Top Banner
“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation possessed for some mediaeval scholastics. It can be considered a relatively harmless habit, like eating peanuts, unless it assumes the form of an obsession; then it becomes a vice” (Stanier, 1970)
29

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Dec 19, 2015

Download

Documents

Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation possessed for some mediaeval scholastics. It can be considered a relatively harmless habit, like eating peanuts, unless it assumes the form of an obsession; then it becomes a vice” (Stanier, 1970)

Page 2: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Linnaean classification• Two major characteristics

• Kingdom Animalia• Phylum Chordata• Class Mammalia• Order Primates• Family Hominidae• Genus Homo• Species sapiens

BIOL E-127 – 10/01/07

Page 3: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Tree of Life: primary divisions

Page 4: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Tree of Life: primary divisions

Page 5: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Tree of Life: three “domains”• Based on 16S rRNA (Woese, 1987):

Page 6: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Tree of Life: three “domains”• Based on 16S rRNA (Pace, 1997):

Page 7: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Tree basics: meaning

Page 8: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Tree basics: rotation

Page 9: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Tree basics: shape

Page 10: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Tree basics: lengths, unrooted

cladograms vs. phylograms

Page 11: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Tree basics: character change

Page 12: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Key phylogenetic terms

Page 13: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Key phylogenetic terms

Page 14: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Phenetics vs. cladistics

Page 15: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Lysozyme amino acid changes in unrelated ruminants

Phenetics vs. cladistics

Page 16: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Maximum Parsimony• Parsimony – shortest tree (fewest homoplasies)

Page 17: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Microbial systematics

• Formerly Pseudomonas (partial list): Ralstonia, Burkholderia, Hydrogenophaga, Sphingomonas, Methylobacterium, Cellvibrio, Xanthomonas, Acidovorax, Hydrogenophillus, Brevundimonas, Pandoraea

multi-C C1(& all use methanol)

Page 18: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Molecular phylogenetics• Zuckerkandl & Pauling. 1965. Molecules as documents of

evolutionary history. J Theor Biol. 8:357-366.

• Neutral theory (Motoo Kimura, 1968)

Page 19: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

16S rRNA as phylogenetic marker• Why a good molecule?

Page 20: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Process to analyze sequence data

Page 21: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Ortholog vs. paralog?

Page 22: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Good Dataset

[A1, A2, A3, A4] [A1, B2, A3, A4]

Bad Dataset

A B

species 1 species 2 species 3 species 4

A1B1

A2B2 A4

B4A3

B3

1. Collect Sequence DataOrtholog vs. paralog?

Page 23: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

2. Sequence Alignment

CGGATAAACCGGATAGACCGCTGATAAACCGGATAC

taxa1taxa2taxa3taxa4

Alignment

Page 24: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

3. Choose Models

Ancestral Sequences

Observed Sequences

?Model

Choose “model”

Page 25: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

Example: Neighbor Joining (NJ)

4. Choose Methods

Taxa CharactersSpecies A ATGGCTATTCTTATAGTACGSpecies B ATCGCTAGTCTTATATTACASpecies C TTCACTAGACCTGTGGTCCASpecies D TTGACCAGACCTGTGGTCCGSpecies E TTGACCAGTTCTCTAGTTCG

A

B

C

DE

Choose methods: distance-based

A B C D E Species A ---- 4 10 9 8Species B ---- 8 11 10Species C ---- 3 8Species D ---- 5Species E ----

A B C D E Species A ---- 4 10 9 8Species B -19.3 ---- 8 11 10Species C -10 -14.7 ---- 3 8Species D -10.7 -11.3 -16 ---- 5Species E -12.7 -13.3 -12 -14.7 ----

M(AB)=d(AB) -[(r(A) + r(B)]/(N-2)

Page 26: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

4. Choose Methods

Maximum Parsimony (MP): Model: Evolution goes through the least number of changes

Maximum Likelihood (ML): L (data| model)

Bayesian Inference

Pr(data)

Pr(model)model)|Pr(datadata)|Pr(model

Markov chain Monte Carlo (MCMC) method for sampling from posterior probability distribution

Discrete character methods

Page 27: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

5. Assess Reliability

I. Bootstrap

Re-sampling to produce pseudo-dataset (random weighting)

II. Jacknife

Sampling with replacement

III. Permutation test

Random deletion of sub-dataset

Randomize dataset to build null likelihood distribution

CGATCGTTA

CAATGATAG

CGCTGATAA

CGCTGATCG

taxa1

taxa2

taxa3

taxa4

123456789

Dataset1: 729338554Dataset2: 631981282

Dataset1: 1-3-56789Dataset2: 12-45678-

10073

Assess reliability

Page 28: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

5. Assess ReliabilityExample analysis: ancestry of HIV-1

(Gao et al., 1999)

Page 29: “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

5. Assess ReliabilityFurther analysis: timing of HIV-1

(Korber et al., 2000. Nature 288:1789-1796)