Evolution of Transthyretin in Marsupials

Eur. J. Biochem. 227, 396-406 (1995) 0 FEBS 1995

Evolution of transthyretin in marsupials Wei DUAN', Samantha J. RICHARDSON', Jeffrey J. BABON', Rebecca J. HEYES', Bridget R. SOUTHWELL', Paul J. HARMS', Richard E. H. WETTENHALL', Katarzyna M. DZIEGIELEWSKA', Lynne SELWOOD', Adrian J. BRADLEY4, Charlotte M. BRACK' and Gerhard SCHREIBER'

' Russell Grimwade School of Biochemistry, University of Melbourne, Parkville, Victoria, Australia Department of Physiology, University of Tasmania, Hobart, Tasmania, Australia Department of Zoology, LaTrobe University, Bundoora, Victoria, Australia Department of Anatomical Sciences, University of Queensland, Brisbane, Queensland, Australia

(Received 5 August 1994) - EJB 94 1203/3

The evolution of the expression and the structure of the gene for transthyretin, a thyroxine-binding plasma protein formerly called prealbumin, was studied in three marsupial species : the South American polyprotodont Monodelphis domestica, the Australian polyprotodont Sminthopsis macroura and the Aus- tralian diprotodont Petaurus breviceps. The transthyretin gene was found to be expressed in the choroid plexus of all three species. In liver it was expressed in P. breviceps and in M. domestica, but not in S. macroura. This, together with previous studies [Richardson, S. J., Bradley, A. J., Duan, W., Wettenhall, R. E. H., Harms, P. J., Babon, J. J., Southwell, B. R., Nicol, S., Donnellan, S. C. & Schreiber, G. (1994) Am. .I. Physiol. 266, R1359 -R1370], suggests the independent evolution of transthyretin synthesis in the liver of the American Polyprotodonta and the Australian Diprotodonta.

The results obtained from cloning and sequencing of the cDNA for transthyretin from the three species suggested that, in the evolution of the structure of transthyretin in vertebrates, marsupial transthyretin structures are intermediate between birdreptile and eutherian transthyretin structures. In marsupials, as in birds and reptiles, a hydrophobic tripeptide beginning with valine and ending with histidine was found in transthyretin at a position which has been identified in eutherians as the border between exon 1 and intron 1. In humans, rats and mice, the nine nucleotides, coding for this tripeptide in marsupials/reptiles/ birds, are found at the 5' end of intron 1. They are no longer present in mature transthyretin mRNA. This results in a change in character of the N-termini of the subunits of transthyretin from hydrophobic to hydrophilic. This change might affect the accessibility of the thyroxine-binding site in the central channel of tr,ansthyretin, since, at least in humans, the N-termini of the subunits of transthyretin are located in the vicinity of the channel entrance [Hamilton, J. A,, Steinrauf, L. K., Braden, B. C., Liepnieks, J., Benson, M. I)., Holmgren, G., Sandgren, 0. & Steen, L. (1993) J. Biol. Chem. 268, 2416-24241.

Keywords. Transthyretin ; evolution ; marsupials ; gene structure ; gene expression ; plasma protein.

In vertebrates, thyroid hormones are of universal importance for differentiation via control of gene expression. They are also involved in the regulation of therrnogenesis. The physicochemi- cal properties of thyroid hormones determine their distribution in tissues. Thyroid hormones have a strong tendency to partition into lipid membranes (Hillier, 1970; Mendel et al., 1987; Dick- son et al., 1987; Southwell et al., 1993). Binding to specific extracellular proteins counteracts this partitioning (Dickson et al., 1987; Mendel et al., 1987) and creates extracellular pools of protein-bound thyroid hormones which are much larger than the extracellular pools of free thyroid hormones (for reviews see Aldred et al., 1992; Southwell et al., 1992).

One of the extracellular proteins binding thyroid hormones is transthyretin (formerly called prealbumin). Transthyretin is

Correspondence to G. Schreiber, Russell Grimwade School of Bio- chemistry, University of Melbourne, Parkville, 3052, Victoria, Australia

Fax: +61 3 3417 7730. Enzymes. Restriction endonucleases (EC 3.1.21.4) ; DNA polymerase

(EC 2.7.7.7); reverse transcriptase (EC 2.7.7.49). Note. The nove:l nucleotide sequence data published here have been

deposited with the iGenBank sequence data bank. Accession numbers are U12517 for Petaurus breviceps, U12518 for Sminthopsis macrouru and U12519 for Monodelphis dornestica.

composed of four identical subunits of about 15 kDa each. The subunits form a central channel containing two binding sites for thyroid hormones. Human transthyretin binds thyroxine about 10 times more strongly than triiodothyronine (for review see Robbins and Edelhoch, 1986). Transthyretin is expressed by cells involved in maintaining protein homeostasis in extracellular compartments, such as the hepatocytes in the liver and the ependymal cells of the choroid plexus (Stauder et al., 1986; Her- bert et al., 1986). In evolution, the initiation of transthyretin gene expression in the choroid plexus preceded that in the liver by about 2X10* years (Schreiber et al., 1993). Transthyretin is the major protein synthesised and secreted by the choroid plexus of all vertebrates, except fish and amphibians. Transthyretin gene expression occurs in the liver in birds and all eutherians (also called placental mammals), but not in fish, amphibians, reptiles and monotremes (Dickson et al., 1985a,b, 1986; Dickson and Schreiber, 1986; Duan et al., 1991 ; Harms et al., 1991 ; Achen et al., 1992, 1993; Aldred et al., 1992; Schreiber et al., 1993). Apparently, transthyretin gene expression in the liver evolved independently in the evolutionary lineages leading to birds and to eutherians.

Australian marsupials are believed to be the descendants of American ancestors. All extant American marsupials are poly-

Duan et al. (EM J. Biochern. 227) 397

protodont ; some Australian marsupials are polyprotodont, others diprotodont (for review see Tyndale-Biscoe, 1973). The Austra- lian diprotodont marsupials probably arose from polyprotodont ancestors. In a recent study, we have shown that Australian diprotodont marsupial species possess high levels of transthyretin in their blood, indicating the hepatic synthesis and secretion of transthyretin, whereas none of the polyprotodont Australian marsupial species studied showed transthyretin in their blood plasma (Richardson et al., 1994). The question arises whether the expression of the transthyretin gene in the liver evolved during the radiation of diprotodont marsupials in Australia. For this publication, transthyretin synthesis and secretion, transthyretin structure and cDNA sequence were studied for Monodelphis domes- tics, a South American polyprotodont marsupial. M. domestica is believed to be more closely related to the common ancestor of all marsupials than to the Australian marsupials (Reig et al., 1987).

It has been found that a characteristic change in the structure of the N-terminus of the transthyretin subunit had occurred during the evolution of eutherians. A segment of three amino acids, Val-Ser-His in positions 4-6 from the N-terminus, is lost in eutherians compared with birds and reptiles (Duan et al., 1991 ; Achen et al., 1993). This loss is probably caused by a change in RNA splicing at the border between exon 1 and intron 1. It leads to an increase in the hydrophilicity of the N-terminus of the transthyretin subunit. Since the N-termini of the subunits are located near the entrance to the central channel in transthyretin containing the thyroxine-binding site, this change in hydrophilicl hydrophobic character might possibly result in a change of accessibility of the binding site for thyroxine in transthyretin. In this study, we investigated the cDNA structures for transthyretins from M. domestica (South American short-tailed grey opossum), and from two other marsupials, Petaurus breviceps (sugar glider), an Australian diprotodont expressing transthyretin in the liver, and Sminthopsis macroura (stripe-faced dunnart), an Aus- tralian polyprotodont not expressing the transthyretin gene in the liver. An attempt was made to relate the evolution of transthyretin mRNA splicing near the exon- 1 -intron 1 border to the phys- iological function of transthyretin.

EXPERIMENTAL PROCEDURES

Animals and materials. M . domestica was from an estab- lished colony kept in the Department of Physiology and P breviceps from a colony in the Department of Zoology, both at the University of Tasmania, Australia. S. macroura was from a colony in the Department of Zoology at LaTrobe University, Victo- ria, Australia. Blood was taken from the caval veins of animals under ether anaesthesia. Plasma was prepared by centrifugation of the heparinized blood. Livers were removed and animals were killed by inducing a pneumothorax. For the collection of choroid plexus and cerebrospinal fluid, animals were killed by an over- dose of halothane. Cerebrospinal fluid was obtained as described before (Habgood et al., 1993). Choroid plexus were removed within 15 min after death. Tissue samples for preparation of RNA were frozen in liquid nitrogen, immediately after dissec- tion, and stored at -70°C until use. Lyophilized Didelphis virginiana (opossum) serum was from Sigma.

Complementary DNA synthesis and cloning kits were from Amersham Australia and Thermus aquaticus DNA polymerase from Promega. The sources of other chemicals and enzymes were as described previously (Duan et al., 1991 ; Richardson et al., 1994). ~-[3’,5’-’~~I]Thyroxine (1.2 Cdmg) was from Amer- sham Australia; Sep-Pak C-18 reverse-phase columns were from Millipore Waters Australia, thin-layer chromatography plates

from Merck. All chemicals were of analytical grade. The incubation medium used in choroid plexus studies in vitro was RPMI 1640 from Cytosystems (Castle Hill, NSW, 2154 Australia).

Purification of ~-[3’,5’-~~~I]thyroxine. ~-[3’,5’-’~~I]Thyro- xine was purified by separation from iodide by reverse-phase chromatography using Sep-Pak C-18 columns (Mendel et al., 1989), and analysed by thin-layer chromatography (Pardridge and Mietus, 1980).

Labelling of proteins with radioactive leucine by synthesis in choroid plexus incubated in vitro. Choroid plexus tissue, freshly removed from animals, was incubated for 5 h at 32°C in leucine-free RPMI cell culture medium to which 10 pCi L-[U- ‘‘C]leucine (300 Ci/mol)/ml incubation medium was added. Thereafter, the medium was separated from tissue by centrifugation at 12000Xg for 5 min and the supernatant stored at -20°C.

Analytical electrophoresis of plasma proteins. ~-[3’,5’- ‘251]Thyroxine (2.5 nCi, 1.2 Ci/mg) was incubated with 10 pl plasma, or 10 p1 plasma and 40 ~1 cerebrospinal fluid, or 40 pl cerebrospinal fluid at 25°C for 1 h.

Aliquots (5 pl plasma for ~-[3’,5’-’*~I]thyroxine detection ; 2 pl plasma for detection of proteins) were subjected to non- denaturing polyacrylamide gel electrophoresis, pH 8.6, as described previously (Richardson et al., 1994), using N,N,N‘,N‘- tetramethylethylenediamine as catalyst for gel polymerisation. For removal of contaminants, gels were subjected to electrophoresis for 90min before applying the samples to be analysed. Following electrophoresis, lanes were either stained with Coomassie brilliant blue R-250 for detection of proteins, or subjected to autoradiography on Kodak XAR-5 film at -70°C for detection of ~-[3’,5’-’~~I]thyroxine. Samples of 40 pl choroid plexus incubation medium, or of 40 p1 choroid plexus incubation medium plus 5 pl plasma, were analysed by electrophoresis in adjacent lanes in the same gel. Following electrophoresis, these lanes were soaked in Amplify (Amersham) prior to fluorography on Kodak XAR-5 film with an intensifying screen at -7O”C, for detection of [’4C]leucine-labelled proteins.

Purification of transthyretin from Monodelphis domestica plasma. M. domestica plasma (3 ml) was dialysed against 2 1 0.5 M Tris/HCl pH 6.8, 4”C, overnight and centrifuged to re- move any precipitate, prior to non-denaturing electrophoresis in 10% polyacrylamide gel, pH 8.6 at 4°C. The methods of Ornstein (1964) and Davis (1964) were adapted to large-scale preparation with continuous elution, in a Buchler preparative polyacrylamide gel electrophoresis apparatus (Buchler Instru- ments, Fort Lee NJ); 10 mM Tridglycine pH 8.3, and 0.375 M Tris/HCl pH 8.9 were used as upper and elution buffers, respectively. Fractions were analysed by SDS/PAGE as described by Laemmli and Favre (1973); those containing only transthyretin (identified by subunit mass; Dickson et al., 1985b) were pooled and concentrated with an Amicon Diaflo apparatus using a YM- 10 membrane, then with an Amicon Centricon-10 device. The protein was then further purified by reverse-phase HPLC, as described elsewhere (Duan et al., 1991 ; Richardson et al., 1994), and concentrated using a Speedi-Vac system.

Analysis of N-terminal amino acid sequence of M. domes- tics transthyretin. The N-terminal amino acid sequence of M. dornestica transthyretin was determined by automatic Edman degradation, as previously described for the analysis of transthyretins from other species (Duan et al., 1991; Richardson et al., 1 994).

Isolation of RNA, construction of cDNA libraries, and sequence analysis. Total cellular RNA was isolated, polydeny- lated RNA was prepared and cDNA libraries were constructed in bacteriophage Agtl0 for choroid plexus from S. macroura and M. domestica and for liver from P breviceps, as described previously (Cole et al., 1989). Approximately 50000 plaques were

398 Duan et a]. (EM J. Biochem. 227)

screened from each of the amplified cDNA libraries with a DNA fragment which had been amplified from the M. dornestica cDNA library by the polymerase chain reaction and labelled with [CI-~~P]~ATP by random hexanucleotide-primed synthesis. Complementary DNAs were subcloned into plasmid pGEM7zf(+) and the entire sequences of cDNAs were determined for both strands by the chain-termination method (Sanger et al., 1977).

Polymerase chain reaction. For the polymerase chain reaction, recombinant phage DNA was prepared from the amplified M. dornestica chouoid plexus cDNA library, using methods described by Sambrook et al., (1989). Oligonucleotide primers L1 and L2, described previously (Achen et al., 1993), were used to amplify M. dornestica transthyretin cDNA. L1 is a degenerate primer which covers all coding possibilities for amino acid residues 12-18. L2 is a degenerate primer for the complementary strand corresponding to the DNA segment coding for residues 1 13 - 108 of mammalian and chicken transthyretins. Approxi- mately 1 pg recombinant bacteriophage DNA was amplified by the polymerase chain reaction, as described by Duan et al. (1991), except that the following cycle profiles were used: denaturation at 95°C for 5 min, followed by 35 cycles of annealing at 45 "C for 40 s, extension at 68 "C for 30 s and denaturation at 95°C for 30 s.

Northern analysis. For Northern analysis, total cellular RNA was isolated and analysed by denaturing gel electrophoresis (Duan et al., 1991). RNA was transferred to a nitrocellulose filter and hybridized at 42°C for 18 h with 32P-labelled transthyretin cDNA probe (see Results, second section, for descrip- tion of the cDNA probe). The conditions for hybridization and washing of the filter were as previously described (Duan et al., 1991).

Construction of a phylogenetic tree and derivation of a molecular clock for transthyretin. Available amino acid sequences of transthyretins were aligned using ALIGN and COMPARE programs (Orcutt et al., 1982, 1983; Dayhoff et al., 1983; Gotoh, 1986) to allow maximum possible matches. The most parsimonious tree was constructed using branch and bound algorithm via the computer program PAUP (Swofford, 1991), with lizard transthyretin as an outgroup. A sequence break or deletion was counted as one mutation event, irrespective of the number of amino acids involved. For each protein, the number of accepted point mutations was derived from the number of observed amino acid mutations using the conversion table de- vised by Dayhoff (1978).

RESULTS AND DISCUSSION

Thyroxine-binding proteins in the blood plasma of M. domes- tics. Blood was obtained from the caval vein of M. domestica and plasma prepared as described in Experimental Procedures. A total of 2.5 nCi ~-[3',5'-~~~I]thyroxine was added to 10 pl plasma and incubated for 1 h. This amount, corresponding to 2.1 pg (0.58 fmol) thyroxine, is a tracer dose which leads to labelling of all thyroxine-binding proteins in the plasma or serum of humans (Nicoloff, 1986) and other vertebrate species (Lars- son et al., 1985; Richardson et al., 1994). Duplicate samples were analysed by PAGE under non-denaturing conditions, as described in Experimental Procedures. For one set of samples, gels were stained with Coomassie blue; for the other set, gels were dried and exposed on X-ray film for autoradiography. As positive controls for the presence of transthyretin, plasma samples from H. sapiens and P. breviceps were analysed. As negative controls, plasma samples from D. virginiana and S. macroura were included. D. virginiana is the only American marsupial for

Fig. 1. Analysis of thyroxine-binding proteins in plasma from Ameri- can and Australian marsupials. Plasma samples were from H. sapiens (lanes 1 and 2 from the left), M. dornestica (lanes 3 and 4), D. virginianu (lanes 5 and 6), S. rnacrouru (lanes 7 and 8) and R breviceps (lanes 9 and 10). Samples were incubated with 2.5 nCi ['251]thyroxine and analysed by electrophoresis in polyacrylamide gel at pH 8.6 under non-denaturing conditions, as described in Experimental Procedures. Lanes were either stained with Coomassie blue-R250 (Coo) or autoradiographed (AR). The positions of albumin and transthyretin are indicated by D and 4, respectively.

which the binding of thyroxine by plasma proteins has been studied. It belongs to the Polyprotodonta, as does the South American M. dornestica. No thyroxine-binding protein with a greater electrophoretic mobility than that of albumin had been found for D. virginiuna by Davis and Jurgelski (1973). No transthyretin mRNA had previously been found in Northern analysis of liver RNA from S. mucroura (Richardson et al., 1993).

The results obtained are shown in Fig. 1. The staining with Coomassie blue clearly shows strong bands corresponding to albumins. Similarly to the result obtained for human plasma, no bands corresponding to proteins migrating faster than albumin were seen in the staining of M. dornestica plasma proteins with Coornassie blue. However, in human plasma, for example, the concentration of transthyretin is 0.3 mg/ml (about 100 times lower than that of albumin) and this would not be expected to give a 'band' in the staining with Coomassie blue.

Autoradiography (lanes labelled AR) shows the location of the thyroxine-binding proteins in the electrophoresis of the plasma proteins. Unexpectedly, three bands were observed for M. domesticu plasma. This is in contrast to the results obtained for all 22 studied Australian polyprotodont marsupials (Richard- son et al., 1994) and also to those obtained for the American polyprotodont marsupial D. virginiana (Davis and Jurgelski, 1973). In contrast to the Australian Polyprotodonta and to the polyprotodont American D. virginiana, M. dornestica was found to possess a thyroxine-binding plasma protein with a higher electrophoretic mobility than that of albumin in non-denaturing PAGE at pH 8.6. In the plasma of eutherians, birds and diprotodont marsupials this plasma protein has been identified as transthyretin (Richardson et al., 1994).

The protein in M . dornestica plasma that bound thyroxine and migrated faster than albumin was compared with the major protein synthesised and secreted by choroid plexus from M. dornestica (Fig. 2) . Cerebrospinal fluid contained only one thyroxine-binding protein (Fig. 2, lane 4). Its electrophoretic

https://www.researchgate.net/publication/244470882_Molecular_CLoning_A_Laboratory_Manual?el=1_x_8&enrichId=rgreq-8b8d9bf1-9d82-4119-9b27-2360fd130395&enrichSource=Y292ZXJQYWdlOzE1MzQ4NjQxO0FTOjE0OTQzNDczODQxNzY2NEAxNDEyNjM5NDI2NDkx

Duan et al. ( E m J. Biochem. 227) 399

Fig. 2. Analysis of thyroxine-binding proteins in plasma and cerebrospinal fluid of M. domesticu. Aliquots of 10 pl plasma (lane 1 from the left), 10 p1 plasma and ['z51]thyroxine (T4, lane 2), 5 p1 plasma, 40 pl cerebrospinal fluid (CSF) and T4 (lane 3), 40 p1 CSF and T4 (lane 4), 40 p1 choroid plexus incubation medium (CPIM, lane 5) and 40 pl CPIM and 5 p1 plasma (lane 6) were analysed by PAGE at pH 8.6 under non- denaturing conditions and autoradiography (to locate '251-labelling) or fluorography (to locate ''C-labelling), as described in Experimental Pro- cedures. Gels were then stained with Coomassie blue R-250 (lane I), autoradiographed (lanes 2-4), or fluorographed (lanes 5 and 6). The positions of albumin and transthyretin are indicated as D and 4, respectively.

mobility was identical with that of the putative transthyretin from plasma (Fig. 2, tracks 2-4 from the left). This was also the case for the major protein synthesised and secreted by choroid plexus incubated with radioactive leucine (Fig. 2, tracks 5 and 6 from the left). This major protein, synthesised and secreted by M. dornestica choroid plexus, bound to retinol-binding protein and required prolonged heating in 2 % SDS in order to dis- sociate the tetramer into subunits, as elucidated by SDSPAGE, properties typical of transthyretin (Dickson et al., 1982).

For final unambiguous identification, the putative transthyretin was purified from M. dornestica plasma by preparative PAGE, followed by reverse-phase HPLC (see Experimental Pro- cedures), and the primary structure of the N-terminus of the subunit was determined by Edman degradation. The sequence obtained was Ala-Pro-Val-Ile-Xaa-Gly-Ala-Glu-Asp-Ser-Lys- Xaa-Pro-Leu-Met-Val-Xaa-Val-Leu(Glu), i.e. very similar to that of transthyretins from other species (see Figs 3 and 7).

Isolation and nucleotide sequence of the cDNA for M. domes- tics transthyretin. An M. dornestica choroid plexus cDNA library was constructed in bacteriophage AgtlO, as described in Experimental Procedures. Polymerase chain reactions were car- ried out using bacteriophage DNA prepared from the cDNA library as a template and oligonucleotides L1 and L2 as primers. These two oligonucleotides have been described elsewhere (Achen et al., 1993). They correspond to the highly conserved regions of amino acid sequences of transthyretins. The major product of this reaction was a DNA fragment of approximately 300 base pairs. The size of this DNA fragment corresponded to the size expected for a product of the polymerase chain reaction using L1L2 primer pairs and a transthyretin cDNA template.

Furthermore, in a Northern analysis of total cellular RNA from M. dornestica choroid plexus with this DNA fragment as the probe, a distinct signal was detected with a size of =700 bases. This agrees with the sizes of all known transthyretin mRNA, as analysed by Northern analysis. This 300-bp DNA fragment was subsequently used as a probe to screen the cDNA libraries constructed for tissue from M. dornestica, P. breviceps and S. macroura.

Initial screening of about 50000 recombinants from the M. dornestica choroid plexus cDNA library by hybridization to the 300-nucleotide DNA fragment revealed 100 positive clones. The clone with the largest insert was selected for sequencing. The nucleotide sequences were determined for both strands, as described in Experimental Procedures. The sequencing strategy is illustrated in Fig. 3A. The nucleotide and deduced amino acid sequences are depicted in Fig. 3B. The cDNA consisted of 637 nucleotides, followed by 36 adenylate residues. The longest open reading frame possessed 447 nucleotides, starting from an ATG codon 24 bases downstream from the 5' end of the cDNA and ending with an in-frame stop codon TAA at nucleotides 471-473. The untranslated sequence at the 3'-end (166 nucleotides) preceding the poly(A) segment possessed one additional in-frame stop codon (nucleotides 510-513). The consensus polyadenylation sequence, AATAAA, was found to be located 16 bp upstream from the 5' end of the polyadenylate segment. The entire M. dornestica transthyretin cDNA sequence displays 67-73 %, 65% and 65% identity to eutherian (Mita et al., 1984; Dickson et al., 1985b; Wakasugi et al., 1985; Fung et al., 1988; Duan et al., 1989; Tu et al., 1989), chicken (Duan et al., 1991) and lizard (Achen et al., 1993) transthyretin cDNAs, respectively. The mass of the subunit of M. dornestica transthyretin, calculated from the deduced amino acid sequence, is 14317 Da, assuming no post-translational modifications.

Tissue specificity of the expression of the M. dornestica transthyretin gene. Total cellular RNA was prepared from the choroid plexus and liver of M. domestica and subjected to Northern analysis, using M. dornestica transthyretin cDNA as a probe. The results are shown in Fig. 4. Both tissues expressed the transthyretin gene. However, the signal resulting from only 0.5 pg choroid plexus total cellular RNA was stronger than that from 20 pg total cellular liver RNA.

Cloning and nucleotide sequence analysis of transthyretin cDNA from S. macroura. After the unexpected observation of the expression of the transthyretin gene in the liver of M. domes- tics, a polyprotodont marsupial (previous paragraph), it was de- cided to investigate the structure of transthyretin in a polyprotodont marsupial not expressing the transthyretin gene in its liver. Total cellular RNA was isolated from the choroid plexus of S. macroura, polyadenylated RNA was prepared and a cDNA library in bacteriophage IgtlO was constructed, as described in Experimental Procedures. A full-length S. rnacroura transthyretin cDNA clone was isolated after screening the cDNA library with the 300-nucleotide DNA fragment (synthesised by polymerase chain reaction as described above) as a probe. The strategy for cDNA sequence analysis, the complete nucleotide and the deduced amino acid sequences are shown in Fig. 5. The S. macroura transthyretin subunit consisted of 129 amino acid residues beginning with the first methionine at nucleotides 14-16 and ending with a stop codon at nucleotides 461-463. There were four other in-frame stop codons (nucleotides 497-499, 500-502, 587-590 and 605 -607) in the 3'-untranslated region of the cDNA. The cDNA contained a 5'-untranslated region of 13 bp, followed by an open reading frame of 447 bp and a 3'- untranslated region of 163 bp with a polyadenylate segment of

400 Duan et al. (Eur J. Biochern. 227)

A

Eco RI Eco RI

0 100 200 300 400 500 600 700 bp

B

ATGGCTTTTCATTCCCTGCTCCTCCTGGGCCTTGCCAGCCTGCTGTTTGTGTCTGATGCT MetAlaPheHiSSerLeuLeuLeuLeuGlyLeuAlaSerLeuLeuPheValSerAspAla - 2 0 -10 -1

';C-CCTG_GATCCATGGAGCT(iAAGA_TCCAAATGCCCTCTGAT~TTAARGTTCTTGAT AlaProValI lelliSG~yAla~iluAspSer~.y~C~sProLeuMetValLysValLeuAsp -1 10 20

GCAGTCCGAGG~AGCCC'IGCG(;TCAACGTGAA-GTSAAAGTGT'IC~~AATL'TGA;GAG nl~ValArgGlySerPrcAlaV~lAsriValAsr.~~alL~sVa:~~.cLy~l.~sSeKGluGl~~

4: - " 3 .

CR;\ACATGGGASCCC_TTGCRnC-GGGARAACCPArGATTAT~GAGAGATCCATCAACTC G!nThrTrpSluPrOPheAlaThrG!y! ysThrASnAS&TyrGlyGi L? ! e!!isc;l-Leu

5 0 6 :

'rCGAA~GCCC_TGG_GTTTCC('CA"TCCATCCAT~~~rA~~(~A~ATGTGGTGTTCA,~G';CC~~ ~rpAsriAlaLcilClyVa1 Ser1'roPhe:iisGluTyrAlaAspVal~~l PheLysAlaAsn

9 3 1 o c

GATGCTGGCCATCGTCATTACACCA'ITGCI SCCC-CCTGAGTCCATACT-CTRT_C(;RC'" :~spAlaG:yHlsAIyHis~r'rtirIlePlaAlaLeuLeuSerProTyrCcrTyrSer'rnr

1 1 3 1 2 -

ACGGCTGTAGTCAGCAACCCAAAGGACTAAACAAATATCATTTTTATC?'GTGGCAACACC ThrAlaValValSerAsnProLysAsp***

1 2 9

AATAARTAGGTTGGAAGGAGAGAAGAGAAAGGACCACCTTTTATGGAGCTAATAGTGTTG

CATTTTTCCACAAAGCAGTATTTTCACTTTCTTATTAACTTGGGCAPAATCAATAAACCA

TTCATGCTAAAGCAAAAAAAAAAAAAAAAAAAAAAAAAAA

2 3

8 3

1 4 3

2 0 3

2 6 3

3 2 3

3 8 3

4 4 3

503

5 6 3

6 2 3

673

Fig. 3. Cloning and sequence analysis of transthyretin cDNA from the choroid plexus of the South American short-tailed grey opossum, M. dornestica. (A) Strategy for nucleotide sequencing. The transthyretin cDNA is depicted as a hatched bar. The cDNA is flanked by two EcoRI cloning sites. Arrows indicate the direction and the extent of sequencing. (B) Nucleotide sequence of M. domestica choroid plexus transthyretin cDNA and deduced amino acid sequence of M. domestica transthyretin. Nucleotides are numbered at the right of the figure in the 5' to 3' direction, beginning with the first nucleotide of the cDNA insert. The deduced amino acid residues are indicated below the nucleotide triplets. The amino acid residues of the signal peptide are numbered -20 to -1. The N-terminal residue of mature M. domestica transthyretin, as determined by amino acid sequencing, is designated as +I . The first in-frame stop codon is marked by three asterisks. A potential polyadenylation signal in the 3'- untranslated region of the cDNA is underlined.

14 nucleotides, following a consensus AATAAA polyadenylation signal at nucle'otides 603-608. The S. rnacroura transthyretin cDNA sequence displays 68 %, 70 %, 68 %, 64 %, 69 %, and 66 % identity with the sequences for human (Mita et al., 1984), sheep (Tu et al., 1989), rat (Dickson et al., 198513; Fung et al., 1988; Duan et al., 1989), mouse (Wakasugi et al., 1985), chicken (Duan et al., 1991)., and lizard transthyretin (Achen et al., 1993), respectively. The calculated mass of the subunit of S. rnacroura transthyretin, deduced from the cDNA, is 14203 Da. Compared with eutherian transthyretin mRNAs, the S. rnacrotara transthyretin mRNA codes for an extra segment of three amino acids, Val- Ala-His, near the N-termini of the subunits in the mature protein.

Cloning and nucleotide sequence analysis of transthyretin cDNA from I? breviceps. For comparison with the structures of transthyretin cDNAs in polyprotodont marsupials, total cellular RNA was isolated, polyadenylated RNA prepared and a cDNA library constructed in bacteriophage AgtlO for liver from the Australian diprotodont marsupial P. breviceps. Using the 300-bp DNA fragment described above as a probe, about 200 positive clones were identified in the initial screening of the cDNA library. A cDNA clone of 0.65 kb was isolated and the entire nucleotide sequence was determined (Fig. 6). The f? breviceps transthyretin cDNA sequence was found to contain a 5'-untranslated region of 14 bp, followed by an open reading frame

Duan et al. ( E m J. Biochem. 227) 40 1

Fig. 4. Northern analysis of transthyretin mRNA from the choroid plexus and the liver of the South American short-tailed grey opossum M. dornestica. Total cellular RNA from liver (20 pg) and total cellular RNA prepared from choroid plexus (<0.5 pg) from one animal were subjected to Northern analysis with M. dornestica cDNA as a probe, as described under Experimental Procedures. Autoradiographic exposure for 2 days at -70°C with double intensifying screens using Kodak X-AR film. The positions of 28 S and 18 S ribosomal RNA bands are shown on the right. The strong signals at the lower ends of the tracks correspond to the position of transthyretin mRNA. Non-specific binding to 28 S and 18 S rRNA is apparent in the liver track due to the 40 times larger amount of RNA in this track compared with the choroid plexus track.

of 447 bp, a stop codon and a 3’-untranslated region of 164 bp. Four additional in-frame stop codons (nucleotides 491 -493, 542-544, 545-547 and 620-622) were found after the first in- frame stop codon (nucleotides 461 -463). The consensus polyadenylation sequence, AATAAA, was found to be located 16 bp upstream of the poly(A) segment. Similarly to other marsupial transthyretin mRNAs, the P. breviceps transthyretin mRNA pos- sesses a special segment of nine nucleotides, encoding the amino acids Val-Ala-His after the third amino acid of the mature protein. The P. breviceps transthyretin cDNA sequence displays 70%, 69%, 70%, 64%, 68% and 65% identity with the sequences of human (Mita et al., 1984), sheep (Tu et al., 1989), rat (Dickson et al., 1985b; Fung et al., 1988; Duan et al., 1989), mouse (Wakasugi et al., 1985), chicken (Duan et al., 1991) and lizard transthyretin cDNA (Achen et al., 1993). The mass calculated for the R breviceps transthyretin subunit from the deduced amino acid sequence is 14195 Da.

Evolution of transthyretin structure. Fig. 7 shows a comparison of the amino acid sequences derived from the nucleotide sequences of the cDNAs reported here with the amino acid sequences of transthyretins from other species for which the full sequences are known. The degree of conservation varies along the polypeptide chain. The inner regions of the subunits and the regions corresponding to the central channel, containing the thyroxine-binding sites (defined for human transthyretin by Blake et al. in 1978), are strongly conserved.

The greatest variation in amino acid sequence is found at the N-terminus of the protein after the third amino acid (numbering for eutherians, reptiles and birds, corresponding to amino acid 2 of the marsupials). A segment of three amino acids, Val-Xaa- His, is found in bird, reptile and marsupial transthyretins, but is absent from eutherian transthyretins. A comparison of the nucleotide sequences coding for these three amino acids with the sequence of transthyretin genomic DNA in humans (Sasaki et al.,

1985; Tsuzuki et al., 1985), rats (Fung et al., 1988) and mice (Wakasugi et al., 1986) shows that this nucleotide sequence is present at the 5‘ end of intron 1 of the transthyretin gene in the above three eutherians, i.e. it is not found in the mature transthyretin mRNA and, therefore, it is not translated into protein (Fig. 8). The consequence of the change in expression of these three codons is a change at the protein level in the amphipathic character of the N-terminus of the transthyretin subunit. The N- terminus becomes more hydrophilic in eutherians (Gly-Pro-Thr- Gly-Thr-Gly-Glu) than in reptiles and birds (Ala-Pro-Leu-Val- Ser-His) .

The N-termini of the transthyretin subunits in marsupials are more similar to those in birdsheptiles than to those in eutherians in regard to the hydrophobicityhydrophilicity of the amino acid sequence. It remains to be investigated whether this influences the interaction between thyroxine and transthyretins and, conse- quently, would be of importance for the distribution of thyroxine in the body. Recent studies by Hamilton et al. (1993) for human transthyretin have shown that the first nine N-terminal amino acids form a curved rod extending from CyslO. Since this rod is located near the entrance to the central channel of transthyretin, it is conceivable that alterations of its structure may interfere with exit and entry of thyroxine from and into the channel.

The splice site recognition sequence at the 5’-terminus of introns, GUA (loo%, 100% and 60% conservation, respectively), is strongly conserved (for review see Padgett et al., 1986). It codes for the strongly hydrophobic amino acid valine. Most changes from this amino acid are likely to increase hydrophilicity. Thus, a change in splice site of mRNA would lead to a change in hydrophobicity of a polypeptide segment.

Fig. 9 shows the results of a parsimony analysis of the amino acid sequences of the currently available sequences for the primary translation products of transthyretin mRNAs with lizard transthyretin as an outgroup. The phylogenetic tree obtained is similar to those based on morphological data. Eutherian transthyretins are more closely related to each other than to marsupials. Diprotodont marsupials are more closely related to each other than to Polyprotodonta. Australasian marsupials are more closely related to each other than to the South American M. dornestica. Nevertheless, M. dornestica expresses the transthyretin gene in the liver, while the Australian polyprotodont dunnart (S. rnacrouru) does not.

Rate of evolution of transthyretin. Nucleotide and amino acid replacements resulting from the chance fixation of selectively neutral mutations during evolution will accumulate in a gene and in a protein in proportion to time. Thus, plotting accepted mutations against time since divergence of species can give a straight line. Examples of such ‘molecular clocks’ have been reported for albumin (Wilson et al., 1977) and globin (Jukes, 1980). A plot of accepted point mutations of transthyretins against time since divergence of species is shown in Fig. 10. Two straight lines going through the origin can be constructed, one for time periods greater than about 150 million years and one for time periods smaller than this value. The common ancestors of eutherians and marsupials probably lived about 150 million years ago. Apparently the rate of evolution of transthyretin is higher in the mammalian lineage than in the birdreptile lineage. Gibbs and Dugaiczyk (1994) recently showed that the molecular clock may run at different rates for the same gene in different species, namely for members of the protein superfamily of albumin, a-fetoprotein, and vitamin-D-binding protein.

One reason for ambiguities in constructing molecular clocks is the difficulty of obtaining reliable values for the time since divergence of species. A difference exists in particular for the time proposed for the divergence of rats and mice on the basis

402 Duan et al. (Eur: J. Biochern. 227)

A

Eco RI Eco RI

0 100 200 300 400 500 600 700 bp

CATTATCAGCAAG 13 B

A'XXCTTTTCAT7CCCTGCTSCXCTTl'GCCTCtiCTGGCCTSG I'STTC? :'G?CTCAGGC'.* 7 3 ~JcA1~Ph~H1SSe~LeuLeJLeuLeu~'~~LeJAl~C,:y~euVal~he~.e~JSerG.uAla

2 0 -1: - 1

G ; A C C T G T G G C C C A T G G A C C " G A G G A T 1 ' C C ~ T ~ C ~ ~ T C ~ G A T G S ~ ~ , ~ A G ~ ? C ' r _ G A T 133 C ; l y P r 3 V a l A l a ~ 1 s G l y A ~ a G l u A s ~ . ~ e r L ' / s C y s l r l I.ySV3:L.ecAsF .1 10 20

TCAGT~C3AC;CAAGC(:CAGCG(:TCA4T(; rGGATGTARAAG I'GT rC/A"ua\CTCAGGAC 19 3 PerValArgGlySerProAlaValAsnValAsp~/alLysValPher.~~LysThrCl~~l~

30 4 3

~AAACTTGti'~AtiT'TCTT_GCMGTGGGAAAACCAATAACAATSGhGAAA_CCATCAAC'rC 2 5 3 C l n ' I ' h r l r ~ G 1 ~ l e ~ P h e A l a S e r G l y L y s T h r A s n A s n A s n G ~ y C l u I ~ ~ H i s C ~ ~ ~ ~ u

5 c 6 0

GATGCTGGTCACCS'PCAC'~ACACTA'~T(;C-GCCC~C-SX';CCCA-"L"TC"TTT~CAACL' 4 3 3 AspA1aG1y~iSArg!!1S~r~hrIleAliSlnLc.S~?r?r~?hcSarP~.e-CerThr

110 1 2 0

~~_AGCTG_AGTGAGCAA,CCAAAGGRC? MrA'I'A':'S'KAl"lY: :'C'K I'GTGSCAACAAC J5 i ?hrAlaValValSerAsn?roLysAsp'"*

1 2 7

CATTAATAGAGGTTTGGCAATGTAGAAATGACCATCTTTCATGGAGCTAATAGTATCACA 553

TTTTTCCACARAGCACTATTTCCACTTTGTTATTAACTTGGGCA~GTC~CCATT 613

CTTGCTAAAGCAAAAAAAAAAA 638

Fig. 5. Cloning and sequence analysis of transthyretin cDNA from the choroid plexus of the Australian polyprotodont marsupial S. mucrouru (stripe-faced dunnart). (A) Strategy for nucleotide sequencing of the transthyretin cDNA. The S. mucroura transthyretin cDNA is depicted as a hatched bar. The EcoRI cloning sites flanking the cDNA are shown. Arrows indicate the direction and the extent of sequencing. (B) Nucleotide sequence of S. rnucrouru choroid plexus transthyretin cDNA and deduced amino acid sequence of transthyretin. Nucleotides are numbered at the right of the figure in the 5' to 3' direction, beginning with the first nucleotide of the cDNA insert. The deduced N-terminal amino acid residue of mature S. macrouru transthyretin, as inferred from aligning the amino acid sequence of dunnart transthyretin with those of transthyretins from other vertebrate species is designated as + I . The first in-frame stop codon is marked by three asterisks. A potential polyadenylation signal in the 3'- untranslated region of the cDNA is underlined.

of palaeontological and molecular biological data. The former lead to a predictiosn of 8-12 million years ago (Jaeger et al., 1986), the latter to a prediction of 17-35 million years ago for the time at which a common rodent ancestor lived on earth (Wil- son et d., 1977; Brownell, 1983). A convergent evolution of the morphological characters used to define the ancestors of murine species would lead to erroneously short times for the divergence of rats and mice (Chevret et al., 1993). However, no example of sequence convergence standing up to rigorous statistical scrutiny has yet been observed (Doolittle, 1994). The data for the evolution of transthyretin reported here suggest a time of divergence

of about 30 million years for rats and mice, in agreement with the molecular and biological data, but in disagreement with the palaeontological data.

Evolution of transthyretin gene expression. Throughout the subphylum Vertebrata, except in fish and amphibians, transthyretin was found to be expressed in the choroid plexus. It is the major protein secreted by this organ (for review see Schreiber et al., 1993). In toad choroid plexus, a lipocalin is the protein equivalent in rate of production and mRNA content to the transthyretin observed in the choroid plexus of higher vertebrates

Duan et al. ( E m J. Biochem. 227) 403

0 100 200 300 400 500 600 700 bp

B CATTACCAGCAAA 13

Ar(;CC~?'T_CA_TCCC'rGC'."GC~CCTGTGCCTTt-CTGGACTCCTCTT?GTG1'C'I'SAGGC r 7 3 ?le~Alal'hcl~isSerLeuLeuLe~~LeuCysLe~iA~aGlyLeJ~e~PheVdlSer~~uA~.I -20 -10

GC-ACC-(:TC~CCCA'l'GGAGGTGAGGATTCC~RG'~GCCCTCTGATGGTTAAAGTTCTCC,A'r 133 GlyPrcValAlaHisGlyGlyGlcAspSerLysCysProLetValLysValLeuAs~~ +1 10 20

GCAGTC('GAGGAAGACCAGCTG?'CCATGTGSATG-S~GTG_TCAAAAAAACTSAGAAJ 193 AlaValArgClyArg7rcAlaValnsnValRspValLysValPneLysLysTnrS1ul.y~;

3 C 40

C,IACT~~GSAGC-C___(;CATCTGSGAAAR-_McchlGGCGAGA.CC~-GAGCTC 2 5 3 G :nThr 'rrFS?uLcnPhoAlaSerS .yLys_hrAsnAst-Asr.Sl~G :.! I I eE: sGluLeL

5 3 60

ACAnGTC;ATG.4CAAAT"TGGAGAGSSTT_ATACAAGGT~-TGACAC1'ATC-CCTX'I 313 'l'hrSesXspAspLy3FneGlyGlu;lyLellTyrLysValGl~~~eAspThrI~eSerTyr

70 89

TGGAM';CCCTTGGTGTCTCCCCATTCCATGAGTATGCAGAl'GTGGTG'I'TCACCGCCAA~ 373 TrpLyS~~laLeuGlyValSerProPheHistiluTyrAla.~s~!V~l~al PheThrAlaAsn

YC 100

C;ATGCTGGTCATCGCCAYrACACCC.l'I GClSCTCAACTGAGl'CCG'~AC'~CTTTT?CMC(: 4 3 3 AspAla.;ly~isAr;His~/~-Thr IleAlanlaGl?LeuSer PrcTyrSerFheSerThr

1 1 I 1?0

A C A G C T A T A G T C A G C A A C C C A A C A G A A T A A A C A A A T G T A A T A G 4 9 3 ThrAlaIleValSerAsnPraThrGlu***

129

CCATTCATAGAGGTTTGGCAGGAGAGAAAGGACCACCTTTTATGGAGCTAATAGTATCAC 553

ATTTTTCCACAAAGCAGTATTTTCACTTTGTTATTAACTTGGGCAGAGTCAATAAACCAT 613

TCTTGCTAAAGCAAAAAAAAARAAAAA 640

Fig. 6. Cloning and sequence analysis of transthyretin eDNA from the liver of the Australian diprotodont marsupial f! breviceps (sugar glider). (A) Strategy for nucleotide sequencing of the P. breviceps liver transthyretin cDNA. The P. breviceps transthyretin cDNA is depicted as a hatched bar. The EcoRI cloning sites flanking the cDNA are shown. Arrows indicate the direction and the extent of sequencing. (B) Nucleotide sequence of P. breviceps liver transthyretin cDNA and deduced amino acid sequence of Z? breviceps transthyretin. Nucleotides are numbered at the right of the figure in the 5' to 3' direction, beginning with the first nucleotide of the cDNA insert. The deduced amino acid residue of mature P. breviceps transthyretin, as inferred from aligning its amino acid sequence with those of transthyretins from other vertebrate species, is designated as + 1. The first in-frame stop codon is marked by three asterisks. A potential polyadenylation signal in the 3'-untranslated region of the cDNA is underlined.

(Achen et al., 1992). Strong transthyretin synthesis and high transthyretin mRNA levels in choroid plexus have been reported for a reptile (Achen et al., 1993). Reptiles are also the first vertebrates in which a cerebral cortex appears during evolution (for review see Kent, 1987) and possess morphological brain features suggesting the beginning of consciousness (Eccles, 1992). The brain can be regarded as the organ with the greatest tendency to increase in relative size during evolution (Wilson, 1991). Re- lated to this increase in size is an increase in space for the distribution of thyroid hormones within the brain. Distribution within the brain and, in particular, the size of the extracellular pools of thyroxine within the brain, are determined by the binding of

thyroxine to extracellular proteins. The main thyroxine-binding protein in the cerebrospinal fluid of higher vertebrates is transthyretin, synthesised and secreted by the choroid plexus (Dick- son et al., 1985a.b; Dickson and Schreiber, 1986; Achen et al., 1993). We suggest that the first and probably still the most important function of transthyretin is to create an extracellular thyroxine pool in the central nervous system (Southwell et al., 1993).

Expression of the transthyretin gene in the liver of birds (Duan et al., 1991; Southwell et al., 1991; Richardson et al., 1994) and eutherians (Mita et al., 1984; Dickson et al., 1985a,b; Wakasugi et al., 1985; Fung et al., 1988; Duan et al., 1989; Tu

https://www.researchgate.net/publication/36858041_Comparative_Anatomy_of_the_Vertebrates?el=1_x_8&enrichId=rgreq-8b8d9bf1-9d82-4119-9b27-2360fd130395&enrichSource=Y292ZXJQYWdlOzE1MzQ4NjQxO0FTOjE0OTQzNDczODQxNzY2NEAxNDEyNjM5NDI2NDkx

404 Duan et al. (Eul: J. Biochern. 227)

Human Sheep Rabbit Rat Mouse S.Glider Wallaby Dunnart Monodel. Chic ken Lizard

Human Sheep Rabbit Rat Mouse S .Glider Wallaby Dunnart Monodel. Chicken Lizard

Human Sheep Rabbit Rat Mouse S .Glider Wallaby Dunnart Monodel. Chicken Lizard

a- helix----.--l - YWKALGISPE * * * s * * * * * * * * * * * * * * * * ********** ***T****** ******v*** ******v***

**pJ***v***

******v*** I

***TF*****

***G**L***

90187) 1 1 0 1 1 0 7 ) 1 2 0 ( 1 1 7 ) 1 3 0 1 1 2 7 ) E x o n 3 wk 100f:bn4

Fig.7. Comparison of the primary structures of 11 transthyretins. The amino acid sequence of rabbit transthyretin and those deduced from cDNA sequences for sheep (Tu et al., 1989), rat (Dickson et al., 1985b; Duan et al., 1989), mouse (Wakasugi et al., 1985), Tammar wallaby (M. eugenii, Brack et al., 1994), the lizard Tiliqua rugosa (Achen et al., 1993) and the sequences for the sugar glider P. breviceps, the dunnart S. rnacrouru and the opossum M. dornestica, described in this paper, are aligned with the deduced amino acid sequence of human transthyretin (Mita et al., 1984). The N-terminal residue of mature transthyretin (designated + I ) has been identified for human (Kanda et al., 1974), rabbit (Sundelin et al., 1985), rat (Navab et al., 1977), chicken (Duan et al., 1991) and M. dornesticu (this paper), but has been inferred for mouse, sugar glider, dunnart and sheep from this alignment. Numbers below the sequences refer to the amino acids of reptile or chicken transthyretin. The numbers in parentheses refer to the corresponding amino acids in human transthyretin. Those residues which are identical to those in human transthyretin are represented by asterislrs. Presegments contain the residues numbered from -20 to - 1 . Features of secondary structure in human transthyretin (Blake et al., 1974, 1978) art; indicated above the sequence for human transthyretin. Residues located in the core of the transthyretin subunit are singly underlined, those located in the central channel of the tetramer are doubly underlined, and those which participate in the binding of thyroxine (Blake and Oatley, 1977; for review see de la Paz et al., 1992) are enclosed in rectangles. The arrows below the amino acid sequences indicate the intron- exon boundaries in the human (Tsuzuki et al., 1985) and mouse (Wakasugi et al., 1986) transthyretin genes.

et al., 1989), but not in reptiles (Achen et al., 1993; Richardson et al., 1994) suggezits that the transthyretin gene was turned on in the liver independently in the lineages leading to birds and eutherians. Marsupials can be divided into two groups, the evolutionarily older Polyprotodonta and the evolutionarily younger Diprotodonta. Living diprotodont marsupial species are only found in Australia. Living polyprotodont marsupial species exist in both America and Australia. The common ancestors for mod- em Polyprotodonta and modern Diprotodonta were polyprotodont and lived in America (for review see Tyndale-Biscoe, 1973). After the separation of Antarctica and Australia, about 40 million years ago (Talent, 1984), marsupials evolved independently in America and Australia. About half (67 species) of all Australian marsupial species have been analysed for transthyretin in blood. A11 studied Australian Polyprotodonta lacked transthyretin in the bloodstream. All studied Diprotodonta pos-

sessed transthyretin in the bloodstream (Richardson et al., 1993, 1994). This suggested the independent evolution of transthyretin gene expression in the liver of birds, eutherians and diprotodont marsupials, less than 40 million years ago. Based on dental characters, reproductive features and serological resemblances it has been postulated that the South American marsupial M. dornestica and the North American marsupial D. virginiana evolved from a common ancestor well after the separation of marsupials into American and Australian lineages (Reig et al., 1987). From this and the data presented in Fig. 1, it may be concluded that the expression of the transthyretin gene in the liver of M. domes- t i c ~ is a fourth example of the independent turning on of the transthyretin gene in the liver, the first three examples being the birds, the eutherians and the diprotodont marsupials. The multiple appearance of transthyretin gene expression in liver during evolution indicates the important function of this second

https://www.researchgate.net/publication/22934824_Protein-DNA_and_protein-hormone_interactions_in_prealbumin_A_model_of_the_thyroid_hormone_nuclear_receptor?el=1_x_8&enrichId=rgreq-8b8d9bf1-9d82-4119-9b27-2360fd130395&enrichSource=Y292ZXJQYWdlOzE1MzQ4NjQxO0FTOjE0OTQzNDczODQxNzY2NEAxNDEyNjM5NDI2NDkx


Duan et al. (Eur: J. Biochem. 227)

12 -

405

-

5

* A * * *

HUMAN

RAT

MOUSE

GUG GCC

GUG GCC

GUG AUC

GGA CCA CUG GUG UCC

GCA CCA CUG GUU UCA

SUGARGLIDER GfA c:u V A H * G E D *

V A H * A E D * DUNNART GGA ccu * * MONODELPHIS c:u V I H * A E D *

CHICKEN A * L V S H * S V D * A * L V S H * S I D * LIZARD

Fig.8. Nucleotide and amino acid sequences around the border of exon 1 and intron 1 in transthyretin precursor mRNA. The region corresponding to the 5' end of intron 1 of the precursor mRNAs in placental mammals is indicated by a box. It is not expressed in mature eutherian transthyretin mRNA. The fictitious amino residues which would result from a hypothetical translation are given in open letters.

r r Opossum

Chicken 22 I ' 12 'O

I Lizard

Fig. 9. Phylogenetic analysis using parsimony (PAUP) of the evolution of transthyretin. The entire amino acid sequence of the primary translation product of transthyretin mRNAs was used in the analysis with lizard transthyretin as an outgroup. The numbers indicate the changes in amino acid residues in the transthyretin amino acid sequence from ancestor to living vertebrate species.

source (after the choroid plexus) of transthyretin in the body of endothems. The selection pressure leading to the expression of the transthyretin gene in liver might have been the need for intravascular pools of thyroxine. Sufficient intravascular pools of thyroxine-binding proteins are necessary for even distribution of thyroxine in tissues (Mendel et al., 1987, 1988). They are cre- ated by specific proteins reducing the partitioning of thyroxine into lipid membranes.

We are very grateful to Mrs M. Cai for processing nucleic acid sequence data, to Mr G. Knott for assistance in surgical procedures with M. domestica and to Drs A. Aldred and M. Schreiber for critically reading the manuscript. The help of Mrs J. Guest in word processing is also much appreciated. This work was supported by the National Health and

4 P

.CI

0 0 c 2 d

1 W x Divergence time (years)

Fig. 10. Molecular clock for transthyretin. The number of point accepted mutations (PAM) per 100 amino acid residues is plotted against the time since divergence of species. These times, in millions of years, were assumed to be 30 for rats/mice (Wilson et al., 1977; Brownell, 1983; Janke et al., 1994), 70 for rabbitdrodents (Novacek, 1992), 80 for the mammalian radiation (McLaughlin and Dayhoff, 1972), 80 for AmericadAustralian marsupials (Reig et al., 1987; Westerman et al., 1990), 130 for eutherians/marsupials (Air et al., 1971; Carroll, 1988; Novacek, 1992; Janke et al., 1994), 220 for birdreptiles (McLaughlin and Dayhoff, 1972), and 300 for eutherians/birds-reptiles (McLaughlin and Dayhoff, 1972).

Medical Research Council of Australia and the Australian Research Council.

REFERENCES Achen, M. G., Harms, P. J., Thomas, T., Richardson, S. J., Wettenhall,

R. E. H. & Schreiber, G. (1992) J. Biol. Chem. 267, 23170-23174. Achen, M. G., Duan, W., Pettersson, T. M., Harms, P. J., Richardson, S.

J., Lawrence, M. C., Wettenhall, R. E. H., Aldred, A. R. & Schreiber, G. (1993) Am. J. Physiol. 265, R982-R989.

Air, G. M., Thompson, E. 0. P., Richardson, B. J. & Sharman, G. B. (1971) Nature 229, 391-394.

Aldred, A. R. Pettersson, T. M., Harms, P. J., Richardson, S. J., Duan, W., Tu, G.-F., Achen, M. G., Nicol, S. & Schreiber, G. (1992) in Platypus and echidnas. (Augee, M. L., ed.) pp. 44-52, The Royal Zoological Society of New South Wales, Sydney.

Blake, C. C. F. & Oatley, S. J. (1977) Nature 268, 115-120. Blake, C. C. F., Geisow, M. J., Swan, I. D. A,, Rtrat, C. & RCrat, B.

Blake, C. C. F., Geisow, M. J., Oatley, S. J., Rkrat, B. & RCrat, C. (1978)

Brack, C., Duan, W., Hulbert, A. J. & Schreiber, G. (1994) Comp. Bio-

Brownell, E. (1983) Evolution 37, 1034-1051. Carroll, R. L. (1988) Vertebrate paleontology and evolution, W. H. Free-

Chevret, P., Denys, C., Jaeger, J.-J., Michaux, J. & Catzeflis, F. M.

Cole, T., Dickson, P. W., Esnard, F., Averill, S., Risbridger, G. P., Gau-

Davis, B. J. (1964) Ann. N. I.: Acad. Sci. 121, 404-427. Davis, P. J. & Jurgelski, W. Jr (1973) Endocrinology 92, 822-832. Dayhoff, M. O., ed. (1978) Atlas of protein sequence and structure,

vol. 5 , suppl. 3, pp. 375, National Biomedical Research Foundation, Washington DC.

Dayhoff, M. O., Barker, W. C. & Hunt, L. T. (1983) Methods Enzyrnol. 91, 524-545.

de la Paz, P., Bumdge, J. M., Oatley, S. J. & Blake, C. C. F. (1992) in The design of drugs to macromolecular targets (Beddel, C. R., ed.) pp. 119-172, John Wiley & Sons, Chichester.

(1974) J. Mol. Biol. 88, 1-12.

J. Mol. Biol. 121, 339-356.

chem. Physiol. B, in the press.

man, New York.

(1993) Proc. Natl Acad. Sci. USA 90, 3433-3436.

thier, F. & Schreiber, G. (1989) Eur: J. Biochem. 186, 35-42.

Dickson, P. W. & Schreiber, G. (1986) Neurosci. Lett. 66, 311-315. Dickson, P. W., Howlett, G. J. & Schreiber, G. (1982) Eur: J. Biochem.

129, 289-293.


https://www.researchgate.net/publication/274300101_Vertebrate_Paleontology_and_Evolution?el=1_x_8&enrichId=rgreq-8b8d9bf1-9d82-4119-9b27-2360fd130395&enrichSource=Y292ZXJQYWdlOzE1MzQ4NjQxO0FTOjE0OTQzNDczODQxNzY2NEAxNDEyNjM5NDI2NDkx

https://www.researchgate.net/publication/274300101_Vertebrate_Paleontology_and_Evolution?el=1_x_8&enrichId=rgreq-8b8d9bf1-9d82-4119-9b27-2360fd130395&enrichSource=Y292ZXJQYWdlOzE1MzQ4NjQxO0FTOjE0OTQzNDczODQxNzY2NEAxNDEyNjM5NDI2NDkx

https://www.researchgate.net/publication/284249618_Atlas_of_Protein_Sequence_and_Structure?el=1_x_8&enrichId=rgreq-8b8d9bf1-9d82-4119-9b27-2360fd130395&enrichSource=Y292ZXJQYWdlOzE1MzQ4NjQxO0FTOjE0OTQzNDczODQxNzY2NEAxNDEyNjM5NDI2NDkx



406 Duan et al. (Eul: J. Biochem. 227)

Dickson, P. W., Aldred, A. R., Marley, P. D., Tu, G.-F., Howlett, G. J. & Schreiber, G. (19 th ) Biochem. Biophys. Res. Commun. 127, 890- 895.

Dickson, P. W., Howllett, G. J. & Schreiber, G. (1985b) J. Biol, Chem. 260, 8214-8219.

Dickson, P. W., Aldred, A. R., Marley, P. D., Bannister, D. & Schreiber, G. (1986) J. Biol. Chem. 261, 347553478,

Dickson, P. W., Aldre’d, A. R., Menting, J. G. T., Marley, P. D., Sawyer, W. H. & Schreiber, G. (1987) J. Biol. Chem. 262, 13907-13915.

Doolittle, R. F. (1994) Trends Biochem. Sci. 19, 15-18. Duan, W., Cole, T. & Schreiber, G. (1989) Nucleic Acids Res. 17, 3979. Duan, W,, Achen, M. G., Richardson, S. J., Lawrence, M. C., Wettenhall,

R. E. H., Jaworowski, A. & Schreiber, G. (1991) Eut: J . Biochem. 200, 679-687.

Ecclcs, 3. C. (1992) Proc. Natl Acad. Sci. USA 89, 7320-7324. Fung, W.-P., Thomas. T., Dickson, P. W., Aldred, A. R., Milland, J.,

Dziadek, M., Power, B.. Hudson, P. & Schreiber, G. (1988) J. Biol. Chem. 263, 480-488.

Gibbs, P. E. M. & Dugaiczyk, A. (1994) Proc. Natl Acad. Sci. USA 91, 3413 -3417.

Gotoh, 0. (1986) J. Theor: Biol. 121, 327-337. Habgood, M. D., Knott, G. W., Dziegielewska, K. M. & Saunders, N.

R. (1993) J. Physiol. (Lond.) 468, 73-83. Hamilton, J. A,, Steinrauf, L. K., Braden, B. C., Liepnicks, J., Benson,

M. D., Holmgren, G., Sandgreen, 0. & Steen, L. (1993) J. Biol. Chem. 268,241662424.

Harms, P. J., Tu, G.-F., Richardson, S. J., Aldred, A. R., Jaworowski, A. & Schreiber, G. (1991) Comp. Biochem. Physiol. 99B, 239-249.

Herbert, J., Wilcox, J. N., Pham, K.-T. C., Fremeau, R. T. Jr, Zeviani, M., Dwork, A,, Soprano, D. R., Makover, A,, Goodman, D. S., Zim- merman, E. A,, Roberts, J. L. & Schon, E. A. (1986) Neurology 36, 900 - 91 1.

Hillier, A. P. (1970) J. Physiol. ( h n d . ) 211, 585-597. Jaeger, J.-J., Tong, H. & Denys, C. (1986) C. R. Acad. Sci. 14, 917-

Janke, A,, Feldmaier-Fuchs, G., Thomas, W. K., Haeseler, A. V. &

Jukes, T. H. (1980) Science 210, 973-978. Kanda, Y., Goodman, D. S., Canfield, R. E. & Morgan, F. J. (1974) J.

Biol. Chem. 249, 6796-6805. Kent, G. C. (1987) Comparative anatomy of the vertebrates, 6th edn,

p. 542, Times MirrorfMosby College Pub., St. Louis, Toronto, Santa Clara.

922.

Paabo, S. (1994) Genetics 137, 243-256.

Laemmli, U. K. & Fane, M. (1973) J. Mol. Biol. 80, 575-599. Larsson, M., Pettersson, T. & Carlstrom, A. (1985) Gen. Comp. Endocri-

nol. 58, 360-375. McLaughlin, P. J. & Dayhoff, M. 0. (1972) in Atlas ofprotein sequence

and structure 1972, vol. 5, pp. 47-52, National Biomedical Re- search Foundation, Washington DC.

Mendel, C. M., Weisiger, R. A., Jones, A. L. & Cavalieri, R. R. (1987) Endocrinology 120, 1142- 1749.

Mendel, C. M., Cavalieri, R. R. & Weisiger, R. A. (1988) Am. J. Physiol. 255, E110-EI19.

Mendel, C. M., Cavaliieri, R. R., Gavin, L. A,, Pettersson, T. & Inoue, M. (1989) J. Clin. Invest. 83, 143-148.

Mita, S., Maeda, S., Shimada, K. & Araki, S. (1984) Biochem. Biophys. Rex. Commun. 124, 558-564.

Navab, M., Mallia, A. K., Kanda, Y. & Goodman, D. S. (1977) J. Biol. Chem. 252, 5100-5106.

Nicoloff, J. T. (1986) in Werner’s the thyroid (Ingbar, S. H. & Braver- man, L. E., eds) pp. 128-135, Lippincott, Philadelphia.

Novacek, M. J. (1992) Nature 356, 121-125. Orcutt, B. C., George, 13. G., Fredrickson, J. A. & Dayhoff, M. 0. (1982)

Nucleic Acids Res. 10, 157 - 174.

Orcutt, B. C., George, D. G. & Dayhoff, M. 0. (1983) Annu. Rev. Bio-

Omstein, L. (1964) Ann. N. I! Acad. Sci. 121, 321-349. Padgett, R. A., Grabowski, P. J., Konarska, M. M., Seiier, S. & Sharp,

P. A. 1986) Annu. Rev. Biochem. 55, 1119-1150. Pardridge, W. M. & Mietus, L. J. (1980) J. Clin. Invest. 66, 367-374. Reig, 0. A., Kirsch, J. A. W. & Marshall, L. G. (1987) in Possums and

opossums: studies in evolution (Archer, M., ed.) vol. 1, pp. 1-89, Surrey Beatty & Sons, Chipping Norton NSW.

Richardson, S. J., Bradley, A. J., Duan, W., Southwell, B. R., Selwood, L. & Schreiber, G. (1993) Gen. Comp. Endocrinol. 90, 177-182.

Richardson, S. J., Bradley, A. J., Duan, W., Wettenhall, R. E. H., Harms, P. J., Babon, J. J., Southwell, B. R., Nicol, S., Donnellan, S. C. & Schreiber, G. (1994) Am. J. Physiol. 266, R1359-R1370.

Robbins, J. & Edelhoch, H. (1986) in Werner’s the thyroid (Ingbar, S. H. & Braverman, L. E., eds) pp. 116-127, Lippincott, Philadelphia.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd edn, Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY.

Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Nut1 Acad. Sci. USA 74, 5463-5467.

Sasaki, H., Yoshioka, N., Takagi, Y. & Sakaki, Y. (1985) Gene (Amst.) 37, 191-197.

Schreiber, G., Pettersson, T. M., Southwell, B. R., Aldred, A. R., Harms, P. J., Richardson, S. J., Wettenhall, R. E. H., Duan, W. & Nicol, S. C. (1993) Comp. Biochem. Physiol. 105B, 317-325.

Southwell, B. R., Duan, W., Tu, G.-F. & Schreiber, G. (1991) Comp. Biochem. Physiol. IOOB, 329-338.

Southwell, B. R., Tu, G.-F., Duan, W., Achen, M., Harms, P. J., Aldred, A. R., Richardson, S. J., Thomas, T., Pettersson, T. M. & Schreiber, G. (1992) Acta Med. Austriaca, 19 ( S I ) , 28-31.

Southwell, B. R., Duan, W., Alcom, D., Brack, C., Richardson, S. J., Kohrle, J. & Schreiber, G. (1993) Endocrinology 133, 2116-2126.

Stauder, A. J., Dickson, P. W., Aldred, A. R.. Schreiber, G., Mendelsohn, F. A. 0. & Hudson, P. (1986) J. Histochem. Cytochem. 34, 949- 952.

Sunderlin, J., Melhus, H., Das, S., Eriksson, U., Lind, P., TragArdh, L., Peterson, P. A. & Rask, L. (1985) J . Bid. Chem. 260, 6481-6487.

Swofford, D. L. (1991) PAUP: Phylogenetic analysis using parsimony, version 3.1, Illinois Natural History Survey, Champaign IL.

Talent, J. A. (1984) in Phanerozoic earth history of Australia (Veevers, J., ed.) pp. 57-93, Oxford University Press, London.

Tsuzuki, T., Mita, S., Maeda, S., Araki, S. & Shimada, K. (1985) J. Biol. Chem. 260, 12224-12227.

Tu, G.-F., Cole, T., Duan, W. & Schreiber, G. (1989) Nucleic Acids Res. 17, 6384.

Qndale-Biscoe, H. (1973) Life of marsupials (Banington, E. J. W. & Willis, A. J., eds) Edward Amold, London.

Wakasugi, S., Maeda, S., Shimada, K., Nakashima, H. & Migita, S. (1985) J. Biochem. (Toyko) 98, 1707-1714.

Wakasugi, S., Maeda, S. & Shimada, K. (1986) J. Biochem. (Tokyo) 100,

Westerman, M., Janczewski, D. N. & O’Brien, S. J. (1990) in Mammals from pouches and eggs: genetics, breeding and evolution of marsupials and monotremes (Graves, J. A. M., Hope, R. M. & Cooper, D. W., eds) pp. 173-181, CSIRO, Australia.

Wilson, A. C. (2991) in Perspectives on cellular regulation: from bacte- ria to cancer (Campisi, J., Cunningham, D. D., Inouye, M. & Riley M., eds) vol. 11, pp. 331-340, Wiley-Liss, New York.

Wilson, A. C., Carlson, S. S. & White, T. J. (1977) Annu. Rev. Biochem. 46, 573-639.

phys. Bioeng. 12, 419-441.

49-58.








Evolution of Transthyretin in Marsupials

Documents