61, by a non-hexokinase sugar-signalling pathway
4.1 Sugar regulation of AtMYB61 expression in dark-grown wild-type seedlings, 7 days post-germination ........................................................................................................... 92
xiv
4.2 Promoter-reporter and qRT-PCR analysis of AtMYB61 expression in response to sugars ........................................................................................................................... 93
4.3 qRT-PCR analysis of AtMYB61 and HXK-2 expression in wild-type (WT) and glucose insensitive (gin) loss-of-function mutants ...................................................................... 96
4.4 Analysis of AtMYB61 promoter-reporter fusion constructs that contain or do not contain AtMYB61 5’ intragenic sequences in response to sucrose ............................... 98
4.5 Phylogenetic footprinting identifies a conserved repeat motif in the second intron of AtMYB61 Brassicaceae homologues ............................................................................ 99
4.6 EMSA shows AtMYB61 second intron motif bound differentially by proteins in nuclear extracts from seedlings grown in the absence or presence of sucrose in the dark, consistent with the derepression model ...................................................................... 101
4.7 Affinity purification coupled with LC-MS/MS determines putative AtMYB61 repressor proteins that bound the second intron repeat .............................................................. 104
4.8 qRT-PCR of putative repressors of AtMYB61 expression loss-of-function mutants (rmx) that had AtMYB61 misexpression in seedlings grown in the absence of sucrose in the dark, validating the repressor hypothesis .......................................................... 107
S4.1 Sequence alignment of the second intron of Brassicaceae AtMYB61 homologues .... 112
S4.2 Sequence alignment of AtMYB61 and AtMYB50 reveals no second intron repeat within AtMYB50 second intron .................................................................................... 113
S4.3 EMSA shows AtMYB61 second intron motif bound differentially by proteins in nuclear extracts from seedlings grown in the absence or presence of sucrose in the dark, consistent with the derepression model ............................................................. 114
S4.4 Validation of biotinylation of AtMYB61 second intron and second intron repeat ......... 115
S4.5 Semi-quantitative PCR of AtMYB61 expression in repressors of AtMYB61 expression loss-of-function mutant (rmx) seedlings grown in the absence or presence of sucrose in the dark .................................................................................. 116
S4.6 At2g43970 and At1g09540 share inverse transcript abundance profiles across development ............................................................................................................... 117
A Appendix. The wound-, pathogen-, and ultraviolet B-responsive MYB134 gene encodes an R2R3 MYB transcription factor that regulates a suite of genes involved in proanthocyanidin synthesis in Poplar
A.1 MYB134 binds to the promoters of putative downstream target genes ........................ 146
1
Chapter 1
Introduction
This chapter contains the following publication in its entirety:
Prouse M.B., and Campbell M.M. (2012) The interaction between MYB proteins and
their target DNA binding sites. Biochimica Et Biophysica Acta-Gene Regulatory
MBP contributed specifically to each figure and table in this chapter.
Copyright: Sections 1.1 to 1.6 inclusive are copyrighted by Elsevier B.V.
2
1. Introduction
1.1 Transcription Factors
In eukaryotic organisms, gene expression is subject to complex patterns of spatial and
temporal regulation. The first step of transcriptional regulation of any gene is
orchestrated by the activity of sequence-specific transcription factors, proteins that
function to reconfigure gene expression in response to external and internal cues.
Sequence-specific transcription factors frequently have a modular structure –
comprising a DNA-binding domain together with a transcriptional regulatory domain
(Colladovides et al., 1991). The DNA-binding domains of transcription factors are highly
conserved, while their transcriptional regulatory domains are variable (Schwechheimer
and Bevan, 1998). Sequence-specific transcription factors can act as transcriptional
activators, repressors, or both (Maniatis et al., 1987).
In eukaryotes, transcription factors that promote transcription are termed activator
proteins. Transcriptional activators can promote transcription of protein coding genes in
numerous ways. Activator proteins can bind a cognate target DNA site to directly or
indirectly recruit RNA polymerase II and general transcription factors (GTFs) that in turn
carry out transcription of a gene (Schwechheimer and Bevan, 1998; Lee and Young,
2000). Activator proteins can also effect the rate of transcription of a gene through
interactions with RNA polymerase II and GTFs (Lee and Young, 2000). Finally,
activator proteins can promote the acetylation of histone proteins making the DNA more
accessible for transcription (Cosma et al., 1999). Transcriptional activators accomplish
these tasks by directly or indirectly recruiting other proteins with this catalytic activity to
the DNA target.
Sequence-specific transcription factors that reduce transcription are transcriptional
repressors. These proteins act in three ways: (i) by binding to a cognate DNA site to
block the binding of general transcription factors or activators; (ii) by blocking
transcription by means of inhibitory interaction with general transcription factors or
activators; or (iii) by altering the higher-order DNA structure in a way to inhibit
3
transcription (HannaRose and Hansen, 1996). Repressors can reduce the rate of
transcription, or suppress it altogether.
Large families, or superfamilies of activator and repressor proteins have evolved in
eukaryotes. These are categorised based on the similarities of the DNA-binding
domain, with several such groups composed of one hundred or more members (Pabo
and Sauer, 1992; Yanhui et al., 2006). The MYB superfamily is one of the largest and
most diverse families of sequence-specific transcription factors (Rosinski and Atchley,
1998; Riechmann et al., 2000).
Much is known about the specifics of the interaction between animal MYB proteins and
their cognate DNA binding sites. By contrast, the knowledge of the details of MYB-DNA
interactions in plants is rather incomplete. This introduction will consider the current
state of knowledge with respect to MYB-DNA interactions in animals, and contrast this
with what is known in plants, suggesting means by which the gap in knowledge in plants
can be addressed. Moreover, this introduction will address how MYB proteins are
regulated to elicit their downstream responses.
1.2 The Nature of MYB Proteins
1.2.1 The MYB Transcription Factor Superfamily
The MYB superfamily is found in all major eukaryotic lineages, and is thought to be
more than 1 billion years old (Lipsick, 1996; Rosinski and Atchley, 1998; Kranz et al.,
2000; Wilkins et al., 2009). MYB proteins acquired their name from v-MYB, the
oncogenic component of avian myeloblastosis virus (AMV), where the sequence-
specific MYB domain was initially discovered (Peters et al., 1987). The cellular
counterpart of v-MYB is c-MYB, a MYB protein that plays a critical role in controlling the
proliferation and differentiation of hematopoietic cells (Mucenski et al., 1991). c-MYB
mutations that alter target gene expression drastically reduce the proliferation of
hematopoietic cells (Gewirtz and Calabretta, 1988). In keeping with this, homozygous
c-MYB knock-out lines of mice die before reaching day 15 of the fetal lifecycle due to
the inability to sustain hepatic erythropoiesis (Mucenski et al., 1991).
4
MYB superfamily members are characterised by a highly conserved DNA-binding
domain, referred to as the MYB domain, which consists of up to four imperfect amino
acid repeats (R1, R2, R3 and R4) of 50-53 amino acids (Fig. 1.1)(Rosinski and Atchley,
1998). Each of the MYB repeats, within the MYB domain, gives rise to a helix-helix-
turn-helix secondary structure (Fig. 1.1). The MYB domain is predominantly found
within the N-terminus of MYB-proteins (Fig.1.1)(Stracke et al., 2001); however, MYB
domains recently have also been discovered within the C-termini of MYB-proteins
(Linger and Price, 2009). Each MYB repeat consists of several highly conserved
tryptophan residues that are regularly spaced forming a hydrophobic core (Fig.
1.1)(Ogata et al., 1994). In contrast to the MYB domain, the C-terminal region of MYB
proteins is characteristically highly variable from one MYB protein to another, and
usually functions as either an activation or repression domain (Jin and Martin, 1999;
Kranz et al., 2000; Stracke et al., 2001; Jia et al., 2004). This gives rise to a wide range
of variability both structurally and functionally within the MYB superfamily.
In animals, the MYB superfamily is relatively small, generally comprising four or five
proteins (Lipsick, 1996; Konig et al., 1998; Rosinski and Atchley, 1998; Wong et al.,
1998). Animal MYB superfamily members regulate gene expression related to cell
division or a discrete subset of cellular differentiation events (Biedenkapp et al., 1988;
Golay et al., 1991; Howe and Watson, 1991). By contrast, the MYB superfamily in
plants has expanded dramatically, with 100-200 MYB family members commonly found
in individual plant species (Dubos et al., 2010). In plants, MYB proteins regulate a vast
array of biochemical, cellular and developmental processes (Martin and PazAres, 1997;
Jin and Martin, 1999; Dubos et al., 2010).
1.2.2 Animal MYB Proteins
As is the case with c-MYB, animal MYB superfamily members contain three MYB
repeats (Howe et al., 1990; Luscher and Eisenman, 1990; Ogata et al., 1994); although,
there are some notable exceptions that deviate from this, including human SNAPc 190
and TRF1 (Konig et al., 1998; Wong et al., 1998). In all annotated vertebrate genomes,
5
Figure 1.1. Schematic representation of an R2R3-MYB transcription factor. The primary structure, secondary structure and protein-DNA model are indicated for an R2R3-MYB transcription factor. MYB proteins are classified depending on the number of adjacent MYB repeats (R). Each MYB repeat gives rise to a helix-helix-turn-helix secondary structure that is involved in sequence specific binding. Model of an R2R3-MYB transcription factor binding to the major groove of its target sequence was generated by Pymol. H, helix; T, turn; W, tryptophan; X, amino-acid; red, helix secondary structure; green, turn secondary structure; yellow, DNA target.
6
there are only three MYB proteins with three MYB repeats: A-MYB, B-MYB, and c-MYB
(Lipsick, 1996; Rosinski and Atchley, 1998). A-MYB and B-MYB proteins are R1R2R3-
MYB nuclear transcription factors expressed in hematopoietic cells, epithelial cells, and
fibroblasts (Nomura et al., 1988). A-MYB negatively regulates cellular proliferation
(Golay et al., 1991), while B-MYB positively regulates cell growth control, differentiation,
and cancer (Sala and Watson, 1999).
1.2.3 Plant MYB Proteins
In comparison to animals, the MYB superfamily is greatly expanded in plants (Stracke et
al., 2001; Jia et al., 2004; Wilkins et al., 2009). For example, of the over 1600
sequence-specific transcription factors identified in the genome of the model
dicotyledonous plant, Arabidopsis thaliana, almost 10% are members of the MYB
transcription factor family (Riechmann et al., 2000; Dubos et al., 2010). In contrast to
animals, Arabidopsis thaliana has 5 three-repeat MYB proteins, and 126 two-repeat
(R2R3) MYB proteins, (Martin and PazAres, 1997; Arabidopsis Genome, 2000;
Riechmann et al., 2000; Stracke et al., 2001; Yanhui et al., 2006; Dubos et al., 2010),
while the monocotyledon plant rice (Oryza sativa) has 109 predicted R2R3-MYB
proteins (Yanhui et al., 2006). In addition, single-repeat MYBs have also been identified
in plants and animals in increasing numbers (Baranowskij et al., 1994; Carre and Kay,
1995; Feldbrugge et al., 1997; Konig and Rhodes, 1997; Schaffer et al., 1998; Koering
et al., 2000; Alabadi et al., 2001; Chen et al., 2001; Hwang et al., 2001; Nishikawa et al.,
2001; Lu et al., 2002; Mohrmann et al., 2002; Li and de Lange, 2003; Marian et al.,
2003; Maxwell et al., 2003; Court et al., 2005; Xue, 2005; Fukuzawa et al., 2006; Lira et
al., 2007; Ko et al., 2008; Liao et al., 2008; Pitt et al., 2008; Ehrenkaufer et al., 2009; Ko
et al., 2009; Rawat et al., 2009; Lang and Juan, 2010; Yi et al., 2010; Yu et al., 2010).
Although, single-repeat MYB proteins have been identified in both animals and plants,
the majority of single repeat MYB proteins have not been characterised in plants.
As their name implies, R2R3-MYB proteins have two MYB repeats (Stracke et al.,
2001). R2R3-MYB proteins comprise the largest group of MYB transcription factors in
the MYB superfamily and appear to be specific to plants (Dubos et al., 2010). Plant
R2R3-MYB proteins regulate a myriad of processes, including primary and secondary
7
metabolism; regulation of cell fate and identity; regulation of plant development; and
responses to biotic and abiotic stresses (Pazares et al., 1987; Martin and PazAres,
1997; Glover et al., 1998; Jin and Martin, 1999; Martin et al., 2002; Patzlaff et al.,
2003a; Patzlaff et al., 2003b; Gomez-Maldonado et al., 2004; Jia et al., 2004; Liang et
al., 2005; Dubos et al., 2010). While analogous processes, such as regulation of cell
fate and identity, can be found in animals, the precise functions associated with R2R3-
MYB proteins appear to be plant specific (Martin and PazAres, 1997; Jin and Martin,
1999; Dubos et al., 2010).
1.2.4 Single MYB Repeat Proteins
Single MYB repeat proteins can be classified into the following two groups: 1) proteins
with MYB domain at C-terminus (Indicator Binding Protein (IBP) group), and 2) proteins
with MYB domain at the N-terminus (Single MYB Histone (SMH) group). The IBP group
of proteins includes RTBP1 from rice, AtTRP1 and AtTBP1 from Arabidopsis thaliana
(Konig et al., 1998; Chen et al., 2001; Hwang et al., 2001), as well as the highly
characterized telomeric DNA-binding proteins TRF1, TRF2, RAP1 and Taz1. SMH
proteins are a novel group of single MYB proteins that have only been identified in
plants. SMH group of proteins include PcMYB1 from Petroselinum crispum, AtTRB1,
AtTRB2, AtTRB3 from Arabidopsis thaliana, and Smh1 from Maize. AtTRB1, AtTRB2,
AtTRB3 have been studied in detail, all sharing a single MYB repeat more similar to R2
than R1 and R3 (Marian et al., 2003). In Arabidopsis thaliana, single-repeat MYB
proteins CAPRICE (CPC), TRYPTICHON (TRY), ETC1 (ENHANCER OF TRY and
CPC) and ETC2 have been identified (Schellmann et al., 2002; Kirik et al., 2004).
1.2.5 Expansion and Diversification of the MYB Family
Two theories of how the MYB superfamily evolved have been constructed based on
parsimony (Lipsick, 1996). The first is formulated on the premise that three-repeat MYB
proteins are closely related to vertebrate c-MYB and other similar three-repeat MYB
proteins in other eukaryotic groups, such as ciliates and slime molds (Braun and
Grotewold, 1999; Yang et al., 2003b). These primitive proteins are predicted to have
existed before the divergence between animals and plants (Yang et al., 2003b). This
8
theory proposes that R2R3-MYB proteins originated recently from three-repeat MYB
proteins due to loss of R1-MYB repeat (Braun and Grotewold, 1999; Dias et al., 2003).
The second theory postulates that within an ancient R2R3 predecessor that there was a
domain duplication and subsequent gain of R1, suggesting that R2R3 is a precursor of
MYB3R (Jiang et al., 2004a). Common to both theories, there was a vast expansion of
R2R3-MYB proteins in plants via duplications of entire genes (Lipsick, 1996); however,
the expansion was restricted for the three-repeat MYB proteins in both animals and
plants. Comparisons of DNA-binding specificities and functional roles between MYB
proteins with different repeats could help elucidate the nature of the evolutionary
pathway for MYB proteins.
1.3 DNA targets of MYB family members
1.3.1 Animal MYB DNA-Binding Sites
The DNA target of animal three-repeat MYB transcription factors was first determined
by isolation of chicken genomic DNA fragments bound by v-MYB on filters (Biedenkapp
et al., 1988) and by comparison of putative MYB binding sites within the SV40 enhancer
region (Nakagoshi et al., 1990). Binding-site selection methods with c-MYB protein
resulted in added minor extensions to the c-MYB consensus sequence. The c-MYB
consensus sequence was found to be ((T/C)AAC(G/T)G(A/C/T)(A/C/T)) and was termed
MYB binding site I (MBSI) (Howe et al., 1990; Weston, 1992). Mutational assays
validated by NMR structural data revealed that the MBSI sequence was bipartite. The
first half-site ((T/C)AAC)) has the majority of specific contacts with R3, and the second
half-site ((G/T)G(A/C/T)(A/C/T)) had specific contacts with R2 (Tanikawa et al., 1993;
Ogata et al., 1994; Ording et al., 1994). Following identification of the c-MYB DNA-
binding site, mammalian A-MYB and B-MYB, were subsequently shown to bind MBSI
(Mizuguchi et al., 1990; Watson et al., 1993; Ma and Calabretta, 1994; Jin and Martin,
1999).
9
1.3.2 Plant MYB DNA-Binding Sites
Although R1R2R3-MYB proteins in plants share the same functionality as animal
R1R2R3-MYB family members, their DNA-binding specificities are different (Howe and
Watson, 1991; Weston, 1992; Ito, 2005). All three characterised animal three-repeat
MYB proteins bind to the same sequence MBSI ((T/C)AAC(G/T)G(A/C/T)(A/C/T)) and
have similar functions in cell-cycle control (Biedenkapp et al., 1988; Golay et al., 1991;
Howe and Watson, 1991). In comparison, plant three-repeat MYB proteins, such as
tobacco MYBA1, MYBA2, and MYBB have an important role at the G2/M phase of the
cell-cycle, by regulating transcription of cyclin B and other cell-cycle genes that are
expressed at a similar time in the cell-cycle (Ito et al., 1998). Through a yeast one-
hybrid screen, NtMYBA1, NtMYBA2, and NtMYBB were found to bind to AACGG. This
consensus sequence is known as the M phase-specific activator (MSA) element, and
was identified previously in tobacco.
Relatively few of the possible plant R2R3-MYB DNA targets have been characterised;
but some common elements of plant MYB-DNA interactions have emerged (Fig. 1.2,
Table 1.1). Recognition of plant MYB DNA targets was first determined with studies
conducted on the Maize P protein, an R2R3-MYB protein involved in flavonoid
biosynthesis (Grotewold et al., 1994). Through binding-site selection assays and
EMSAs, P was shown to bind to ACC(A/T)ACC(A/C/T). This contrasted with the animal
MYB DNA consensus sequence of ((T/C)AAC(G/T)G(A/C/T)(A/C/T)), but was a
harbinger for the majority of plant MYB proteins, which recognise MBSI
((T/C)AAC(G/T)G(A/C/T)(A/C/T)), MBSII (AGTTAGTTA), and MBSIIG
((C/T)ACC(A/T)A(A/C)C). Nevertheless, it is important to note that not all plant MYB
proteins, especially within the R2R3-MYB family, recognise these motifs (Romero et al.,
1998). Many R2R3-MYB transcription factors recognise AC elements, DNA motifs that
are enriched in adenosine and cytosine residues (Grotewold et al., 1994; Sablowski et
al., 1994; Sablowski et al., 1995; Moyano et al., 1996; Sainz et al., 1997; Uimari and
Strommer, 1997; Tamagnone et al., 1998; Jin et al., 2000; Sugimoto et al., 2000; Yang
et al., 2001; Patzlaff et al., 2003a; Patzlaff et al., 2003b; Fukuzawa et al., 2006). Some
R2R3-MYB proteins function as transcriptional activators at these sites (Patzlaff et al.,
2003a; Patzlaff et al., 2003b), while others function as transcriptional repressors
10
Figure 1.2. Phylogenetic relationships and subgroup designations for 87 MYB superfamily members. The unrooted phylogenetic tree was generated using the amino acid sequences of the MYB proteins in Table 1.1. Whole MYB protein sequences were downloaded from The Arabidopsis Information Resource (TAIR; http://Arabidopsis.org) and from the National Center for Biotechnology Information protein database (NCBI Entrez; http://www.ncvi.nlm.nih.gov/sites/entrez). The phylogenetic analysis included 9 three-repeat MYB proteins (R1R2R3-MYB proteins), 50 two-repeat MYB proteins (R2R3-MYB proteins) and 28 one-repeat MYB proteins (R1-MYB proteins). The full-length amino acid sequences were aligned using Multiple Alignment using Fast Fourier Transform (MAFFT) using the G-INS-I algorithm (Katoh et al., 2005). A neighbour-joining tree was constructed using Molecular Evolutionary Genetics Analysis 4 (MEGA 4) (Tamura et al., 2007) with the parameters for the Jones-Taylor-Thornton substitution model and a Gamma parameter of 1.0 to account for the
11
Figure 1.2 caption continued. uneven rates of substitution across the length of the MYB proteins. Pairwise gap deletion was used, along with a bootstrap value of 1000. DNA-binding sites for MYB proteins were obtained from the literature. MYB proteins are annotated by colour based on DNA sequence recognition. Red, blue, green, orange, purple and grey represent MYB proteins that bind CNGTT(A/G), ACC(A/T)A(A/C), TTAGGG, AAAATATCT, GATA and TATCCA respectively. Black represents MYB proteins that do not bind to an assigned group. N indicates adenosine, guanine, cytosine or thymine. * indicates that the MYB protein DNA-binding specificity differs slightly from the consensus sequence of its group. Refer to Table 1.1 for specific details on DNA sequences bound by the MYB proteins.
12
Table 1.1. DNA binding specificities of members of the MYB superfamily. The information in the table represents the current state of knowledge pertaining to the DNA targets of MYB proteins, as determined from the literature. N indicates adenosine, guanine, cytosine or thymine. * indicates that the MYB protein DNA-binding specificity differs slightly from the consensus sequence of its group.
Group MYB Protein Binding Site Species MYB REPEAT References
Figure 2.1. Transcript abundance of a subset of genes in the Arabidopsis thaliana transcriptome is influenced by the presence or absence of AtMYB61 activity. Clustergram of transcript abundance of genes that share the same transcript abundance profile as AtMYB61 in 7 d old, dark-grown wild-type (WT), atmyb61, and 35S::MYB61 seedlings. Each row shows transcript abundance data for a given gene in 7 d old, dark-grown seedlings as determined by Affymetrix ATH1 GeneChip microarrays. Three biological replicates were analysed for each genotype. Green indicates low transcript abundance; whereas, red indicates high transcript abundance. Genes that share the same transcript abundance profile as AtMYB61 as determined by Expression Angler, using a Pearson correlation coefficient >0.8 as the cut-off, are characterised by having low transcript abundance in the atmyb61 mutant and high transcript abundance in the 35S::MYB61 overexpressor.
44
Table 2.1. Genes that share transcript abundance profiles with AtMYB61 Determined by Pearson correlation coefficient, across the AtGenExpress developmental baseline dataset.
Pearson correlation co-
efficient relative to AtMYB61
Arabidopsis Gene
Identifier (AGI) Gene Product Description
0.911 At1g63300 unknown protein
0.906 At5g58930 unknown protein 0.906 At5g40960 unknown protein 0.898 At1g62990 KNOTTED-LIKE HOMEOBOX 7
0.894 At3g11690 unknown protein
0.894 At1g14380 IQ67 DOMAIN PROTEIN 28
0.892 At2g43060 transcription factor
0.890 At5g60820 C3HC4-type RING finger
0.887 At4g33330 PGSIP3__transferase, transferring glycosyl groups
Figure 2.2. AtMYB61 binds to the promoters of putative downstream targets, to motifs that are over-represented in these promoters and is sufficient to activate transcription from these motifs. (a) Schematic representation of the 5‘ noncoding sequences of the three putative AtMYB61 downstream target genes identified as the intersection set of genes found to be co-regulated with AtMYB61 in both the AtGenExpress developmental dataset and a
49
Figure 2.2 caption continued. AtMYB61-specific microarray experiment, as determined by Expression Angler. +/− indicate the orientation of canonical R2R3-MYB binding site motifs relative to the sense coding strand, and numbers indicate the position of these motifs relative to the putative transcriptional start (indicated by an arrow). Blue horizontal lines under the sequences correspond to the location of the DNA sequence used as the target in the electrophoretic mobility shift assay (EMSA) conducted in (b). (b) AtMYB61 binding of the 5‘ noncoding sequences of the three putative target genes as determined by EMSA. Recombinant AtMYB61 binds to all three 5‘-noncoding sequences, as determined by a gel shift of the probe, and can be outcompeted with increasing quantities of unlabelled DNA corresponding to a canonical R2R3-MYB binding site, known as an AC element. (c) Left: over-represented motif in the 5‘ noncoding sequences of the three genes outlined above, as determined by the Promomer algorithm (Toufighi et al., 2005) (average = 2.9; Z-score = 13; significance = 0.001). Right: AtMYB61 binding to the AC-rich motif as determined by EMSA. Recombinant AtMYB61 binds to the AC-rich motif (AC: 5′ attgttcttcctggggtgaccgtccACCTAAcgctaaaagccgtcgcgggataagcctgtctg 3′), but not to a mutated version of the putative binding motif (NBS: 5′ attgttcttcctggggtgaccgtgcATGGATcgctaaaagccgtcgcgggataagcctgtctg 3′). (d) AtMYB61-mediated activation of promoter activity in Saccharomyces cerevisiae. AC (5′ gaagacgaggtaccagccACCTAAcccACCTAAcccACCTAAcgctgttctcgagcctcatct 3′) and NBS (5′ gaagacgaggtaccagTCCATGGATcgccATGGATcgccATGGATcctgttctcgagccctcatct 3′) sequences are triplicated within the segment. Left: schematic representation of the effector (top) and reporter (bottom) constructs used in this study (CYC1: minimal yeast promoter). Right: quantitative analysis of β-galactosidase activity in yeast (noninducible medium: glucose, open bars; inducible medium: galactose, closed bars). Error bars represent standard deviation. *Significantly different from control, P < 0.05, t-test.
50
Table 2.3. AC elements within the promoters of putative downstream targets. Table of the orientation and location of AC elements within the upstream non-coding regions of the putative targets.
AGI Gene AC Element Orientation Location
At1g62990 AtKNAT7 ACCTAA Antisense 558
ACCTAA Antisense 665
ACCTAA Antisense 704
At2g45220 AtPME ACCAAC Antisense 139
ACCAAT Antisense 143
ACCAAT Sense 151
At4g26220 AtCCoAOMT7 ACCAAA Antisense 82
ACCAAC Sense 128
ACCAAA Antisense 165
ACCAAA Antisense 235
51
Figure 2.3. AtMYB61 binding to the 5’ non-coding sequences of the three putative target genes as determined by EMSA. Recombinant AtMYB61 bound to all three 5‘-non coding sequences of AtKNAT7, AtCCoAOMT7 and AtPME, as determined by a gel shift of the probe (arrows), and could not be outcompeted with increasing quantities of unlabelled DNA corresponding a random binding site (NBS: 5‘ attgttcttcctggggtgaccgtgcATGGATcgctaaaagccgtcgcgggataagcctgtctg 3‘).
52
involved in xylem differentiation, including one that involves AtMYB61. As such,
AtKNAT7 could be viewed as a regulatory module that is co-opted by several gene
regulatory networks.
2.4.3 AtMYB61 Regulates Genes Which Themselves Contribute to
AtMYB61-Related Phenotypes
To determine whether the putative AtMYB61 targets contribute to any of the xylem-
related traits in which AtMYB61 is involved (Romano et al., 2012), the phenotypes of the
loss-of-function mutants for the target genes (atknat7/irx11, atpme and atccoaomt7)
were compared with atmyb61 and WT. Loss-of-function mutations in each of the three
target genes generated xylem-related phenotypes that at least partially phenocopied
atmyb61 phenotypes. For example, secondary thickening of xylem vessel cell walls
was reduced in atknat7/irx11 and atpme mutants relative to WT, like atmyb61 (Fig. 2.4).
As with atmyb61 mutants, the xylem : phloem ratio was reduced relative to WT in
secondary thickened hypocotyls of atknat7/irx11, atpme and atccoaomt7 mutants
(Fig. 2.4). Strikingly, the atknat7/irx11, atpme and atccoaomt7 mutants had far fewer
fibre cells and disproportionately more vessel cells relative to WT (Fig. 2.4). Unlike
atmyb61 mutants, the atknat7/irx11, atpme and atccoaomt7 mutants were able to make
vessels, and fusiform cambial cells were not the predominant cell type. These findings
are in keeping with the hypothesis that AtMYB61 functions upstream of AtKNAT7,
AtPME and AtCCoAOMT7, as AtMYB61 activity promotes the differentiation of both
vessels and fibres, whereas the differentiation of vessels more prominently occurs in the
atknat7/irx11, atpme and atccoaomt7 mutants. This suggests that AtKNAT7, AtPME
and AtCCoAOMT7 are involved in pathways governing fibre differentiation in secondary
hypocotyl development, whereas AtMYB61 sits upstream of both fibre and vessel
differentiation pathways in the development of this anatomical region.
Figure 2.4. AtMYB61 downstream target genes have an impact on secondary wall formation and xylem formation in secondary thickened hypocotyls. Transmission electron micrographs (×2000) of cross-sections obtained from primary inflorescence stems of growth stage 6.03 Arabidopsis thaliana plants grown under 12 h light : 12 h dark conditions, for (a) wild-type (WT), (b) atmyb61, (c) atknat7, (d) atpme and (e) atccoaomt7 genotypes. All plants were grown until the inflorescence stems were an equivalent length (26 cm), and cross-sections were made at 0.5 cm from the base of the stem (adjacent to the rosette). Bars, 10 μm. (f–j) Secondary thickened hypocotyls from mature plants after 10 wk of growth with continuous removal of primary and secondary inflorescences under 12 h light : 12 h dark conditions. Sections were stained with phloroglucinol to reveal alterations of lignified xylem cells to phloem cells. Sections are (f) WT, (g) atmyb61, (h) atknat7, (i) atpme and (j) atccoaomt7 genotypes. (k) Quantitative assessment of the ratio of xylem area : phloem area obtained from multiple measurements (biological replicates, n > 10) of secondary thickened hypocotyl cross-sections obtained as already described. (l) Fibre quality analysis of secondary thickened hypocotyls from plants after 10 wk of growth with continuous removal of the primary and secondary inflorescence under 12 h light : 12 h dark conditions. Results are shown as the ratio of length to diameter to reflect particular cell types. Length : diameter (L : D) ratios of 10 indicate vessels, of 17.5 indicate fibres and of 20 indicate cambial cells. Bars represent ± SE. *Significantly different from WT (P < 0.05). Data from experiments performed in triplicate with 5–20 seedlings per genotype per experiment, depending on the nature of the experiment. (f-j) Bars, 50 μm.
54
2.5 Conclusion
These findings suggest that AtMYB61 functions as a pleiotropic regulator of carbon
acquisition and allocation of the plant via a small gene network. Three direct
downstream targets of AtMYB61 were predicted based on comparative transcriptome
analyses between microarrays that examined changes in gene expression that were
modulated by differences in AtMYB61 activity and sugar, and those that examined the
co-expression of AtMYB61 across plant development and in different organs. These
predicted direct downstream targets of AtMYB61 are: a KNOTTED1-like transcription
factor (KNAT7, At1g62990); a caffeoyl-CoA 3-O-methyltransferase (CCoAOMT7,
At4g26220), and a pectin-methylesterase (PME, At2g45220). AtMYB61 bound the
putative downstream targets‘ promoter regions in an AC-motif-dependent fashion.
Expression of AtMYB61 protein in yeast was sufficient to drive the transactivation of a
reporter gene comprising a tandem repeat of an AC element fused to a yeast minimal
promoter, upstream of the reporter lac-Z. Together, these results suggest that
AtMYB61 binds to promoter regions of downstream targets to modulate transcription to
regulate the allocation of carbon to non-recoverable sinks when conditions are
favourable to do so.
2.6 Acknowledgements
We are most grateful to Astrid Patzlaff, Christine Surman and Joan Ouellette for
excellent technical assistance. This work was generously supported by funding from
the Natural Science and Engineering Research Council of Canada (NSERC) and the
Canada Foundation for Innovation (CFI) to S.D.M., by a Canadian Graduate
Scholarship (CGSD) from NSERC awarded to M.B.P., and O.W., by an NSERC
Discovery Grant and the NSERC Green Crops Network to C.J.D., and by funding from
the University of Toronto, CFI and NSERC to M.M.C. Research infrastructure was
provided by the Centre for Analysis of Genome Evolution and Function at the University
of Toronto.
55
Chapter 3
Interactions between the R2R3-MYB transcription factor, AtMYB61, and target DNA binding sites
This chapter is the equivalent of the following submitted manuscript in its entirety:
Prouse M.B., and Campbell M.M. (2013) Interactions between the R2R3-MYB
transcription factor, AtMYB61, and target DNA binding sites. PLOS ONE. 8(5): e65132.
criteria identified sequences with a min/max motif width of 6, any number of repetitions
of a single motif distributed among the sequences, and no restrictions on the number of
motifs identified. Following MEME analysis, all CASTing-enriched sequences contained
over-represented motifs characterised by an abundance of adenosine and cytosine
residues. These over-represented motifs had a conserved set of ACC nucleotides
present at the beginning of the motifs, suggesting that these nucleotides may be
essential for recognition and binding (Table 3.1, Table 3.2, Fig. 3.1b). These motifs
correspond to canonical AC elements, also known as H-boxes or PAL-boxes (Table 3.1,
Table 3.2, Fig. 3.1b).
63
Figure 3.1. Cylic amplification and selection of targets (CASTing) recovered a suite of hexamer target sequences that bound to AtMYB61. (a) 27bp random sequences flanked by two primer sites (63bp in total) were used in the CASTing assay. (b) Sequence logo of CASTing targets discovered by MEME. The ACC motif was conserved among all target sequences. Two nucleotides upstream and downstream of the over-represented hexamer target sequences were included to analyse if the over-represented motifs could be extended beyond a hexameric sequence.
64
Table 3.1. Alignment of AtMYB61 binding sites obtained from CASTing Assay
Seven hexomer targets were determined to be overrepresentative by MEME (Multiple EM for Motif Elicitation).
Group AtMYB61 Site
ACCACC
1 ACCCCAGAGTCCC ACCACC CGACCCCC
2 ACCCAAACACCACGCCCTAG ACCACC C
3 GCTAAACGTTCATTCCCCT ACCACC CC
4 A ACCACC TCAACAAACCCCGGCCGCCC
5 ACCAC ACCACC ACCCACCCCCCCCCCC
6 G ACCACC CTCCAACCTATACCGGCCCC
7 CCAAACTCGACCGTTCCCGC ACCACC C
8 GCACCCC ACCACC ACCATACCTACCCC
9 ACCCGATCAGGCCCTCC ACCACC CCCC
10 CCACACCCCACCCCGAACG ACCACC GC
11 ACCAACGGACTAGCTCCCAC ACCACC C
12 C ACCACC CCACCATACAATCCCTAGGC
13 ACCAC ACCACC ACCCCACCCTAGGACC
14 ACCACC ACTACCCGGACCCGGCCCCCC
15 ACACGAGATAACGACCCG ACCACC CCC
ACCTAC
16 GACACAAGACAC ACCTAC ACCCCCCCC
17 GCAGCCC ACCTAC ACTCCCGCTCCCCC
18 GCACCCCACCACCACCAT ACCTAC CCC
19 ACCCCCCCTAATTG ACCTAC GGCAGGC
20 CAG ACCTAC CCCCGCCCCCAACCCGCC
21 CACCCACCGTCCAACG ACCTAC ACCCC
22 GCGCACCCCACCCCCC ACCTAC GGCCC
ACCACA
23 ACCACA ATGCAGCCGTACTTCGACCCC
24 ACCACA CCACCACCCACCCCCCCCCCC
25 A ACCACA TCAACAAACCCCGGCCGCCC
26 CAACCCCTCCA ACCACA CCTCCCCGCC
27 CC ACCACA CTCTGCATTCTTGACCGCC
ACCATA
28 GGGTAATGTC ACCATA GCCCCCCCCCC
29 GCACCCCACCACC ACCATA CCTACCCC
30 CA ACCATA CACAACGCCCCGACCCCCC
31 CACCACCCC ACCATA CAATCCCTAGGC
32 CAGGCACCCCCAACCCCCC ACCATA CC
ACCAAT
33 AAAGGGTATACACAGGT ACCAAT GGCC
34 AACCTTAGGG ACCAAT CAATAAGGGAC
35 ACCAAT GAAGAGACCCCTAACCATTAC
36 ATGTGTAG ACCAAT GGCATAATCTGCA
37 GTCGAGTCG ACCAAT GCAGCACGCAGC
ACCAAC
38 CAG ACCAAC CTCATACCCCCCCCTGCC
39 CC ACCAAC CCTCCCTCCCAATGCCCGC
40 ACCAAC GGACTAGCTCCCACACCACCC
41 AACATGCTGTGCAACCAA ACCAAC ACC
ACCAAA
42 ACCAAA AGATCAACCCCCCCCCGTACC
43 AACATGCTGTGCA ACCAAA CCAACGCC
44 ACACATAAACAGCA ACCAAA CCAGCCC
45 AACATGCTGTGCA ACCAAA CCAACACC
65
Table 3.2. AtMYB61 consensus sequence was derived from a comparison of 89 sequences recovered from 5 cycles of CASTing The composition of each base at each position of the hexameric sequence is provided. -/+ indicate the bases 5' or 3' of hexameric consensus sequence. The bases 5' or 3' of hexameric consensus sequence does not add up to 45 in certain circumstances because primer sites were negated from the analysis. W corresponds to A/T, H corresponds to A/T/C, – corresponds to a zero value.
-2 -1 A C C W H H +1 +2
G 3 11 – – – – – – 9 7
A 10 8 45 – – 38 20 14 10 4
T 2 3 – – – 7 5 5 2 4
C 20 17 – 45 45 – 20 26 24 27
Total 45 45 45 45 45 45
66
AC elements, also known as PAL boxes or H-boxes, play key roles in regulating
transcription for a variety of genes, particularly those encoding enzymes implicated in
phenylpropanoid metabolism (Lois et al., 1989; Joos and Hahlbrock, 1992; Leyva et al.,
1992; Hauffe et al., 1993; Hatton et al., 1995; Logemann et al., 1995; BellLelong et al.,
1997; Seguin et al., 1997; Lacombe et al., 2000; Lauvergeat et al., 2002). R2R3-MYB
proteins are known to bind AC elements and activate transcription from these motifs in
yeast and in planta (Prouse and Campbell, 2012). For example, pine (Pinus taeda)
MYB1 (Patzlaff et al., 2003a) and MYB4 (Patzlaff et al., 2003b) and eucalyptus
(Eucalyptus grandis) MYB2 (Goicoechea et al., 2005), were all able to bind to AC
elements present in the promoters of lignin biosynthetic genes. Similarly, pine (Pinus
taeda) MYB1 and MYB4 bound AC elements present in the gene regulatory sequences
of a pine gene encoding GLUTAMATE SYNTHETASE1b (GS1b) (Gomez-Maldonado et
al., 2004). R2R3-MYB binding to AC elements is predicted to play a role in dictating
xylem-localised expression of the aforementioned genes (Patzlaff et al., 2003a; Patzlaff
et al., 2003b; Gomez-Maldonado et al., 2004; Goicoechea et al., 2005). Given the
xylem-localised expression of AtMYB61 (Romano et al., 2012), it is likely that it
functions in an equivalent manner to drive AC-element-mediated expression in
Arabidopsis thaliana.
3.4.2 AtMYB61 Bound to DNA Target Sequences with Varying Degrees of
Affinity
The relative binding affinities of recombinant AtMYB61 protein to the CASTing-derived
sequences were determined (Table S3.1). Dissociation constants for each CASTing
target were calculated by GRAFIT software program by using Scatchard plots (Table
3.3). The CASTing target that bound with the highest affinity (9.12E-09 M) was ACCTAC
(AC-I) (Table 3.3). Since the AC-I motif was the preferred target of AtMYB61, a
mutational assay was conducted on this motif to examine which nucleotides were
essential for binding (Table 3.4). A guanine nucleotide was substituted one nucleotide
at a time and shifted along the motif. A nitrocellulose filter-binding assay was used to
calculate the Kds of the mutated AC-I motifs (Table 3.4). Binding diminished when a
mutation was present in the first three nucleotides of the AC-I motif (Kd>5.00E-06 M);
67
Table 3.3. Dissociation constants (Kd) in mol/L and associated errors of CASTing targets. Relative binding affinities of the CASTing targets to AtMYB61 were determined by a nitrocellulose filter-binding assay. The relative binding affinities were used to determine the dissociation constants of the CASTing targets by GRAFIT program which linearized the nonlinear regression via scatchard plots to calculate the ligand concentration at which half of the binding sites of AtMYB61 are occupied. ACCTAC bound with the greatest affinity to AtMYB61. NBS or non-binding site did not bind to recombinant AtMYB61.
Kd Error
ACCTAC 9.12E-09 3.11E-09
ACCAAT 1.21E-08 3.42E-09
ACCAAA 1.68E-08 4.07E-09
ACCATA 1.83E-08 5.06E-09
ACCAAC 7.37E-08 1.53E-08
ACCACA 8.08E-08 6.93E-09
ACCACC 6.90E-07 2.27E-08
NBS >5.00E-06
68
Table 3.4. Dissociation constants (Kd) in mol/L and associated errors of mutated ACCTAC (AC1 element) sequences A guanine nucleotide was inserted one nucleotide at a time and shifted along the AC1 motif. Relative binding affinities of the mutated AC1 elements to AtMYB61 were determined by a nitrocellulose filter-binding assay. The relative binding affinities were used to determine the dissociation constants of the CASTing targets by GRAFIT program which linearized the nonlinear regression via scatchard plots to calculate the ligand concentration at which half of the binding sites of AtMYB61 are occupied. Underlined bases corresponds to a substituted guanine.
Kd Error
ACCTAC 9.12E-09 3.11E-09
GCCTAC >5.00E-06
AGCTAC >5.00E-06
ACGTAC >5.00E-06
ACCGAC 7.19E-07 2.12E-07
ACCTGC 7.97E-08 1.83E-08
ACCTAG 5.60E-08 5.09E-09
69
however, when a mutation is present in the last three nucleotides of the AC-I motif, the
binding is reduced but not completely abolished (Table 3.4). The relative binding
affinities of recombinant AtMYB61 protein to CASTing targets and mutated motifs were
validated by EMSAs (Fig. 3.2). EMSAs were conducted at a protein concentration of
5x10-08 M because this was the protein concentration at which not all the targets
reached their binding max as determined by nitrocellulose filter-binding assay (Fig. 3.2,
Table S3.1). This enabled detection of differential binding via EMSAs.
AtMYB61 bound its preferred target AC-I (ACCTAC) with a binding constant of 9.12E-09
M (Table 3.3), which is similar to the tight binding of the vertebrate c-MYB R2R3 domain
to the MYB binding site ((T/C)AAC(G/T)G(A/C/T)(A/C/T)) (binding constant = 1.5E-09
M±28% ) (Tanikawa et al., 1993; Ebneth et al., 1994). Tanikawa et al. found that AACG
nucleotides in the c-MYB binding site were critical for binding (Tanikawa et al., 1993).
The second adenosine, fourth cytosine, and sixth guanine were particularly important in
determining binding specificity. If any of these core nucleotides were mutated, binding
affinity decreased by greater than 500 fold. The third adenosine was not as crucial - if it
was mutated, the binding affinity would be decreased up to 15 fold. Consistent with
this, AtMYB61 had a set of core recognition nucleotides – ACC – that could not be
mutated without abolishing binding (Fig. 3.2b, Table 3.4). Moreover, mutation of the
latter half of the binding site, occurring at residues TAC, reduced binding but did not
abolish it completely.
3.4.3 The Affinity of AtMYB61 to Specific Target DNA Sequences Was
Predicted by Molecular Interactions Determined in silico
Computational analysis of the 3-dimensional structure of the N-terminal DNA-binding
region of AtMYB61 was conducted in order to validate the role of this domain in
sequence-specific binding. Previously, the structure of the N-terminal DNA-binding
domain of animal c-MYB bound to its DNA consensus motif (AACNG) was solved by
heteronuclear multidimensional NMR (Ogata et al., 1994). Animal c-MYB DNA-binding
region contains a conserved R2R3-MYB domain that exhibits high similarity to plant
R2R3-MYB DNA binding domains. This NMR structure was used as a template to
model the structure of AtMYB61. The AC-I (ACCTAC) and NBS (GAGACC) nucleotide
70
Figure 3.2. Relative binding affinities of AtMYB61 to CASTing targets and to mutated ACCTAC motif determined by nitrocellulose filter-binding assays are confirmed by electrophoretic mobility shift assays (EMSAs). (a) EMSA of recombinant AtMYB61 protein binding to 6 labelled CASTing target sequences. The protein concentration used was 5x10-08M. Protein concentrations were conducted at 5x10-08M because this was the protein concentration at which targets had not all reached their binding max as determined by nitrocellulose filter-binding assay, allowing one to observe differential binding. (b) EMSA validating relative binding affinities of AtMYB61 to mutated ACCTAC motif. The protein concentration used was 5x10-08M. Mutations were conducted by substituting a single guanine nucleotide along the AC1 element. Black arrow indicates gel shift by the probe. Non-binding site (NBS) is a sequence that does not bind AtMYB61, acting as a negative control. Probes were engineered for the EMSA reaction by inserting the hexamer CASTing sequence or mutated AC1 element sequence into the underlined area.
71
models were then docked into the predicted binding sites of the AtMYB61 model (Fig.
3.3).
Based on the model of AtMYB61, the molecular interactions shared between the
binding sites of AtMYB61 to its targets supported in vitro binding data (Fig. 3.3). For
example, there were more hydrogen bonds shared between AtMYB61 DNA-binding
domain and AC-I compared to NBS (Fig. 3.3bcd). Based on the model of AtMYB61
bound to AC-I, several specific intermolecular interactions are predicted to create
binding specificity. These include hydrogen bonds between the following residues:
asparagine-59 (R3 helix) of AtMYB61 with adenosine-1 nitrogen of AC-I; asparagine-
106 (R3 helix) oxygen of AtMYB61 with adenosine-1 hydrogen of AC-I; asparagine-59
(R3 helix) oxygen of AtMYB61 with cytosine-2 hydrogen of AC-I; asparagine-102 (R3
helix) oxygen of AtMYB61 with cytosine-3 hydrogen of AC-I; arginine-56 (R2 helix)
oxygen of AtMYB61 with cytosine-3 hydrogen of AC-I; arginine-54 (R2 helix) hydrogen
of AtMYB61 with thymidine-4 oxygen of AC-I; and, lysine-51 (R2 helix) of AtMYB61 with
adenosine-5 nitrogen of AC-I (Fig. 3.3bc). The leucine-55 (R2 helix) methyl group of
AtMYB61 is predicted to form a non-polar bond with thymidine-4 methyl group of AC-I.
Cytosine-6 remained unbound in the model (Fig. 3.3c). In comparison, the NBS model
had only one hydrogen bond present, involving asparagine-59 (R3 helix) oxygen of
AtMYB61 with adenosine-2 hydrogen of AC-I (Fig. 3.3d).
3.4.4 The Affinity of AtMYB61 to Specific Target DNA Sequences Did Not
Correlate with AtMYB61-Driven Transcriptional Activation with
Each of the Target Sequences
Previous studies have shown that AtMYB61 protein is sufficient to drive transcription in
yeast from promoter sequences that contain AC elements (Romano et al., 2012).
Consequently, yeast transcriptional activation assays were used to determine the
relationship between AtMYB61 affinity to specific DNA sequences and its capacity to
drive transcription (Fig. 3.4). Reporter constructs comprised the coding sequence for -
galactosidase under the control of the yeast minimal CYC1 promoter fused to triple
repeats of a given CASTing target or a mutated AC-I motif (Fig. 3.4). The minimal
72
Figure 3.3. Molecular modelling of AtMYB61 with target sequences confirm binding preferences determined by nitrocellulose filter-binding assays and EMSAs. (a) Pymol models of ACCTAC motif docked into the binding site of AtMYB61. Molecular modelling was completed by using the online program PHYRE (Protein Homology/analogY Recognition Engine) to predict a crystal structure of AtMYB61 using homology to the c-MYB DNA binding domain. The PDB (Protein Data Bank) file recovered from the PHYRE analysis was used to superimpose the predicted AtMYB61 crystal structure with the c-MYB crystal structure using DaliLite. Using Pymol the 3D sequence model -- ACCTAC -- was docked into the predicted binding sites of AtMYB61. The AC1 element model is displayed in yellow, the loop secondary structure of AtMYB61 inferred model is displayed in green, and the helix secondary structure of AtMYB61 inferred model is displayed in red. (b) Model of AtMYB61 binding site with the first three ACC nucleotides in the ACCTAC sequence determines that these nucleotides are essential for binding. The AC1 (ACCTAC) nucleotide model was docked into the predicted binding site of AtMYB61. The specific hydrogen bonding between the amino acids of AtMYB61 binding site to the ACC nucleotides of AC1 were predicted by Pymol and
73
Figure 3.3 caption continued. listed as follows: asparagine-59 (R3 helix) hydrogen to adenosine-1 nitrogen; asparagine-106 (R3 helix) oxygen to adenosine-1 hydrogen; asparagine-59 (R3 helix) oxygen to cytosine-2 hydrogen; asparagine-102 (R3 helix) oxygen to cytosine-3 hydrogen; and arginine-56 (R2 helix) oxygen to cytosine-3 hydrogen. This confirms binding data determined by the nitrocellulose filter-binding assay and EMSAs, iterating that the ACC motif is the core recognition motif of AtMYB61. (c) Model of AtMYB61 binding site with the TAC nucleotides in the ACCTAC sequence determine that these nucleotides are less essential for binding. The AC1 (ACCTAC) nucleotide models were docked into the predicted binding sites of AtMYB61. The molecular interactions between the amino acids of AtMYB61 binding site and the TAC nucleotides of AC1 were analyzed by Pymol and are listed as follows: leucine-55 (R2 helix) methyl group was predicted to form a non-polar bond with thymidine-4 methyl group; Arginine-54 (R2 helix) hydrogen was predicted to form a hydrogen bound with thymidine-4 oxygen; lysine-51 (R2 helix) hydrogen was predicted to form a hydrogen bound with adenosine-5 nitrogen; and cytosine-6 remained unbound in the model. (d) Model of AtMYB61 binding site with non-binding site (GAGACC) predicts that this motif is not recognised by AtMYB61. The non binding site model was docked into AtMYB61 binding site via Pymol and hydrogen bonding was analyzed. Only one hydrogen bond was predicted between AtMYB61 asparagine-59 (R3 helix) oxygen and the non-binding site adenosine-2 hydrogen. Yellow dashed lines indicate hydrogen bonding established by Pymol program, and blue dashed lines indicate non-polar interactions.
74
Figure 3.4. AtMYB61-mediated activation of promoter activity in Saccharomyces cerevisiae in an AC dependent fashion. (a) The sequence of the oligonucleotides cloned into the reporter vector using EcoRI and SalI sites. Each AC element or mutated ACI element is triplicated within the segment. (b) Schematic representations of the Effector
75
Figure 3.4 caption continued. (pYES2TRP::AtMYB61) and Reporter (pLacZi::AC) constructs used in this assay (CYC1: minimal yeast promoter). (c) Quantitative analysis of β-galactosidase activity in yeast after induction. The measurements in liquid assay were made from three biological independent replicates. Activation of artificial genes comprising a minimal CYC1 promoter fused to a tandem AC element or mutated ACI element upstream of the lacZ gene by AtMYB61 protein, upon growth of the yeast in galactose (light grey bars), gave rise to β-galactosidase activity that was significantly greater than the controls, as determined by analysis of variance (P < 0.005); including each vector alone, or both together after growth on non-inducing glucose (dark grey bars). Error bars represent standard deviations. * indicates statistically significant, P < 0.005, determined by t-test. Underlined bases corresponds to a substituted guanine.
76
CYC1 promoter is unable to support transcription, so reporter expression would be
contingent on the capacity of AtMYB61 to bind to the fused motifs, which would function
as gene regulatory sequences. The expression of AtMYB61 was under the control of
the galactose-inducible GAL1 promoter. As determined by the quantification of -
galactosidase activity, when AtMYB61 protein was induced by galactose, the protein
was able to activate transcription from the CASTing target sequences but not from the
mutated AC-I elements (Fig. 3.4). The extent of transcriptional activation varied for
each CASTing target (Fig. 3.4c). Notably, CASTing target sequences ACCATA,
ACCAAT, and ACCAAA supported greater amounts of -galactosidase induction
relative to the AC-I element, which bound with the greatest affinity to AtMYB61 (Fig.
3.4c).
Previously, R2R3-MYB proteins have been shown to bind to AC elements and activate
transcription in yeast and in planta; however, these studies did not correlate binding
affinity with ability to activate transcription (Jin et al., 2000; Patzlaff et al., 2003a;
Patzlaff et al., 2003b; Gomez-Maldonado et al., 2004). Yeast activation assays
determined that the affinity of AtMYB61 to specific target DNA sequences did not
correlate with AtMYB61-driven transcriptional activation with each of the target
sequences. This is consistent with results obtained using the glucocorticoid receptor
(GR), where no correlation between in vitro binding affinities and in vivo transcriptional
activities was observed (Meijsing et al., 2009). GR target sequences, differing by as
little as a single nucleotide, differentially affected GR DNA binding and transcriptional
activity, with no correlation between these parameters. Similarly, binding affinity of
AtMYB61 to specific target DNA sequences did not correlate with AtMYB61-driven
transcriptional activation with each of the target sequences. It may be that conformation
of AtMYB61 changes when binding to a specific DNA sequence, altering its ability to
activate transcription.
3.4.5 CASTing Target Sequences Were Found in the Promoter Regions
of Three Putative Direct Downstream Targets of AtMYB61
Previous experiments identified three putative direct downstream target genes of
AtMYB61 (Fig. 3.5)(Romano et al., 2012). These gene targets encode the following
77
Figure 3.5. Sequences recovered from the CASTing assay were found in all three promoter regions of predicted direct downstream targets of AtMYB61, namely KNOTTED1-like transcription factor (KNAT7, At1g62990); caffeoyl-CoA 3-O-methyltransferase (CCoAOMT7, At4g26220), and pectin-methylesterase (PME, At2g45220). The three putative AtMYB61 direct downstream target genes were identified by Romano et al. by using the intersection set of genes found to be co-regulated with AtMYB61 in both the AtGenExpress developmental dataset and AtMYB61-specific microarray experiment. 1000bp upstream regulatory regions were examined of the three genes. +/- indicate the orientation of CASTing target sequences relative to the sense coding strand; whereas, numbers indicate the position of these motifs relative to the putative transcriptional start (indicated by an arrow). Triangle represents ACCAAA, square represents ACCAAT, and circle represents ACCATA.
78
gene products: a KNOTTED1-like transcription factor (KNAT7, At1g62990); a caffeoyl-
CoA 3-O-methyltransferase (CCoAOMT7, At4g26220); and a pectin-methylesterase
(PME, At2g45220). The CASTing targets were identified in the 1000bp 5‘ non-coding
regions of the three putative direct target genes (Fig. 3.5). AtMYB61 bound to the 5‘
gene regulatory sequences of all three putative direct target genes in an AC dependent
manner (Romano et al., 2012). These data support the hypothesis that AtMYB61 binds
to AC elements in a distinct set of target genes to modify gene expression.
3.5 Conclusion
Despite the size and importance of the plant R2R3-MYB family of transcriptional
regulators, little is known about the molecular functioning of given family members. The
work described herein casts greater light on the interaction between an R2R3-MYB
family member and its cognate DNA targets. The findings support the hypothesis that
AtMYB61 is recruited to target genes via its interactions with a set of unique sequences,
and thereby modifies gene expression. Surprisingly, the affinity of AtMYB61 to specific
target DNA sequences did not correlate with AtMYB61-driven transcriptional activation
with each of the target sequences, suggesting that the conformation of AtMYB61 may
be altered allosterically when bound to specific target sequences. These findings point
to additional complexities in the regulation of plant gene expression, and argue for the
need for greater exploration of the molecular intricacies involved in the interactions
between plant transcription factors and their DNA targets.
3.6 Acknowledgements
We are very grateful to Ms. Joan Ouellette for technical assistance, Mr. Ke Wu for
assistance on the CASTing assay and to Ms. Stephanie Tung, Ms. Kate Lee and Ms.
Trisha Min for assistance with the yeast experiments. This work was generously
supported by a Natural Science and Engineering Research Council of Canada
(NSERC) Canadian Graduate Scholarship (CGSD) awarded to MP, and funding from
NSERC to M.M.C.
79
3.7 Supplemental Figures and Tables
Figure S3.1. AtMYB61 antibody generation and validation. (a) Amino acid sequence similarity of AtMYB61 along with its closest family member AtMYB50. The two proteins have conserved N-terminal amino acid sequences but unique C-terminal domains, which was the domain selected to generate AtMYB61 antibodies against (highlighted region). (b) A chemiluminescence western-blot of full length AtMYB61 recombinant protein (Lane 1), of antibody alone (Lane 2), and AtMYB61 recombinant protein immunoprecipitated with prebleed serum (Lane 3) and with AtMYB61 specific antiserum (Lane 4) validate AtMYB61 antibody specificity. Western-blot was done with 1:20 000 dilution of post-injected serum. Western-blot shows greater quantities of AtMYB61 protein eluted off the Magnetic Dynabeads Protein G post-injected antibody complex compared to the Magnetic Dynabeads Protein G pre-injected antibody complex, showing that the immunoprecipitation was successful.
80
Supplemental Table S3.1. Relative binding of CASTing targets and mutated AC1
This table includes nitrocellulose filter binding data determining the relative binding of AtMYB61 to the CASTing targets and to the mutated ACCTAC motifs in triplicate. The 60 bp DNA probes were present in excess amounts. The probe concentration for each sequence was 1065nM and the total amount of DNA added to each reaction was 124.41ng. The protein concentrations are labelled in red and vary from 0M to 5.00E -09 M. The cpm of each sample was measured by a liquid scintillation counter. If AtMYB61 bound to a sequence then it would reach a binding max of ~0.75 binding. If AtMYB61 did not bind to a sequence, then the binding would not increase with the increase in protein concentration.
83
Chapter 4
Novel regulation of an R2R3-MYB transcription factor, AtMYB61, by a non-hexokinase sugar-signalling pathway
This chapter comprises the following manuscript-in-preparation in its entirety:
Michael B. Prouse, Christian Dubos, Cécile Vriet, & Malcolm M. Campbell (2013) Novel
Regulation of an R2R3-MYB transcription factor AtMYB61 by a non-hexokinase sugar-
signalling pathway.
Contributions: MBP, CD, MMC designed research; MBP, CD, CV performed
research; MBP, CD, CV, MMC analysed data; MBP, MMC wrote manuscript with
(Fig. 4.1). This effect was not osmotic as the presence of sorbitol (a non-metabolisable
sugar alcohol) did not induce an increase in transcript abundance.
To investigate how AtMYB61 expression is shaped by sugars, qualitative and
quantitative changes in the activity of the -glucuronidase (GUS) reporter gene driven
by a translational fusion with the AtMYB61 promoter and 5‘ intragenic sequences
(61PN::GUS) were examined (Fig. 4.2ab). Metabolisable sugars (sucrose, glucose,
92
Figure 4.1. Sugar regulation of AtMYB61 expression in dark-grown wild-type seedlings, 7 days post-germination. qRT-PCR analysis of AtMYB61 expression in response to sugars was conducted on wild-type seedlings grown for 7 days of dark. Sucrose, glucose and fructose all induced AtMYB61 expression. Sorbitol acted as an osmotic control and did not induce AtMYB61 expression. * indicates significantly different from the no sugar control, p<0.05, t-test.
93
Figure 4.2. Promoter-reporter and qRT-PCR analysis of AtMYB61 expression in response to sugars. (a) 61PN::GUS expression of 7 day-old dark-grown seedlings within the hypocotyl xylem in response to sugars. In response to metabolisable sugars (sucrose, glucose, fructose and maltose), AtMYB61 gene regulatory sequences were sufficient to drive GUS expression in the hypocotyls of 7 day-old dark-grown seedlings. A mannitol control confirmed that this effect was not due to osmotic regulation. Turanose and palatinose controls validated that the effect was not due to sucrose sensing alone. A raffinose control showed that this effect was not due a sucrose translocation effect. 3-O-methylglucose (3-OMG) and 2-deoxyglucose (2-DG) controls displayed that this effect was not due to the detection of hexose sugars involving the hexokinase (HXK) pathway (b) Quantitative analysis of 61PN::GUS expression in response to the same sugars and controls presented in (a). Bars in (a) represent 100µm. * in (b) represent signicantly different from no sugar control (P < 0.05).
94
fructose or maltose) significantly increased expression; whereas, an equivalent change
in osmotic conditions using sorbitol did not (Fig. 4.2ab). The disaccharides, turanose
and palatinose, which can interact with extracellular sucrose sensors (Loreti et al., 2000;
Sinha et al., 2002), failed to increase expression. Similarly, raffinose, which is
translocated with sucrose in the phloem, but not hydrolysed (Haritatos et al., 2000), did
not increase expression (Fig. 4.2ab).
Sugars have been shown to modify gene expression within a few members of R2R3-
MYB family members, AtMYB61 being one within this subset. Previously, it was shown
that AtMYB61 was diurnally regulated, to account for light-to-dark transitions in stomatal
aperture (Liang et al., 2005). Furthermore, AtMYB61 expression was shown to be
modulated by two amino acids implicated in nitrogen partitioning and signalling,
glutamate and glycine (Dubos et al., 2005). It is striking that AtMYB61 activity is up-
regulated by the most significant product of photosynthesis, sucrose, and that it is
down-regulated by two amino acids that are significant by-products of photorespiration,
glutamate and glycine. It may be that AtMYB61 is poised to respond to the abundance
of different carbon skeletons in plants, and thereby modulate carbon acquisition via
stomata and carbon allocation in sink tissues.
4.4.2 AtMYB61 Acts in a Pathway Independent of the Hexokinase Sugar
Signalling Pathway
Hexokinase (HXK) is important as a sugar sensor in plants (Jang et al., 1997;
Smeekens, 2000; Xiao et al., 2000; Rolland et al., 2002; Halford and Paul, 2003; Moore
et al., 2003; Gibson, 2005). Experiments using 3-O-methylglucose (3-OMG), which is
transported into plant cells but not metabolised by HXK, and 2-deoxyglucose (2-DG)
and mannose, which are phosphorylated by HXK but not metabolised further, can be
used to examine the involvement of HXK in sugar signalling (Jang et al., 1997; Pego et
al., 2000). GUS expression driven by the AtMYB61 promoter was not increased in
dark-grown plants provided with 3-O-methylglucose (3-OMG) or 2-deoxyglucose (2-DG)
(Fig. 4.2ab), showing that the sugar-sensing pathway did not simply entail detection of
hexose sugars, nor involve direct signalling via HXK (Jang et al., 1997; Gibson, 2000;
Smeekens, 2000). AtMYB61 promoter-mediated expression was increased by sucrose
95
even in the presence of the specific HXK inhibitor mannoheptulose (MHL) (Jang et al.,
1997; Chiou and Bush, 1998; Smeekens, 2000) (Fig. 4.2ab). The ability of sucrose to
increase AtMYB61 expression in the presence of MHL supports the hypothesis that
signalling directly by HXK is unlikely to be involved in AtMYB61 expression. AtMYB61
expression was not simply a response to the presence of carbon-based metabolites, as
acetate, pyruvate, succinate and trehalose, which are implicated in carbon metabolite
signalling (Graham et al., 1994), did not induce expression (data not shown).
The relationship between AtMYB61 expression and HXK sugar signalling was also
examined using the Arabidopsis thaliana loss-of-function mutants involved in the
glucose insensitive1 (gin1) (Zhou et al., 1998), and glucose insensitive6 (gin6) (Arenas-
Huertero et al., 2000) (Fig. 4.3ab). As determined by qRT-PCR, AtMYB61 transcript
abundance increased in response to sucrose and glucose in wild-type plants (Fig. 4.3a).
This was also observed in gin2, gin1, and gin6 mutants. Moreover, the largest increase
in AtMYB61 transcript abundance was observed when sucrose was added to the
medium. In contrast, transcript abundance of HXK2, which is regulated through the
HXK signalling pathway, increased dramatically in response to glucose, and this
increase was significantly less in the gin2 mutant (Fig 4.3b). Together, these results
suggest that AtMYB61 transcript abundance is not modulated via the HXK1 signalling
pathway.
Transcript abundance data support the hypothesis that, under most circumstances,
AtMYB61 is likely to function independently of HXK. That is, AtMYB61 and
AtHXK1/GIN2 (At4g29130) have transcript abundance profiles that are slightly
negatively correlated in the AtGenExpress developmental dataset (RAGE=-0.236). This
indicates that the two genes are likely to have inverse transcript abundance relative to
each other, in those instances when their expression is coincident at all. Thus, the HXK
pathway and a distinct ―AtMYB61 pathway‖ are likely to operate non-redundantly, and
the pathway that is deployed is likely to be contingent on the developmental context. A
novel sugar-signalling pathway that does not involve hexokinase has been predicted
(Chiou and Bush, 1998; Tiessen et al., 2003; Dekkers et al., 2004), but the components
96
Figure 4.3. qRT-PCR analysis of AtMYB61 and HXK-2 expression in wild-type (WT) and glucose insensitive (gin) loss-of-function mutants. (a) qRT-PCR of AtMYB61 expression in response to sugars (glucose and sucrose) in WT and glucose insensitive mutants (gin1, gin6 and gin2) reveal that AtMYB61 acts in a sugar signalling pathway independent of HXK. (b) qRT-PCR of HXK-2 expression in response to sugars (glucose and sucrose) in wild-type and gin1, gin6 and gin2 mutants confirm that HXK-2 acts in the HXK sugar signalling pathway.
97
of this signalling pathway have yet to be elucidated. It may be that AtMYB61 is a
component of this pathway. One might be able to capitalise on this information to
uncover additional components of the uncharacterised AtMYB61-related sugar-
signalling pathway.
4.4.3 AtMYB61 Expression is Sugar Derepressed, Involving an Intragenic
Sequence within the 5‘ Coding Region Containing Two Introns
AtMYB61 gene regulatory sequences comprising the 5‘ intragenic region (61PN::GFP)
were sufficient to drive the expression of GFP in the xylem of seedlings grown in the
presence of sucrose but not in the absence of sucrose (Fig. 4.4ab). In contrast,
AtMYB61 gene regulatory sequences without the 5‘ intragenic region (61P::GFP)
constitutively expressed GFP in the seedlings grown in the presence and absence of
sucrose. The most parsimonious hypothesis for this finding is that AtMYB61 expression
is de-repressed by soluble sugars in a mechanism involving intragenic sequences.
Sequence comparison of Brassicaceae AtMYB61 homologues (Arabidopsis thaliana,
Arabidopsis lyrata, Capsella rubella, Brassica rapa, and Thellungiella halophila)
uncovered a highly conserved motif (CTCTGTTTT) in intron-two, repeated 4 times (Fig.
4.5; Fig. S4.1). The repeats within the second introns of AtMYB61 homologues occur 4
times - 3 times in the sense direction and once in the antisense direction. Scanning the
Arabidopsis thaliana genome for this repeat, with an occurrence cutoff of 3 times within
500bp, identified 83 genes and 15 intergenic regions (Table S4.1, S4.2). Of the 98
instances, 45 of these occurrences were in introns (Table S4.3). That is, when this
motif is repeated 3 or more times within a 500bp region of the Arabidopsis thaliana
genome, 45.9% of these occurrences are within introns (Table S4.3). Notably, introns
comprise only 15.6% of the Arabidopsis thaliana genome (Kaul et al., 2000). Of the 45
occurrences of this repeat within Arabidopsis thaliana introns, 21 are within sugar-
Figure 4.4. Analysis of AtMYB61 promoter-reporter fusion constructs that contain or do not contain AtMYB61 5’ intragenic sequences in response to sucrose. (a) Schematic representation of the constructs used to drive the expression of GUS (uidA) and GFP (GFP). 61P correspond to the promoter of AtMYB61, and 61PN to the promoter of AtMYB61 plus the portion of the coding sequence that encodes the N-terminus of the protein, which includes the two introns (E:exon; I: intron; NosT: nopaline synthase terminator sequence). (b) Expression of 61P and 61PN constructs within developing xylem of 7 day-old dark-grown seedlings in response to 30mM sucrose support the sugar derepression model.
99
Figure 4.5. Phylogenetic footprinting identifies a conserved repeat motif in the second intron of AtMYB61 Brassicaceae homologues. Sequence logo of AtMYB61 second intron (green highlight) flanked by exon 2 and exon 3 (red highlight). An over-represented conserved motif is present within AtMYB61 second intron that repeats itself three times in a sense direction and once in an antisense direction. Brassicaceae AtMYB61 homologues include: Arabidopsis thaliana gene At1g09540; Arabidopsis lyrata gene 919710; Capsella rubella gene Carubv10009497m.g; Brassica rapa gene Bra020016; and Thellungiella halophila gene Thhalv10008000m.g.
100
To further assess the putative functional role of the conserved over-represented motif
within AtMYB61 second intron, AtMYB61 was aligned with AtMYB50 (At1g57560), its
most closely related R2R3-MYB family member (Fig. S4.2)(Stracke et al., 2001). Direct
nucleotide sequence comparison between the two genes shows that, while AtMYB50
contain 2 introns, and while the introns of both genes share significant sequence
similarity; neither of the AtMYB50 intron contains the AtMYB61 second intron repeat.
Notably, AtMYB50 is not sugar induced (data not shown). Taken together with the data
above, the findings support the hypothesis that the repeat sequences found in the
second AtMYB61 intron might function as a gene regulatory sequence to mediate
sugar-responsive gene regulation. What‘s more, if they do function in this manner, they
might serve as binding sites for a repressor that binds to the sequences in the absence
of sugar, which are then released when sugar is present.
To determine if the repeats in the second intron of AtMYB61 could function as targets
for binding by a hypothetical sugar-mediated repressor, EMSAs were undertaken.
EMSAs used radioactively labeled second-intron repeats, and nuclear extracts from
plants that were grown in either the presence or absence of sucrose in the dark. The
second intron repeat motif was bound by to a greater extent by proteins in nuclear
extracts obtained from seedlings grown in the absence of sucrose in the dark, relative to
those from seedlings grown in the presence of sucrose in the dark (Fig. 4.6). This
interaction was specific as determined by a competition assay using either unlabelled
second intron repeat or poly(dI-dC) as a competitor (Fig. S4.3). Taken together, these
findings are consistent with a nuclear-localised repressor protein binding to the second
intron repeat in seedlings grown in the absence of sugar.
Recently, intragenic regulatory elements have been identified that can function as either
repressors, enhancers or promoters of gene transcription (Dooley et al., 1996; Busch et
al., 1999; Deyholos and Sieburth, 2000; Kapranov et al., 2001; Fiume et al., 2004;
Wang et al., 2004; Fu et al., 2005; Osnato et al., 2010). In barley, a tandem duplication
of 305bp in intron IV is responsible for the dominant Hooded phenotype, which leads to
an ectopic over expression of Knox3 at the distal end of the lemma and the
development of an extra flower in place of an awn present in wild-type spikelets (Muller
et al., 1995). In transgenic Nicotiana tabacum lines, the 305bp element can drive
101
Figure 4.6. EMSA shows AtMYB61 second intron motif bound differentially by proteins in nuclear extracts from seedlings grown in the absence or presence of sucrose in the dark, consistent with the derepression model. EMSA of nuclear extracts from wild-type Columbia seedlings grown for 7 days of dark with or without 30mM of sucrose on the second intron repeat shows differential binding. Competition with AtMYB61 second intron repeat cold probe shows that this interaction is specific. Arrows indicate gel shifts by the probe.
102
reporter gene expression within the flower base, in contrast to the Knox3 promoter,
whose activity is restricted to the SAM (Santi et al., 2003). The 305bp intron element
acts as a floral-specific regulatory element. A one-hybrid screen identified three
proteins that bound the 305bp intron element (Osnato et al., 2010). The proteins were
Nuclear proteins were affinity purified from 7 day-old dark grown wild-type Columbia
seedlings that had been grown either in the absence or presence of sucrose.
Streptavidin beads were used to immobilise the biotinylated second intron and second
intron repeat. The streptavidin-biotin complexes were then used to affinity purify
proteins that bound to the intron sequences generally, and the second intron repeat
specifically (Fig. 4.7). Affinity purified proteins were then characterised using liquid
chromatography coupled with tandem mass spectrometry (LC-MS/MS), and the proteins
identified based on their MS fingerprints (Table 4.1)(Kislinger et al., 2003; Hewel et al.,
104
Figure 4.7. Affinity purification coupled with LC-MS/MS determines putative AtMYB61 repressor proteins that bound AtMYB61 second intron repeat. Nuclear proteins were purified from 7 day-old dark grown wild-type Columbia seedlings grown in the absence or presence of sucrose. The nuclear proteins were exposed to AtMYB61 second intron or second intron repeat sequences. The silver stained gel of proteins eluted from the streptavidin-biotin pull-down assay displays certain proteins binding with greater affinity in the no sucrose condition compared to the 30mM sucrose condition consistent with the derepression model.
105
Table 4.1. List of putative repressors of AtMYB61 expression (RMX) that bound AtMYB61 second intron repeat
List of putative RMX proteins that bound AtMYB61 second intron repeat with corresponding Arabidopsis thaliana gene idenfications (AGIs), mutant labels, SALK lines and protein annotations. AtMYB61 transcript abundance was misexpressed in a subset of rmx loss-of-function mutants in response to sucrose as determined by qRT-PCR and semi-quantitative RT-PCR. Confidence of each protein identified was calculated by StatQuest program (Kislinger et al., 2003) and each protein identified had a confidence level of greater than 50 percent (Hewel et al., 2010).
AGI Mutant Label
AtMYB61 Misexpression to Sucrose SALK Line Protein Annotation
At4g04940 No SALK_112391C Putative WD-repeat membrane protein At1g06840 No SALK_134409C Leucine-rich transmembrane kinase
At4g16830 No SALK_143514C Putative nuclear antigen homolog protein
At3g45810 rmx1 Yes SALK_050658 Respiratory burst oxidase-like protein
At5g35700 rmx2 Yes SALK_082219C Fimbrin FIMBRIN-LIKE PROTEIN 2 At2g43970 rmx3 Yes SALK_046986 La and winged repressor domain protein
At1g10170 No SALK_129409C Homologue of human repressor NF-X1
At3g52100 No SALK_047892C PHD finger family protein At3g22980 No SALK_150941C Elongation factor EF-2
At5g11700 No SALK_147133 Glycine rich protein on chromosome 5
At2g24650 rmx4 Yes SALK_109533C DNA binding / transcription factor
At1g50680 rmx5 Yes SALK_047550C RAV-like DNA-binding protein
At5g22760 No SALK_125978 PHD finger family protein At1g07650 No SALK_009225C Leucine-rich
transmembrane protein kinase
At4g02430 rmx6 Yes SALK_032344C Putative SR1 Protein At4g24710 No SALK_031449C Putative nucleotide binding
protein
At5g55670 No SALK_036546C RNA recognition motif-containing protein
At1g34460 No SALK_100844C B1 cyclin cyclin-dependent protein kinase
106
2010). Consistent with a role in binding the second intron repeat of AtMYB61, the
proteins identified were all nuclear proteins and were mainly nucleic acid binding
proteins or proteins involved in DNA-binding complexes. All of the identified AtMYB61
second intron binding proteins have not been biochemically characterised to date (Table
4.1).
4.4.5 A Subset of Putative AtMYB61 Repressor Genes Are Sugar
Sensitive
In order to determine whether the putative repressor proteins played a role in the
regulation of AtMYB61 expression, a genetic loss-of-function approach was taken.
Loss-of-function Arabidopsis thaliana mutants with T-DNA insertions in exons
corresponding to affinity purified proteins were ordered from the Arabidopsis Biological
Resource Centre and verified. These were then tested as putative repressors of
AtMYB61 expression (rmx) mutants. Sucrose-dependent AtMYB61 expression was
examined in putative rmx mutants using semi-quantitative PCR and quantitative real-
time PCR (Fig. S4.4; Fig. 4.8). In rmx mutants, it is hypothesised that AtMYB61
transcript abundance should be elevated, specifically in seedlings that had been grown
in the dark in the absence of sucrose. Of the 18 proteins for which putative rmx mutants
could be obtained, six proteins had rmx mutants that showed the predicted transcript
abundance profile, with elevated AtMYB61 transcripts in seedlings that had been grown
in the absence of sucrose (Fig. S4.5; Fig. 4.8; Table 4.1). While these six proteins have
yet to be characterized biochemically, four have been annotated as putative DNA-
binding proteins (Table 4.1). Notably, in certain rmx backgrounds (rmx1, rmx3, rmx4,
and rmx5), AtMYB61 transcript abundance is higher in the absence of sucrose
compared to the presence of sucrose (Fig. 4.8). Moreover, in the presence of sucrose,
AtMYB61 transcript abundance is, in general, lower in rmx background compared to
wild-type (Fig. 4.8).
107
Figure 4.8. qRT-PCR of putative repressors of AtMYB61 expression loss-of-function mutants (rmx) that had AtMYB61 misexpression in seedlings grown in the absence of sucrose in the dark, consistent with the repressor hypothesis. The RNA and cDNA were purified from rmx mutants, and analysis of AtMYB61 gene expression, via AtMYB61 specific primers, validated a subset of rmx mutants that had higher AtMYB61 expression when grown in the absence of sucrose. These 6 positive rmx mutants were filtered out from a screen of 18 putative rmx mutants recovered from the streptavidin-biotin pull-down assay. Wild-type Columbia, loss of function atmyb61 mutants, and 35S::MYB61 overexpressor mutants acted as controls for AtMYB61 expression for the quantitative PCR assay. ACTIN-11 control was used as a reference gene for the qRT-PCR.
Figure 4.9. Phenotypes of Arabidopsis thaliana wild-type (WT) plants, AtMYB61 loss-of-function mutants (atmyb61), AtMYB61 over-expressor mutants (35S::MYB61) and At2g43970 loss-of-function mutants (rmx3). (a) Plants grown on soil for 21 d at WT growth stage 1.12. (b) Plants grown on soil for 28 d at WT growth stage 5.90. (c) Graph displaying leaf senescence of plants grown for 8 weeks at WT growth stage 8.00 (1, fully yellow leaves: 5, fully green leaves). Leaf senescence assay was conducted on the basis of published standards (Romano et al., 2012). *Significantly different from WT (P < 0.05). Data from experiments were conducted on >10 plants per genotype per experiment. Plants were grown in individual pots, and were randomized in flats to discourage position dependent effects. All rosette leaves were harvested. Measurement line represents 1 cm. Growth stages were assigned on the basis of published standards (Boyes et al., 2001).
110
4.5 Conclusion
The data presented herein provides evidence that AtMYB61, an R2R3-MYB
transcription factor, functions at the interface of sugar perception and sugar response.
Although in plants, gene specific transcriptional regulation is generally effected by the
binding of regulatory proteins to 5‘ non-coding regions (Schwechheimer and Bevan,
1998; Lee and Young, 2000), the findings presented in this study support the hypothesis
that AtMYB61 makes use of intragenic, non-coding sequences as cis-acting binding
sites for a sugar mediated repressor protein to regulate its gene expression in a sugar
dependent manner. AtMYB61 was regulated by metabolisable sugars, particularly
sucrose, in a sugar-signalling pathway that does not appear to directly involve
was de-repressed by sucrose in a mechanism involving intragenic sequences
determined by promoter-reporter fusion constructs, hinting at a sugar mediated
repression mechanism (Rolland et al., 2006). An over-represented motif was conserved
within the second intron of Brassicaceae AtMYB61 homologues and this motif
functioned as a binding target for a putative sugar-mediated repressor, as determined
by EMSA. Putative repressor proteins (RMX) that bound AtMYB61 second intron motif
in seedlings grown in the absence of sucrose were affinity purified and characterised
using LC-MS/MS, and the proteins identified based on their MS fingerprints. These
proteins were all nuclear proteins and were mainly DNA-binding proteins or proteins
involved in DNA-binding complexes and have not been chararcterised to date. In rmx
mutants, it was hypothesised that AtMYB61 transcript abundance should be elevated in
seedlings that have been grown in the dark in the absence of sucrose. Six rmx mutants
showed this predicted transcript profile. Only one rmx mutant, whose gene corresponds
to At2g43970, could phenocopy transgenic plants overexpressing AtMYB61 (Romano et
al., 2012), this result supports the hypothesis that this gene encodes a repressor protein
that modulates AtMYB61 gene expression in vivo. At2g43970 gene encodes a La
domain-containing protein that contains a winged helix repressor DNA-binding domain
and has not been characterised in Arabidopsis thaliana to date (Schwartz et al., 1999).
Moreover, AtMYB61 and At2g43970 had inverse transcript abundance data across
development, supporting the hypothesis that At2g43970 encodes a protein that
111
represses AtMYB61. Taken together, a novel protein activity that binds a conserved
repeat motif within AtMYB61 second intron is uncovered, and suggested to regulate
sugar mediated gene expression in AtMYB61 and other genes that contain this repeat,
acting independently of the HXK sugar signalling pathway.
4.6 Acknowledgements
The authors are grateful to Christine Surman (University of Oxford) for technical
assistance; John Baker (University of Oxford) for assistance with photography; Ho-
Young Koo for assistance with nuclear protein extractions; Hilda Doan for the
assistance with plant phenotype analyses; Nottingham Arabidopsis Stock Centre
(NASC) and Arabidopsis Biological Resource Center for provision of seeds. This
research was generously supported by the Natural Science and Engineering Research
Council of Canada (NSERC) Canadian Graduate Scholarship (CGSD) awarded to
M.B.P., and by competitive grant funding from the UK Biotechnology and Biological
Sciences Research Council (BBSRC), the Canada Foundation for Innovation, and the
Natural Science and Engineering Research Council of Canada (NSERC) to M.M.C..
112
4.7 Supplemental Figures and Tables
Figure S4.1. Sequence alignment of the second intron of Brassicaceae AtMYB61 homologues. Sequence comparison of Brassicaceae AtMYB61 homologues (Arabidopsis thaliana gene At1g09540; Arabidopsis lyrata gene 919710; Capsella rubella gene Carubv10009497m.g; Brassica rapa gene Bra020016; and Thellungiella halophila gene Thhalv10008000m.g) uncovers a highly conserved motif (16-21 million years ago) in intron-2. Yellow boxes indicate second intron repeat in sense direction. Purple boxes indicate second intron repeat in antisense direction. * indicates positions which have a single, fully conserved residue. : indicates conservation between groups of strongly similar properties. . indicates conservation between groups of weakly similar properties.
113
Figure S4.2. Sequence alignment of AtMYB61 and AtMYB50 reveals no second intron repeat within AtMYB50 second intron. Sequence alignment was conducted on the AtMYB61 and AtMYB50 intron 2. AtMYB50 is AtMYB61 closest related R2R3-MYB member. AtMYB50 is not sugar responsive and did not contain the second intron repeat. Yellow boxes indicate second intron motif in the sense direction (5‘ – CTCTGTTTT - 3‘). Purple boxes indicate second intron motif in the antisense direction (5‘ - AAAACAGAG - 3‘).
114
Figure S4.3. EMSA shows AtMYB61 second intron motif bound differentially by proteins in nuclear extracts from seedlings grown in the absence or presence of sucrose in the dark, consistent with the derepression model. EMSA of nuclear proteins from wild-type Columbia seedlings grown for 7 days of dark with or without 30mM of sucrose on the second intron repeat shows differential binding. Competition with the nonspecific competitor poly(dIdC) could not outcompete this specific interaction. Arrows indicate gel shifts by the probe.
115
Figure S4.4. Validation of biotinylation of AtMYB61 second intron and second intron repeat. The biotinylation of the second intron and the second intron repeat of AtMYB61 was confirmed using the Chemiluminescent Biofisher Detection Biotin Kit. Detection was only reported on biotinylated AtMYB61 intron 2 and second intron repeat.
116
Figure S4.5. Semi-quantitative PCR of AtMYB61 expression in repressors of AtMYB61 expression loss-of-function mutant (rmx) seedlings grown in the absence or presence of sucrose in the dark. Semi-quantitative PCR validated a subset of rmx mutants that had higher AtMYB61 expression when grown in the absence of sucrose in the dark. These 6 positive rmx mutants were filtered out from a screen of 18 putative rmx mutants. Wild-type (WT), loss-of-
function atmyb61 mutants, and AtMYB61 overexpressor mutants (35S::MYB61) provided
controls for AtMYB61 expression in response to sucrose. ACTIN-11 (ACT-11) control was used as a reference gene and a loading control for the assay. 25 PCR cycles were used in this experiment.
117
Figure S4.6. At2g43970 and At1g09540 share inverse transcript abundance profiles across development. eFP browser shows that both (a) At2g43970 and (b) At1g09540 (AtMYB61) have inverse transcript abundance profiles across development in different organs. This suggests, along with other data presented within this study, that At2g43970 is a repressor of AtMYB61.
118
Table S4.1. AtMYB61 second intron repeat motif identified within all Arabidopsis thaliana genes Note a cutoff of at least 3 motifs occurring at least 500 bp apart was set. Thus 83 genes contain this repeat. Highlighted regions indicate unique gene.
AGI # of hits Position Orientation
AT5G46240.1 8 246 238 AAAACAGAG
AT5G46240.1 8 370 378 CTCTGTTTT
AT5G46240.1 8 384 392 CTCTGTTTT
AT5G46240.1 8 436 444 CTCTGTTTT
AT5G46240.1 8 472 480 CTCTGTTTT
AT5G46240.1 8 1130 1122 AAAACAGAG
AT5G46240.1 8 1845 1837 AAAACAGAG
AT5G46240.1 8 2594 2586 AAAACAGAG
AT1G67070.1 7 564 572 CTCTGTTTT
AT1G67070.1 7 576 584 CTCTGTTTT
AT1G67070.1 7 766 774 CTCTGTTTT
AT1G67070.1 7 779 787 CTCTGTTTT
AT1G67070.1 7 805 813 CTCTGTTTT
AT1G67070.1 7 951 959 CTCTGTTTT
AT1G67070.1 7 964 972 CTCTGTTTT
AT3G60130.1 6 1707 1715 CTCTGTTTT
AT3G60130.1 6 1724 1732 CTCTGTTTT
AT3G60130.1 6 1751 1759 CTCTGTTTT
AT3G60130.1 6 1778 1786 CTCTGTTTT
AT3G60130.1 6 1805 1813 CTCTGTTTT
AT3G60130.1 6 2597 2605 CTCTGTTTT
AT5G38970.1 6 75 67 AAAACAGAG
AT5G38970.1 6 95 87 AAAACAGAG
AT5G38970.1 6 107 99 AAAACAGAG
AT5G38970.1 6 721 729 CTCTGTTTT
AT5G38970.1 6 745 753 CTCTGTTTT
AT5G38970.1 6 849 857 CTCTGTTTT
AT5G45340.1 6 279 271 AAAACAGAG
AT5G45340.1 6 296 288 AAAACAGAG
AT5G45340.1 6 740 732 AAAACAGAG
AT5G45340.1 6 776 768 AAAACAGAG
AT5G45340.1 6 781 789 CTCTGTTTT
AT5G45340.1 6 804 812 CTCTGTTTT
119
Table S4.1 continued.
AT5G53660.1 6 680 672 AAAACAGAG
AT5G53660.1 6 815 823 CTCTGTTTT
AT5G53660.1 6 842 850 CTCTGTTTT
AT5G53660.1 6 855 863 CTCTGTTTT
AT5G53660.1 6 900 892 AAAACAGAG
AT5G53660.1 6 1003 995 AAAACAGAG
AT1G30320.1 5 203 211 CTCTGTTTT
AT1G30320.1 5 726 734 CTCTGTTTT
AT1G30320.1 5 737 745 CTCTGTTTT
AT1G30320.1 5 834 842 CTCTGTTTT
AT1G30320.1 5 877 885 CTCTGTTTT
AT2G21560.1 5 56 64 CTCTGTTTT
AT2G21560.1 5 591 583 AAAACAGAG
AT2G21560.1 5 635 627 AAAACAGAG
AT2G21560.1 5 645 637 AAAACAGAG
AT2G21560.1 5 708 700 AAAACAGAG
AT4G02780.1 5 35 27 AAAACAGAG
AT4G02780.1 5 346 354 CTCTGTTTT
AT4G02780.1 5 476 484 CTCTGTTTT
AT4G02780.1 5 566 574 CTCTGTTTT
AT4G02780.1 5 718 726 CTCTGTTTT
AT5G37600.1 5 368 376 CTCTGTTTT
AT5G37600.1 5 556 564 CTCTGTTTT
AT5G37600.1 5 580 588 CTCTGTTTT
AT5G37600.1 5 592 600 CTCTGTTTT
AT5G37600.1 5 1688 1680 AAAACAGAG
AT1G09540.1 4 575 567 AAAACAGAG
AT1G09540.1 4 604 612 CTCTGTTTT
AT1G09540.1 4 621 629 CTCTGTTTT
AT1G09540.1 4 661 669 CTCTGTTTT
AT1G17830.1 4 2338 2346 CTCTGTTTT
AT1G17830.1 4 2351 2359 CTCTGTTTT
AT1G17830.1 4 2381 2389 CTCTGTTTT
AT1G17830.1 4 2394 2402 CTCTGTTTT
AT1G32700.1 4 198 206 CTCTGTTTT
AT1G32700.1 4 225 233 CTCTGTTTT
AT1G32700.1 4 373 381 CTCTGTTTT
120
Table S4.1 continued.
AT1G32700.1 4 390 398 CTCTGTTTT
AT1G51950.1 4 451 459 CTCTGTTTT
AT1G51950.1 4 469 461 AAAACAGAG
AT1G51950.1 4 662 670 CTCTGTTTT
AT1G51950.1 4 833 841 CTCTGTTTT
AT1G61800.1 4 668 676 CTCTGTTTT
AT1G61800.1 4 729 737 CTCTGTTTT
AT1G61800.1 4 757 765 CTCTGTTTT
AT1G61800.1 4 787 795 CTCTGTTTT
AT1G69530.1 4 764 772 CTCTGTTTT
AT1G69530.1 4 787 779 AAAACAGAG
AT1G69530.1 4 826 834 CTCTGTTTT
AT1G69530.1 4 849 841 AAAACAGAG
AT1G70550.1 4 639 647 CTCTGTTTT
AT1G70550.1 4 650 658 CTCTGTTTT
AT1G70550.1 4 661 669 CTCTGTTTT
AT1G70550.1 4 710 718 CTCTGTTTT
AT1G72150.1 4 2 10 CTCTGTTTT
AT1G72150.1 4 476 468 AAAACAGAG
AT1G72150.1 4 491 483 AAAACAGAG
AT1G72150.1 4 521 513 AAAACAGAG
AT2G01540.1 4 499 507 CTCTGTTTT
AT2G01540.1 4 540 548 CTCTGTTTT
AT2G01540.1 4 580 588 CTCTGTTTT
AT2G01540.1 4 619 627 CTCTGTTTT
AT2G37440.1 4 244 252 CTCTGTTTT
AT2G37440.1 4 502 510 CTCTGTTTT
AT2G37440.1 4 660 668 CTCTGTTTT
AT2G37440.1 4 703 711 CTCTGTTTT
AT2G38120.1 4 354 362 CTCTGTTTT
AT2G38120.1 4 411 419 CTCTGTTTT
AT2G38120.1 4 425 433 CTCTGTTTT
AT2G38120.1 4 466 474 CTCTGTTTT
AT2G40320.1 4 515 507 AAAACAGAG
AT2G40320.1 4 707 715 CTCTGTTTT
AT2G40320.1 4 733 741 CTCTGTTTT
AT2G40320.1 4 759 767 CTCTGTTTT
121
Table S4.1 continued.
AT3G03650.1 4 479 471 AAAACAGAG
AT3G03650.1 4 518 510 AAAACAGAG
AT3G03650.1 4 535 527 AAAACAGAG
AT3G03650.1 4 557 549 AAAACAGAG
AT3G16520.1 4 298 306 CTCTGTTTT
AT3G16520.1 4 691 683 AAAACAGAG
AT3G16520.1 4 715 723 CTCTGTTTT
AT3G16520.1 4 844 852 CTCTGTTTT
AT3G28180.1 4 932 940 CTCTGTTTT
AT3G28180.1 4 943 951 CTCTGTTTT
AT3G28180.1 4 975 983 CTCTGTTTT
AT3G28180.1 4 986 994 CTCTGTTTT
AT4G00430.1 4 463 471 CTCTGTTTT
AT4G00430.1 4 480 488 CTCTGTTTT
AT4G00430.1 4 505 513 CTCTGTTTT
AT4G00430.1 4 539 547 CTCTGTTTT
AT4G13710.1 4 488 496 CTCTGTTTT
AT4G13710.1 4 533 525 AAAACAGAG
AT4G13710.1 4 733 741 CTCTGTTTT
AT4G13710.1 4 778 770 AAAACAGAG
AT4G19230.1 4 746 754 CTCTGTTTT
AT4G19230.1 4 813 805 AAAACAGAG
AT4G19230.1 4 829 837 CTCTGTTTT
AT4G19230.1 4 1300 1292 AAAACAGAG
AT4G34990.1 4 361 369 CTCTGTTTT
AT4G34990.1 4 398 406 CTCTGTTTT
AT4G34990.1 4 412 420 CTCTGTTTT
AT4G34990.1 4 608 600 AAAACAGAG
AT5G02170.1 4 208 216 CTCTGTTTT
AT5G02170.1 4 362 370 CTCTGTTTT
AT5G02170.1 4 600 608 CTCTGTTTT
AT5G02170.1 4 1578 1586 CTCTGTTTT
AT5G40030.1 4 734 742 CTCTGTTTT
AT5G40030.1 4 846 854 CTCTGTTTT
AT5G40030.1 4 934 942 CTCTGTTTT
AT5G40030.1 4 1170 1178 CTCTGTTTT
AT5G61570.1 4 687 695 CTCTGTTTT
122
Table S4.1 continued.
AT5G61570.1 4 699 707 CTCTGTTTT
AT5G61570.1 4 932 940 CTCTGTTTT
AT5G61570.1 4 1284 1276 AAAACAGAG
AT5G63850.1 4 839 847 CTCTGTTTT
AT5G63850.1 4 869 877 CTCTGTTTT
AT5G63850.1 4 890 898 CTCTGTTTT
AT5G63850.1 4 910 918 CTCTGTTTT
AT1G01590.1 3 1752 1760 CTCTGTTTT
AT1G01590.1 3 2134 2142 CTCTGTTTT
AT1G01590.1 3 2164 2172 CTCTGTTTT
AT1G04610.1 3 927 919 AAAACAGAG
AT1G04610.1 3 946 954 CTCTGTTTT
AT1G04610.1 3 965 957 AAAACAGAG
AT1G07340.1 3 632 640 CTCTGTTTT
AT1G07340.1 3 653 661 CTCTGTTTT
AT1G07340.1 3 675 683 CTCTGTTTT
AT1G10220.1 3 354 346 AAAACAGAG
AT1G10220.1 3 628 620 AAAACAGAG
AT1G10220.1 3 742 750 CTCTGTTTT
AT1G10750.1 3 676 684 CTCTGTTTT
AT1G10750.1 3 716 724 CTCTGTTTT
AT1G10750.1 3 745 753 CTCTGTTTT
AT1G16380.1 3 2527 2535 CTCTGTTTT
AT1G16380.1 3 2591 2599 CTCTGTTTT
AT1G16380.1 3 2757 2749 AAAACAGAG
AT1G19050.1 3 277 285 CTCTGTTTT
AT1G19050.1 3 303 311 CTCTGTTTT
AT1G19050.1 3 334 342 CTCTGTTTT
AT1G26770.1 3 756 748 AAAACAGAG
AT1G26770.1 3 778 786 CTCTGTTTT
AT1G26770.1 3 801 793 AAAACAGAG
AT1G64355.1 3 458 466 CTCTGTTTT
AT1G64355.1 3 497 505 CTCTGTTTT
AT1G64355.1 3 529 537 CTCTGTTTT
AT1G65150.1 3 1653 1661 CTCTGTTTT
AT1G65150.1 3 1756 1764 CTCTGTTTT
AT1G65150.1 3 1817 1825 CTCTGTTTT
123
Table S4.1 continued.
AT1G65920.1 3 178 186 CTCTGTTTT
AT1G65920.1 3 205 213 CTCTGTTTT
AT1G65920.1 3 215 223 CTCTGTTTT
AT1G76360.1 3 180 172 AAAACAGAG
AT1G76360.1 3 191 183 AAAACAGAG
AT1G76360.1 3 515 523 CTCTGTTTT
AT1G77330.1 3 239 247 CTCTGTTTT
AT1G77330.1 3 349 341 AAAACAGAG
AT1G77330.1 3 593 585 AAAACAGAG
AT1G78440.1 3 223 231 CTCTGTTTT
AT1G78440.1 3 444 452 CTCTGTTTT
AT1G78440.1 3 463 471 CTCTGTTTT
AT2G03730.1 3 145 153 CTCTGTTTT
AT2G03730.1 3 397 405 CTCTGTTTT
AT2G03730.1 3 506 514 CTCTGTTTT
AT2G13840.1 3 552 560 CTCTGTTTT
AT2G13840.1 3 619 627 CTCTGTTTT
AT2G13840.1 3 687 695 CTCTGTTTT
AT2G23320.1 3 806 814 CTCTGTTTT
AT2G23320.1 3 834 826 AAAACAGAG
AT2G23320.1 3 1049 1041 AAAACAGAG
AT2G25460.1 3 41 33 AAAACAGAG
AT2G25460.1 3 67 59 AAAACAGAG
AT2G25460.1 3 91 83 AAAACAGAG
AT2G33230.1 3 747 739 AAAACAGAG
AT2G33230.1 3 785 777 AAAACAGAG
AT2G33230.1 3 801 809 CTCTGTTTT
AT2G38090.1 3 216 224 CTCTGTTTT
AT2G38090.1 3 520 528 CTCTGTTTT
AT2G38090.1 3 643 635 AAAACAGAG
AT2G39210.1 3 670 662 AAAACAGAG
AT2G39210.1 3 681 673 AAAACAGAG
AT2G39210.1 3 691 683 AAAACAGAG
AT3G03780.1 3 115 123 CTCTGTTTT
AT3G03780.1 3 146 154 CTCTGTTTT
AT3G03780.1 3 195 203 CTCTGTTTT
AT3G24600.1 3 2056 2064 CTCTGTTTT
124
Table S4.1 continued.
AT3G24600.1 3 2068 2076 CTCTGTTTT
AT3G24600.1 3 2311 2319 CTCTGTTTT
AT3G46110.1 3 310 318 CTCTGTTTT
AT3G46110.1 3 325 333 CTCTGTTTT
AT3G46110.1 3 519 527 CTCTGTTTT
AT3G48360.1 3 554 562 CTCTGTTTT
AT3G48360.1 3 627 635 CTCTGTTTT
AT3G48360.1 3 976 984 CTCTGTTTT
AT3G61230.1 3 429 437 CTCTGTTTT
AT3G61230.1 3 443 451 CTCTGTTTT
AT3G61230.1 3 567 575 CTCTGTTTT
AT3G61750.1 3 106 114 CTCTGTTTT
AT3G61750.1 3 272 280 CTCTGTTTT
AT3G61750.1 3 300 292 AAAACAGAG
AT4G03210.1 3 281 289 CTCTGTTTT
AT4G03210.1 3 299 307 CTCTGTTTT
AT4G03210.1 3 313 321 CTCTGTTTT
AT4G09460.1 3 362 354 AAAACAGAG
AT4G09460.1 3 381 373 AAAACAGAG
AT4G09460.1 3 558 566 CTCTGTTTT
AT4G12080.1 3 741 749 CTCTGTTTT
AT4G12080.1 3 753 761 CTCTGTTTT
AT4G12080.1 3 912 920 CTCTGTTTT
AT4G22880.1 3 65 73 CTCTGTTTT
AT4G22880.1 3 105 113 CTCTGTTTT
AT4G22880.1 3 117 125 CTCTGTTTT
AT4G25420.1 3 423 415 AAAACAGAG
AT4G25420.1 3 618 610 AAAACAGAG
AT4G25420.1 3 681 689 CTCTGTTTT
AT4G28025.1 3 106 98 AAAACAGAG
AT4G28025.1 3 270 278 CTCTGTTTT
AT4G28025.1 3 419 427 CTCTGTTTT
AT4G35300.1 3 235 243 CTCTGTTTT
AT4G35300.1 3 332 340 CTCTGTTTT
AT4G35300.1 3 427 435 CTCTGTTTT
AT5G09220.1 3 1108 1116 CTCTGTTTT
AT5G09220.1 3 1122 1130 CTCTGTTTT
125
Table S4.1 continued.
AT5G09220.1 3 1163 1171 CTCTGTTTT
AT5G09460.1 3 137 145 CTCTGTTTT
AT5G09460.1 3 198 206 CTCTGTTTT
AT5G09460.1 3 475 483 CTCTGTTTT
AT5G09461.1 3 137 145 CTCTGTTTT
AT5G09461.1 3 198 206 CTCTGTTTT
AT5G09461.1 3 475 483 CTCTGTTTT
AT5G09462.1 3 137 145 CTCTGTTTT
AT5G09462.1 3 198 206 CTCTGTTTT
AT5G09462.1 3 475 483 CTCTGTTTT
AT5G09463.1 3 137 145 CTCTGTTTT
AT5G09463.1 3 198 206 CTCTGTTTT
AT5G09463.1 3 475 483 CTCTGTTTT
AT5G12050.1 3 240 232 AAAACAGAG
AT5G12050.1 3 430 422 AAAACAGAG
AT5G12050.1 3 458 450 AAAACAGAG
AT5G14370.1 3 109 101 AAAACAGAG
AT5G14370.1 3 150 142 AAAACAGAG
AT5G14370.1 3 331 323 AAAACAGAG
AT5G26230.1 3 453 461 CTCTGTTTT
AT5G26230.1 3 632 624 AAAACAGAG
AT5G26230.1 3 651 643 AAAACAGAG
AT5G39785.1 3 387 379 AAAACAGAG
AT5G39785.1 3 399 407 CTCTGTTTT
AT5G39785.1 3 435 427 AAAACAGAG
AT5G39850.1 3 134 142 CTCTGTTTT
AT5G39850.1 3 269 277 CTCTGTTTT
AT5G39850.1 3 309 317 CTCTGTTTT
AT5G40460.1 3 139 147 CTCTGTTTT
AT5G40460.1 3 153 161 CTCTGTTTT
AT5G40460.1 3 175 183 CTCTGTTTT
AT5G41380.1 3 485 477 AAAACAGAG
AT5G41380.1 3 731 739 CTCTGTTTT
AT5G41380.1 3 748 756 CTCTGTTTT
AT5G49340.1 3 512 520 CTCTGTTTT
AT5G49340.1 3 682 674 AAAACAGAG
AT5G49340.1 3 707 699 AAAACAGAG
126
Table S4.1 continued.
AT5G51670.1 3 525 517 AAAACAGAG
AT5G51670.1 3 536 528 AAAACAGAG
AT5G51670.1 3 549 541 AAAACAGAG
AT5G57350.1 3 2683 2691 CTCTGTTTT
AT5G57350.1 3 2695 2703 CTCTGTTTT
AT5G57350.1 3 2720 2728 CTCTGTTTT
AT5G58000.1 3 257 249 AAAACAGAG
AT5G58000.1 3 492 484 AAAACAGAG
AT5G58000.1 3 705 713 CTCTGTTTT
AT5G62140.1 3 289 281 AAAACAGAG
AT5G62140.1 3 472 480 CTCTGTTTT
AT5G62140.1 3 514 522 CTCTGTTTT
127
Table S4.2. AtMYB61 second intron repeat motif identified within all Arabidopsis thaliana intergenic regions Note a cutoff of at least 3 motifs occurring at least 500 bp apart was set. Thus 15 intergenic regions contain this repeat. Highlighted regions indicate unique intergenic regions.
AGI of intergenic region # of hits Position Orientation
AT5G57480-AT5G57490 6 37 29 AAAACAGAG
AT5G57480-AT5G57490 6 51 43 AAAACAGAG
AT5G57480-AT5G57490 6 70 62 AAAACAGAG
AT5G57480-AT5G57490 6 81 73 AAAACAGAG
AT5G57480-AT5G57490 6 101 93 AAAACAGAG
AT5G57480-AT5G57490 6 121 113 AAAACAGAG
AT4G16880-AT4G16890 4 1840 1848 CTCTGTTTT
AT4G16880-AT4G16890 4 2114 2106 AAAACAGAG
AT4G16880-AT4G16890 4 2284 2276 AAAACAGAG
AT4G16880-AT4G16890 4 3170 3162 AAAACAGAG
AT5G16970-AT5G16980 4 350 342 AAAACAGAG
AT5G16970-AT5G16980 4 369 361 AAAACAGAG
AT5G16970-AT5G16980 4 743 735 AAAACAGAG
AT5G16970-AT5G16980 4 755 747 AAAACAGAG
AT1G71680-AT1G71690 3 60 52 AAAACAGAG
AT1G71680-AT1G71690 3 79 71 AAAACAGAG
AT1G71680-AT1G71690 3 92 84 AAAACAGAG
AT1G71950-AT1G71960 3 674 682 CTCTGTTTT
AT1G71950-AT1G71960 3 705 713 CTCTGTTTT
AT1G71950-AT1G71960 3 717 725 CTCTGTTTT
AT2G05360-AT2G05370 3 63 55 AAAACAGAG
AT2G05360-AT2G05370 3 291 283 AAAACAGAG
AT2G05360-AT2G05370 3 304 296 AAAACAGAG
AT3G16120-AT3G16130 3 583 591 CTCTGTTTT
AT3G16120-AT3G16130 3 666 658 AAAACAGAG
AT3G16120-AT3G16130 3 682 674 AAAACAGAG
AT3G27610-AT3G27620 3 813 805 AAAACAGAG
AT3G27610-AT3G27620 3 835 827 AAAACAGAG
AT3G27610-AT3G27620 3 845 837 AAAACAGAG
AT4G23200-AT4G23210 3 604 596 AAAACAGAG
AT4G23200-AT4G23210 3 620 612 AAAACAGAG
AT4G23200-AT4G23210 3 648 640 AAAACAGAG
128
Table S4.2 continued.
AT4G34400-AT4G34410 3 447 439 AAAACAGAG
AT4G34400-AT4G34410 3 454 462 CTCTGTTTT
AT4G34400-AT4G34410 3 713 705 AAAACAGAG
AT4G37030-AT4G37040 3 202 210 CTCTGTTTT
AT4G37030-AT4G37040 3 243 251 CTCTGTTTT
AT4G37030-AT4G37040 3 259 267 CTCTGTTTT
AT5G12950-AT5G12960 3 543 551 CTCTGTTTT
AT5G12950-AT5G12960 3 564 572 CTCTGTTTT
AT5G12950-AT5G12960 3 586 594 CTCTGTTTT
AT5G29015-AT5G29020 3 1008 1016 CTCTGTTTT
AT5G29015-AT5G29020 3 1300 1308 CTCTGTTTT
AT5G29015-AT5G29020 3 1328 1336 CTCTGTTTT
AT5G57520-AT5G57530 3 3396 3404 CTCTGTTTT
AT5G57520-AT5G57530 3 3471 3479 CTCTGTTTT
AT5G57520-AT5G57530 3 3496 3504 CTCTGTTTT
AT5G57535-AT5G57540 3 169 177 CTCTGTTTT
AT5G57535-AT5G57540 3 181 189 CTCTGTTTT
AT5G57535-AT5G57540 3 202 210 CTCTGTTTT
129
Table S4.3. AtMYB61 second intron repeat motif identified within all Arabidopsis thaliana introns and corresponding transcript response to sugar Note a cutoff of at least 3 motifs occurring at least 500 bp apart was set. Thus 45 introns contain this repeat. 45.9% of the AtMYB61 second intron repeat motif occurrences are within introns. Within the 45 introns with these repeats, 21 of these occurrences are within sugar responsive genes (46.7%). Highlighted regions indicate unique gene. -n within AGI represents which intron the motif is present within. Sugar responsive genes were identified from microarray data conducted by Romano et al. (Romano et al., 2012).
AGI # of hits Position Orientation Sugar Responsive
AT1G67070.1-1 7 15 23 CTCTGTTTT NO
AT1G67070.1-1 7 27 35 CTCTGTTTT
AT1G67070.1-1 7 217 225 CTCTGTTTT
AT1G67070.1-1 7 230 238 CTCTGTTTT
AT1G67070.1-1 7 256 264 CTCTGTTTT
AT1G67070.1-1 7 402 410 CTCTGTTTT
AT1G67070.1-1 7 415 423 CTCTGTTTT
AT3G60130.1-7 5 168 176 CTCTGTTTT YES
AT3G60130.1-7 5 185 193 CTCTGTTTT
AT3G60130.1-7 5 212 220 CTCTGTTTT
AT3G60130.1-7 5 239 247 CTCTGTTTT
AT3G60130.1-7 5 266 274 CTCTGTTTT
AT1G09540.1-2 4 58 50 AAAACAGAG YES
AT1G09540.1-2 4 87 95 CTCTGTTTT
AT1G09540.1-2 4 104 112 CTCTGTTTT
AT1G09540.1-2 4 144 152 CTCTGTTTT
AT1G30320.1-2 4 76 84 CTCTGTTTT NO
AT1G30320.1-2 4 87 95 CTCTGTTTT
AT1G30320.1-2 4 184 192 CTCTGTTTT
AT1G30320.1-2 4 227 235 CTCTGTTTT
AT1G32700.1-1 4 40 48 CTCTGTTTT YES
AT1G32700.1-1 4 67 75 CTCTGTTTT
AT1G32700.1-1 4 215 223 CTCTGTTTT
AT1G32700.1-1 4 232 240 CTCTGTTTT
AT1G61800.1-1 4 89 97 CTCTGTTTT YES
AT1G61800.1-1 4 150 158 CTCTGTTTT
AT1G61800.1-1 4 178 186 CTCTGTTTT
AT1G61800.1-1 4 208 216 CTCTGTTTT
AT1G69530.1-2 4 25 33 CTCTGTTTT YES
AT1G69530.1-2 4 48 40 AAAACAGAG
130
Table S4.3 continued.
AT1G69530.1-2 4 87 95 CTCTGTTTT
AT1G69530.1-2 4 110 102 AAAACAGAG
AT1G70550.1-1 4 85 93 CTCTGTTTT NO
AT1G70550.1-1 4 96 104 CTCTGTTTT
AT1G70550.1-1 4 107 115 CTCTGTTTT
AT1G70550.1-1 4 156 164 CTCTGTTTT
AT2G01540.1-1 4 125 133 CTCTGTTTT YES
AT2G01540.1-1 4 166 174 CTCTGTTTT
AT2G01540.1-1 4 206 214 CTCTGTTTT
AT2G01540.1-1 4 245 253 CTCTGTTTT
AT2G37440.1-1 4 137 145 CTCTGTTTT NO
AT2G37440.1-1 4 395 403 CTCTGTTTT
AT2G37440.1-1 4 553 561 CTCTGTTTT
AT2G37440.1-1 4 596 604 CTCTGTTTT
AT2G38120.1-1 4 82 90 CTCTGTTTT YES
AT2G38120.1-1 4 139 147 CTCTGTTTT
AT2G38120.1-1 4 153 161 CTCTGTTTT
AT2G38120.1-1 4 194 202 CTCTGTTTT
AT3G28180.1-1 4 15 23 CTCTGTTTT YES
AT3G28180.1-1 4 26 34 CTCTGTTTT
AT3G28180.1-1 4 58 66 CTCTGTTTT
AT3G28180.1-1 4 69 77 CTCTGTTTT
AT4G00430.1-1 4 36 44 CTCTGTTTT YES
AT4G00430.1-1 4 53 61 CTCTGTTTT
AT4G00430.1-1 4 78 86 CTCTGTTTT
AT4G00430.1-1 4 112 120 CTCTGTTTT
AT4G02780.1-1 4 202 210 CTCTGTTTT NO
AT4G02780.1-1 4 332 340 CTCTGTTTT
AT4G02780.1-1 4 422 430 CTCTGTTTT
AT4G02780.1-1 4 574 582 CTCTGTTTT
AT5G37600.1-1 4 109 117 CTCTGTTTT YES
AT5G37600.1-1 4 297 305 CTCTGTTTT
AT5G37600.1-1 4 321 329 CTCTGTTTT
AT5G37600.1-1 4 333 341 CTCTGTTTT
AT5G40030.1-1 4 84 92 CTCTGTTTT NO
AT5G40030.1-1 4 196 204 CTCTGTTTT
AT5G40030.1-1 4 284 292 CTCTGTTTT
131
Table S4.3 continued.
AT5G40030.1-1 4 520 528 CTCTGTTTT
AT5G45340.1-2 4 33 25 AAAACAGAG YES
AT5G45340.1-2 4 69 61 AAAACAGAG
AT5G45340.1-2 4 74 82 CTCTGTTTT
AT5G45340.1-2 4 97 105 CTCTGTTTT
AT5G46240.1-1 4 22 30 CTCTGTTTT NO
AT5G46240.1-1 4 36 44 CTCTGTTTT
AT5G46240.1-1 4 88 96 CTCTGTTTT
AT5G46240.1-1 4 124 132 CTCTGTTTT
AT5G61570.1-1 4 7 15 CTCTGTTTT NO
AT5G61570.1-1 4 19 27 CTCTGTTTT
AT5G61570.1-1 4 252 260 CTCTGTTTT
AT5G61570.1-1 4 604 596 AAAACAGAG
AT5G63850.1-3 4 17 25 CTCTGTTTT NO
AT5G63850.1-3 4 47 55 CTCTGTTTT
AT5G63850.1-3 4 68 76 CTCTGTTTT
AT5G63850.1-3 4 88 96 CTCTGTTTT
AT1G04610.1-1 3 77 69 AAAACAGAG NO
AT1G04610.1-1 3 96 104 CTCTGTTTT
AT1G04610.1-1 3 115 107 AAAACAGAG
AT1G07340.1-2 3 46 54 CTCTGTTTT NO
AT1G07340.1-2 3 67 75 CTCTGTTTT
AT1G07340.1-2 3 89 97 CTCTGTTTT
AT1G10750.1-1 3 149 157 CTCTGTTTT NO
AT1G10750.1-1 3 189 197 CTCTGTTTT
AT1G10750.1-1 3 218 226 CTCTGTTTT
AT1G19050.1-1 3 29 37 CTCTGTTTT YES
AT1G19050.1-1 3 55 63 CTCTGTTTT
AT1G19050.1-1 3 86 94 CTCTGTTTT
AT1G26770.1-3 3 37 29 AAAACAGAG YES
AT1G26770.1-3 3 59 67 CTCTGTTTT
AT1G26770.1-3 3 82 74 AAAACAGAG
AT1G64355.1-1 3 8 16 CTCTGTTTT NO
AT1G64355.1-1 3 47 55 CTCTGTTTT
AT1G64355.1-1 3 79 87 CTCTGTTTT
AT1G65920.1-1 3 34 42 CTCTGTTTT NO
AT1G65920.1-1 3 61 69 CTCTGTTTT
132
Table S4.3 continued.
AT1G65920.1-1 3 71 79 CTCTGTTTT
AT2G13840.1-1 3 198 206 CTCTGTTTT NO
AT2G13840.1-1 3 265 273 CTCTGTTTT
AT2G13840.1-1 3 333 341 CTCTGTTTT
AT2G33230.1-1 3 48 40 AAAACAGAG NO
AT2G33230.1-1 3 86 78 AAAACAGAG
AT2G33230.1-1 3 102 110 CTCTGTTTT
AT2G39210.1-1 3 67 59 AAAACAGAG NO
AT2G39210.1-1 3 78 70 AAAACAGAG
AT2G39210.1-1 3 88 80 AAAACAGAG
AT2G40320.1-2 3 19 27 CTCTGTTTT NO
AT2G40320.1-2 3 45 53 CTCTGTTTT
AT2G40320.1-2 3 71 79 CTCTGTTTT
AT3G03780.1-1 3 60 68 CTCTGTTTT NO
AT3G03780.1-1 3 91 99 CTCTGTTTT
AT3G03780.1-1 3 140 148 CTCTGTTTT
AT4G03210.1-1 3 39 47 CTCTGTTTT YES
AT4G03210.1-1 3 57 65 CTCTGTTTT
AT4G03210.1-1 3 71 79 CTCTGTTTT
AT4G09460.1-1 3 46 38 AAAACAGAG YES
AT4G09460.1-1 3 65 57 AAAACAGAG
AT4G09460.1-1 3 242 250 CTCTGTTTT
AT4G12080.1-1 3 19 27 CTCTGTTTT YES
AT4G12080.1-1 3 31 39 CTCTGTTTT
AT4G12080.1-1 3 190 198 CTCTGTTTT
AT4G19230.1-2 3 9 17 CTCTGTTTT YES
AT4G19230.1-2 3 76 68 AAAACAGAG
AT4G19230.1-2 3 92 100 CTCTGTTTT
AT4G22880.1-1 3 39 47 CTCTGTTTT NO
AT4G22880.1-1 3 79 87 CTCTGTTTT
AT4G22880.1-1 3 91 99 CTCTGTTTT
AT4G34990.1-1 3 20 28 CTCTGTTTT NO
AT4G34990.1-1 3 57 65 CTCTGTTTT
AT4G34990.1-1 3 71 79 CTCTGTTTT
AT4G35300.4-1 3 295 303 CTCTGTTTT NO
AT4G35300.4-1 3 392 400 CTCTGTTTT
AT4G35300.4-1 3 487 495 CTCTGTTTT
133
Table S4.3 continued.
AT5G09220.1-3 3 11 19 CTCTGTTTT YES
AT5G09220.1-3 3 25 33 CTCTGTTTT
AT5G09220.1-3 3 66 74 CTCTGTTTT
AT5G38970.1-2 3 28 36 CTCTGTTTT NO
AT5G38970.1-2 3 52 60 CTCTGTTTT
AT5G38970.1-2 3 156 164 CTCTGTTTT
AT5G39850.1-1 3 75 83 CTCTGTTTT YES
AT5G39850.1-1 3 210 218 CTCTGTTTT
AT5G39850.1-1 3 250 258 CTCTGTTTT
AT5G51670.1-1 3 41 33 AAAACAGAG NO
AT5G51670.1-1 3 52 44 AAAACAGAG
AT5G51670.1-1 3 65 57 AAAACAGAG
AT5G53660.1-2 3 32 40 CTCTGTTTT YES
AT5G53660.1-2 3 59 67 CTCTGTTTT
AT5G53660.1-2 3 72 80 CTCTGTTTT
AT5G57350.1-5 3 14 22 CTCTGTTTT YES
AT5G57350.1-5 3 26 34 CTCTGTTTT
AT5G57350.1-5 3 51 59 CTCTGTTTT
134
Chapter 5
General Conclusions and Future Directions
135
5 General Conclusions and Future Directions
5.1 General Conclusions
This thesis investigated the upstream and downstream regulation of the Arabidopsis
thaliana R2R3-MYB transcription factor, AtMYB61. It addressed three major aims. The
first aim related to the identification of direct downstream targets of AtMYB61. The
second aim related to the determination of DNA targets preferentially bound by
AtMYB61. The third aim dealt with the examination of upstream regulatory mechanisms
that impact the transcription of AtMYB61. The scientific objectives and the major
findings that arose by addressing these aims are as follows:
(1) To determine the direct downstream targets of AtMYB61
Three putative downstream target genes of AtMYB61 were identified. Putative
AtMYB61 targets were predicted on the basis of comparative transcriptome analysis.
This transcriptome analysis entailed identification and comparison of genes whose
transcript abundance was modulated by differences in AtMYB61 activity, relative to
those genes whose transcript abundance profiles paralleled AtMYB61 across
development and in different organs.
The three putative AtMYB61 targets identified through this comparison are predicted to
encode the following proteins: a KNOTTED1-like transcription factor (KNAT7,
At1g62990); a caffeoyl-CoA 3-O-methyltransferase (CCoAOMT7, At4g26220), and a
pectin-methylesterase (PME, At2g45220). Statistically over-represented motifs were
identified in the 5‘ non-coding regions of the three putative target genes. These motifs
corresponded to previously-characterised AC-element motifs that function as R2R3-
MYB targets in other systems (Grotewold et al., 1994; Sablowski et al., 1994; Sablowski
et al., 1995; Moyano et al., 1996; Sainz et al., 1997; Uimari and Strommer, 1997;
Tamagnone et al., 1998; Jin et al., 2000; Sugimoto et al., 2000; Yang et al., 2001;
Patzlaff et al., 2003a; Patzlaff et al., 2003b; Fukuzawa et al., 2006).
The consensus motif identified in the gene regulatory regions of the three putative
AtMYB61 target genes functions as a bona fide target for AtMYB61 binding, as
136
determined by EMSA using purified recombinant AtMYB61 protein. Moreover, the 5‘
non-coding regulatory regions of each of the putative target genes could also be bound
by AtMYB61, as determined by EMSA. AtMYB61 expression in yeast was sufficient to
drive transcription of a synthetic reporter gene comprising a tandem AC-element fused
to a yeast minimal promoter, upstream of the reporter gene lac-Z. Together, these
findings support the hypothesis that AtMYB61 binds to, and regulates, the expression of
a small subset of genes, which in turn shape multiple facets of plant growth and
metabolism.
(2) To identify and characterise the DNA binding motifs to which AtMYB61
preferentially binds
The DNA binding sites to which a gene regulatory protein binds can be affinity purified
using the CASTing system. This system was used to identify DNA recognition sites to
which recombinant AtMYB61 protein preferentially binds in vitro. The binding kinetics of
AtMYB61 to the CASTing-selected DNA target sequences were determined using a
nitrocellulose filter-binding assay. These experiments confirmed that a core ACC
nucleotide motif was essential for binding by AtMYB61. The nature of the interactions
between amino acids in the AtMYB61 DNA-binding site and nucleotides in the
preferential DNA targets were explored using molecular modeling in silico. These
predict key interactions that likely shape the affinity of protein binding to the cognate
DNA sequence. Notably, while recombinant AtMYB61 was sufficient to drive gene
expression from CASTing-identified target DNA sequences in yeast, it did so in a
manner that was not entirely consistent with predicted affinities. Together, these
findings illustrate the binding specificity of an R2R3-MYB protein, and underscore the
fact that such specificity may play out in a complex manner in a biological system.
(3) To determine the molecular components that function upstream to modulate
AtMYB61 expression.
AtMYB61 was regulated by photosynthate in a sugar-signalling pathway that appears to
act independent of the hexokinase sugar signalling pathway. Analysis of AtMYB61
promoter-reporter fusion constructs with or without AtMYB61 5‘ intragenic sequences
suggested that AtMYB61 expression is de-repressed by sucrose in a mechanism
137
involving intragenic sequences. An over-represented conserved motif was identified
within the second intron of Brassicaceae AtMYB61 homologues. The second intron
repeats of AtMYB61 could function as binding targets for a putative sugar-mediated
repressor, as determined by EMSA. Putative repressor proteins that bound this motif in
the absence of sucrose were identified by affinity purification coupled with mass
spectrometry, and characterised using a combination of loss-of-function genetics and
transcriptome analysis. Together, these findings support the hypothesis of a novel
protein activity that binds a conserved repeat motif within AtMYB61 second intron to
regulate sugar mediated gene expression in AtMYB61.
5.2 Future Directions
Molecular Characterisations of Plant Transcription Factors
Despite the vast knowledge of plant transcription factor function at the gross
morphological level, little is known about the mechanistic basis for transcription factor
activity. In addition to shedding light on a particular transcription factor AtMYB61, this
thesis has established a pipeline for the characterisation of the functions of any
transcription factor on the molecular level. This pipeline is essential because it gives
insight into the mechanisms that drive phenotypes. The identification of more DNA-
binding sites of regulatory proteins should lead to more accurate in silico motif
prediction programs for novel DNA-binding proteins. These insights are not only
important from a basic science perspective, but can also be fruitful in terms of
developing schemes for the modification of important transcription factors, like
AtMYB61, for specific end purposes, such as the directed modification of plant
architecture or metabolic engineering.
ChIP-Seq
In addition to the in vitro and in silico characterisation of AtMYB61 and its target
sequences demonstrated in this thesis, it is critical that an in vivo characterisation be
conducted as well to further determine how AtMYB61 influence phenotype-affecting
mechanisms. Recently, chromatin immunoprecipitation (ChIP) followed by high-
138
throughput signature sequencing (ChIP-seq) has proven to be an incredibly powerful
means by which to identify in vivo DNA-binding sites of sequence-specific transcription
factors (Massie and Mills, 2008). ChIP-seq could be used to identify AtMYB61 in vivo
DNA targets in the Arabidopsis thaliana genome. Towards this note, a viable antibody
has been generated against the variable region of AtMYB61 (refer to Chapter 3 of this
thesis). DNA sequences can be pulled down, sequenced, and analysed to determine
their location in the Arabidopsis thaliana genome. Targets can be validated by
analysing their transcript abundance in atmyb61 loss-of-function and AtMYB61
overexpressor mutants. The in vivo direct downstream targets of AtMYB61 can be
compared to the in vitro and in silico targets determined in this thesis to confirm
accuracy of methods.
Characterisations of Putative AtMYB61 Repressors
The identification of putative repressors that bound the second intron of AtMYB61
determined in this thesis demonstrated the molecular components that function
upstream to modulate AtMYB61 expression; however, the biochemical characterisations
of these repressor proteins still remain. To determine if the putative AtMYB61 proteins
can repress gene activity, these proteins should be expressed in Arabidopsis thaliana
protoplasts to observe if they can repress a synthetic reporter gene comprising tandem
AtMYB61 second intron repeats fused to a Cauliflower Mosaic Virus 35S promoter,
upstream of the GUS reporter gene uidA. In addition to the biochemical
characterisations of these putative repressor proteins, the in vivo direct downstream
targets of these proteins should be identified. ChIP-seq should be conducted on these
repressor proteins to identify in vivo targets. To determine the expression of AtMYB61
repressors in tissues throughout development, promoter-reporter fusion constructs
should be transformed into plants and analysed.
The validation of binding of putative AtMYB61 repressors to AtMYB61 second intron
repeat is also to be determined. The cDNA of putative AtMYB61 repressors should be
cloned into the pET-15b protein expression vectors and expressed. To determine if the
proteins bind to AtMYB61 second intron repeat in vitro, an electrophoretic mobility shift
assay (EMSA) is to be conducted with recombinant putative AtMYB61 repressor
139
proteins and labelled AtMYB61 second intron repeat. In addition to this, to determine if
the putative AtMYB61 repressor proteins bind to AtMYB61 second intron repeat in vivo,
an EMSA is to be conducted with labelled AtMYB61 second intron repeat and nuclear
proteins purified from putative AtMYB61 repressor loss-of-function (rmx) mutants. It is
hypothesised that in the rmx loss-of-function background, the binding would be reduced
in the EMSA compared to the same assay conducted with wild-type nuclear proteins.
Despite the size and importance of the plant R2R3-MYB family of transcription factors,
little is known about the molecular functioning of individual family members. AtMYB61,
a member of the R2R3-MYB family in Arabidopsis thaliana, regulates pleiotropic
modifications of carbon acquisition and allocation throughout the plant body. As is the
case for most R2R3-MYB transcription factors, the precise mechanisms that enable
AtMYB61 to bring about important changes in plant function were unknown before the
onset of this thesis. The work described in this thesis casts light on the downstream
and upstream mechanisms of AtMYB61. The findings presented in this thesis point to
additional complexities in the regulation of plant gene expression, and argue for the
need for greater exploration of the molecular intricacies involved in how a given plant
transcription factor elicits a phenotype.
140
Appendices
The wound-, pathogen-, and ultraviolet B-responsive MYB134 gene encodes an R2R3 MYB transcription factor that
regulates a suite of genes involved in proanthocyanidin synthesis in Poplar
This chapter is an extract of material originally contained in the following publication:
CPC wrote manuscript with editorial assistance from MBP, RDM, LTT, MMC, CPC
MBP contributed specifically to each figure and table in this chapter.
Copyright: The material in this chapter is copyrighted by The American Society of
Plant Biologists and is cited as:
141
A The Wound-, Pathogen-, and Ultraviolet B-Responsive MYB134 Gene Encodes an R2R3 MYB Transcription Factor that Regulates a Suite of Genes Involved in Proanthocyanidin Synthesis in Poplar
A.1 Abstract
In poplar (Populus spp.), the major defense phenolics produced in leaves are flavonoid-
derived proanthocyanidins (PAs). Transcriptional activation of PA biosynthetic genes
leading to PA accumulation in leaves occurs following herbivore damage and
mechanical wounding. A poplar R2R3-MYB transcription factor gene, MYB134, exhibits
close sequence similarity to the Arabidopsis thaliana PA regulator TRANSPARENT
TESTA2 and is coinduced with PA biosynthetic genes following mechanical wounding
and exposure to elevated ultraviolet B light. Overexpression of MYB134 in poplar
results in transcriptional activation of the full PA biosynthetic pathway and a significant
plant-wide increase in PA levels. Here, we demonstrate through electrophoretic mobility
shift assays (EMSA) that recombinant MYB134 protein is able to bind to promoter
regions of early and late PA pathway genes: PHENYLALANINE AMMONIA-LYASE1
(PAL1), DIHYDROFLAVONOL REDUCTASE1 (DFR1) and ANTHOCYANIDIN
REDUCTASE2 (ANR2). Sequences enriched with adenosine and cytosine nucleotides,
termed AC elements, were over-represented in the 5‘ non-coding regions of putative
target genes. The consensus motif functions as a bona fide target for MYB134 as
determined by EMSA. Our data provide insight into the regulatory mechanisms
controlling PA metabolism in poplar, and the identification of a regulator of stress-
responsive PA biosynthesis constitutes a valuable tool for manipulating PA metabolism
in poplar and investigating the biological functions of PAs in resistance to biotic and
abiotic stresses.
A.2 Introduction
Plant secondary metabolites play important ecological roles and in many plants
constitute a critical component of defenses against biotic and abiotic stress. Many
142
secondary metabolic pathways are responsive to environmental conditions and can be
rapidly activated by stresses such as pathogen infection, elevated light, and herbivory.
The phenylpropanoid pathway in particular leads to the synthesis of a large and diverse
class of plant secondary metabolites, many of which are stress induced (Dixon and
Paiva, 1995). Synthesis of phenylpropanoids and other secondary metabolites
following stress is typically mediated by the transcriptional activation of suites of
biosynthetic genes coordinately regulated by transcription factor proteins (Weisshaar
and Jenkins, 1998; Davies and Schwinn, 2003). The possibility of identifying
transcription factors that control entire pathways is motivating many studies in plant
stress biology, since such regulators would be valuable for the metabolic engineering of
plants for both plant and human health (Dixon, 2005; Sharma and Dixon, 2005; Yu and
McGonigle, 2005).
Populus species (cottonwoods, poplars, and aspens, hereafter referred to collectively as
poplar) are often ecological foundation species and include the most widely distributed
trees in the Northern Hemisphere. The phenolic metabolites produced by poplar are
thought to be important determinants of community structure and ecosystem dynamics
(Lindroth and Hwang, 1996; Schweitzer et al., 2004; Bailey et al., 2005; LeRoy et al.,
2006; Whitham et al., 2006). Poplar leaves typically accumulate several classes of
phenolic metabolites, including the salicylate-derived phenolic glycosides (PGs),
flavonoids such as flavonol glycosides, anthocyanins, and proanthocyanidins (PAs; or
condensed tannins), and numerous small phenolic acids and their esters (Pearl and
Darling, 1971; Klimczak et al., 1972; Palo, 1984; Lindroth and Hwang, 1996). PGs and
PAs are generally the most abundant foliar phenolic metabolites in poplar and together
can constitute more than 30% of leaf dry weight (Pearl and Darling, 1971; Klimczak et
al., 1972; Palo, 1984; Lindroth and Hwang, 1996). PAs are also constitutively produced
in poplar leaves, but their biosynthesis is often up-regulated by stresses such as insect
herbivory, mechanical wounding, and pathogen infection (Peters and Constabel, 2002;
Stevens and Lindroth, 2005; Miranda et al., 2007). PA accumulation following
wounding and herbivory occurs both locally at the site of damage and systemically in
distal leaves (Peters and Constabel, 2002). The strong systemic activation of the PA
biosynthetic pathway in poplar following insect herbivory suggests that these
143
compounds function in herbivore defense. However, experimental evidence indicates
that poplar leaf PAs may not be strong, broad-spectrum antiherbivore compounds
(Hemming and Lindroth, 1995; Ayres et al., 1997). In addition to biotic stresses, nutrient
limitation and high light levels have also been found to result in greater PA
concentrations in poplar (Hemming and Lindroth, 1999; Osier and Lindroth, 2001),
hinting at broader biological roles.
Transcriptional regulation of flavonoid and PA biosynthetic genes involves combinatorial
interactions between several classes of transcription factor proteins (Mol et al., 1998;
Nesi et al., 2001; Winkel-Shirley, 2001). These include members of the R2R3-MYB
domain, basic helix-loop-helix (bHLH) domain, and WD-repeat (WDR) families (Lepiniec
et al., 2006). In Arabidopsis thaliana seed testa, PA biosynthesis is regulated by a
MYB-bHLH-WDR ternary complex composed of the TT2, TT8, and TTG1 proteins (Nesi
et al., 2000; Nesi et al., 2001. The MYB factor (TT2) confers target gene specificity to
the complex, activating the late PA biosynthetic genes, including DFR, BAN, TT12, and
AHA10 {Baudry, 2004 #208; Debeaujon et al., 2003; Baudry et al., 2004; Sharma and
Dixon, 2005). The DNA sequences bound by TT2 have not been elucidated, although
the closely related maize (Zea mays) COLORLESS1 (C1) protein, a regulator of
anthocyanin metabolism, has been shown to bind to both AC-rich motifs known as AC
elements and the animal c-MYB consensus sequence (CNGTTR) present in the
regulatory regions of numerous phenylpropanoid genes (Howe and Watson, 1991;
Weston, 1992; Sainz et al., 1997; Hernandez et al., 2004).
The R2R3-MYBs constitute large gene families in plants, with 126 members in
Arabidopsis thaliana (Stracke et al., 2001) and 192 in poplar (Wilkins et al., 2009).
Although many remain functionally uncharacterised, numerous R2R3-MYB proteins are
implicated in the regulation of plant-specific developmental and physiological processes,
including the regulation of phenylpropanoid metabolism (Stracke et al., 2001). R2R3-
MYB proteins are characterised by two imperfectly repeated N-terminal MYB domains
each forming DNA-binding helix-helix-turn-helix structures. Outside of the R2R3 MYB
domain, the proteins are highly divergent except for short conserved amino acid
sequence motifs. These motifs, together with sequence homology within the MYB
144
domains, form the basis for their classification into different subgroups (Stracke et al.,
2001; Jiang et al., 2004b).
We previously showed that the stress induction of PAs in poplar leaves follows the
transcriptional activation of PA biosynthetic genes (Peters and Constabel, 2002;
Miranda et al., 2007) and therefore hypothesised that a TT2-like R2R3 MYB protein
regulates this process. MYB134 was also previously identified as a candidate PA
regulator that is consistently coregulated with PA biosynthetic genes (Mellway et al.,
2009). Constitutive expression of MYB134 in transgenic poplar resulted in a specific
activation of PA pathway genes, leading to a dramatic increase in PA concentrations,
suggesting that this gene is indeed a poplar PA regulator. Here, we show that
recombinant MYB134 protein binds to promoter regions of both early and late PA
pathway genes containing predicted MYB binding sites. These findings provide insight
into the regulatory mechanisms mediating stress-induced PA biosynthesis, and the PA-
modified poplar trees produced here represent a valuable tool for investigating the
functions of carbon-based allelochemicals in poplar.
A.3 Materials and Methods
A.3.1 EMSA
Recombinant MYB134 protein was produced in Escherichia coli using the coding
sequence cloned in-frame into the NdeI and BamHI sites of the pET15b vector
(Novagen). Recombinant MYB134 protein was produced, extracted, and affinity purified
as described previously for pine (Pinus spp.) MYB proteins (Patzlaff et al., 2003b).
EMSA conditions were exactly as described previously (Patzlaff et al., 2003b; Gomez-
Maldonado et al., 2004) except that recombinant MYB134 protein was used in place of
pine MYB protein.
145
A.4 Results and Discussion
A.4.1 MYB134 Binds to Promoter Regions of PA Biosynthetic Genes
Figure A.1. MYB134 binds to the promoters of putative downstream target genes. (a) Schematic representation of 1,000 bp of 5′ noncoding sequences for three putative MYB134 downstream target genes. + and − indicate the orientations of AC element-like motifs relative to the sense coding strand; numbers indicate the positions of these motifs relative to the putative transcriptional start. Arrows above each line indicate bHLH consensus sites (CANNTG), while arrows below each line indicate c-MYB consensus sites (CNGTTR). Light gray horizontal lines under the sequences correspond to the location of the DNA sequence used as the binding target in the EMSA conducted in B. (b) MYB134 binding to 5′ noncoding sequences of the three putative target genes as determined by EMSA. Recombinant MYB134 bound to all three 5′ noncoding sequences, as determined by a gel shift of the probe (arrows), which could be outcompeted with increasing quantities of unlabeled DNA corresponding to a canonical R2R3 MYB-binding site, known as an AC element motif (AC; 5′-ATTGTTCTTCCTGGGGTGACCGTCCACCTACGCTAAAAGCCGTCGCGGGATAAGCCTGTCTG-3′). C, MYB134 binding to the AC-rich canonical R2R3 MYB-binding site motif as determined by EMSA. Binding of recombinant MYB134 to radiolabeled AC can be outcompeted by cold competitor AC (left) but not by the nonspecific competitor poly(dIdC).
147
(encoding dihydroflavonol reductase) promoter sequence that is bound by maize C1
and the maize P protein, an R2R3-MYB protein that regulates the biosynthesis 3-deoxy
flavonoids and phlobaphenes (Fig. A.1a)(Sainz et al., 1997). Within the 180-bp regions
analyzed, poplar DFR1 and ANR2 both contain motifs that are quite similar to the AC
elements defined by (Hatton et al., 1995) in the tobacco PAL2 promoter (GCCTACC
and ACCTACA, respectively)(Fig. A.1a). EMSA experiments showed that the
recombinant MYB134 protein specifically bound the 180-bp upstream regulatory
sequences (Fig. A.1b). Two shifted bands were observed for the PAL1 and ANR2 180-
bp probes, while only one was seen with the DFR1 probe (Fig. A.1b). It is possible that
the MYB134 protein binds both of the overlapping AC elements in the PAL1 promoter
and both the AC element-like sequence and the c-MYB-binding site in the ANR2
promoter. A sequence containing a canonical AC element was an effective competitor
and eliminated MYB134 binding (Fig. A.1b), and recombinant MYB134 also bound to
this element in a specific manner (Fig. A.1c). Thus, MYB134 appears to bind to the
gene regulatory regions of putative target genes in an AC motif-dependent fashion. Our
work indicates that high sequence similarity to TT2 can be used to link MYB gene
function to PA pathway regulation.
In silico analysis has shown that the promoter regions of the poplar flavonoid and PA
biosynthetic genes contain cis elements matching the consensus sequences recognised
by phenylpropanoid regulatory R2R3-MYB proteins (Tsai et al., 2006). MYB134 was
shown to bind to promoter fragments containing motifs similar to the AC elements found
in a wide variety of phenylpropanoid biosynthetic gene promoters (Fig. A.1b). MYB134
was also shown to bind to a DNA sequence containing a canonical AC element
(ACCTAC; Fig. A.1c). These results suggest that such motifs are bound by MYB134 in
vivo, although these results do not rule out the involvement of other putative MYB
binding sites, such as the animal c-MYB recognition site found in the ANR2 promoter.
AC element-like motifs are present within the 2-kb 5′ noncoding sequence of most
poplar flavonoid genes (Tsai et al., 2006). Given that AC elements are widely
distributed in the regulatory regions not just of PA biosynthetic genes but of genes
involved in other branches of flavonoid and phenylpropanoid metabolism, interactions
with cofactors such as bHLH domain proteins that require the presence of additional
148
binding sites likely contribute to the specific activation of different branch pathways
(Hartmann et al., 2005). Consistent with specific bHLH cofactor binding sites
contributing to MYB134 target gene specificity, putative bHLH-binding sites are present
in all poplar PA pathway genes (R.D. Mellway and C.P. Constabel, unpublished data).
In activating the full suite of early and late flavonoid as well as PA biosynthetic genes,
MYB134 differs from Arabidopsis thaliana TT2, which regulates a more limited set of
late PA structural genes (Nesi et al., 2001; Sharma and Dixon, 2005). A wider target
gene set for MYB134, in conjunction with the natural constitutive PA production in a
wider range of poplar tissues, may account for the different effects of TT2
overexpression in Arabidopsis thaliana compared with MYB134 overexpression in
poplar. Unlike poplar, Arabidopsis thaliana produces PAs only in the seed testa, and
ectopic expression of TT2 does not result in plant-wide PA accumulation (Nesi et al.,
2001). A more detailed elucidation of how the pathway is regulated will require
functional characterization of the members of both MYB gene families as well as
identification and analysis of the additional interacting proteins such as the bHLH and
WDR proteins.
A.5 Conclusion
The extensive genomics resources combined with the complexity and biological
importance of phenylpropanoid metabolism in poplar make it a useful system for
investigating this pathway. In this report, we describe work identifying a gene encoding
an R2R3-MYB transcription factor, PtMYB134, which appears to play an important role
in controlling PA biosynthesis. PtMYB134 was shown to bind to the 5‘ non-coding
regulatory regions of both early and late PA biosynthetic genes: PAL1, DFR1 and
ANR2. AC elements were identified within the targets promoter regions and this
consensus motif functions as a bona fide target for MYB134 binding as determined by
an electrophoretic mobility shift assay. Identifying transcriptional regulators of
biosynthetic pathway genes is an important goal for metabolic engineering of secondary
metabolism in plants, and the identification of a putative regulator of PA metabolism in
poplar may permit new experimental approaches for evaluating the biological functions
of PAs.
149
A.6 Acknowledgements
This work was generously supported by a Natural Science and Engineering Research
Council of Canada (NSERC) Canadian Graduate Scholarship (CGSD) awarded to MP,
and by funding from the University of Toronto and NSERC to MMC.
150
B Study Labels
Study Label SALK Line Mutant Label
A SALK_112391C
C SALK_134409C
E SALK_143514C
G SALK_050658 rmx1
I SALK_082219C rmx2
J SALK_046986 rmx3
K SALK_129409C
L SALK_047892C
M SALK_150941C
N SALK_147133
O SALK_109533C rmx4
P SALK_047550C rmx5
Q SALK_125978
R SALK_009225C
S SALK_032344C rmx6
T SALK_031449C
U SALK_036546C
V SALK_100844C
151
References
Ades, S.E., and Sauer, R.T. (1994). Differential DNA-binding specificity of the engrailed homeodomain: the role of residue 50. Biochemistry 33, 9187-9194.
Affolter, M., Percivalsmith, A., Muller, M., Leupin, W., and Gehring, W.J. (1990). DNA binding properties of the purified Antennapedia homeodomain. Proc. Natl. Acad. Sci. U. S. A. 87, 4093-4097.
Alabadi, D., Oyama, T., Yanovsky, M.J., Harmon, F.G., Mas, P., and Kay, S.A. (2001). Reciprocal regulation between TOC1 and LHY/CCA1 within the Arabidopsis circadian clock. Science 293, 880-883.
Alonso, J.M., Stepanova, A.N., Leisse, T.J., Kim, C.J., Chen, H.M., Shinn, P., Stevenson, D.K., Zimmerman, J., Barajas, P., Cheuk, R., Gadrinab, C., Heller, C., Jeske, A., Koesema, E., Meyers, C.C., Parker, H., Prednis, L., Ansari, Y., Choy, N., Deen, H., Geralt, M., Hazari, N., Hom, E., Karnes, M., Mulholland, C., Ndubaku, R., Schmidt, I., Guzman, P., Aguilar-Henonin, L., Schmid, M., Weigel, D., Carter, D.E., Marchand, T., Risseeuw, E., Brogden, D., Zeko, A., Crosby, W.L., Berry, C.C., and Ecker, J.R. (2003). Genome-wide Insertional mutagenesis of Arabidopsis thaliana. Science 301, 653-657.
Anton, I.A., and Frampton, J. (1988). Tryptophans in myb proteins. Nature 336, 719-719.
Arabidopsis Genome, I. (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796-815.
Arenas-Huertero, F., Arroyo, A., Zhou, L., Sheen, J., and Leon, P. (2000). Analysis of Arabidopsis glucose insensitive mutants, gin5 and gin6, reveals a central role of the plant hormone ABA in the regulation of plant vegetative development by sugar. Genes Dev. 14, 2085-2096.
Avila, J., Nieto, C., Canas, L., Benito, M.J., and Pazares, J. (1993). Petunia hybrida genes related to the maize regulatory C1 gene and to animal myb proto-oncogenes. Plant J. 3, 553-562.
Aya, K., Ueguchi-Tanaka, M., Kondo, M., Hamada, K., Yano, K., Nishimura, M., and Matsuoka, M. (2009). Gibberellin Modulates Anther Development in Rice via the Transcriptional Regulation of GAMYB. Plant Cell 21, 1453-1472.
Ayres, M.P., Clausen, T.P., MacLean, S.F., Redman, A.M., and Reichardt, P.B. (1997). Diversity of structure and antiherbivore activity in condensed tannins. Ecology 78, 1696-1712.
(2009). Diversity and Complexity in DNA Recognition by Transcription Factors. Science 324, 1720-1723.
Bailey, J.K., Deckert, R., Schweitzer, J.A., Rehill, B.J., Lindroth, R.L., Gehring, C., and Whitham, T.G. (2005). Host plant genetics affect hidden ecological players: links among Populus, condensed tannins, and fungal endophyte infection. Canadian Journal of Botany-Revue Canadienne De Botanique 83, 356-361.
Bailey, T.L., Williams, N., Misleh, C., and Li, W.W. (2006). MEME: discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res. 34, W369-W373.
Baranowskij, N., Frohberg, C., Prat, S., and Willmitzer, L. (1994). A novel DNA binding protein with homology to Myb oncoproteins containing only one repeat can function as a transcriptional activator. Embo J. 13, 5383-5392.
Barbulescu, K., Geserick, C., Schuttke, I., Schleuning, W.D., and Haendler, B. (2001). New androgen response elements in the murine Pem promoter mediate selective transactivation. Mol. Endocrinol. 15, 1803-1816.
Baudry, A., Heim, M.A., Dubreucq, B., Caboche, M., Weisshaar, B., and Lepiniec, L. (2004). TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant J. 39, 366-380.
Beall, E.L., Manak, J.R., Zhou, S., Bell, M., Lipsick, J.S., and Botchan, M.R. (2002). Role for a Drosophila Myb-containing protein complex in site-specific DNA replication. Nature 420, 833-837.
BellLelong, D.A., Cusumano, J.C., Meyer, K., and Chapple, C. (1997). Cinnamate-4-hydroxylase expression in Arabidopsis - Regulation in response to development and the environment. Plant Physiol. 113, 729-738.
Berge, T., Matre, V., Brendeford, E.M., Saether, T., Luscher, B., and Gabrielsen, O.S. (2007). Revisiting a selection of target genes for the hematopoietic transcription factor c-Myb using chromatin immunoprecipitation and c-Myb knockdown. Blood Cells Mol. Dis. 39, 278-286.
Berger, M.F., Philippakis, A.A., Qureshi, A.M., He, F.X.S., Estep, P.W., and Bulyk, M.L. (2006). Compact, universal DNA microarrays to comprehensively determine transcription-factor binding site specificities. Nat. Biotechnol. 24, 1429-1435.
Bergholtz, S., Andersen, T.O., Andersson, K.B., Borrebaek, J., Luscher, B., and Gabrielsen, O.S. (2001). The highly conserved DNA-binding domains of A-, B- and c-Myb differ with respect to DNA-binding, phosphorylation and redox properties. Nucleic Acids Res. 29, 3546-3556.
Bianchi, A., Smith, S., Chong, L., Elias, P., and deLange, T. (1997). TRF1 is a dimer and bends telomeric DNA. Embo J. 16, 1785-1794.
Bilaud, T., Koering, C.E., BinetBrasselet, E., Ancelin, K., Pollice, A., Gasser, S.M., and Gilson, E. (1996). The telobox, a Myb-related telomeric DNA binding motif found in proteins from yeast, plants and human. Nucleic Acids Res. 24, 1294-1303.
Borg, M., Brownfield, L., Khatab, H., Sidorova, A., Lingaya, M., and Twell, D. (2011). The R2R3 MYB Transcription Factor DUO1 Activates a Male Germline-Specific Regulon Essential for Sperm Cell Differentiation in Arabidopsis. Plant Cell 23, 534-549.
Boyes, D.C., Zayed, A.M., Ascenzi, R., McCaskill, A.J., Hoffman, N.E., Davis, K.R., and Gorlach, J. (2001). Growth stage-based phenotypic analysis of arabidopsis: A model for high throughput functional genomics in plants. Plant Cell 13, 1499-1510.
Braun, E.L., and Grotewold, E. (1999). Newly discovered plant c-myb-like genes rewrite the evolution of the plant myb gene family. Plant Physiol. 121, 21-24.
Brown, D.M., Zeef, L.A.H., Ellis, J., Goodacre, R., and Turner, S.R. (2005). Identification of novel genes in Arabidopsis involved in secondary cell wall formation using expression profiling and reverse genetics. Plant Cell 17, 2281-2295.
Bruhat, A., Tourmente, S., Chapel, S., Sobrier, M.L., Couderc, J.L., and Dastugue, B. (1990). Regulatory elements in the 1st-intron contribute to transcriptional regulation of the beta-3 tubulin gene by 20-hydroxyecdysone in Drosophila kc-cells. Nucleic Acids Res. 18, 2861-2867.
Bulow, L., Brill, Y., and Hehl, R. (2010). AthaMap-assisted transcription factor target gene identification in Arabidopsis thaliana. Database-the Journal of Biological Databases and Curation.
Bulow, L., Engelmann, S., Schindler, M., and Hehl, R. (2009). AthaMap, integrating transcriptional and post-transcriptional data. Nucleic Acids Res. 37, D983-D986.
Busch, M.A., Bomblies, K., and Weigel, D. (1999). Activation of a floral homeotic gene in Arabidopsis. Science 285, 585-587.
Carmel, L., Wolf, Y.I., Rogozin, I.B., and Koonin, E.V. (2007). Three distinct modes of intron dynamics in the evolution of eukaryotes. Genome Res. 17, 1034-1044.
Carra, J.H., and Privalov, P.L. (1997). Energetics of folding and DNA binding of the MAT alpha 2 homeodomain. Biochemistry 36, 526-535.
154
Carre, I.A., and Kay, S.A. (1995). Multiple DNA-protein complexes at a circadian-regulated promoter element. Plant Cell 7, 2039-2051.
Chaffey, N., Cholewa, E., Regan, S., and Sundberg, B. (2002). Secondary xylem development in Arabidopsis: a model for wood formation. Physiologia Plantarum 114, 594-600.
Chen, C.M., Wang, C.T., and Ho, C.H. (2001). A plant gene encoding a Myb-like protein that binds telomeric GGTTTAG repeats in vitro. J. Biol. Chem. 276, 16511-16519.
Chen, P.W., Chiang, C.M., Tseng, T.H., and Yu, S.M. (2006). Interaction between rice MYBGA and the gibberellin response element controls tissue-specific sugar sensitivity of alpha-amylase genes. Plant Cell 18, 2326-2340.
Chiou, T.J., and Bush, D.R. (1998). Sucrose is a signal molecule in assimilate partitioning. Proc. Natl. Acad. Sci. U. S. A. 95, 4784-4788.
Colladovides, J., Magasanik, B., and Gralla, J.D. (1991). Control site location and transcriptional regulation in Escherichia coli. Microbiol. Rev. 55, 371-394.
Collins, T.J. (2007). ImageJ for microscopy. Biotechniques 43, 25-+.
Cosma, M.P., Tanaka, T.U., and Nasmyth, K. (1999). Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter. Cell 97, 299-311.
Coupe, S.A., Palmer, B.G., Lake, J.A., Overy, S.A., Oxborough, K., Woodward, F.I., Gray, J.E., and Quick, W.P. (2006). Systemic signalling of environmental cues in Arabidopsis leaves. J. Exp. Bot. 57, 329-341.
Court, R., Chapman, L., Fairall, L., and Rhodes, D. (2005). How the human telomeric proteins TRF1 and TRF2 recognize telomeric DNA: a view from high-resolution crystal structures. EMBO Rep. 6, 39-45.
Davies, K.M., and Schwinn, K.E. (2003). Transcriptional regulation of secondary metabolism. Functional Plant Biology 30, 913-925.
Debeaujon, I., Nesi, N., Perez, P., Devic, M., Grandjean, O., Caboche, M., and Lepiniec, L. (2003). Proanthocyanidin-accumulating cells in Arabidopsis testa: Regulation of differentiation and role in seed development. Plant Cell 15, 2514-2531.
Dekkers, B.J.W., Schuurmans, J., and Smeekens, S.C.M. (2004). Glucose delays seed germination in Arabidopsis thaliana. Planta 218, 579-588.
DeLano, W.L. (2002). The PyMOL Molecular Graphics System DeLano Scientific. http://www.pymol.org.
Deyholos, M.K., and Sieburth, L.E. (2000). Separable whorl-specific expression and negative regulation by enhancer elements within the AGAMOUS second intron. Plant Cell 12, 1799-1810.
Dias, A.P., Braun, E.L., McMullen, M.D., and Grotewold, E. (2003). Recently duplicated maize R2R3 Myb genes provide evidence for distinct mechanisms of evolutionary divergence after duplication. Plant Physiol. 131, 610-620.
Dill, A., and Sun, T.P. (2001). Synergistic derepression of gibberellin signaling by removing RGA and GAI function in Arabidopsis thaliana. Genetics 159, 777-785.
Do, C.-T., Pollet, B., Thevenin, J., Sibout, R., Denoue, D., Barriere, Y., Lapierre, C., and Jouanin, L. (2007). Both caffeoyl Coenzyme A 3-O-methyltransferase 1 and caffeic acid O-methyltransferase 1 are involved in redundant functions for lignin, flavonoids and sinapoyl malate biosynthesis in Arabidopsis. Planta 226, 1117-1129.
Dooley, S., Seib, T., Welter, C., and Blin, N. (1996). c-myb Intron I protein binding and association with transcriptional activity in leukemic cells. Leuk. Res. 20, 429-439.
Dubos, C., Willment, J., Huggins, D., Grant, G.H., and Campbell, M.M. (2005). Kanamycin reveals the role played by glutamate receptors in shaping plant resource allocation. Plant J. 43, 348-355.
Dubos, C., Stracke, R., Grotewold, E., Weisshaar, B., Martin, C., and Lepiniec, L. (2010). MYB transcription factors in Arabidopsis. Trends Plant Sci. 15, 573-581.
Ebneth, A., Schweers, O., Thole, H., Fagin, U., Urbanke, C., Maass, G., and Wolfes, H. (1994). Biophysical characterization of the c-Myb DNA-binding domain. Biochemistry 33, 14586-14593.
Ehrenkaufer, G.M., Hackney, J.A., and Singh, U. (2009). A developmentally regulated Myb domain protein regulates expression of a subset of stage-specific genes in Entamoeba histolytica. Cell Microbiol. 11, 898-910.
Fairall, L., Schwabe, J.W.R., Chapman, L., Finch, J.T., and Rhodes, D. (1993). The crystal structure of a two zinc-finger peptide reveals an extension to the rules for zinc-finger/DNA recognition. Nature 366, 483-487.
Feldbrugge, M., Sprenger, M., Hahlbrock, K., and Weisshaar, B. (1997). PcMYB1, a novel plant protein containing a DNA-binding domain with one MYB repeat, interacts in vivo with a light-regulatory promoter unit. Plant J. 11, 1079-1093.
156
Fiume, E., Christou, P., Giani, S., and Breviario, D. (2004). Introns are key regulatory elements of rice tubulin expression. Planta 218, 693-703.
Florence, B., Handrow, R., and Laughon, A. (1991). DNA-binding specificity of the fushi tarazu homeodomain. Mol. Cell. Biol. 11, 3613-3623.
Fornale, S., Shi, X.H., Chai, C.L., Encina, A., Irar, S., Capellades, M., Fuguet, E., Torres, J.L., Rovira, P., Puigdomenech, P., Rigau, J., Grotewold, E., Gray, J., and Caparros-Ruiz, D. (2010). ZmMYB31 directly represses maize lignin genes and redirects the phenylpropanoid metabolic flux. Plant J. 64, 633-644.
Frampton, J., Gibson, T.J., Ness, S.A., Doderlein, G., and Graf, T. (1991). Proposed structure for the DNA-binding domain of the Myb oncoprotein based on model building and mutational analysis. Protein Eng. 4, 891-901.
Fu, D.L., Szucs, P., Yan, L.L., Helguera, M., Skinner, J.S., von Zitzewitz, J., Hayes, P.M., and Dubcovsky, J. (2005). Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat. Mol. Genet. Genomics 273, 54-65.
Fukuzawa, M., Zhukovskaya, N.V., Yamada, Y., Araki, T., and Williams, J.G. (2006). Regulation of Dictyostelium prestalk-specific gene expression by a SHAQKY family MYB transcription factor. Development 133, 1715-1724.
Galis, I., Simek, P., Narisawa, T., Sasaki, M., Horiguchi, T., Fukuda, H., and Matsuoka, K. (2006). A novel R2R3 MYB transcription factor NtMYBJS1 is a methyl jasmonate-dependent regulator of phenylpropanoid-conjugate biosynthesis in tobacco. Plant J. 46, 573-592.
Gallagher, S.R. (1992). GUS protocols : using the GUS gene as a reporter of gene expression. (San Diego ; London: Academic Press).
Galuschka, C., Schindler, M., Bulow, L., and Hehl, R. (2007). AthaMap web tools for the analysis and identification of co-regulated genes. Nucleic Acids Res. 35, D857-D862.
Gaudet, J., and Mango, S.E. (2002). Regulation of organogenesis by the Caenorhabditis elegans, FoxA protein PHA-41. Science 295, 821-825.
Gaudet, J., Muttumu, S., Horner, M., and Mango, S.E. (2004). Whole-genome analysis of temporal gene expression during foregut development. PLoS. Biol. 2, 1828-1842.
Georlette, D., Ahn, S., MacAlpine, D.M., Cheung, E., Lewis, P.W., Beall, E.L., Bell, S.P., Speed, T., Manak, J.R., and Botchan, M.R. (2007). Genomic profiling and expression studies reveal both positive and negative activities for the Drosophila Myb-MuvB/dREAM complex in proliferating cells. Genes Dev. 21, 2880-2896.
157
Gertz, J., Riles, L., Turnbaugh, P., Ho, S.W., and Cohen, B.A. (2005). Discovery, validation, and genetic dissection of transcription factor binding sites by comparative and functional genomics. Genome Res. 15, 1145-1152.
Gewirtz, A.M., and Calabretta, B. (1988). A c-myb antisense oligodeoxynucleotide inhibits normal human hematopoiesis in vitro. Science 242, 1303-1306.
Gibon, Y., Pyl, E.-T., Sulpice, R., Lunn, J.E., Hoehne, M., Guenther, M., and Stitt, M. (2009). Adjustment of growth, starch turnover, protein content and central metabolism to a decrease of the carbon supply when Arabidopsis is grown in very short photoperiods. Plant Cell and Environment 32, 859-874.
Gibson, S.I. (2000). Plant sugar-response pathways. Part of a complex regulatory web. Plant Physiol. 124, 1532-1539.
Gibson, S.I. (2005). Control of plant development and gene expression by sugar signaling. Curr. Opin. Plant Biol. 8, 93-102.
Glover, B.J., Perez-Rodriguez, M., and Martin, C. (1998). Development of several epidermal cell types can be specified by the same MYB-related plant transcription factor. Development 125, 3497-3508.
Godoy, M., Franco-Zorrilla, J.M., Pérez-Pérez, J., Oliveros, J.C., Lorenzo, Ó., and Solano, R. (2011). Improved protein-binding microarrays for the identification of DNA-binding specificities of transcription factors. The Plant Journal 66, 700-711.
Goicoechea, M., Lacombe, E., Legay, S., Mihaljevic, S., Rech, P., Jauneau, A., Lapierre, C., Pollet, B., Verhaegen, D., Chaubet-Gigot, N., and Grima-Pettenati, J. (2005). EgMYB2, a new transcriptional activator from Eucalyptus xylem, regulates secondary cell wall formation and lignin biosynthesis. Plant J. 43, 553-567.
Golay, J., Capucci, A., Arsura, M., Castellano, M., Rizzo, V., and Introna, M. (1991). Expression of c-myb and B-myb, but not A-myb, correlates with proliferation in human hematopoietic cells. Blood 77, 149-158.
Gomez-Maldonado, J., Avila, C., de la Torre, F., Canas, R., Canovas, F.M., and Campbell, M.M. (2004). Functional interactions between a glutamine synthetase promoter and MYB proteins. Plant J. 39, 513-526.
Gong, W., He, K., Covington, M., Dinesh-Kumar, S.P., Snyder, M., Harmer, S.L., Zhu, Y.X., and Deng, X.W. (2008). The development of protein microarrays and their applications in DNA-protein and protein-protein interaction analyses of Arabidopsis transcription factors. Mol. Plant. 1, 27-41.
Graesser, F.A., Lamontagne, K., Whittaker, L., Stohr, S., and Lipsick, J.S. (1992). A highly conserved cysteine in the v-Myb DNA-binding domain is essential for transformation and transcriptional trans-activation. Oncogene 7, 1005-1009.
158
Graf, A., Schlereth, A., Stitt, M., and Smith, A.M. (2010). Circadian control of carbohydrate availability for growth in Arabidopsis plants at night. Proc. Natl. Acad. Sci. U. S. A. 107, 9458-9463.
Grotewold, E., Drummond, B.J., Bowen, B., and Peterson, T. (1994). The myb-homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene subset. Cell 76, 543-553.
Grove, C.A., De Masi, F., Barrasa, M.I., Newburger, D.E., Alkema, M.J., Bulyk, M.L., and Walhout, A.J.M. (2009). A Multiparameter Network Reveals Extensive Divergence between C. elegans bHLH Transcription Factors. Cell 138, 314-327.
Gubler, F., Kalla, R., Roberts, J.K., and Jacobsen, J.V. (1995). Gibberellin-regulated expression of a myb gene in barley aleurone cells: evidence for Myb transactivation of a high-pI alpha-amylase gene promoter. Plant Cell 7, 1879-1891.
Guehmann, S., Vorbrueggen, G., Kalkbrenner, F., and Moelling, K. (1992). Reduction of a conserved Cys is essential for Myb DNA-binding. Nucleic Acids Res. 20, 2279-2286.
Halford, N.G., and Paul, M.J. (2003). Carbon metabolite sensing and signalling. Plant Biotechnology Journal 1, 381-398.
Hall, K.B., and Kranz, J.K. . (2008). Nitrocellulose Filter Binding for Determination of Dissociation Constants. In RNA Protein Interaction Protocols Humana Press, 105-114.
HannaRose, W., and Hansen, U. (1996). Active repression mechanisms of eukaryotic transcription repressors. Trends Genet. 12, 229-234.
Hanson, J., and Smeekens, S. (2009). Sugar perception and signaling - an update. Curr. Opin. Plant Biol. 12, 562-567.
Hara, Y., Onishi, Y., Oishi, K., Miyazaki, K., Fukamizu, A., and Ishida, N. (2009). Molecular characterization of Mybbp1a as a co-repressor on the Period2 promoter. Nucleic Acids Res. 37, 1115-1126.
Haritatos, E., Medville, R., and Turgeon, R. (2000). Minor vein structure and sugar transport in Arabidopsis thaliana. Planta 211, 105-111.
Harlow, E., and Lane, D. . (1988). Antibodies: A Laboratory Manual. Cold Spring Harbor NY. Cold Spring Harbor Laboratory Press.
159
Hartmann, U., Sagasser, M., Mehrtens, F., Stracke, R., and Weisshaar, B. (2005). Differential combinatorial interactions of cis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes. Plant Mol.Biol. 57, 155-171.
Hatton, D., Sablowski, R., Yung, M.H., Smith, C., Schuch, W., and Bevan, M. (1995). 2 Classes of cis sequences contribute to tissue-specific expression of a PAL2 promtoer in transgenic tobacco. Plant J. 7, 859-876.
Hauffe, K.D., Lee, S.P., Subramaniam, R., and Douglas, C.J. (1993). Combinatorial interactions between positive and negative cis-acting elements control spatial patterns of 4CL-1 expression in transgenic tobacco Plant J. 4, 235-253.
Hebsgaard, S.M., Korning, P.G., Tolstrup, N., Engelbrecht, J., Rouze, P., and Brunak, S. (1996). Splice site prediction in Arabidopsis thaliana pre-mRNA by combining local and global sequence information. Nucleic Acids Res. 24, 3439-3452.
Heine, G.F., Hernandez, J.M., and Grotewold, E. (2004). Two cysteines in plant R2R3 MYB domains participate in REDOX-dependent DNA binding. J. Biol. Chem. 279, 37878-37885.
Heine, G.F., Malik, V., Dias, A.P., and Grotewold, E. (2007). Expression and molecular characterization of ZmMYB-IF35 and related R2R3-MYB transcription factors. Mol. Biotechnol. 37, 155-164.
Hemming, J.D.C., and Lindroth, R.L. (1995). Intraspecific variation in aspen phytochemistry - effects on performance of gypsy moths and forest tent caterpillars. Oecologia 103, 79-88.
Hemming, J.D.C., and Lindroth, R.L. (1999). Effects of light and nutrient availability on aspen: Growth, phytochemistry, and insect performance. Journal of Chemical Ecology 25, 1687-1714.
Hernandez, J.M., Heine, G.F., Irani, N.G., Feller, A., Kim, M.G., Matulnik, T., Chandler, V.L., and Grotewold, E. (2004). Different mechanisms participate in the R-dependent activity of the R2R3 MYB transcription factor C1. J. Biol. Chem. 279, 48205-48213.
Hetherington, A.M., and Woodward, F.I. (2003). The role of stomata in sensing and driving environmental change. Nature 424, 901-908.
Hewel, J.A., Liu, J.A., Onishi, K., Fong, V., Chandran, S., Olsen, J.B., Pogoutse, O., Schutkowski, M., Wenschuh, H., Winkler, D.F.H., Eckler, L., Zandstra, P.W., and Emili, A. (2010). Synthetic Peptide Arrays for Pathway-Level Protein Monitoring by Liquid ChromatographyTandem Mass Spectrometry. Mol. Cell. Proteomics 9, 2460-2473.
160
Higo, K., Ugawa, Y., Iwamoto, M., and Higo, H. (1998). PLACE: a database of plant cis-acting regulatory DNA elements. Nucleic Acids Res. 26, 358-359.
Hirayama, T., and Shinozaki, K. (1996). A cdc5(+) homolog of a higher plant, Arabidopsis thaliana. Proc. Natl. Acad. Sci. U. S. A. 93, 13371-13376.
Hoeren, F.U., Dolferus, R., Wu, Y.R., Peacock, W.J., and Dennis, E.S. (1998). Evidence for a role for AtMYB2 in the induction of the Arabidopsis alcohol dehydrogenase gene (ADH1) by low oxygen. Genetics 149, 479-490.
Holm, L., and Park, J. (2000). DaliLite workbench for protein structure comparison. Bioinformatics 16, 566-567.
Howe, K.M., and Watson, R.J. (1991). Nucleotide preferences in sequence-specific recognition of DNA by c-myb protein. Nucleic Acids Res. 19, 3913-3919.
Howe, K.M., Reakes, C.F.L., and Watson, R.J. (1990). Characterization of the sequence-specific interaction of mouse c-myb protein with DNA. Embo J. 9, 161-169.
Huang, R.P. (2003). Protein arrays, an excellent tool in biomedical research. Front. Biosci. 8, D559-D576.
Huang, Y.C., Su, L.H., Lee, G.A., Chiu, P.W., Cho, C.C., Wu, J.Y., and Sun, C.H. (2008). Regulation of Cyst Wall Protein Promoters by Myb2 in Giardia lamblia. J. Biol. Chem. 283, 31021-31029.
Hwang, M.G., Chung, I.K., Kang, B.G., and Cho, M.H. (2001). Sequence-specific binding property of Arabidopsis thaliana telomeric DNA binding protein 1 (AtTBP1). FEBS Lett. 503, 35-40.
Ito, M. (2005). Conservation and diversification of three-repeat Myb transcription factors in plants. J. Plant Res. 118, 61-69.
Ito, M., Iwase, M., Kodama, H., Lavisse, P., Komamine, A., Nishihama, R., Machida, Y., and Watanabe, A. (1998). A novel cis-acting element in promoters of plant B-type cyclin genes activates M phase-specific transcription. Plant Cell 10, 331-341.
Ito, M., Araki, S., Matsunaga, S., Itoh, T., Nishihama, R., Machida, Y., Doonan, J.H., and Watanabe, A. (2001). G2/M-phase-specific transcription during the plant cell cycle is mediated by c-Myb-like transcription factors. Plant Cell 13, 1891-1905.
Jackson, J., Ramsay, G., Sharkov, N.V., Lium, E., and Katzen, A.L. (2001). The role of transcriptional activation in the function of the Drosophila myb gene. Blood Cells Mol. Dis. 27, 446-455.
Jang, J.C., Leon, P., Zhou, L., and Sheen, J. (1997). Hexokinase as a sugar sensor in higher plants. Plant Cell 9, 5-19.
161
Jia, L., Clegg, M.T., and Jiang, T. (2004). Evolutionary dynamics of the DNA-binding domains in putative R2R3-MYB genes identified from rice subspecies indica and japonica genomes. Plant Physiol. 134, 575-585.
Jiang, C.H., Gu, J.Y., Chopra, S., Gu, X., and Peterson, T. (2004a). Ordered origin of the typical two- and three-repeat Myb genes. Gene 326, 13-22.
Jiang, C.Z., Gu, X., and Peterson, T. (2004b). Identification of conserved gene structures and carboxy-terminal motifs in the Myb gene family of Arabidopsis and Oryza sativa L. ssp indica. Genome Biol. 5, 11.
Jin, H.L., and Martin, C. (1999). Multifunctionality and diversity within the plant MYB-gene family. Plant Mol.Biol. 41, 577-585.
Jin, H.L., Cominelli, E., Bailey, P., Parr, A., Mehrtens, F., Jones, J., Tonelli, C., Weisshaar, B., and Martin, C. (2000). Transcriptional repression by AtMYB4 controls production of UV-protecting sunscreens in Arabidopsis. Embo J. 19, 6150-6161.
Joos, H.J., and Hahlbrock, K. (1992). Phenylalanine ammonia-lyase in potato (Solanum-tuberosum L) - genomic complexity, structural comparison of 2 selected genes and modes of expression Eur. J. Biochem. 204, 621-629.
Kapranov, P., Routt, S.M., Bankaitis, V.A., de Bruijn, F.J., and Szczyglowski, K. (2001). Nodule-specific regulation of phosphatidylinositol transfer protein expression in Lotus japonicus. Plant Cell 13, 1369-1382.
Katoh, K., Kuma, K., Toh, H., and Miyata, T. (2005). MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 33, 511-518.
Kaul, S., Koo, H.L., Jenkins, J., Rizzo, M., Rooney, T., Tallon, L.J., Feldblyum, T., Nierman, W., Benito, M.I., Lin, X.Y., Town, C.D., Venter, J.C., Fraser, C.M., Tabata, S., Nakamura, Y., Kaneko, T., Sato, S., Asamizu, E., Kato, T., Kotani, H., Sasamoto, S., Ecker, J.R., Theologis, A., Federspiel, N.A., Palm, C.J., Osborne, B.I., Shinn, P., Conway, A.B., Vysotskaia, V.S., Dewar, K., Conn, L., Lenz, C.A., Kim, C.J., Hansen, N.F., Liu, S.X., Buehler, E., Altafi, H., Sakano, H., Dunn, P., Lam, B., Pham, P.K., Chao, Q., Nguyen, M., Yu, G.X., Chen, H.M., Southwick, A., Lee, J.M., Miranda, M., Toriumi, M.J., Davis, R.W., Wambutt, R., Murphy, G., Dusterhoft, A., Stiekema, W., Pohl, T., Entian, K.D., Terryn, N., Volckaert, G., Salanoubat, M., Choisne, N., Rieger, M., Ansorge, W., Unseld, M., Fartmann, B., Valle, G., Artiguenave, F., Weissenbach, J., Quetier, F., Wilson, R.K., de la Bastide, M., Sekhon, M., Huang, E., Spiegel, L., Gnoj, L., Pepin, K., Murray, J., Johnson, D., Habermann, K., Dedhia, N., Parnell, L., Preston, R., Hillier, L., Chen, E., Marra, M., Martienssen, R., McCombie, W.R., Mayer, K., White, O., Bevan, M., Lemcke, K., Creasy, T.H., Bielke, C., Haas, B., Haase, D., Maiti, R., Rudd, S., Peterson, J., Schoof, H., Frishman, D., Morgenstern, B., Zaccaria, P., Ermolaeva, M., Pertea, M., Quackenbush, J., Volfovsky, N., Wu, D.Y., Lowe, T.M., Salzberg, S.L., Mewes, H.W., Rounsley, S., Bush, D., Subramaniam, S.,
162
Levin, I., Norris, S., Schmidt, R., Acarkan, A., Bancroft, I., Brennicke, A., Eisen, J.A., Bureau, T., Legault, B.A., Le, Q.H., Agrawal, N., Yu, Z., Copenhaver, G.P., Luo, S., Pikaard, C.S., Preuss, D., Paulsen, I.T., Sussman, M., Britt, A.B., Selinger, D.A., Pandey, R., Mount, D.W., Chandler, V.L., Jorgensen, R.A., Pikaard, C., Juergens, G., Meyerowitz, E.M., Dangl, J., Jones, J.D.G., Chen, M., Chory, J., and Somerville, M.C. (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796-815.
Kim, K.N., and Guiltinan, M.J. (1999). Identification of cis-acting elements important for expression of the starch-branching enzyme I gene in maize endosperm. Plant Physiol. 121, 225-236.
Kim, M.J., Lee, T.H., Pahk, Y.M., Kim, Y.H., Park, H.M., Choi, Y.D., Nahm, B.H., and Kim, Y.K. (2009). Quadruple 9-mer-based protein binding microarray with DsRed fusion protein. BMC Mol. Biol. 10, 11.
Kirik, V., Simon, M., Huelskamp, M., and Schiefelbein, J. (2004). The ENHANCER OF TRY AND CPCl gene acts redundantly with TRIPTYCHON and CAPRICE in trichome and root hair cell patterning in Arabidopsis. Dev. Biol. 268, 506-513.
Kislinger, T., Rahman, K., Radulovic, D., Cox, B., Rossant, J., and Emili, A. (2003). PRISM, a generic large scale proteomic investigation strategy for mammals. Mol. Cell. Proteomics 2, 96-106.
Klimczak, M., Kahl, W., and Grodzins.Z. (1972). Studies on phenolic acids, derivatives of cinnamic acid, in plants .1. phenolic acids in poplar (populus). Dissertationes Pharmaceuticae Et Pharmacologicae 24, 181-&.
Klug, A., and Schwabe, J.W.R. (1995). Protein motifs 5. Zinc fingers. Faseb J. 9, 597-604.
Ko, S., Yu, E.Y., Shin, J., Yoo, H.H., Tanaka, T., Kim, W.T., Cho, H.S., Lee, W., and Chung, I.K. (2009). Solution Structure of the DNA Binding Domain of Rice Telomere Binding Protein RTBP1. Biochemistry 48, 827-838.
Ko, S., Jun, S.H., Bae, H., Byun, J.S., Han, W., Park, H., Yang, S.W., Park, S.Y., Jeon, Y.H., Cheong, C., Kim, W.T., Lee, W., and Cho, H.S. (2008). Structure of the DNA-binding domain of NgTRF1 reveals unique features of plant telomere-binding proteins. Nucleic Acids Res. 36, 2739-2755.
Koch, K. (2004). Sucrose metabolism: regulatory mechanisms and pivotal roles in sugar sensing and plant development. Curr. Opin. Plant Biol. 7, 235-246.
Koch, K.E. (1996). Carbohydrate-modulated gene expression in plants. Annual Review of Plant Physiology and Plant Molecular Biology 47, 509-540.
163
Koering, C.E., Fourel, G., Binet-Brasselet, E., Laroche, T., Klein, F., and Gilson, E. (2000). Identification of high affinity Tbf1p-binding sites within the budding yeast genome. Nucleic Acids Res. 28, 2519-2526.
Konig, P., and Rhodes, D. (1997). Recognition of telomeric DNA. Trends Biochem.Sci. 22, 43-47.
Konig, P., Fairall, L., and Rhodes, D. (1998). Sequence-specific DNA recognition by the Myb-like domain of the human telomere binding protein TRF1: a model for the protein-DNA complex. Nucleic Acids Res. 26, 1731-1740.
Koshino-Kimura, Y., Wada, T., Tachibana, T., Tsugeki, R., Ishiguro, S., and Okada, K. (2005). Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis. Plant Cell Physiol. 46, 817-826.
Kranz, H., Scholz, K., and Weisshaar, B. (2000). c-MYB oncogene-like genes encoding three MYB repeats occur in all major plant lineages. Plant J. 21, 231-235.
Lacombe, E., Van Doorsselaere, J., Boerjan, W., Boudet, A.M., and Grima-Pettenati, J. (2000). Characterization of cis-elements required for vascular expression of the Cinnamoyl CoA Reductase gene and for protein-DNA complex formation. Plant J. 23, 663-676.
Lang, M., and Juan, E. (2010). Binding site number variation and high-affinity binding consensus of Myb-SANT-like transcription factor Adf-1 in Drosophilidae. Nucleic Acids Res. 38, 6404-6417.
Lascaris, R.F., Mager, W.H., and Planta, R.J. (1999). DNA-binding requirements of the yeast protein Rap1p as selected in silico from ribosomal protein gene promoter sequences. Bioinformatics 15, 267-277.
Lauvergeat, V., Rech, P., Jauneau, A., Guez, C., Coutos-Thevenot, P., and Grima-Pettenati, J. (2002). The vascular expression pattern directed by the Eucalyptus gunnii cinnamyl alcohol dehydrogenase EgCAD2 promoter is conserved among woody and herbaceous plant species. Plant Mol.Biol. 50, 497-509.
Le Hir, H., Nott, A., and Moore, M.J. (2003). How introns influence and enhance eukaryotic gene expression. Trends Biochem.Sci. 28, 215-220.
Lee, T.I., and Young, R.A. (2000). Transcription of eukaryotic protein-coding genes. Annual Review of Genetics 34, 77-137.
Legay, S., Lacombe, E., Goicoechea, M., Briere, C., Seguin, A., Mackay, J., and Grima-Pettenati, J. (2007). Molecular characterization of EgMYB1, a putative transcriptional repressor of the lignin biosynthetic pathway. Plant Sci. 173, 542-549.
164
Lepiniec, L., Debeaujon, I., Routaboul, J.-M., Baudry, A., Pourcel, L., Nesi, N., and Caboche, M. (2006). Genetics and biochemistry of seed flavonoids. In Annual Review of Plant Biology, pp. 405-430.
LeRoy, C.J., Whitham, T.G., Keim, P., and Marks, J.C. (2006). Plant genes link forests and streams. Ecology 87, 255-261.
Li, B.B., and de Lange, T. (2003). Rap1 affects the length and heterogeneity of human telomeres. Mol. Biol. Cell 14, 5060-5068.
Li, S.F., and Parish, R.W. (1995). Isolation of two novel myb-like genes from Arabidopsis and studies on the DNA-binding properties of their products. Plant J. 8, 963-972.
Liang, Y.-K., Xie, X., Lindsay, S.E., Wang, Y.B., Masle, J., Williamson, L., Leyser, O., and Hetherington, A.M. (2010). Cell wall composition contributes to the control of transpiration efficiency in Arabidopsis thaliana. Plant J. 64, 679-686.
Liang, Y.K., Dubos, C., Dodd, I.C., Holroyd, G.H., Hetherington, A.M., and Campbell, M.M. (2005). AtMYB61, an R2R3-MYB transcription factor controlling stomatal aperture in Arabidopsis thaliana. Curr. Biol. 15, 1201-1206.
Lieb, J.D., Liu, X.L., Botstein, D., and Brown, P.O. (2001). Promoter-specific binding of Rap1 revealed by genome-wide maps of protein-DNA association. Nature Genet. 28, 327-334.
Lindroth, R.L., and Hwang, S.Y. (1996). Diversity, redundancy, and multiplicity in chemical defense systems of aspen. In Phytochemical Diversity and Redundancy in Ecological Interactions, J.T. Romeo, J.A. Saunders, and P. Barbosa, eds, pp. 25-56.
Linger, B.R., and Price, C.M. (2009). Conservation of telomere protein complexes: shuffling through evolution. Crit. Rev. Biochem. Mol. Biol. 44, 434-446.
Linnell, J., Mott, R., Field, S., Kwiatkowski, D.P., Ragoussis, J., and Udalova, I.A. (2004). Quantitative high-throughput analysis of transcription factor binding specificities. Nucleic Acids Res. 32, 7.
Lipsick, J.S. (1996). One billion years of Myb. Oncogene 13, 223-235.
165
Lira, C.B.B., Neto, J.L.D., Khater, L., Cagliari, T.C., Peroni, L.A., dos Reis, J.R.R., Ramos, C.H.I., and Cano, M.I.N. (2007). LaTBP1: A Leishmania amazonensis DNA-binding protein that associates in vivo with telomeres and GT-rich DNA using a Myb-like domain. Arch. Biochem. Biophys. 465, 399-409.
Liu, G.Y., Ren, G., Guirgis, A., and Thornburg, R.W. (2009). The MYB305 Transcription Factor Regulates Expression of Nectarin Genes in the Ornamental Tobacco Floral Nectary. Plant Cell 21, 2672-2687.
Logemann, E., Parniske, M., and Hahlbrock, K. (1995). Modes of expression and common structural features of the complete phenylalanine ammonia-lyase gene family in parsley. Proc. Natl. Acad. Sci. U. S. A. 92, 5905-5909.
Lois, R., Dietrich, A., Hahlbrock, K., and Schulz, W. (1989). A phenylalanine ammonia-lyase gene from parsley - structure, regulation and identification of elicitor and light responsive cis-acting elements. Embo J. 8, 1641-1648.
Loreti, E., Alpi, A., and Perata, P. (2000). Glucose and disaccharide-sensing mechanisms modulate the expression of alpha-amylase in barley embryos. Plant Physiol. 123, 939-948.
Lu, C.A., Ho, T.H.D., Ho, S.L., and Yu, S.M. (2002). Three novel MYB proteins with one DNA binding repeat mediate sugar and hormone regulation of alpha-amylase gene expression. Plant Cell 14, 1963-1980.
Luscher, B., and Eisenman, R.N. (1990). New light on Myc and Myb. Part I. Myc. Genes Dev. 4, 2025-2035.
Ma, X.P., and Calabretta, B. (1994). DNA binding and transactivation activity of A-myb, a c-myb-related gene. Cancer Res. 54, 6512-6516.
Maeda, K., Kimura, S., Demura, T., Takeda, J., and Ozeki, Y. (2005). DcMYB1 acts as a transcriptional activator of the carrot phenylalanine ammonia-lyase gene (DcPAL1) in response to elicitor treatment, UV-B irradiation and the dilution effect. Plant Mol.Biol. 59, 739-752.
Maniatis, T., Goodbourn, S., and Fischer, J.A. (1987). Regulation of inducible and tissue-specific gene expression. Science 236, 1237-1245.
Mardis, E.R. (2007). ChIP-seq: welcome to the new frontier. Nat. Methods 4, 613-614.
Marian, C.O., Bordoli, S.J., Goltz, M., Santarella, R.A., Jackson, L.P., Danilevskaya, O., Beckstette, M., Meeley, R., and Bass, H.W. (2003). The maize Single myb histone 1 gene, Smh1, belongs to a novel gene family and encodes a protein that binds telomere DNA repeats in vitro. Plant Physiol. 133, 1336-1350.
Martin, C., and PazAres, J. (1997). MYB transcription factors in plants. Trends Genet. 13, 67-73.
166
Martin, C., Bhatt, K., Baumann, K., Jin, H., Zachgo, S., Roberts, K., Schwarz-Sommer, Z., Glover, B., and Perez-Rodrigues, M. (2002). The mechanics of cell fate determination in petals. Philos. Trans. R. Soc. Lond. Ser. B-Biol. Sci. 357, 809-813.
Massie, C.E., and Mills, I.G. (2008). ChIPping away at gene regulation. EMBO Rep. 9, 337-343.
Matsumoto, B. (2002). Cell biological applications of confocal microscopy. (San Diego ; London: Academic Press).
Maxwell, B.B., Andersson, C.R., Poole, D.S., Kay, S.A., and Chory, J. (2003). HY5, Circadian Clock-Associated 1, and a cis-element, DET1 dark response element, mediate DET1 regulation of chlorophyll a/b-binding protein 2 expression. Plant Physiol. 133, 1565-1577.
McDonnell, A.V., Jiang, T., Keating, A.E., and Berger, B. (2006). Paircoil2: improved prediction of coiled coils from sequence. Bioinformatics 22, 356-358.
Mehrtens, F., Kranz, H., Bednarek, P., and Weisshaar, B. (2005). The Arabidopsis transcription factor MYB12 is a flavonol-specific regulator of phenylpropanoid biosynthesis. Plant Physiol. 138, 1083-1096.
Meijsing, S.H., Pufall, M.A., So, A.Y., Bates, D.L., Chen, L., and Yamamoto, K.R. (2009). DNA Binding Site Sequence Directs Glucocorticoid Receptor Structure and Activity. Science 324, 407-410.
Melcher, K. (2000). A modular set of prokaryotic and eukaryotic expression vectors. Anal. Biochem. 277, 109-120.
Mellway, R.D., Tran, L.T., Prouse, M.B., Campbell, M.M., and Constabel, C.P. (2009). The Wound-, Pathogen-, and Ultraviolet B-Responsive MYB134 Gene Encodes an R2R3 MYB Transcription Factor That Regulates Proanthocyanidin Synthesis in Poplar. Plant Physiol. 150, 924-941.
Mena, M., Cejudo, F.J., Isabel-Lamoneda, I., and Carbonero, P. (2002). A role for the DOF transcription factor BPBF in the regulation of gibberellin-responsive genes in barley aleurone. Plant Physiol. 130, 111-119.
Meneses, E., Cardenas, H., Zarate, S., Brieba, L.G., Orozco, E., Lopez-Camarillo, C., and Azuara-Liceaga, E. (2010). The R2R3 Myb protein family in Entamoeba histolytica. Gene 455, 32-42.
Miranda, M., Ralph, S.G., Mellway, R., White, R., Heath, M.C., Bohlmann, J., and Constabel, C.P. (2007). The transcriptional response of hybrid poplar (Populus trichocarpa x P-deltoides) to infection by Melampsora medusae leaf rust involves induction of flavonoid pathway genes leading to the accumulation of proanthocyanidins. Molecular Plant-Microbe Interactions 20, 816-831.
167
Mizuguchi, G., Nakagoshi, H., Nagase, T., Nomura, N., Date, T., Ueno, Y., and Ishii, S. (1990). DNA binding activity and transcriptional activator function of the human B-myb protein compared with c-MYB. J. Biol. Chem. 265, 9280-9284.
Mohrmann, L., Kal, A.J., and Verrijzer, C.P. (2002). Characterization of the extended Myb-like DNA-binding domain of trithorax group protein zeste. J. Biol. Chem. 277, 47385-47392.
Mol, J., Grotewold, E., and Koes, R. (1998). How genes paint flowers and seeds. Trends Plant Sci. 3, 212-217.
Moore, B., Zhou, L., Rolland, F., Hall, Q., Cheng, W.H., Liu, Y.X., Hwang, I., Jones, T., and Sheen, J. (2003). Role of the Arabidopsis glucose sensor HXK1 in nutrient, light, and hormonal signaling. Science 300, 332-336.
Morita, A., Umemura, T., Kuroyanagi, M., Futsuhara, Y., Perata, P., and Yamaguchi, J. (1998). Functional dissection of a sugar-repressed alpha-amylase gene (RAmylA) promoter in rice embryos. FEBS Lett. 423, 81-85.
Morohashi, K., and Grotewold, E. (2009). A Systems Approach Reveals Regulatory Circuitry for Arabidopsis Trichome Initiation by the GL3 and GL1 Selectors. PLoS Genet. 5, 17.
Morohashi, K., Casas, M.I., Falcone Ferreyra, L., Mejia-Guerra, M.K., Pourcel, L., Yilmaz, A., Feller, A., Carvalho, B., Emiliani, J., Rodriguez, E., Pellegrinet, S., McMullen, M., Casati, P., and Grotewold, E. (2012). A genome-wide regulatory framework identifies maize pericarp color1 controlled genes. Plant Cell 24, 2745-2764.
Moyano, E., MartinezGarcia, J.F., and Martin, C. (1996). Apparent redundancy in Myb gene function provides gearing for the control of flavonoid biosynthesis in Antirrhinum flowers. Plant Cell 8, 1519-1532.
Mucenski, M.L., McLain, K., Kier, A.B., Swerdlow, S.H., Schreiner, C.M., Miller, T.A., Pietryga, D.W., Scott, W.J., and Potter, S.S. (1991). A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis. Cell 65, 677-689.
Mukherjee, S., Berger, M.F., Jona, G., Wang, X.S., Muzzey, D., Snyder, M., Young, R.A., and Bulyk, M.L. (2004). Rapid analysis of the DNA-binding specificities of transcription factors with DNA microarrays. Nature Genet. 36, 1331-1339.
Muller, K.J., Romano, N., Gerstner, O., Garciamaroto, F., Pozzi, C., Salamini, F., and Rohde, W. (1995). The barley Hooded mutation caused by a duplication in a homeobox gene intron. Nature 374, 727-730.
Nakagoshi, H., Nagase, T., Kaneiishii, C., Ueno, Y., and Ishii, S. (1990). Binding of the c-myb proto-oncogene product to the simian virus 40 enhancer stimulates transcription. J. Biol. Chem. 265, 3479-3483.
168
Nesi, N., Jond, C., Debeaujon, I., Caboche, M., and Lepiniec, L. (2001). The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. Plant Cell 13, 2099-2114.
Nesi, N., Debeaujon, I., Jond, C., Pelletier, G., Caboche, M., and Lepiniec, L. (2000). The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 12, 1863-1878.
Newman, L.J., Perazza, D.E., Juda, L., and Campbell, M.M. (2004). Involvement of the R2R3-MYB, AtMYB61, in the ectopic lignification and dark-photomorphogenic components of the det3 mutant phenotype. Plant J. 37, 239-250.
Nishikawa, T., Okamura, H., Nagadoi, A., Konig, P., Rhodes, D., and Nishimura, Y. (2001). Solution structure of a telomeric DNA complex of human TRF1. Structure 9, 1237-1251.
Nomura, N., Takahashi, M., Matsui, M., Ishii, S., Date, T., Sasamoto, S., and Ishizaki, R. (1988). Isolation of human cDNA clones of myb-related genes, A-myb and B-myb. Nucleic Acids Res. 16, 11075-11089.
Oda, M., Furukawa, K., Sarai, A., and Nakamura, H. (1999). Kinetic analysis of DNA binding by the c-Myb DNA-binding domain using surface plasmon resonance. FEBS Lett. 454, 288-292.
Ogata, K., Kanai, H., Inoue, T., Sekikawa, A., Sasaki, M., Nagadoi, A., Sarai, A., Ishii, S., and Nishimura, Y. (1993). Solution structures of Myb DNA-binding domain and its complex with DNA. Nucleic acids symposium series, 201-202.
Ogata, K., Morikawa, S., Nakamura, H., Sekikawa, A., Inoue, T., Kanai, H., Sarai, A., Ishii, S., and Nishimura, Y. (1994). Solution structure of a specific DNA complex of the Myb DNA-binding domain with cooperative recognition helices. Cell 79, 639-648.
Ogata, K., Morikawa, S., Nakamura, H., Hojo, H., Yoshimura, S., Zhang, R.H., Aimoto, S., Ametani, Y., Hirata, Z., Sarai, A., Ishii, S., and Nishimura, Y. (1995). Comparison of the free and DNA-complexed forms of the DNA-binding domain from c-Myb. Nat. Struct. Biol. 2, 309-320.
Ong, S.J., Hsu, H.M., Liu, H.W., Chu, C.H., and Tai, J.H. (2006). Multifarious transcriptional regulation of adhesion protein gene ap65-1 by a novel Myb1 protein in the protozoan parasite Trichomonas vaginalis. Eukaryot. Cell 5, 391-399.
Ong, S.J., Hsu, H.M., Liu, H.W., Chu, C.H., and Tai, J.H. (2007). Activation of multifarious transcription of an adhesion protein ap65-1 gene by a novel Myb2 protein in the protozoan parasite Trichomonas vaginalis. J. Biol. Chem. 282, 6716-6725.
169
Oppenheimer, D.G., Herman, P.L., Sivakumaran, S., Esch, J., and Marks, M.D. (1991). A myb gene required for leaf trichome differentiation in Arabidopsis is expressed in stipules. Cell 67, 483-493.
Ording, E., Kvavik, W., Bostad, A., and Gabrielsen, O.S. (1994). Two functionally distinct half sites in the DNA-recognition sequence of the Myb oncoprotein. Eur. J. Biochem. 222, 113-120.
Osier, T.L., and Lindroth, R.L. (2001). Effects of genotype, nutrient availability, and defoliation on aspen phytochemistry and insect performance. Journal of Chemical Ecology 27, 1289-1313.
Osnato, M., Stile, M.R., Wang, Y.M., Meynard, D., Curiale, S., Guiderdoni, E., Liu, Y.X., Horner, D.S., Ouwerkerk, P.B.F., Pozzi, C., Muller, K.J., Salamini, F., and Rossini, L. (2010). Cross Talk between the KNOX and Ethylene Pathways Is Mediated by Intron-Binding Transcription Factors in Barley. Plant Physiol. 154, 1616-1632.
Osuna, D., Usadel, B., Morcuende, R., Gibon, Y., Blaesing, O.E., Hoehne, M., Guenter, M., Kamlage, B., Trethewey, R., Scheible, W.-R., and Stitt, M. (2007). Temporal responses of transcripts, enzyme activities and metabolites after adding sucrose to carbon-deprived Arabidopsis seedlings. Plant J. 49, 463-491.
Pabo, C.O., and Sauer, R.T. (1992). Transcription factors: structural families and principles of DNA recognition. Annu. Rev. Biochem. 61, 1053-1095.
Palo, R.T. (1984). Distribution of birch (Betula spp), willow (Salix spp), and poplar (Populus spp) secondary metabolites and their potential role as chemical defense against herbivores. Journal of Chemical Ecology 10, 499-520.
Patzlaff, A., Newman, L.J., Dubos, C., Whetten, R., Smith, C., McInnis, S., Bevan, M.W., Sederoff, R.R., and Campbell, M.M. (2003a). Characterisation of PtMYB1, an R2R3-MYB from pine xylem. Plant Mol.Biol. 53, 597-608.
Patzlaff, A., McInnis, S., Courtenay, A., Surman, C., Newman, L.J., Smith, C., Bevan, M.W., Mansfield, S., Whetten, R.W., Sederoff, R.R., and Campbell, M.M. (2003b). Characterisation of a pine MYB that regulates lignification. Plant J. 36, 743-754.
Pavletich, N.P., and Pabo, C.O. (1991). Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A. Science 252, 809-817.
Pavletich, N.P., and Pabo, C.O. (1993). Crystal structure of a five-finger GLI-DNA complex: new perspectives on zinc fingers. Science 261, 1701-1707.
Pazares, J., Ghosal, D., Wienand, U., Peterson, P.A., and Saedler, H. (1987). The regulatory c1 locus of Zea mays encodes a protein with homology to myb proto-
170
oncogene products and with structural similarities to transcriptional activators. Embo J. 6, 3553-3558.
Pearl, I.A., and Darling, S.F. (1971). Studies on leaves of family Salicacear .16. Phenolic extractives of leaves of Populus balsamifera and of P. trichocarpa. Phytochemistry 10, 2844-&.
Pego, J.V., Kortstee, A.J., Huijser, G., and Smeekens, S.G.M. (2000). Photosynthesis, sugars and the regulation of gene expression. J. Exp. Bot. 51, 407-416.
Pelloux, J., Rusterucci, C., and Mellerowicz, E.J. (2007). New insights into pectin methylesterase structure and function. Trends Plant Sci. 12, 267-277.
Penfield, S., Meissner, R.C., Shoue, D.A., Carpita, N.C., and Bevan, M.W. (2001). MYB61 is required for mucilage deposition and extrusion in the Arabidopsis seed coat. Plant Cell 13, 2777-2791.
Peters, C.W.B., Sippel, A.E., Vingron, M., and Klempnauer, K.H. (1987). Drosophila and vertebrate myb proteins share two conserved regions, one of which functions as a DNA-binding domain. Embo J. 6, 3085-3090.
Peters, D.J., and Constabel, C.P. (2002). Molecular analysis of herbivore-induced condensed tannin synthesis: cloning and expression of dihydroflavonol reductase from trembling aspen (Populus tremuloides). Plant J. 32, 701-712.
Phan, H.A., Iacuone, S., Li, S.F., and Parish, R.W. (2011). The MYB80 Transcription Factor Is Required for Pollen Development and the Regulation of Tapetal Programmed Cell Death in Arabidopsis thaliana. Plant Cell 23, 2209-2224.
Pitt, C.W., Valente, L.P., Rhodes, D., and Simonsson, T. (2008). Identification and characterization of an essential telomeric repeat binding factor in fission yeast. J. Biol. Chem. 283, 2693-2701.
Prestridge, D.S. (1991). Signal scan - a computer-program that scans DNA-sequences for eukaryotic transcriptional elements. Computer Applications in the Biosciences 7, 203-206.
Prouse, M.B., and Campbell, M.M. (2012). The interaction between MYB proteins and their target DNA binding sites. Biochimica Et Biophysica Acta-Gene Regulatory Mechanisms 1819, 67-77.
Ptashne, M., and Gann, A. (1997). Transcriptional activation by recruitment. Nature 386, 569-577.
Punwani, J.A., Rabiger, D.S., and Drews, G.N. (2007). MYB98 positively regulates a battery of synergid-expressed genes encoding filiform apparatus-localized proteins. Plant Cell 19, 2557-2568.
171
Punwani, J.A., Rabiger, D.S., Lloyd, A., and Drews, G.N. (2008). The MYB98 subcircuit of the synergid gene regulatory network includes genes directly and indirectly regulated by MYB98. Plant J. 55, 406-414.
Ramirez, V., Agorio, A., Coego, A., Garcia-Andrade, J., Hernandez, M.J., Balaguer, B., Ouwerkerk, P.B.F., Zarra, I., and Vera, P. (2011). MYB46 Modulates Disease Susceptibility to Botrytis cinerea in Arabidopsis. Plant Physiol. 155, 1920-1935.
Ramsay, R.G., Ishii, S., and Gonda, T.J. (1991). Increase in specific DNA binding by carboxyl truncation suggests a mechanism for activation of Myb. Oncogene 6, 1875-1879.
Rawat, R., Schwartz, J., Jones, M.A., Sairanen, I., Cheng, Y.F., Andersson, C.R., Zhao, Y.D., Ljung, K., and Harmer, S.L. (2009). REVEILLE1, a Myb-like transcription factor, integrates the circadian clock and auxin pathways. Proc. Natl. Acad. Sci. U. S. A. 106, 16883-16888.
Riechmann, J.L., Heard, J., Martin, G., Reuber, L., Jiang, C.Z., Keddie, J., Adam, L., Pineda, O., Ratcliffe, O.J., Samaha, R.R., Creelman, R., Pilgrim, M., Broun, P., Zhang, J.Z., Ghandehari, D., Sherman, B.K., and Yu, C.L. (2000). Arabidopsis transcription factors: Genome-wide comparative analysis among eukaryotes. Science 290, 2105-2110.
Rippe, R.A., Lorenzen, S.I., Brenner, D.A., and Breindl, M. (1989). Regulatory elements in the 5'-flanking region and the 1st intron contribute to transcriptional control of the mouse alpha-1 type-i collagen gene. Mol. Cell. Biol. 9, 2224-2227.
Robertson, G., Hirst, M., Bainbridge, M., Bilenky, M., Zhao, Y.J., Zeng, T., Euskirchen, G., Bernier, B., Varhol, R., Delaney, A., Thiessen, N., Griffith, O.L., He, A., Marra, M., Snyder, M., and Jones, S. (2007). Genome-wide profiles of STAT1 DNA association using chromatin immunoprecipitation and massively parallel sequencing. Nat. Methods 4, 651-657.
Roche, P.J., Hoare, S.A., and Parker, M.G. (1992). A consensus DNA-binding site for the androgen receptor. Mol. Endocrinol. 6, 2229-2235.
Rogers, L.A., and Campbell, M.M. (2004). The genetic control of lignin deposition during plant growth and development. New Phytol. 164, 17-30.
Rogers, L.A., Dubos, C., Cullis, I.F., Surman, C., Poole, M., Willment, J., Mansfield, S.D., and Campbell, M.M. (2005). Light, the circadian clock, and sugar perception in the control of lignin biosynthesis. J. Exp. Bot. 56, 1651-1663.
Rogg, L.E., and Bartel, B. (2001). Auxin signaling: Derepression through regulated proteolysis. Developmental Cell 1, 595-604.
172
Roldan, M., Gomez-Mena, C., Ruiz-Garcia, L., Salinas, J., and Martinez-Zapater, J.M. (1999). Sucrose availability on the aerial part of the plant promotes morphogenesis and flowering of Arabidopsis in the dark. Plant J. 20, 581-590.
Rolland, F., Moore, B., and Sheen, J. (2002). Sugar sensing and signaling in plants. Plant Cell 14, S185-S205.
Rolland, F., Baena-Gonzalez, E., and Sheen, J. (2006). Sugar sensing and signaling in plants: Conserved and novel mechanisms. In Annual Review of Plant Biology, pp. 675-709.
Romano, J.M., Dubos, C., Prouse, M.B., Wilkins, O., Hong, H., Poole, M., Kang, K.Y., Li, E.Y., Douglas, C.J., Western, T.L., Mansfield, S.D., and Campbell, M.M. (2012). AtMYB61, an R2R3-MYB transcription factor, functions as a pleiotropic regulator via a small gene network. New Phytol. 195, 774-786.
Romero, I., Fuertes, A., Benito, M.J., Malpica, J.M., Leyva, A., and Paz-Ares, J. (1998). More than 80R2R3-MYB regulatory genes in the genome of Arabidopsis thaliana. Plant J. 14, 273-284.
Rose, A., Meier, I., and Wienand, U. (1999). The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins. Plant J. 20, 641-652.
Rose, A.B. (2002). Requirements for intron-mediated enhancement of gene expression in Arabidopsis. RNA-Publ. RNA Soc. 8, 1444-1453.
Rosinski, J.A., and Atchley, W.R. (1998). Molecular evolution of the Myb family of transcription factors: Evidence for polyphyletic origin. J. Mol. Evol. 46, 74-83.
Ruan, M.B., Liao, W.B., Zhang, X.C., Yu, X.L., and Peng, M. (2009). Analysis of the cotton sucrose synthase 3 (Sus3) promoter and first intron in transgenic Arabidopsis. Plant Sci. 176, 342-351.
Ryu, K.H., Kang, Y.H., Park, Y.H., Hwang, D., Schiefelbein, J., and Lee, M.M. (2005). The WEREWOLF MYB protein directly regulates CAPRICE transcription during cell fate specification in the Arabidopsis root epidermis. Development 132, 4765-4775.
Sablowski, R.W.M., and Meyerowitz, E.M. (1998). A homolog of NO APICAL MERISTEM is an immediate target of the floral homeotic genes APETALA3/PISTILLATA. Cell 92, 93-103.
173
Sablowski, R.W.M., Baulcombe, D.C., and Bevan, M. (1995). Expression of a flower-specific Myb protein in leaf cells using a viral vector causes ectopic activation of a target promoter. Proc. Natl. Acad. Sci. U. S. A. 92, 6901-6905.
Sablowski, R.W.M., Moyano, E., Culianezmacia, F.A., Schuch, W., Martin, C., and Bevan, M. (1994). A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes. Embo J. 13, 128-137.
Saikumar, P., Murali, R., and Reddy, E.P. (1990). Role of tryptophan repeats and flanking amino acids in Myb-DNA interactions. Proc. Natl. Acad. Sci. U. S. A. 87, 8452-8456.
Sainz, M.B., Grotewold, E., and Chandler, V.L. (1997). Evidence for direct activation of an anthocyanin promoter by the maize C1 protein and comparison of DNA binding by related Myb domain proteins. Plant Cell 9, 611-625.
Sakura, H., Chie, K.I., Nagase, T., Nakagoshi, H., Gonda, T.J., and Ishii, S. (1989). Delineation of three functional domains of the transcriptional activator encoded by the c-myb protooncogene. Proc. Natl. Acad. Sci. U. S. A. 86, 5758-5762.
Sala, A., and Watson, R. (1999). B-Myb protein in cellular proliferation, transcription control, and cancer: Latest developments. J. Cell. Physiol. 179, 245-250.
Saleh, A., Alvarez-Venegas, R., and Avramova, Z. (2008). An efficient chromatin immunoprecipitation (ChIP) protocol for studying histone modifications in Arabidopsis plants. Nat. Protoc. 3, 1018-1025.
Samach, A., Onouchi, H., Gold, S.E., Ditta, G.S., Schwarz-Sommer, Z., Yanofsky, M.F., and Coupland, G. (2000). Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science 288, 1613-1616.
Santi, L., Wang, Y.M., Stile, M.R., Berendzen, K., Wanke, D., Roig, C., Pozzi, C., Muller, K., Muller, J., Rohde, W., and Salamini, F. (2003). The GA octodinucleotide repeat binding factor BBR participates in the transcriptional regulation of the homeobox gene Bkn3. Plant J. 34, 813-826.
Schaffer, R., Ramsay, N., Samach, A., Corden, S., Putterill, J., Carre, I.A., and Coupland, G. (1998). The late elongated hypocotyl mutation of Arabidopsis disrupts circadian rhythms and the photoperiodic control of flowering. Cell 93, 1219-1229.
Schellmann, S., Schnittger, A., Kirik, V., Wada, T., Okada, K., Beermann, A., Thumfahrt, J., Jurgens, G., and Hulskamp, M. (2002). TRIPTYCHON and CAPRICE mediate lateral inhibition during trichome and root hair patterning in Arabidopsis. Embo J. 21, 5036-5046.
Schmid, M., Davison, T.S., Henz, S.R., Pape, U.J., Demar, M., Vingron, M., Scholkopf, B., Weigel, D., and Lohmann, J.U. (2005). A gene expression map of Arabidopsis thaliana development. Nature Genet. 37, 501-506.
174
Schwartz, T., Rould, M.A., Lowenhaupt, K., Herbert, A., and Rich, A. (1999). Crystal structure of the Z alpha domain of the human editing enzyme ADAR1 bound to left-handed Z-DNA. Science 284, 1841-1845.
Schwechheimer, C., and Bevan, M. (1998). The regulation of transcription factor activity in plants. Trends Plant Sci. 3, 378-383.
Schweitzer, J.A., Bailey, J.K., Rehill, B.J., Martinsen, G.D., Hart, S.C., Lindroth, R.L., Keim, P., and Whitham, T.G. (2004). Genetically based trait in a dominant tree affects ecosystem processes. Ecology Letters 7, 127-134.
Seeliger, D., and de Groot, B.L. (2010). Ligand docking and binding site analysis with PyMOL and Autodock/Vina. J. Comput.-Aided Mol. Des. 24, 417-422.
Seguin, A., Laible, G., Leyva, A., Dixon, R.A., and Lamb, C.J. (1997). Characterization of a gene encoding a DNA-binding protein that interacts in vitro with vascular specific cis elements of the phenylalanine ammonia-lyase promoter. Plant Mol.Biol. 35, 281-291.
Seong, S.Y., and Choi, C.Y. (2003). Current status of protein chip development in terms of fabrication and application. Proteomics 3, 2176-2189.
Serpa, V., Vernal, J., Lamattina, L., Grotewold, E., Cassia, R., and Terenzi, H. (2007). Inhibition of AtMYB2 DNA-binding by nitric oxide involves cysteine S-nitrosylation. Biochem. Biophys. Res. Commun. 361, 1048-1053.
Sharma, S.B., and Dixon, R.A. (2005). Metabolic engineering of proanthocyanidins by ectopic expression of transcription factors in Arabidopsis thaliana. Plant J. 44, 62-75.
Shimazaki, K.-i., Doi, M., Assmann, S.M., and Kinoshita, T. (2007). Light regulation of stomatal movement. In Annual Review of Plant Biology, pp. 219-247.
Sinha, A.K., Hofmann, M.G., Romer, U., Kockenberger, W., Elling, L., and Roitsch, T. (2002). Metabolizable and non-metabolizable sugars activate different signal transduction pathways in tomato. Plant Physiol. 128, 1480-1489.
Smeekens, S. (2000). Sugar-induced signal transduction in plants. Annual Review of Plant Physiology and Plant Molecular Biology 51, 49-81.
Smith, A.M., and Stitt, M. (2007). Coordination of carbon supply and plant growth. Plant Cell and Environment 30, 1126-1149.
Solano, R., Nieto, C., and Pazares, J. (1995). MYB.Ph3 transcription factor from Petunia hybrida induces similar DNA-bending/distortions on its two types of binding site. Plant J. 8, 673-682.
Solano, R., Fuertes, A., SanchezPulido, L., Valencia, A., and PazAres, J. (1997). A single residue substitution causes a switch from the dual DNA binding specificity
175
of plant transcription factor MYB.Ph3 to the animal c-MYB specificity. J. Biol. Chem. 272, 2889-2895.
Solfanelli, C., Poggi, A., Loreti, E., Alpi, A., and Perata, P. (2006). Sucrose-specific induction of the anthocyanin biosynthetic pathway in Arabidopsis. Plant Physiol. 140, 637-646.
Solomon, M.J., Larsen, P.L., and Varshavsky, A. (1988). Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene. Cell 53, 937-947.
Steffens, N.O., Galuschka, C., Schindler, M., Bulow, L., and Hehl, R. (2004). AthaMap: an online resource for in silico transcription factor binding sites in the Arabidopsis thaliana genome. Nucleic Acids Res. 32, D368-D372.
Steffens, N.O., Galuschka, C., Schindler, M., Bulow, L., and Hehl, R. (2005). AthaMap web tools for database-assisted identification of combinatorial cis-regulatory elements and the display of highly conserved transcription factor binding sites in Arabidopsis thaliana. Nucleic Acids Res. 33, W397-W402.
Stenman, G., Andersson, M.K., and Andren, Y. (2010). New tricks from an old oncogene Gene fusion and copy number alterations of MYB in human cancer. Cell Cycle 9, 2986-2995.
Stevens, M.T., and Lindroth, R.L. (2005). Induced resistance in the indeterminate growth of aspen (Populus tremuloides). Oecologia 145, 298-306.
Stitt, M., Gibon, Y., Lunn, J.E., and Piques, M. (2007). Multilevel genomics analysis of carbon signalling during low carbon availability: coordinating the supply and utilisation of carbon in a fluctuating environment. Functional Plant Biology 34, 526-549.
Stobergrasser, U., Brydolf, B., Bin, X., Grasser, F., Firtel, R.A., and Lipsick, J.S. (1992). The Myb DNA-binding domain is highly conserved in Dictyostelium discoideum. Oncogene 7, 589-596.
Stracke, R., Werber, M., and Weisshaar, B. (2001). The R2R3-MYB gene family in Arabidopsis thaliana. Curr. Opin. Plant Biol. 4, 447-456.
Stracke, R., Ishihara, H., Barsch, G.H.A., Mehrtens, F., Niehaus, K., and Weisshaar, B. (2007). Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in different parts of the Arabidopsis thaliana seedling. Plant J. 50, 660-677.
Sugimoto, K., Takeda, S., and Hirochika, H. (2000). MYB-related transcription factor NtMYB2 induced by wounding and elicitors is a regulator of the tobacco retrotransposon Tto1 and defense-related genes. Plant Cell 12, 2511-2527.
176
Sulpice, R., Pyl, E.-T., Ishihara, H., Trenkamp, S., Steinfath, M., Witucka-Wall, H., Gibon, Y., Usadel, B., Poree, F., Piques, M.C., Von Korff, M., Steinhauser, M.C., Keurentjes, J.J.B., Guenther, M., Hoehne, M., Selbig, J., Fernie, A.R., Altmann, T., and Stitt, M. (2009). Starch as a major integrator in the regulation of plant growth. Proc. Natl. Acad. Sci. U. S. A. 106, 10348-10353.
Sun, C.H., Palm, D., McArthur, A.G., Svard, S.G., and Gillin, F.D. (2002). A novel Myb-related protein involved in transcriptional activation of encystation genes in Giardia lamblia. Mol. Microbiol. 46, 971-984.
Suzuki, A., Wu, C.Y., Washida, H., and Takaiwa, F. (1998). Rice MYB protein OSMYB5 specifically binds to the AACA motif conserved among promoters of genes for storage protein glutelin. Plant Cell Physiol. 39, 555-559.
Tahirov, T.H., Sasaki, M., Inoue-Bungo, T., Fujikawa, A., Sato, K., Kumasaka, T., Yamamoto, M., and Ogata, K. (2001). Crystals of ternary protein-DNA complexes composed of DNA-binding domains of c-Myb or v-Myb, C/EBP alpha or C/EBP beta and tom-1A promoter fragment. Acta Crystallogr. Sect. D-Biol. Crystallogr. 57, 1655-1658.
Tahirov, T.H., Sato, K., Ichikawa-Iwata, E., Sasaki, M., Inoue-Bungo, T., Shiina, M., Kimura, K., Takata, S., Fujikawa, A., Morii, H., Kumasaka, T., Yamamoto, M., Ishii, S., and Ogata, K. (2002). Mechanism of c-Myb-C/EBP beta cooperation from separated sites on a promoter. Cell 108, 57-70.
Tallman, G. (2004). Are diurnal patterns of stomatal movement the result of alternating metabolism of endogenous guard cell ABA and accumulation of ABA delivered to the apoplast around guard cells by transpiration? J. Exp. Bot. 55, 1963-1976.
Tamagnone, L., Merida, A., Parr, A., Mackay, S., Culianez-Macia, F.A., Roberts, K., and Martin, C. (1998). The AmMYB308 and AmMYB330 transcription factors from antirrhinum regulate phenylpropanoid and lignin biosynthesis in transgenic tobacco. Plant Cell 10, 135-154.
Tamura, K., Dudley, J., Nei, M., and Kumar, S. (2007). MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596-1599.
Tanikawa, J., Yasukawa, T., Enari, M., Ogata, K., Nishimura, Y., Ishii, S., and Sarai, A. (1993). Recognition of specific DNA sequences by the c-myb protooncogene product: role of three repeat units in the DNA-binding domain. Proc. Natl. Acad. Sci. U. S. A. 90, 9320-9324.
Telfer, A., Bollman, K.M., and Poethig, R.S. (1997). Phase change and the regulation of trichome distribution in Arabidopsis thaliana. Development 124, 645-654.
Tiessen, A., Prescha, K., Branscheid, A., Palacios, N., McKibbin, R., Halford, N.G., and Geigenberger, P. (2003). Evidence that SNF1-related kinase and hexokinase are involved in separate sugar-signalling pathways modulating post-
177
translational redox activation of ADP-glucose pyrophosphorylase in potato tubers. Plant J. 35, 490-500.
Toufighi, K., Brady, S.M., Austin, R., Ly, E., and Provart, N.J. (2005). The Botany Array Resource: e-Northerns, Expression Angling, and Promoter analyses. Plant J. 43, 153-163.
Treisman, R., Marais, R., and Wynne, J. (1992). Spatial flexibility in ternary complexes between SRF and its accessory proteins. Embo J. 11, 4631-4640.
Tsai, C.-J., Harding, S.A., Tschaplinski, T.J., Lindroth, R.L., and Yuan, Y. (2006). Genome-wide analysis of the structural genes regulating defense phenylpropanoid metabolism in Populus. New Phytol. 172, 47-62.
Uimari, A., and Strommer, J. (1997). Myb26: a MYB-like protein of pea flowers with affinity for promoters of phenylpropanoid genes. Plant J. 12, 1273-1284.
Urao, T., Yamaguchishinozaki, K., Urao, S., and Shinozaki, K. (1993). An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5, 1529-1539.
Usadel, B., Blaesing, O.E., Gibon, Y., Retzlaff, K., Hoehne, M., Guenther, M., and Stitt, M. (2008). Global transcript levels respond to small changes of the carbon status during progressive exhaustion of carbohydrates in Arabidopsis rosettes. Plant Physiol. 146, 1834-1861.
Vakoc, C.R., Letting, D.L., Gheldof, N., Sawado, T., Bender, M.A., Groudine, M., Weiss, M.J., Dekker, J., and Blobel, G.A. (2005). Proximity amona distant reaulatory elements at the beta-globin locus requires GATA-1 and FOG-1. Mol. Cell 17, 453-462.
Vavouri, T., and Elgar, G. (2005). Prediction of cis-regulatory elements using binding site matrices - the successes, the failures and the reasons for both. Curr. Opin. Genet. Dev. 15, 395-402.
Verrijdt, G., Haelens, A., and Claessens, F. (2003). Selective DNA recognition by the androgen receptor as a mechanism for hormone-specific regulation of gene expression. Mol. Genet. Metab. 78, 175-185.
Vicente, C., Conchillo, A., Pauwels, D., Vazquez, I., Garcia-Orti, L., Calasanz, M.J., Lahortiga, I., Cools, J., and Odero, M.D. (2009). MYB Overexpression Is Directly Involved in Acute Myeloid Leukemia Pathogenesis and Could Constitute a New Therapeutic Target for Patients with Aberrant Expression of This Gene. Blood 114, 948-948.
Wagner, D., Sablowski, R.W.M., and Meyerowitz, E.M. (1999). Transcriptional activation of APETALA1 by LEAFY. Science 285, 582-584.
178
Wang, Q.F., Lauring, J., and Schlissel, M.S. (2000). c-Myb binds to a sequence in the proximal region of the RAG-2 promoter and is essential for promoter activity in T-lineage cells. Mol. Cell. Biol. 20, 9203-9211.
Wang, S., Wang, J.W., Yu, N., Li, C.H., Luo, B., Gou, J.Y., Wang, L.J., and Chen, X.Y. (2004). Control of plant trichome development by a cotton fiber MYB gene. Plant Cell 16, 2323-2334.
Wang, Z.Y., and Tobin, E.M. (1998). Constitutive expression of the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) gene disrupts circadian rhythms and suppresses its own expression. Cell 93, 1207-1217.
Watson, R.J., Robinson, C., and Lam, E.W.F. (1993). Transcription regulation by murine B-myb is distinct from that by c-myb. Nucleic Acids Res. 21, 267-272.
Weisshaar, B., and Jenkins, G.I. (1998). Phenylpropanoid biosynthesis and its regulation. Curr. Opin. Plant Biol. 1, 251-257.
Weston, K. (1992). Extension of the DNA binding consensus of the chicken c-Myb and v-Myb proteins. Nucleic Acids Res. 20, 3042-3049.
Whitham, T.G., Bailey, J.K., Schweitzer, J.A., Shuster, S.M., Bangert, R.K., LeRoy, C.J., Lonsdorf, E.V., Allan, G.J., DiFazio, S.P., Potts, B.M., Fischer, D.G., Gehring, C.A., Lindroth, R.L., Marks, J.C., Hart, S.C., Wimp, G.M., and Wooley, S.C. (2006). A framework for community and ecosystem genetics: from genes to ecosystems. Nature Reviews Genetics 7, 510-523.
Wilkins, O., Nahal, H., Foong, J., Provart, N.J., and Campbell, M.M. (2009). Expansion and Diversification of the Populus R2R3-MYB Family of Transcription Factors. Plant Physiol. 149, 981-993.
Williams, C.E., and Grotewold, E. (1997). Differences between plant and animal myb domains are fundamental for DNA binding activity, and chimeric Myb domains have novel DNA binding specificities. J. Biol. Chem. 272, 563-571.
Winkel-Shirley, B. (2001). Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 126, 485-493.
Wong, M.W., Henry, R.W., Ma, B.C., Kobayashi, R., Klages, N., Matthias, P., Strubin, M., and Hernandez, N. (1998). The large subunit of basal transcription factor SNAP(C) is a Myb domain protein that interacts with Oct-1. Mol. Cell. Biol. 18, 368-377.
Wright, W.E., Binder, M., and Funk, W. (1991). Cyclic amplification and selection of targets (CASTing) for the myogenin consensus binding site. Mol. Cell. Biol. 11, 4104-4110.
179
Xiang, Q.J., and Judelson, H.S. (2010). Myb transcription factors in the oomycete Phytophthora with novel diversified DNA-binding domains and developmental stage-specific expression. Gene 453, 1-8.
Xiao, W.Y., Sheen, J., and Jang, J.C. (2000). The role of hexokinase in plant sugar signal transduction and growth and development. Plant Mol.Biol. 44, 451-461.
Xie, D.Y., and Dixon, R.A. (2005). Proanthocyanidin biosynthesis - still more questions than answers? Phytochemistry 66, 2127-2144.
Xie, Z.D., Lee, E., Lucas, J.R., Morohashi, K., Li, D.M., Murray, J.A.H., Sack, F.D., and Grotewold, E. (2010). Regulation of Cell Proliferation in the Stomatal Lineage by the Arabidopsis MYB FOUR LIPS via Direct Targeting of Core Cell Cycle Genes. Plant Cell 22, 2306-2321.
Xue, G.P. (2005). A CELD-fusion method for rapid determination of the DNA-binding sequence specificity of novel plant DNA-binding proteins. Plant J. 41, 638-649.
Yang, H., Chung, H.J., Yong, T., Lee, B.H., and Park, S. (2003a). Identification of an encystation-specific transcription factor, Myb protein in Giardia lamblia. Mol. Biochem. Parasitol. 128, 167-174.
Yang, S.C., Sweetman, J.P., Amirsadeghi, S., Barghchi, M., Huttly, A.K., Chung, W.I., and Twell, D. (2001). Novel anther-specific myb genes from tobacco as putative regulators of phenylalanine ammonia-lyase expression. Plant Physiol. 126, 1738-1753.
Yang, T., Perasso, R., and Baroin-Tourancheau, A. (2003b). Myb genes in ciliates: A common origin with the myb protooncogene? Protist 154, 229-238.
Yang, Y.O., and Klessig, D.F. (1996). Isolation and characterization of a tobacco mosaic virus-inducible myb oncogene homolog from tobacco. Proc. Natl. Acad. Sci. U. S. A. 93, 14972-14977.
Yanhui, C., Xiaoyuan, Y., Kun, H., Meihua, L., Jigang, L., Zhaofeng, G., Zhiqiang, L., Yunfei, Z., Xiaoxiao, W., Xiaoming, Q., Yunping, S., Li, Z., Xiaohui, D., Jingchu, L., Xing-Wang, D., Zhangliang, C., Hongya, G., and Li-Jia, Q. (2006). The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. Plant Mol.Biol. 60, 107-124.
Yi, J.X., Derynck, M.R., Li, X.Y., Telmer, P., Marsolais, F., and Dhaubhadel, S. (2010). A single-repeat MYB transcription factor, GmMYB176, regulates CHS8 gene expression and affects isoflavonoid biosynthesis in soybean. Plant J. 62, 1019-1034.
Yu, E.Y., Yen, W.F., Steinberg-Neifach, O., and Lue, N.F. (2010). Rap1 in Candida albicans: an Unusual Structural Organization and a Critical Function in Suppressing Telomere Recombination. Mol. Cell. Biol. 30, 1254-1268.
180
Yu, O., and McGonigle, B. (2005). Metabolic engineering of isoflavone biosynthesis. In Advances in Agronomy, Volume 86, D.L. Sparks, ed, pp. 147-190.
Zheng, Y.M., Ren, N., Wang, H., Stromberg, A.J., and Perry, S.E. (2009). Global Identification of Targets of the Arabidopsis MADS Domain Protein AGAMOUS-Like15. Plant Cell 21, 2563-2577.
Zhong, M., Niu, W., Lu, Z.J., Sarov, M., Murray, J.I., Janette, J., Raha, D., Sheaffer, K.L., Lam, H.Y.K., Preston, E., Slightham, C., Hillier, L.W., Brock, T., Agarwal, A., Auerbach, R., Hyman, A.A., Gerstein, M., Mango, S.E., Kim, S.K., Waterston, R.H., Reinke, V., and Snyder, M. (2010). Genome-Wide Identification of Binding Sites Defines Distinct Functions for Caenorhabditis elegans PHA-4/FOXA in Development and Environmental Response. PLoS Genet. 6, 13.
Zhong, R., Richardson, E.A., and Ye, Z.-H. (2007). The MYB46 transcription factor is a direct target of SND1 and regulates secondary wall biosynthesis in Arabidopsis. Plant Cell 19, 2776-2792.
Zhong, R., Lee, C., Zhou, J., McCarthy, R.L., and Ye, Z.-H. (2008). A Battery of Transcription Factors Involved in the Regulation of Secondary Cell Wall Biosynthesis in Arabidopsis. Plant Cell 20, 2763-2782.
Zhou, J.L., Lee, C.H., Zhong, R.Q., and Ye, Z.H. (2009). MYB58 and MYB63 Are Transcriptional Activators of the Lignin Biosynthetic Pathway during Secondary Cell Wall Formation in Arabidopsis. Plant Cell 21, 248-266.
Zhou, L., Jang, J.C., Jones, T.L., and Sheen, J. (1998). Glucose and ethylene signal transduction crosstalk revealed by an Arabidopsis glucose-insensitive mutant. Proc. Natl. Acad. Sci. U. S. A. 95, 10294-10299.
Zhu, Z., An, F., Feng, Y., Li, P., Xue, L., Mu, A., Jiang, Z., Kim, J.-M., To, T.K., Li, W., Zhang, X., Yu, Q., Dong, Z., Chen, W.-Q., Seki, M., Zhou, J.-M., and Guo, H. (2011). Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 108, 12539-12544.
Zimmermann, I.M., Heim, M.A., Weisshaar, B., and Uhrig, J.F. (2004). Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. Plant J. 40, 22-34.
181
Copyright Acknowledgements
Statement of Publications
The research presented in this thesis has appeared or has been submitted as a series
of original publications in refereed journals.
Chapter 1
Prouse M.B., and Campbell M.M. (2012) The interaction between MYB proteins and
their target DNA binding sites. Biochimica Et Biophysica Acta-Gene Regulatory
Mechanisms. 1819: 67-77.
Chapter 2
Romano J, Dubos, C., Prouse, M.B., Wilkins, O., Hong, H., Poole, M., Kang, K., Li, E., ,
Douglas, C.J., Western, T.L., Mansfield, S.D., and Campbell, M.M. (2012) AtMYB61, an
R2R3-MYB transcription factor, is a pleiotropic regulator of plant carbon acquisition and
resource allocation. New Phytologist. 195: 774-786.
Chapter 3
Prouse M.B., and Campbell M.M. (2013) Interactions between the R2R3-MYB
transcription factor, AtMYB61, and target DNA binding sites. PLOS ONE. 8(5): e65132.