Evolutionary Evolutionary Art Art A.E. Eiben A.E. Eiben Free University Amsterdam Free University Amsterdam www.cs.vu.nl/~gusz www.cs.vu.nl/~gusz
Jan 14, 2016
Evolutionary ArtEvolutionary ArtA.E. EibenA.E. Eiben
Free University AmsterdamFree University Amsterdam
www.cs.vu.nl/~guszwww.cs.vu.nl/~gusz
What is Evolutionary Art?What is Evolutionary Art? ““Imagery produced by a process of simulated Imagery produced by a process of simulated
evolution inside a computer, guided by an artist's evolution inside a computer, guided by an artist's aesthetic fitness selection”aesthetic fitness selection” Steven Rooke at http://www.azstarnet.com/~srooke/glossary.htmlSteven Rooke at http://www.azstarnet.com/~srooke/glossary.html
“… “… allows the artists to generate complex allows the artists to generate complex computer artwork without them needing to delve computer artwork without them needing to delve into the actual programming used”into the actual programming used”Andrew Rowbottom at http://www.netlink.co.uk/~snaffle/form/evolutio.htmlAndrew Rowbottom at http://www.netlink.co.uk/~snaffle/form/evolutio.html
“… “… more akin to genetic engineering than to more akin to genetic engineering than to painting”painting”Jeffrey Ventrella at http://www.ventrella.com/Art/Tweaks/tweaks.html Jeffrey Ventrella at http://www.ventrella.com/Art/Tweaks/tweaks.html
What is Evolutionary Art?What is Evolutionary Art?
Technically, it is creating pieces of art Technically, it is creating pieces of art
through human-computer interaction, wherethrough human-computer interaction, where compuer: runs evolutionary algorithmcompuer: runs evolutionary algorithm human: applies subjective/aesthetic human: applies subjective/aesthetic
selectionselection
The Roles in Evolutionary The Roles in Evolutionary ArtArt
Role of compuer: Role of compuer:
offers choices, creates diversityoffers choices, creates diversity Role of human: Role of human:
makes choices, reduces diversitymakes choices, reduces diversity
Selection (aesthetic, subjective) steers Selection (aesthetic, subjective) steers generation process towards implicit user generation process towards implicit user preferencespreferences
Q: who is creative here?Q: who is creative here?
Example: Mondriaan Example: Mondriaan evolverevolver((Craenen, Eiben, van Hemert))
Application evolving images in the style of Piet Mondriaan
Programming assignment of my univ. course on evolutionary computing
1999 Dutch-Belgium AI Conference paper
On-line “toy” at:
http://www.cs.vu.nl/ci/Mondriaanhttp://www.cs.vu.nl/ci/MondriaanComposition with Red, Blue, and Yellow, 1930
Mondriaan evolverMondriaan evolver
GUI shows population of 9 GUI shows population of 9 picturespictures
User gives grades User gives grades (thus defines fitness values)(thus defines fitness values)
Computer performs one Computer performs one evolutionary cycle, i.e.evolutionary cycle, i.e.– selection, based on this selection, based on this
fitness (thus creates mating fitness (thus creates mating pool)pool)
– crossover & mutation crossover & mutation (thus creates new (thus creates new population)population)
Repeat Repeat
The Evolutionary Art Cycle The Evolutionary Art Cycle 11
PopulationPopulation
Recombination,Recombination,mutationmutation
Parent poolParent pool
Parent selectionParent selectionaesthetic selectionaesthetic selectionsubjective selectionsubjective selection
Representation in Evolutionary Representation in Evolutionary ArtArt
AGCTCTTA
PhenotypePhenotypelevellevel
GenotypeGenotypelevellevel
Decoding
User selection actsUser selection actson this levelon this level
Genetic Genetic operators act on operators act on this levelthis level
Mondriaan representationMondriaan representation
w h ite 0 .5 g reen
sp lit_ y
ro o t
red 0 .33
w h ite 0 .5 g reen
sp lit_x
sp lit_ y
ro o t
red 0 .33
w h ite 0 .5
ye llo w 0 .5 g reen
sp lit_ y
sp lit_x
sp lit_ y
ro o t
The Evolutionary Art Cycle The Evolutionary Art Cycle 22
PopulationPopulationphenotypesphenotypes
Parent poolParent poolphenotypesphenotypesParent Parent
selectionselection
EncodingEncoding
AGCTCTTA
TGATCGTA
GTGACTCC
Parent poolParent poolgenotypesgenotypes
PopulationPopulationgenotypesgenotypes
Recomb.Recomb.mutationmutation
AGCTCTTA
TGATCGTA
GTGACTCC
CCTCACAACCTTTGGGCCTTTGAA
AGAGACTAAGTACTTA
AGAGACTA
DecodingDecoding
Effects Effects & hand-made mutations& hand-made mutations
AGCTCT+0000
1. Chromosomes consist of two parts: image + effect1. Chromosomes consist of two parts: image + effect they evolve togetherthey evolve together
2. User can try effects with preview and select one (some)2. User can try effects with preview and select one (some)
AGCTCT+0001AGCTCT+0100AGCTCT+1000
Chosen effects are coded onto the chromosomes (Lamarck)Chosen effects are coded onto the chromosomes (Lamarck)
Points of attentionPoints of attention RepresentationRepresentation
– phenotypes shluld be appealing (“fine art”)phenotypes shluld be appealing (“fine art”)– genotypes should be easy to manipulate (operators)genotypes should be easy to manipulate (operators)
Coding-decoding:Coding-decoding:– should be fastshould be fast– Lamarckian evolution in case of user-defined effectsLamarckian evolution in case of user-defined effects
OperatorsOperators– too disruptive: user sees no link between generationstoo disruptive: user sees no link between generations– too smooth (small changes): evolution is too slowtoo smooth (small changes): evolution is too slow
SelectionSelection– user grades are continuous (fitness values): hard to gradeuser grades are continuous (fitness values): hard to grade– user grades are binary (die/multiply): not enough differentiationuser grades are binary (die/multiply): not enough differentiation
Karl Sims, GalápagosKarl Sims, Galápagos
GalápagosGalápagos is an interactive media installation is an interactive media installation that allows visitors to "evolve" 3D animated that allows visitors to "evolve" 3D animated formsforms
http://www.genarts.com/galapagos/index.html http://www.genarts.com/galapagos/index.html Exhibited at the:Exhibited at the:
– ICC in Tokyo from 1997 to 2000, ICC in Tokyo from 1997 to 2000,
– Interactive Computer Art, Interactive Computer Art,
Lincoln, Mass. Lincoln, Mass.
– Boston Cyberarts Festival 1999Boston Cyberarts Festival 1999
Karl Sims, GalápagosKarl Sims, Galápagos
Box insect Beaded arms
Bfly larvaJellyfish
Multipus-green
Multipus-purple
Steven Rooke, Darwin meets Steven Rooke, Darwin meets DaliDali
Kleiweg, Evolutionary Art in Kleiweg, Evolutionary Art in PostScriptPostScript
%!PS-Adobe-3.0 EPSF-3.0%%BoundingBox: 45 170 545 670/X 0 def/Y 0 def/pixcol { } def/PI 3.14159265358979323846 def/INDEX { counttomark 1 sub exch cvi abs exch mod index} bind def/ROLL { exch cvi abs counttomark 2 sub mod 1 add exch cvi roll} bind def/DIV { dup abs .0001 lt { 0 lt { -.0001 } { .0001 } ifelse } if div
Eiben et al., Escher Eiben et al., Escher evolverevolver
Exhibited for 6 months in City Exhibited for 6 months in City Museum The HagueMuseum The Hague
Flat screens on walls show Flat screens on walls show computer genarted picturescomputer genarted pictures
Visitors vote on separate Visitors vote on separate images (define fitness values)images (define fitness values)
Computer performs one Computer performs one evolutionary cycle every 30 evolutionary cycle every 30 minutesminutes
Re-design: visitors choose Re-design: visitors choose between two images (split between two images (split screen)screen)Flatfish
Some useful Web linksSome useful Web links Andrew Rowbottom,Andrew Rowbottom, Organic, Genetic, and Evolutionary Art (incl. Organic, Genetic, and Evolutionary Art (incl.
large software overview) large software overview) http://snaffle.users.netlink.co.uk/form/evolutio.htmlhttp://snaffle.users.netlink.co.uk/form/evolutio.html
Craig Reynolds,Craig Reynolds, Evolutionary Computation and its application to art Evolutionary Computation and its application to art and design and design http://www.red3d.com/cwr/evolve.htmlhttp://www.red3d.com/cwr/evolve.html
Matthew Lewis,Matthew Lewis, Visual Aesthetic Evolutionary Design Links Visual Aesthetic Evolutionary Design Links http://www.accad.ohio-state.edu/~mlewis/aed.htmlhttp://www.accad.ohio-state.edu/~mlewis/aed.html
Steven Rooke,Steven Rooke, Evolutionary Art, Glossary of Terms: Evolutionary Art, Glossary of Terms: http://www.azstarnet.com/~srooke/glossary.htmlhttp://www.azstarnet.com/~srooke/glossary.html
Karl Sims,Karl Sims, Homepage at Homepage at GenArts, Inc.,GenArts, Inc., http://www.genarts.com/karl/http://www.genarts.com/karl/
Linda Moss,Linda Moss, Evolutionary GraphicsEvolutionary Graphics
http://www.marlboro.edu/~lmoss/planhome/index.htmlhttp://www.marlboro.edu/~lmoss/planhome/index.html