-
Evolution of transducin alpha, beta andgamma subunit gene
families
David Lagman
Degree project in biology, Master of science (1 year),
2010Examensarbete i biologi 30 hp till magisterexamen, 2010Biology
Education Centre, Uppsala University and Department of Neuroscience
unit of PharmacologySupervisors: Dan Larhammar and Görel
Sundström
-
1
Abstract The genomes of modern vertebrates have expanded
due to two rounds of genome duplication (2R) in the ancestor of the
vertebrates, followed by a third genome duplication in the teleost
fish ancestor (3R). Gene duplications can give rise to new
functions (neo-functionalizations), similar and more specialized
functions than the original copy (sub-functionalizations) or no
function at all (due to subsequent loss of the duplicate).
In the vertebrate retina, all cell types probably arose early in
vertebrate evolution. Duplications of the phototransduction genes
may have lead the way for evolving new aspects of vision. As an
example, the rods and cones use similar but different proteins in
their signal transduction. In this study, the focus lies on the
guanine nucleotide-binding proteins (GN) involved in
phototransduction: the transducins. Their function is to mediate
the signal transduction from the photoreceptor proteins, the
opsins, to the effector proteins, the phosphodiesterases.
Transducins are heterotrimeric G-proteins made of three subunits:
alpha, beta and gamma. The zebrafish genome has 15 members of the
alpha subunit family (GNA), 7 members of the beta subunit family
(GNB), and 14 members of the gamma subunit family (GNG). Out of
these, two alpha genes are expressed in the retina: GNAT1 and
GNAT2, closely related to a third member called GNAT3, involved in
the taste pathways. The GNAT1 and GNAT2 genes seem to have diverged
in one of the two rounds of whole genome duplication in early
vertebrates. They share chromosomal regions with inhibitory GNA
(GNAI) genes, and these seem to follow the same duplication
pattern. Phylogenetic analyses of the five members of the beta
subunit family suggest pre-vertebrate duplication of one gene. One
gene gave rise to the first branch, which contains the GNB1-4
genes. At least two of these are expressed in the retina. The other
pre-vertebrate gene is distantly related to GNB1-4 and has just one
member, GNB5. The gene giving rise to the GNB1-4 genes duplicated
in the vertebrate ancestor after the split from urochordates,
probably in the two rounds of genome duplication. GNB1 and GNB3 are
expressed in the retina. GNB3 shows a high evolutionary rate and
underwent an extra duplication in teleosts, giving rise to GNB3a
and GNB3b. Any differences between these in function or expression
pattern have yet to be investigated. The gamma subunit family
consists of four branches that already existed before the
vertebrate genome duplications. Many genes in these groups were
further duplicated in the early vertebrate and teleost genome
duplications. The GNGT1 and GNGT2 have been reported to be
expressed in retinal photoreceptor cells. These two genes seem to
have been duplicated in 2R. The main aim of this project is to sort
out the evolution, expression patterns and neo- or
subfunctionalizations of the different phototransduction cascade
genes using bioinformatic and molecular tools, starting with the
transducins.
-
2
Introduction
Vision Photoreception, as a sense for guidance, is widely
adopted in multicellular organisms. It is present in many forms and
for many different uses. In some organisms photoreception is mainly
for detecting possible changes in the environment by feeling
differences in light intensities. Other organisms have evolved
special organs for visualising the environment, eyes. Vertebrates
possess a so-called single lens camera eye. The eye is made of
conjunctiva, sclera, lens and neural retina (Fig. 1). The retina
connects to the brain via the optic nerve. The neural retina is the
photoreceptive part of the eye and is built up of several layers
(Fig. 1), which are from the outside in: outer segment, outer
nuclear layer, outer plexiform layer, inner nuclear layer, inner
plexiform layer and ganglion cell layer. The outer segment contains
the photoreceptor parts in which the photoreception for vision
takes place. In the outer plexiform layer the photoreceptor cells
connect to horizontal and bipolar cells, which have their cell
bodies in the inner nuclear layer. The bipolar cells project down
to the inner plexiform layer where they connect to amacrine cells
and ganglion cells. Amacrine cell bodies are located in the inner
nuclear layer while the ganglion cell bodies are located in the
ganglion cell layer (Lamb 2009).
Figure 1: General structure of the vertebrate eye and
neural retina. A) Schematic picture of the vertebrate eye
structure. B) Schematic picture of the vertebrate neural retina
with its cells. Illustration by David Lagman
Photoreceptor cells
The photoreceptor cells are specialized neuroepithelial cells.
They are found in a variety of forms in the animal kingdom
subdivided in two major types of photoreceptor cells. The oldest
form of photoreceptors is called ciliary photoreceptor cell and is
most abundant in today’s vertebrate eyes. The other type is the
rhabdomeric photoreceptor present in many of the modern
invertebrates. The common ancestor to both types of photoreceptors
is believed to have been a ciliary photoreceptor cell. The
rhabdomeric photoreceptor cell has its apical surface tilted 90° so
that it points to the side. In the apical surface are the zonula
adherens (ZA), the fly stalk and the rhabdomes. The ciliary
photoreceptor cells consist of a cell body, ZA, inner segment (IS),
a connecting cilium and the outer segment (OS). In the outer
segment
-
3
of the ciliary photoreceptors there are several folded inner
membranes on which the opsins and all the components of the
phototransduction cascade are located (Lamb 2009).
Phototransduction cascade
The phototransduction cascade in a ciliary photoreceptor (Fig.
2) consists of many different components crucial for the
initiation, transmission and termination of signalling. The cascade
starts at the opsin level. Opsins are seven-transmembrane G-protein
coupled receptors (GPCR) with a prosthetic group consisting of a
retinal molecule in an 11-cis-retinal conformation. Light induces a
conformational change in the retinal molecule to all-trans-retinal,
which in turn changes the conformation of the opsin to an activated
state. The activated opsin binds the G-protein named transducin.
Transducin is a heterotrimeric G-protein and consisting of GNA, GNB
and GNG. Transducins are involved in both taste and vision pathways
(Oldham and Hamm 2006). The G-proteins are a family of proteins
that act in different signalling pathways of cells through similar
intrinsic mechanisms. Common to all G-proteins is the binding of a
G-nucleotide where the active GTP form undergoes an intrinsic GTP
hydrolysis to GDP (Wettschureck and Offermanns 2005). GTP/GDP binds
in the GNA subunit. GDP removal makes it possible for a new GTP to
bind the G-protein. The exchange of GDP for GTP is done by a
G-nucleotide exchange factor (GEF), which is often another protein.
For G-proteins that act in GPCR pathways it is the activated GPCR
that acts as a GEF (Wettschureck and Offermanns 2005). Upon
activation, GNA leaves the GNB-GNG dimer (Wettschureck and
Offermanns 2005). GNA then is free to activate the
phosphodiesterase (PDE), which transforms cyclic guanine
mono-phosphate (cGMP) to guanine mono phosphate (GMP). This closes
the cGMP gated ion channel (CNG) due to the decreasing amounts of
cGMP in the cytoplasm (Chen 2005). Closure of the CNG leads to
decreased influx of ions and thus a hyperpolarization of the
photoreceptor cell, which causes the cell to stop its release of
neurotransmitter. The GNA, GNB and GNG subunits mainly expressed in
the retina are; GNAT1 and GNAT2, GNB1 and GNB3 and GNGT1 and GNGT2
(Wettschureck and Offermanns 2005). Under dark conditions and to
recover the normal state cGMP is produced from GMP by guanylyl
cyclase (GC) present in the disc membrane of the photoreceptor
cell.
Figure 2: A schematic picture of the phototransduction
cascade and its components in a vertebrate photoreceptor cell. All
components are shown within the same membrane as believed to be the
case in the ancestor of rods and cones. In rods parts of the
membrane have been internalized into intracellular discs harbouring
some of the signal transduction components, for example rhodopsin.
(Figure from Larhammar et al. 2009 used with permission from
authors and Royal Society Publishing)
-
4
Transducin As previously mentioned transducin is a
heterotrimeric G-protein and therefore encoded by three different
genes. Each heterotrimer consists of one alpha, one beta and one
gamma subunit (Watson et al. 1994; Birnbaumer 2007). The gene
families containing these genes are of varying size, the largest
and most diverge being the alpha subunit gene family followed by
the gamma subunit gene family and the beta subunit gene family.
Guanine nucleotide binding protein subunit alpha
The alpha subunit gene family has fifteen members in the human
genome, which can be subdivided into four different subfamilies
(Wilkie et al. 1992). The subfamilies are the GNAS, GNAI, GNAQ and
G12/13. Each of these four subfamilies has members expressed in
invertebrates as well as vertebrates suggesting an origin before
the common ancestors of vertebrates and invertebrates (Wilkie et
al. 1992). The GNAS subfamily includes the GNAS and GNAolf; GNAI
subfamily includes GNAI1-3, GNAZ, GNAOa, GNAOb and GNAT1-3; GNAQ
subfamily includes GNAQ, GNA11, 14, 15 and 16; GNA12 includes GNA12
and GNA13 (Wilkie et al. 1992). Members of the GNAS subfamily are
stimulatory G proteins that activate adenylyl cyclase. This
increases the levels of the intracellular second messenger cyclic
adenosine mono phosphate (cAMP), which then acts on different
signalling pathways in the cells. An example of a ligand that
induces signalling through GNAS is growth hormone releasing hormone
(GHRH), which binds to a cell surface GPCR, the GHRH receptor
(GHRHR), that in turn activates GNAS (Lania and Spada 2009).
Serotonin (5-HT) also induces GNAS signalling when it binds to the
GPCRs 5-HT4(b) and 5-HT7(a) which in turn couples to GNAS to
up-regulate intracellular cAMP (Norum et al. 2003). The GNAI
subfamily of alpha subunits has received its name due to its
inhibitory effects. The members that share the family name are the
GNAI1-3 proteins and they are most closely related to GNAT1-3.
These two are located close to one another on the same chromosome
(Larhammar et al. 2009). Members of GNAI interact with various
effectors such as adenylyl cyclase and PI3 kinase. The GNAT genes
of this subfamily act on the gamma subunit of phosphodiesterase 6
(PDE6) except for GNAT3 or gustducin, which acts on cAMP-sprcific
Ca/CaM stimulated PDE1A (Birnbaumer 2007). GNAQ subfamily members
act on for example phospholipase Cβ1 and Burton’s tyrosine kinase
(Btk) (Birnbaumer 2007) while GNA12 and GNA13 subfamily members
mediate the signal of growth factors acting on cell surface
receptors, migration of cells and actin turnover in various
processes in the cells (Shan et al. 2006; Wang et al. 2006).
Guanine nucleotide binding protein subunit beta
The G-protein beta subunit gene family have five members
(GNB1-5) (Watson et al. 1994) in vertebrates with additional
duplicates in teleosts. The GNB family belongs to a superfamily of
proteins containing WD40 repeats, but other proteins in this large
superfamily have not been shown to interact with the subunits of
the heterotrimeric G protein (Watson et al. 1994). The GNB genes
have a beta propeller structure that is built up by seven WD40
repeats (Cabrera-Vera 2003). The beta subunit gene family share
very high sequence similarity, 80%-90%, between the GNB1-4
proteins. GNB5 is the most distantly related member of the family
and shares only about 50% identity (Cabrera-Vera 2003). The GNB1-4
genes are expressed widely throughout an organism while GNB5 has
been shown to be expressed only in the central nervous system (Yan
et al. 1996).
-
5
Guanine nucleotide binding protein subunit gamma
The GNB1-4 genes form a very tight complex with the last subunit
member of the heterotrimeric G-protein, GNG. Also GNB5 have been
shown to form complex with GNG but the affinity between GNB5 and
GNG is lower (Wettschureck and Offermanns 2005). The GNG protein
family is a large family with twelve members in the human genome
(Wettschureck and Offermanns 2005), GNGT1, GNGT2, GNG2, GNG3, GNG4,
GNG5, GNG7, GNG8, GNG10, GNG11, GNG12 and GNG13. The GNG genes
encode short 68-70aa peptides. Studies on the interactions between
the five GNB members and the various GNG subunits have revealed
that GNB1 have its highest affinity towards GNGT1 and GNB3 have its
highest affinity towards GNGT2 (Yan et al. 1996), this follows the
notion that GNB1 and GNGT1 has been reported to be expressed
exclusively in rods and GNB3 and GNGT2 exclusively in cones (Yan et
al. 1996; Larhammar et al. 2009; Ritchey et al. 2010).
Whole Genome Duplication In the genomes of vertebrates one can
see remnants of past duplication events in a common vertebrate
ancestor. Susumu Ohno first proposed the theory of evolution by
gene and genome duplications in the vertebrate lineage in the
1970s. He pointed out that for rapid evolution to take place a lot
of new genomic raw material has to be generated in a short time
(Panopoulou and Poustka 2005). Duplicating an organism’s genome can
do this, resulting in new gene copies with relaxed selection
pressure. Two whole genome duplications is believed to have
occurred in a vertebrate ancestor and a third duplication in the
teleost fish ancestor, named 1R, 2R and 3R respectively (first
round 1R, second round 2R and third round 3R) (Dehal and Boore
2005; Sato and Nishida 2010). The Hox gene clusters are clusters of
genes involved in the morphological patterning of all bilaterians
(Mallo et al. 2010). Studies of these genes suggested that the
common ancestor of vertebrates underwent two rounds of whole genome
duplications (Ohno 1999). This conclusion was based on that only
one Hox gene cluster is present in most invertebrates compared to
four in tetrapods (HoxA, HoxB, HoxC and HoxD) and seven to eight in
teleost fish, as predicted by the 2R-3R hypothesis (Santini et al.
2009; Garcia-Fernàndez and Holland 1994; Chambers et al. 2009). The
cephalochordate amphioxus (Branchiostoma floridae) has the same Hox
gene cluster organization as vertebrates but as with invertebrates
they only have one copy of the cluster (Garcia-Fernàndez and
Holland 1994), this indicates that 1R and 2R occurred after the
split from cephalochordates. The agnathans (jawless vertebrates),
hagfish and lampreys, which are the closest extant relatives to the
gnathostomes (jawed vertebrates) are a group of vertebrates to look
at to help find the time point of the duplication events. The
agnathans have at least three Hox gene clusters in their genome
(Sharman and Holland 1998). This suggests a subsequent loss of
duplicate in the agnathan lineage after two rounds of genome
duplications, or it could be that the second round of duplication
occurred after the divergence of agnathans and that the Hox gene
cluster in agnathans have duplicated independently (Sharman and
Holland 1998). More recent studies suggest the latter, that the Hox
gene clusters have been duplicated independently in the lineages of
gnathostomes and agnathans suggesting two Hox gene cluster in their
common ancestor (Fried et al. 2003; Panopoulou and Poustka 2005).
Incidentally the occurrences of four Hox gene clusters coincide
with the appearance of the first jawed vertebrates (Ohno 1999) and
this may have lead the way for the formation of a jaw. The
sequencing of the elephant shark (Callorhinchus milii) genome
revealed a set of four Hox gene clusters in cartilaginous fishes,
which is an basal branch of the vertebrate lineage, further
suggesting that the 2R events occurred before the emergence of
jawed vertebrates (Venkatesh et al. 2007). These studies give a
plausible
-
6
timeframe of when the two rounds of duplications occurred and
would put the 1R just before and 2R after the agnathan/gnathostome
split and an example of that new gene copies can give rise to new
functions (Fig. 3).
Figure 3: Suggested time points of the major whole genome
duplications in the vertebrate lineage. If the first two events
occurred before and after the agnathan split from the other
vertebrates is still debated. Illustration by David Lagman after
(Panopoulou and Poustka 2005).
The four copies of the Hox gene clusters is just one example of
two major duplication events and many other genes in the genomes of
vertebrates show the same pattern of duplications like the
neuropeptide Y (NPY) system (Larsson et al. 2008; Sundström et al.
2008a), the opioid system (Dreborg et al. 2008; Sundström et al.
2010), major histocompatibility complex (MHC) and fibroblast growth
factor receptor (FGFR) genes (Panopoulou and Poustka 2005). Also
extensive analyses using whole genome data from several species
supports the 2R-3R hypothesis (Dehal and Boore 2005; Nakatani et
al. 2007; Kasahara et al. 2007). The mechanisms of
tetraploidization of a genome can be varied. Often it is believed
to be the result of autopolyploidy or allopolyploidy.
Autopolyploidy is when duplication of the genome is taking place in
one species due to problems during for example meiosis, which
results in four copies of each allele other than the normal two
(Larhammar and Risinger 1994; Spring 1997; Wolfe 2001). In
allopolyploidy the genome is doubled due to a hybridization of two
distinct species that may lead to a doubled genome when the
chromosome count is different between the species involved
(Larhammar and Risinger 1994; Spring 1997). Studies of the genomes
of vertebrates make it clear that they are of different sizes but
the greatest variations in sequence length have been shown to
mostly be in non-coding DNA. The genomes of human and fugu
pufferfish, which differs greatly in overall size, contain about
the same amount of coding genes (Ohno 1999). The 2R hypothesis
proposes that invertebrate genes shall have four counterparts in
vertebrates (i.e. orthologs), if no subsequent gene losses have
occurred (Fig. 4)(Panopoulou and Poustka 2005). This is not the
case, revealed as more and more genomes are sequenced. When the
human genome project was finished the human genome was estimated to
have around 25 000 genes which is not much more than the estimated
20 000 genes of invertebrates and it implies a huge loss of
duplicated genes in vertebrates (Panopoulou and Poustka 2005). The
standard response to genome duplication in a cell is to repair it,
therefore the gene duplicates are often lost fast due to several
mechanisms
-
7
Ancestral chromosome
2R
1R
such as deletions or formation of pseudo genes (Sankoff et al.
2010). Studies have shown that the average lifespan of a duplicate
gene is about 4 million years, which may suggests that not all
original duplicates are still around (Lynch and Conery 2003). A
fraction of duplicated genes will be preserved through different
mechanisms. New copies can maintain a similar function as the
original gene (originalization) but also evolve a completely
different function (neofunctionalization). In some cases the
duplicated genes will share function of the ancestral gene
(subfunctionalization). Neo- and subfunctionalized genes can be
preserved for a long time, explaining the retention of certain
duplicates, due to the selection working on such genes (Lynch and
Conery 2003). It is believed that genome duplications can be
correlated with species radiations (Van de Peer et al. 2009). The
3R event is one example that could be one of the major factors
involved in the extensive radiation of the teleost lineage (Van de
Peer et al. 2009; Santini et al. 2009).
Figure 4: The first two whole genome duplication events pictured
by a single chromosome duplicating. Crossed over boxes represent
gene duplicate losses and blue arrows indicate whole genome
duplication events. Illustration by David Lagman.
Whole genome duplications is today most common in plants where
many species is polyploid i.e. have several copies of each
chromosome (Van de Peer et al. 2009). In vertebrates, however, it
is not as clear due to that most of today’s vertebrates are diploid
i.e. have two copies of each chromosome (Van de Peer et al. 2009)
often the result of a regression towards a diploid state after
duplication. This is believed to happen because diversification of
gene copies and their chromsomes over time makes them less similar
to the other in the pair (Wolfe 2001). Examples of extant
tetraploid vertebrates are the African clawed frog Xenopus laevis
and common carp Cyprinus carpio (Larhammar and Risinger 1994).
Aims This degree project is a part of a more extensive project
with the aim to sort out the evolution, expression patterns and
possibly neo- or subfunctionalizations of the different components
of the phototransduction cascade using bioinformatic tools and in
situ hybridizations. The aim of this degree project is to sort out
the evolution of the transducin alpha beta and gamma subunit genes
using mainly bioinformatic tools but also some in situ
hybridization.
-
8
Material and Methods
Zebrafish as a model In this study the experimental procedures
on retinas have been performed on zebrafish (Danio rerio) retinas.
Zebrafish is a good model animal due to its short generation time,
small size and easy care and breeding. Due to its popularity as a
model animal the genome of zebrafish is well studied and its genome
is sequenced and assembled at 6,5 - 7x coverage
(http://www.ensembl.org/Multi/blastview). Another reason for using
zebrafish is that it is a teleost and thus may have more copies of
photoransduction cascade component genes. This gives a possibility
to see if genome duplications in the aspect of vision have given
rise to neo-functionalizations in 3R copies.
Bioinformatic methods Peptide sequences of the transducin
subunit families of different vertebrate species were collected
from the Ensembl genome database (release 57, march 2010,
http://www.ensembl.org/index.html) through their export FASTA file
format function. If sequences were not annotated in Ensembl a known
peptide sequence from closely related species was aligned to the
deposited cDNA clones or the whole genome of the species of
interest using BLAST (Basic Local Alignment Search Tool,
http://blast.ncbi.nlm.nih.gov/Blast.cgi was used for cDNA clones
and http://www.ensembl.org/Danio_rerio/blastview for the genomic
blast) with the method tblastn.
Species included in the study
To give the broad picture of the evolution of the selected gene
families, sequences from several extant vertebrate lineages were
retrieved and analyzed. Grey short-tailed opossum (Monodelphis
domestica), mouse (Mus musculus) and human (Homo sapiens) sequences
were representing mammals and chicken (Gallus gallus) from birds.
From the fish lineage a cartilaginous fish, the elephant shark
(Callorhinchus milii), and four teleost species; zebrafish (Danio
rerio), Medaka (Oryzias latipes), green spotten pufferfish
(Tetraodon nigroviridis), three-spined stickleback (Gasterosteus
aculeatus), was used. Sequences from interesting species in an
evolutionary perspective, like the cyclostome sea lamprey
(Petromyzon marinus), due to their early branching from other
vertebrates was used as well. As representatives from species
diverging before the 2R, sea squirts (Ciona intestinalis and Ciona
savignyi) and amphioxus (Brachiostoma floridae) were used from the
chordate branch and fruit fly (Drosophila melanogaster) and purple
sea urchin (Strongylocentrotus purpuratus) were used from the
non-chordate invertebrates.
Analysis of conserved synteny
Conserved synteny was analyzed by retrieving of lists with gene
family id, position and protein family description of genes located
within a region of 5Mb upstream and 5Mb downstream of the GNA and
GNB genes. This was done using Ensembl’s BioMart function: in
chicken, human and zebrafish. For the GNA family, human GNA genes
were used and protein families that had representatives on at least
two human chromosomes were analyzed. Families that had
representatives on at least two chicken chromosomes and on at least
two chromosomes in human and zebrafish were used in the analysis
regarding the GNB family. The protein sequences of the family
members of the neighbouring gene families were retrieved and
aligned for a Neighbour-Joining (NJ) phylogenetic tree
construction. Trees were
-
9
manually inspected to see if they seemed to have expanded during
the two rounds of genome duplications using relative dating, as
seem to be the case with the GNB and GNAI gene families.
Phylogenetic analyses of gene families
Retrieved sequences were aligned using ClustalW Multiple
Sequence Alignment and manually edited with Jalview 2.5 version
10.0 (Waterhouse et al. 2009). Sequences were edited by taking into
consideration of conserved stretches of sequences, and conserved
domains of the proteins, like the beta propeller of the GNB genes.
From the alignments Neighbor-Joining trees were calculated using
ClustalX 2.0.12 (Larkin et al. 2007) with bootstrap-iterations set
to 1000 using other settings as standard. Trees were visualized
using FigTree v1.3.1. available online at
http://tree.bio.ed.ac.uk/software/figtree/. To test if the same
result would be obtained using other methods for calculating
phylogenetic trees, the alignments GNA and GNB were saved in PHYLIP
format using ClustalX. The PHYLIP file was used to calculate the
best amino acid substitution model using ProtTest 2.4 (Abascal et
al. 2005) available free on
http://darwin.uvigo.es/software/prottest.html. The PHYLIP file was
then uploaded on the PhyML 3.0 (Guindon and Gascuel 2003) web
server (http://atgc.lirmm.fr/phyml/) to calculate a
Maximum-Likelihood tree for the alignments using the amino acid
substitution model suggested by ProtTest. The settings used were,
JTT as substitution model for the GNA alignments and LG for the GNB
alignments. JTT and LG are two different models used to calculate
the substitution of amino acids. Equilibrium frequencies were set
to “empirical”, proportion of invariable sites was set to
“estimated” and 0,0. Eight substitution rate categories were used
and gamma shape parameter was set to “estimated”. SPR was used for
tree improvement. The remaining settings were used as standard in
the program. Bootstrap was used as branch support instead of aLTR
and 100 bootstrap iterations was used. Hundred iterations was used
because of 1000 would have increased the calculation time too much
even though 1000 bootstrap-iterations was used when building the
N-J trees.
Molecular methods
Tissue preparation
Adult zebrafish were anaesthetized in water containing
benzocaine and sacrificed by removing the head from the body. The
lower jaw and gill covers were removed and the heads were placed in
4% paraformaldehyde for 6-7 hours for fixation. Then washed in
phosphate buffered saline (PBS) overnight to remove the fixative,
placed in 10% sucrose solution for 30 minutes followed by 30%
sucrose solution until the head sank to the bottom of the tube,
indicating saturation in the tissue. Subsequently the head was
placed in a mould, covered with Tissue-Tek® O.C.T (Sakura Finetek,
Alphen aan den Rijn, The Netherlands) and frozen. The heads were
sectioned in 12-20 µm thick slices in a cryostat and placed on
microscope slides. After sectioning the slides were left at room
temperature for two hours to let the sections stick to the glass
slide properly. Then they were stored at -80°C until use.
Probe design
A ∼400bp part of the 3’ untranslated region (3’UTR) in the GNAT,
GNB and GNGT genes was used to create ribo-probes for in situ
hybridization on retinal sections. The 3’UTR was
-
10
used instead of the protein-coding region due to the high
sequence similarity between the different protein family members,
it is a measure to prevent cross hybridizations. For the GNGT2 gene
however a 213bp part of the last exon and the 3’UTR was used
instead because of the short 3’UTR in this gene. The sequences for
the probes were amplified from genomic DNA except for GNGT2; in
this case the probe sequence was amplified from complementary DNA
(cDNA) instead.
RNA extraction
cDNA needed for amplification of GNGT2 was synthesized from mRNA
collected from zebrafish eye. RNA was extracted using Qiagen
RNeasy® Mini kit (Qiagen AB, Sollentuna, Sweden) following the
provided protocol. Eyes of zebrafish were placed in a tube
containing RNAlater (100 µl/10 mg tissue). RNAlater was removed
from the sample and 350 µl RLT buffer containing 1%
beta-mercaptoethanol (14.3M, βME, for inhibition of ribo-nucleases)
was added per tube. The samples were homogenized in a sonicator to
disrupt cells. Samples were centrifuged for 3 minutes at maximum
speed. The supernatants were transferred to a new tube and pellets
were discarded. 350 µl of EtOH 70% per tube with supernatants was
added. 700 µl of the solution was then added to a 2 ml spin column
and centrifuged for 15 seconds at 8000 x g, flow-through was
discarded. 700 µl of RW1 buffer was then added to the column and it
was centrifuged again at 15 seconds and 8000 x g, flow through
discarded. The column was then placed in a new tube and 500 µl of
RPE was added to the column and centrifuged for 15 seconds at 8000
x g, flow-through was discarded. This step was repeated once more.
At last the RNA was eluted from the column into a new tube by
adding 50 µl of water to the column and then spin it down for 1
minute at 8000 x g. The amount and quality was then measured with a
Nanodrop® ND-1000 spectrophotometer (NanoDrop products, 3411
Silverside Rd, Wilmington, DE 19810, USA).
PCR – Polymerase Chain Reaction
The 3’UTR sequences were amplified with the designed primers
(table 1) using these settings; initial denaturation 5 min 95°C,
denaturation 30s 94°C, annealing 30s at different temperatures for
each primer pair see table 1, elongation 1 min 72°C, 3’ extension 7
min 72°C and then down to 4°C.
Table 1: Primer pairs used and annealing temperature used in the
amplification of 3’UTR regions.
Gene Forward 5'-3' Reverse 3'-5' Temperature (°C)
gnat1 TGGCTGAATCAACAAAAC TCATCCACCTCACATAGACA 60 gnat2
GCCCCATCCCCACCTAA ATTGCGATCTGATTTCCCACTA 58 gnb1
GTGTGACCCTGTAAGAGAAAAC TCACAGGAGGGCGCATAAACATT 52 gnb3a
TCAAAGAAATCACGCAATAACAGA GGCCCGAATAAGCAGAAGAA 62 gnb3b
CTCCGGAAGACTGGCTGTT CTGTCTGGCATGTAAAAGT 58 gngt1
GACAGAAAATCCCCCAACAT TGAACAGCTAAATTACTCCACCAT 62
gngt2 AGCCTGTCTCTAAAACTG GTCTTCATGTACTAAAACTAA 57
PCR products were visualized on a 1% agarose gel with SYBR®safe
(0,5X TBE buffer, 90V and 500 mA for 50 minutes) to determine if a
region of correct size had been amplified.
-
11
Cloning
PCR products were inserted into a pCR®II-TOPO® TA vector
(Invitrogen, Carlsbad, CA) according to provided protocol. It is a
linearised vector containing single 3’-thymidine overhangs, which
are necessary to bind the PCR products 3’-adenine overhangs.
Topoisomerase I is covalently bound to the vector and ligates the
PCR product into the vector. The vector is constructed in such a
way that the insert is placed inside the lacZ open reading frame.
This region codes for the enzyme β-galactosidase. It cleaves the
X-gal present on the agar plate into galactose and
5-bromo-4-chloro-3-hydroxyindole. The latter is then oxidized to
5,5'-dibromo-4,4'-dichloro-indigo, which colors the bacterial
colonies blue. If the insert is successfully incorporated into the
vector the colonies will not turn blue but stay white because of
their inability to produce β-galactosidase. Non-transfected
bacteria cannot survive on the plate because they are not ampicilin
resistant. Ampicillin resistance gene is provided in the vector.
This makes it possible to screen colonies containing the vector
with insert for analysis. The ligation of the vector and product
was done by adding three units of PCR product, one unit of salt
solution, one unit of water and one unit of pCR®II-TOPO® TA vector
to a tube. The solution was mixed and incubated for five minutes at
room temperature. The reaction mixture was then placed on ice until
transformation into chemically competent TOP10 (Invitrogen,
Carlsbad, CA) Escherichia coli cells, provided with the kit.
Transformation of vectors into chemically competent cells
Two micro liters from each cloning reaction were added to one
vial of One Shot® Chemically component TOP10 Escherichia coli
bacteria. The cells were gently mixed with the vector and incubated
on ice for 30 minutes. Following incubation, the cells were
heat-chocked by incubation at 42°C for 30 seconds, followed by
cooling on ice. S.O.C. medium was later added to the vials and they
were incubated once more for 1 hour in a horizontal shaking
incubator at 200 rpm and 37°C. After the incubation the cells were
spread out on agar plates, containing 50 µg/ml ampicilin and 40
mg/ml X-gal. The plates were placed in 37°C over night. The
following day, white and light blue colonies were collected and
placed in glass tubes containing LB medium with 50 µg/ml ampicilin.
The glass tubes were incubated in the shaking incubator at 37°C
overnight.
Sequencing of vectors
Vectors were purified using Plasmid minikit I (Omega BIO-TEK,
Beaver Ridge Circle Norcross, GA 30071, USA) following the protocol
provided. It is a column-based kit where you first lyses the cells
and remove proteins and then bind the plasmids to a spin-column.
Then follows several washing steps with wash buffer. Finally the
vectors were eluted in 50 µl dH2O and concentration and purity was
measured using a Nanodrop® spectrophotometer. 100 ng of the vector
elute were transferred into tubes to a final volume of 15 µl. To
each tube either M13 forward or M13 reverse primer were added.
These were provided with the cloning kit (table 2).
-
12
Table 2: Sequencing primer sequences.
Primer Sequence
M13 forward 5'-3' GTAAAACGACGGCCAG
M13 reverse 5'-3' CAGGAAACAGCTATGAC
The tubes with vector and primers were sent to a company for
sequencing. The sequencing results were received by email and
analyzed for correct incorporation of PCR product into the
vector.
Results
Bioinformatic results
Guanine nucleotide binding protein subunit alpha
The GNAI genes are represented by five genes in zebrafish and
three-spined stickleback, four genes in medaka and three in green
spotted pufferfish. All tetrapods in the study have three GNAI
genes. Tetrapods have three GNAT genes, GNAT1-3, while teleost fish
seem to have lost one and have two, GNAT1-2. Two genes were found
to have been cloned in sea lamprey (Petromyzon marinus) and two
genes in this family could be indentified in both sea squirts and
amphioxus and one could be found in fruit fly (Fig. 5 and 6).
-
13
Figure 5: NJ tree of the GNAI and GNAT genes. Numbers
after gene name represent amino acid sequence length. Galpha Z and
Galpa O have been used as outgroups since they are the closest
relatives in the superfamily. Hsa = Homo sapiens, Mmu = Mus
musculus, Mdo = Monodelphis domestica, Gga = Gallus gallus, Dre =
Danio rerio, Tni = Tetraodon nigroviridis, Gac = Gasterosteus
aculeatus, Ola = Oryzias latipes, Pma = Petromyzon marinus, Dme =
Drosophila melanogaster, Cioin = Ciona intestinalis, Bfl =
Branchiostoma floridae.
-
14
Figure 6: Maximum-Likelihood phylogenetic tree of the
transducin alpha subunits and their closest relatives, G protein
alpha inhibitory subunits. Galpha Z and Galpa O have been used as
outgroups since they are the closest relatives in the superfamily.
Branches with lower than 50 percent bootstrap support have been
collapsed. Hsa = Homo sapiens, Mmu = Mus musculus, Mdo =
Monodelphis domestica, Gga = Gallus gallus, Dre = Danio rerio, Tni
= Tetraodon nigroviridis, Gac = Gasterosteus aculeatus, Ola =
Oryzias latipes, Dme = Drosophila melanogaster, Cioin = Ciona
intestinalis, Bfl = Branchiostoma floridae.
-
15
Evolution of neighbouring gene families of GNA
Twelve gene families were identified as neighbours to GNAI and
GNAT according to the search criteria and all but one seem to have
expanded during 2R and later some of them in 3R (Fig. 7). The
families identified are; CELSR, RHO, SEMA3, PTPN, PLASM
(plasminogen precursor), CACNA2D, MAGI, PHTF, RSBN, RBM, SLC6A and
PPM. The SLC6A gene family seem to be old and does not seem to have
been duplicated in 2R and therefore was excluded from this study.
The phylogenetic trees of the following gene families are presented
in the appendix.
-
16
Figure 7: GNAT genes and their neighbours. Red box mark
GNAI and GNAT genes. Single genes are located individually on
different scaffolds or by itself on a chromosome. A) human
chromosomes, B) medaka and C) zebrafish.
-
17
Ras homolog, ABC subfamily (RHO) RHOs are ras-like GTPases (like
the alpha subunit of heterotrimeric G-proteins) that are molecular
switches amplifying external signals. They play roles in for
example the dynamics of the actin cytoskeleton (Boureux et al.
2007). The proteins in the RHO ABC subfamily are highly conserved;
urochordate and mammalian sequences are very similar. The high
sequence similarity makes it very hard to get a good phylogenetic
signal and thus no tree is presented of this family. Therefore the
chromosomal positions are more important to deduce their
evolutionary history. In human and chicken there are three RHO
genes (RHOA, RHOB and RHOC) and in teleosts there are more copies
suggesting possible 3R duplicates. Putative Homeodomain
Transcription Factor (PHTF) The gene family encodes possible
transcription factors that contain a homeodomain transcriptional
regulator, it is a 60aa long sequence that recognizes specific DNA
sequences to initiate and control transcription of certain genes
(Manuel et al. 2000). The PHTF gene family have two copies in all
vertebrates studied, which suggests an expansion in 2R and no
further expansion in 3R. (Fig. 14) Round Spermatid Basic 1 (RSBN)
RSBN is a homeobox like protein belived to be involved in round
spermatid maturation arrest (Takahashi et al. 2004). Human and
chicken carry two copies of RSBN in their genomes while teleosts
have three copies. This suggests a 2R expansion with subsequent
loss of two copies and then a 3R expansion in teleosts of the
RSBN1L gene. (Fig. 15) RNA Binding Motif (RBM) RBM is a family of
proteins that belong to the Spen superfamily of proteins, they bind
to specific RNA sequences to repress many signalling pathways
(Hiriart et al. 2005). The RBM gene family follow the same pattern
as RSBN; human and chicken carry two genes RBM15 and RBM15B.
Teleosts carry the same genes but do also carry a putative 3R copy
of RBM15. (Fig. 16) Semaphorin precursor (SEMA3) The SEMA3 peptides
are involved in axonal guidance during nervous system development
(Haupt et al. 2010). The SEMA3 family is a large family where the
ancestor to all extant gnathostomes seems to have had sixteen
members in its genome as a result of the 2R event. In today’s
vertebrates eight of the members seem to have been lost so that the
ancestor of vertebrates in the study had eight members of the
family in its genome. Humans now carry six SEMA3 genes and chicken
eight, in teleosts it varies a bit more. This teleost variation
could possibly be attributed to genomic rearrangements and local
duplications. In teleosts some of the SEMA3 genes seem to have been
duplicated in the 3R event. (Fig. 17) Protein Phosphatase Mg2+/Mn2+
dependent (PPM) PPM proteins are serine/threonine phosphatases that
are monomeric and metal ion dependent, in this case by Mg2+ or Mn2+
(Sun et al. 2009). The PPM family of genes have three members in
tetrapods and three members in teleosts, but all the genes are not
orthologous. Tetrapods have three of the original genes that
probably arose during 2R, teleosts seem to have lost one of these
genes but seem to have a 3R duplicate of one of the two original
genes on the other hand. Tetrapods have PPM1M, PPM1J and PPM1H
while teleosts have PPM1J and two PPM1H genes. (Fig. 18)
-
18
Membrane Associated Guanylate Kinase, WW and PDZ domain
containing (MAGI) The MAGI gene family consists of synaptic
scaffolding proteins that interact with the other proteins of the
postsynaptic density (PSD) (Yamagata and Sanes 2010). The
MAGI gene family have three members in human located on the three
GNAT and GNAI bearing chromosomes, chicken does also have three
MAGI genes. Teleost fish have four different MAGI genes MAGI1-3 and
MAGIX. The MAGI 1-3 genes seem all to have been duplicated in 3R as
well. The MAGI gene family thus seem to have followed a 2R and
later in teleosts 3R duplication pattern. (Fig. 19)
Cadherin, EGF LAG Seven-pass G-type Receptor (CELSR) The members of
the CELSR gene family are cadherins mediating the contact between
neuronal cells during their migration in development and thus
guiding them to the correct spot in the nervous system (Qu et al.
2010). The CELSR gene family have three members in humans,
CELSR1-3, and four in zebrafish, CELSR1a, CELSR1b and CELSR2-3.
This suggests an expansion in 2R and later a possible expansion of
CELSR1b in 3R, but of the teleosts studied only zebrafish has these
two copies in their genome. Chicken has only one CELSR gene
suggesting a loss of all but flamingo 1, as the copy is called.
(Fig. 20) Protein Tyrosine Phosphatases Non-receptor type (PTPN)
This is a family of genes regulate sgnaltransduction pathways by
dephosophorylating tyrosine residues in proteins involved in
various signalling pathways in the cell (Gandhi et al. 2005). The
evolutionary history of the PTPN gene family is not as clear as the
other gene families studied. Two major possibilities are
considered, the first is that the family expanded during 2R, which
resulted in today’s three mammalian copies. The second possibility
is that there were two original genes and that one of them was
duplicated during 2R. The latter scenario is supported by the
placement of the sea squirt and C. elegans orthologs, which
separates PTPN22 and PTPN12 from PTPN18. This is the reason for
presenting the family tree as unrooted. (Fig. 21) Voltage dependent
calcium channel subunit alpha-2/delta (CACNA2D) Is the family of
the alpha-2/delta subunit in the voltage dependant calcium channel
(L-type calcium channel, LTCC)(Burashnikov et al. 2010). The
CACNA2D family divides itself into two major branches separated by
orthologs in invertebrates. Both of these two branches appear to
have expanded in 2R and yielded two human genes on each branch i.e.
four copies in total. The number of genes varies in teleost fish.
One of the genes CACNA2D3 seem to have been duplicated in 3R. (Fig.
22) Plasminogen precursor (PLASM) Plasminogen is a zymogen (enzyme
precursor) involved in dissolving blood cloths (Forsgren et al.
1987). Four genes represent this protein family in human, three in
opossum and chicken and around four in teleost fish. In sea squirts
one can find three genes in this family, however the protein
sequences are very short and thus increases the insecurity of their
relation to each other. The sea squirt genes are placed on
different contigs, which could mean that they are parts of the same
gene. There are two major possibilities on the evolution of this
protein family. The first is that the family expanded in 2R with a
loss of one gene, and then one of the genes (HGF) was duplicated in
3R. The other possibility is an original set of two genes in the
vertebrate ancestor of whom one was duplicated in 2R and later 3R.
(Fig. 23)
-
19
Guanine nucleotide binding protein subunit beta
In the GNB subunit gene family five members were identified in
mammals and birds, eight in zebrafish, six in three-spined
stickleback and green spotted pufferfish, five in medaka and one in
elephant shark. In the invertebrates studied one gene was found in
sea squirts, amphioxus, purple sea urchin and fruit fly (Fig. 8 and
9).
Figure 8: Neighbor-joining tree of all GNB genes. GNB5
have been used as outgroup as it is the closest relative of GNB1-4.
Hsa = Homo sapiens, Mmu = Mus musculus, Mdo = Monodelphis
domestica, Gga = Gallus gallus, Dre = Danio rerio, Tni = Tetraodon
nigroviridis, Gac = Gasterosteus aculeatus, Ola = Oryzias latipes,
Cmi = Callorhinchus milii, Dme = Drosophila melanogaster, Csa =
Ciona savignyi, Cin = Ciona intestinalis, Bfl = Branchiostoma
floridae, Spu = Strongylocentrotus purpuratus.
-
20
Figure 9: Maximum-likelihood phylogenetic tree of the GNB
genes. GNB5 have been used as outgroup as it is the closest
relative of GNB1-4. Branches with lower than 50 percent bootstrap
support have been collapsed. Hsa = Homo sapiens, Mmu = Mus
musculus, Mdo = Monodelphis domestica, Gga = Gallus gallus, Dre =
Danio rerio, Tni = Tetraodon nigroviridis, Gac = Gasterosteus
aculeatus, Ola = Oryzias latipes, Cmi = Callorhinchus milii, Dme =
Drosophila melanogaster, Csa = Ciona savignyi, Cin = Ciona
intestinalis, Bfl = Branchiostoma floridae, Spu =
Strongylocentrotus purpuratus.
Evolution of neighbouring gene families of GNB
Seven gene families were identified as neighbouring gene
families to GNB according to the search criteria mentioned in
materials an methods; SCNN, IFFO, CHD, DVL, MFN, PEX and USP
(figure 9). All but SCNN (Fig. 30) and PEX (Fig. 29) seem to have
expanded during the two rounds of whole genome duplications. SCNN
seems to have expanded after the tetrapod-teleost split due to its
presence only in tetrapod genomes. PEX is a gene family present
on
-
21
some of the GNB-bearing chromosomes but its phylogeny suggests
an old pair that has not expanded during 2R, mostly due to the
orthologs in invertebrates that split PEX5 and PEX5L from each
other. The phylogenetic trees of the following gene families are
presented in appendix.
Figure 10: GNB genes and their neighbours on GNB bearing
chromosomes. Red box mark GNB1-4 genes. A) human chromosomes, B)
chicken and C) zebrafish.
-
22
Chromodomain Helicase DNA binding protein 3-5 (CHD) The CHD3-5
gene subfamily are involved in chromatin remodelling during various
cell processes such as recombination and transcription (Marfella
and Imbalzano 2007). The family has three members in human, two in
chicken and four in medaka. The phylogenetic tree of the gene
family suggests expansion during 2R and later 3R (one of the
members namely CHD4 seem to have been duplicated in 3R). The
zebrafish CHD4 seem to have been duplicated one more time and has a
copy located on chromosome 15. If this copy is non-functional or
not is not known as an inversion of half the gene seem to have
occurred and thus could have rendered it non-functional. (Fig. 24)
Ubiquitin Specific Peptidase (USP) The USP5 and USP13 genes in the
USP gene family hydrolyzes isopeptide bonds between ubiquitin
molecules in a larger unanchored polyubiquitin molecule and thus
disassembles unused polyubiquitins (Reyes-Turcu et al. 2008). The
family follows a 2R duplication pattern with two copies present in
all vertebrate genomes studied. In some genomes there seem to have
occurred some local duplications as can be seen in zebrafish for
USP13 and green spotted pufferfish with USP5. Due to that it is not
the same gene subjected to local duplication it does not seem to be
related events and they probably duplicated in the two lineages
independently. In the beginning it was probably an ancestral copy
of USP that was duplicated in 2R and two of the 2R copies were lost
and that leaves it with today’s two copies. (Fig. 25) Dishevelled
(DVL) The DVL genes have been shown to interact with several
different proteins to regulate, organize and amplify intracellular
signals (Wharton 2003). The family have three copies in human, two
in chicken and between four and five in teleosts; five members in
zebrafish and four in the other three species included in the
study. The phylogenetic tree suggests an expansion of the family
during 2R followed by a duplication of DVL3 in teleosts in 3R.
(Fig. 26) Intermediate Filament Family Orphan (IFFO) Intermediate
filaments are important components of the cells skeleton and
nuclear envelope of eukaryotic cells (Steinert and Roop 1988). The
IFFO gene subfamily is present in two copies in human and chicken.
Teleosts have a varying amount of IFFO genes in their genomes
(Appendix). Zebrafish have four copies located on four different
chromosomes, namely 16, 19, 11 and 23, tetraodon have three IFFO
genes located on two chromosomes suggesting a local duplicate of
IFFO2. In medaka there are three IFFO genes present on three
chromosomes; 1, 16 and 11. The zebrafish IFFO located on chromosome
19 and the medaka IFFO located on chromosome 16 share chromosome
with an GNB3a each. These IFFO are called IFFO1 and can in both
species also be found on the same chromosome as GNB3b, zebrafish 19
and medaka 11. This suggests a 3R duplication of IFFO1 in the
teleosts according to chromososmal posistions but also if one look
at the NJ tree of IFFO. (Fig. 27) Mitofusin (MFN) Mitofusins are
involved in fusion of mitochondria and are located on their outer
membrane (Santel and Fuller 2001; Gegg et al. 2010). The MFN gene
family have two copies in human and chicken, and three copies in
all fish but tetraodon, which have two copies. The family thus seem
to have expanded during 2R then lost two of the original copies.
The presence of an extra copy in zebrafish, medaka and three spined
stickleback suggests an extra duplication of MFN1 in 3R. (Fig.
28)
-
23
Guanine nucleotide binding protein subunit gamma
Twelve members of the GNG gene family were identified in
mammals, eleven in birds and twelve in zebrafish. In the
invertebrates two GNG genes could be identified in sea squirts,
three in amphioxus and two in purple sea urchin. However the amino
acid sequences are too short (68-70aa) to make a reliable
phylogenetic tree, therefore the chromosomal positions was also
analyzed. The GNG genes cluster into four branches according to
their chromosomal positions marked with a separate colour for each
branch (figure 10).
Figure 11: N-J tree of the GNG alignments showing the four
major branches within the GNG family. The GNGT1, GNG11 and GNGT2
cluster together in one branch. GNGT1 and GNGT2 is the two involved
in the signal transduction cascade in the eye. The other three
branches contain genes involved in other intracellular signal
transduction cascades. The different colour of the branches
represents the four major groups. Hsa = Homo sapiens, Mmu = Mus
musculus, Mdo = Monodelphis domestica, Gga = Gallus gallus, Dre =
Danio rerio, Tni = Tetraodon nigroviridis, Gac = Gasterosteus
aculeatus, Ola = Oryzias latipes, Elu = Esox lucius, Ciona = Ciona
intestinalis, Bfl = Branchiostoma floridae, Spu =
Strongylocentrotus purpuratus.
-
24
ONL INL
Molecular results The 3’UTR of GNA, GNB and GNG genes were
successfully cloned into the vectors and sequenced. This region was
used because of the high sequence similarity of the coding region
between the subunit genes within each family. All purified vectors
contained the correct insert. An in situ hybridization had been
finished at the time of writing this report. The probe used in this
experiment was the GNAT1 3’UTR probe and it shows an expression in
cells of the outer nuclear layer, inner nuclear layer and some
cells at the surface of the retina (figure 11). This suggests
expression of GNAT1 in photoreceptors but as only one probe is used
we cannot tell whether it is expressed in rods or cones or
both.
Figure 12: in situ hybridization using GNAT1 3'utr riboprobe.
Showing expression of GNAT1 in the outer nuclear layer (ONL) and
inner nuclear layer (INL)
Discussion
Evolution The three GNAT and three GNAI genes seem to have
expanded before the emergence of vertebrates. In the NJ tree (Fig.
5) of the GNAI and GNAT gene family one can see that they are
separated by putative orthologs in invertebrates (sea squirts and
amphioxus) suggesting an ancient duplication that lead to the
vertebrate ancestral pair. Thus the GNAT and GNAI genes were likely
present in the vertebrate ancestor (Fig. 5). Teleosts, such as
zebrafish, have duplicate GNAI2 genes, GNAI2 and GNAI2L. These
copies are located on different chromosomes and seem to be the
result of the 3R duplication. No 3R copies of the GNAT genes have
been retained. Two genes in the family have been cloned in sea
lamprey, GNATS and GNATL. These cluster with GNAT1 in the NJ tree
(Fig. 5). The topology of the NJ tree is supported by the maximum
likelihood (ML) analysis of the same gene family in that it shows
two clear clusters: GNAI-GNAI2-GNAI3 and GNAT1-GNAT2-GNAT3 (Fig.
6). However there is not bootstrap support within each cluster to
resolve the relationships between the genes, except to suggest the
duplication of an ancestral gene that lead to the formation of
GNAI3 and GNAI1. In this case the chromosomal locations of the
genes in question could help resolve the evolution of the gene
family. The GNAT genes are located on three different chromosomes
and next to each one of the three copies there is a GNAI located.
This suggests that an ancestral pair of GNA genes duplicated during
2R as mentioned above to give eight copies. Later one of the 2R
copies of both genes was lost and today’s six copies were retained.
Then one of the GNAT genes, namely GNAT3, was lost in the teleost
fish lineage. The teleost genes named GNAT3, as one can see in the
phylogenetic trees (Fig. 5 and 6), cluster with the zebrafish and
tetrapod GNAT2 genes, thus I propose a renaming of these to
-
25
GNAT2. All neighbouring gene families studied seem to have
expanded in 2R and show the same duplication pattern as the GNAT
and GNAI genes, which support this scenario. In tetrapods these
chromosomal regions show conserved synteny (Fig. 7). However in
teleost fishes the gene family members are spread out on several
chromosomes suggesting extensive chromosomal rearrangement in this
region in the teleost lineage (Fig. 7). The sequence alignments and
phylogenetic analyses of the beta subunits suggest two ancestral
genes before the emergence of vertebrates, out of which one
subsequently quadrupled in 1R and 2R and duplicated in 3R. This
resulted in five genes in humans and eight genes in zebrafish, for
example. GNB1 has undergone local duplication in zebrafish giving
GNB1 and GNB1L. The chromosome locations of these genes support
this scenario. As visible from the NJ tree (Fig. 8), GNB5 have two
putative orthologs in sea squirts and fruit fly suggest an origin
before the protostome-deuterostome split. The GNB1-4 genes are more
closely related to one another and seem to share putative orthologs
in several invertebrates suggesting 2R expansion. However in
phylogenetic analyses including sea squirts, purple sea urchin and
amphioxus putative orthologs for GNB, the GNB3 genes place
themselves before the split between vertebrates and invertebrates
(Fig. 8). This may be explained by the relatively rapid
evolutionary rate that the GNB3 genes have been subjected to as
seen in figure 5 where branch length represents evolutionary
distance. An alternative scenario is that they diverged before the
emergence of vertebrates. The ML tree displays a similar picture
but there is not enough bootstrap support to resolve the orthology
relationships to the putative invertebrate orthologs of GNB1-4
(Fig. 9). To resolve this one must look at the chromosomal
positions of the GNB1-4 genes. Analysis of the chromosomal
positions and phylogenies of neighbouring gene families to the GNB
subunits proposes a common origin of the GNB1-4 genes and that they
have expanded in 2R. All the studied neighbouring gene families
follow the same duplication pattern as GNB1-4 and in tetrapods the
chromosomal regions seem to show conserved synteny (Fig. 10).
Neighbouring gene families have members on all GNB bearing
chromosomes. This is in line with what Larhammar et al. (2009)
propose as well, and thus the GNB1-4 genes seem to originate from
the same ancestral chromosome (Larhammar et al. 2009). The GNB5
genes seem to have a pre-vertebrate origin. This supports the
hypothesis of an ancestral vertebrate set of two GNB genes, out of
which GNB1-4 diverged in the two early vertebrate duplication
events, and later in 3R in teleosts. The GNG subunit is made
up of on average 70 amino acids. This does not provide enough
information in the sequence alignment to provide reliable
phylogenetic signal. Thus it is not possible to draw good
conclusions on the interrelationships between the different family
members from a phylogenetic analysis. A crude classification into
different groups is however possible (Fig. 11). The family members
suggested to be expressed in the retina (GNGT1 and GNGT2) cluster
together in the tree, which suggests that they are close relatives.
This cluster also includes the GNG11 gene. This gene is believed to
have arisen in mammals as a local duplication of the GNGT1 gene
(Larhammar et al. 2009). One chicken gene clusters with the
mammalian GNG11 genes. This could either mean that the GNG11 did
not arise in a mammalian ancestor but actually arose before the
emergence of amniotes. Another explanation could be that due to the
short length of the sequence small amino acid substitutions have
made this GNGT1 sequence more similar to GNG11 than the other
GNGT1. In the group with GNG7 and GNG12 it is possible to identify
two representatives of one gene, in zebrafish and northern pike.
This gene is called GNG12L and could be an example of one 3R
duplicate that has been lost in most teleosts but has been retained
in zebrafish and northern pike. This is supported by the fact that
GNG12 and GNG12L in zebrafish are located on different
chromosomes.
-
26
Analyzing the chromosome positions of the gamma subunits
shed more light on the origins. It appears that the subunits
originate from four separate branches present before the emergence
of vertebrates. The first cluster contains the GNG2, 3, 4 and 8,
located in regions on chromosomes 14, 11, 1 and 19. These
chromosome regions seem to originate from the same ancestral
chromosome. The reconstruction of linkage between the amphioxus and
human genomes supports this (Putnam et al. 2008). The bioinformatic
reconstruction of the vertebrate ancestral karyotype does as well
(Nakatani et al. 2007). The next cluster contains GNG5, 7, 10 and
12, located in regions on human chromosomes 1, 19, 9 and 1 that
seem to originate from the same ancestral linkage group as well.
GNG13 genes form a cluster and also seem to originate from a common
ancestral linkage group. The last cluster of gamma subunits
contains GNGT1, GNGT2 and GNG11, members involved in the visual
pathways. The GNGT1 and GNGT2 genes are located in the same
chromosomal regions as the Hox gene clusters. These chromosomes
have previously been reported to have duplicated in 2R (Sundström
et al. 2008b). This division of the family into four separate
branches from four different ancestral vertebrate linkage groups
suggest an old protein family with at least four original members
that have later been duplicated in 2R. Some genes in the different
branches of the family seem to have been duplicated in 3R, but not
the GNGT genes that are involved in the phototransduction
cascade.
Expression The expression studies of the different subunits in
the retina are still ongoing at the time of writing this report and
promise to produce interesting results. Previous studies in the
field have been done using mostly immunohistochemistry. Nelson et
al. (2008) however used in situ hybridizations on zebrafish retinas
and showed a co-expression of rod opsin marker and GNAT1, which
implies that rods use GNAT1 as their alpha subunit (Nelson et al.
2008). They also looked at a marker for cones (rx1) and GNAT2,
which showed co-expression, suggesting GNAT2 as the cone alpha
subunit (Nelson et al. 2008). Expression analysis of the alpha
subunit in lampreys has also been done. Lampreys, which belong to
the agnathans, diverged early in vertebrate evolution, which makes
it of special interest to study which GNAT they use in their
photoreceptors. The phylogenetic analyses of GNAT subunits place
the putative lamprey orthologs at the base of the vertebrate branch
of the GNAT1 subunit (figure 4). This would suggest that both GNAT
subunits present in lampreys are GNAT1 orthologs and that a GNAT2
ortholog may have been lost. Lampreys possess two types of
photoreceptors, the long and short photoreceptors. The specific
identity of short and long photoreceptors in lamprey has long been
debated (Walls 1935; Dickson and Graves 1979). Recent data suggest
that long photoreceptors are cones and short photoreceptors are rod
photoreceptors with several cone-like features (Govardovskii and
Lychakov 1984; Muradov et al. 2008). The view that short
photoreceptors are rods is supported by the expression of GNATS,
which clusters with the rod transducin GNAT1 in the phylogenetic
tree (figure 4), and that they express rhodopsin (Muradov et al.
2008). However long photoreceptors express long wavelength
sensitive opsins (LWS) and appear in other ways to be cones, but
also express GNATL, which diverges basally on the GNAT1 branch
(figure 4) (Muradov et al. 2008). The GNATL expression in LWS
expressing long photoreceptors suggest that GNATL is more of a cone
GNAT even thought it is not in the GNAT2 cluster. This suggests
independent evolution of the two genes in the lineage leading to
lampreys. To further study this GNATS and GNATL have to be included
in a ML analysis, which was not finished at the writing of this
report.
-
27
Using immunohistochemostry on cryosections from macaque retina,
Peng et al. (1992) suggested that GNB1 is expressed in rods and
GNB3 in cones. They also suggest expression of GNGT1 in rods and
GNGT2 in cones by using the same method. However, another study
suggests co-expression of GNB1 and GNB2 in both rods and cones in
chicken, guinea pig (Cavia porcellus), goldfish (Crassius carassius
auratus) and frog (Xenopus (Silurana) tropicalis) retinas (Ritchey
et al. 2010) even thought they mention that the antibody may lack
specificity. The sequence similarity between the members in the
GNAT1-3 family and the members in the GNB1-4 family is very high
and an antibody against one member may crossreact to another. Chen
et al. (2007) shed more light on the tissue specificity of GNGT1.
They used in situ hybridizations on GNGT1 and rhodopsin and found
co-expression in the rods supporting the results of Peng et al.
(1992). Studies have shown that GNGT1 has to be used in the
GNA-GNB-GNG-complex in order to achieve binding to the rhodopsin,
lending further support to the use of GNGT1 in rods (Kisselev and
Gautam 1993). A study on bovine retinas supports the theory that
GNGT2 and GNB3 are used in cones by purifying the G-beta gamma
complex from the retina using a separation technique and
immunohistochemistry on retinal sections (Ong et al. 1995).
Conclusions Phylogenies of the transducin subunits, their
chromosomal positions and the phylogenies of their neighbouring
gene families support the hypothesis that transducin components
expanded during the whole genome duplication events in the
vertebrate lineage (Fig. 13). GNAT1, GNAT2 and GNAT3 together with
their neighbours GNAI1, GNAI2 and GNAI3 seem to have undergone
duplications through the 2R event, with the subsequent loss of one
GNAT and GNAI duplicate before the actinopterygian-sarcopterygian
split. GNAT3 was subsequently lost in the teleost lineage. GNB1-4
seems to have originated from one of two ancestral GNB genes. The
GNB1-4 genes expanded in 2R, followed by a 3R duplication of GNB3,
a possible 3R duplication of GNB4 (seen only in zebrafish) and a
local duplication of GNB1 in zebrafish. GNGT1 and GNGT2 seem to be
the result of 2R, based on their chromosomal position on Hox
bearing chromosomes.
-
28
Figure 13: Deduced evolutionary history of the transducin
subunit genes after the invertebrate-vertebrate split. The mouse
represents mammals and zebrafish teleosts. A) GNAT, B) GNB and C)
GNGT.
This implies that if the expression data available on subunit
distribution in the retina is correct the expansion of these gene
families have contributed with genetic raw material for the
evolution of complex vision in modern vertebrates. The next step is
to test this by performing in situ hybridization experiments on
zebrafish retinas using specific probes targeting each of the
different subunit mRNAs.
-
29
Acknowledgements First I would like to thank Dan Larhammar for
giving me this opportunity to start on this very interesting
project. Thanks go to Christina, Chus, Daniel and Görel for
answering all of my many questions and helping me whenever I didn’t
know what to do. I would also like to thank all the other people in
the lab for good company during lunch and fika.
-
30
References Abascal F, Zardoya R, and Posada D. 2005.
ProtTest: selection of best-fit models of protein
evolution. Bioinformatics (Oxford, England). 21: 2104-2105.
doi:10.1093/bioinformatics/bti263.
Birnbaumer L. 2007. Expansion of signal transduction by G
proteins. The second 15 years or so: from 3 to 16 alpha subunits
plus betagamma dimers. Biochimica et biophysica acta. 1768:
772-793. doi:10.1016/j.bbamem.2006.12.002.
Boureux A, Vignal E, Faure S, and Fort P. 2007. Evolution of the
Rho family of ras-like GTPases in eukaryotes. Molecular biology and
evolution. 24: 203-216. doi:10.1093/molbev/msl145.
Burashnikov E, Pfeiffer R, Barajas-Martinez H, Delpón E, Hu D,
Desai M, Borggrefe M, Häissaguerre M, Kanter R, Pollevick GD,
Guerchicoff A, Laiño R, Marieb M, Nademanee K, Nam GB, Robles R,
Schimpf R, Stapleton DH, Viskin S, Winters S, Wolpert C, Zimmern S,
Veltmann C, Antzelevitch C. 2010. Mutations in the Cardiac L-type
Calcium Channel Associated with Inherited J Wave Syndromes and
Sudden Cardiac Death. Heart Rhythm.
doi:10.1016/j.hrthm.2010.08.026.
Cabrera-Vera TM, Vanhauwe J, Thomas TO, Medkova M, Preininger A,
Mazzoni MR and Hamm HE. 2003. Insights into G Protein Structure,
Function, and Regulation. Endocrine Reviews. 24: 765-781.
doi:10.1210/er.2000-0026.
Chambers KE, McDaniell R, Raincrow JD, Deshmukh M, Stadler PF,
and Chiu C. 2009. Hox cluster duplication in the basal teleost
Hiodon alosoides (Osteoglossomorpha). Theory in biosciences =
Theorie in den Biowissenschaften. 128: 109-120.
doi:10.1007/s12064-009-0056-1.
Chen CK. 2005. The vertebrate phototransduction cascade:
amplification and termination mechanisms. Reviews of Physiology,
Biochemistry and Pharmacology. 154: 101-121.
doi:10.1007/s10254-005-0004-5.
Chen H, Leung T, Giger KE, Stauver AM, Humbert JE, Sinha S,
Horstick EJ, Hansen CA, and Robishaw JD. 2007. Expression of the G
protein T1 subunit during zebraWsh development. Gene. 7: 574-583.
doi:10.1016/j.modgep.2007.01.003.
Dehal P, and Boore JL. 2005. Two Rounds of Whole Genome
Duplication in the Ancestral Vertebrate. PLOS Biology. 3: e314.
doi:10.1371/journal.pbio.0030314.
Dickson DH, and Graves DA. 1979. Fine structure of the lamprey
photoreceptors and retinal pigment epithelium (Petromyzon marinus
L.). Experimental eye research. 29: 45-60.
Dreborg S, Sundström G, Larsson TA, and Larhammar D. 2008.
Evolution of vertebrate opioid receptors. Proceedings of the
National Academy of Sciences of the United States of America. 105:
15487-15492. doi:10.1073/pnas.0805590105.
Forsgren M, Råden B, Israelsson M, Larsson K, and Hedén LO.
1987. Molecular cloning and characterization of a full-length cDNA
clone for human plasminogen. FEBS letters. 213: 254-260.
Fried C, Prohaska SJ, and Stadler PF. 2003. Independent
Hox-cluster duplications in lampreys. Journal of experimental
zoology. Part B, Molecular and developmental evolution. 299: 18-25.
doi:10.1002/jez.b.37.
Gandhi TKB, Chandran S, Peri S, Saravana R, Amanchy, Keshava
Prasad TS, and Pandey A. 2005. A bioinformatics analysis of protein
tyrosine phosphatases in humans. DNA research. 12: 79-89.
doi:10.1093/dnares/12.2.79.
Garcia-Fernàndez J, and Holland PWH. 1994. Archetypal
organization of the amphioxus Hox gene cluster. Nature. 370:
563-566. doi:10.1038/370563a0.
-
31
Gegg ME, Cooper JM, Chau K-Y, Rojo M, Schapira AHV, and Taanman
J-W. 2010. Mitofusin-1 and Mitofusin-2 are ubiquitinated in a
PINK1/parkin dependent manner upon induction of mitophagy. Human
molecular genetics. doi:10.1093/hmg/ddq419.
Govardovskii VI, and Lychakov DV. 1984. Visual cells and visual
pigments of the lamprey,Lampetra fluviatilis. Journal of
Comparative Physiology A. 154: 279-286. doi:10.1007/BF00604994.
Guindon S, and Gascuel O. 2003. A Simple, Fast, and Accurate
Algorithm to Estimate Large Phylogenies by Maximum Likelihood.
Systematic Biology. 52: 696-704. doi:10.1080/10635150390235520.
Haupt C, Kloos K, Faus-Kessler T, and Huber AB. 2010. Semaphorin
3A-Neuropilin-1 signaling regulates peripheral axon fasciculation
and pathfinding but not developmental cell death patterns. The
European journal of neuroscience. 31: 1164-1172.
doi:10.1111/j.1460-9568.2010.07154.x.
Hiriart E, Gruffat H, Buisson M, Mikaelian I, Keppler S, Meresse
P, Mercher T, Bernard OA, Sergeant A, and Manet E. 2005.
Interaction of the Epstein-Barr virus mRNA export factor EB2 with
human Spen proteins SHARP, OTT1, and a novel member of the family,
OTT3, links Spen proteins with splicing regulation and mRNA export.
The Journal of biological chemistry. 280: 36935-36945.
doi:10.1074/jbc.M501725200.
Kasahara M, Naruse K, Sasaki S, Nakatani Y, Qu W, Ahsan B,
Yamada T, Nagayasu Y, Doi K, Kasai Y, Jindo T, Kobayashi D, Shimada
A, Toyoda A, Kuroki Y, Fujiyama A, Sasaki T, Shimizu A, Asakawa S,
Shimizu N, Hashimoto S-I, Yang J, Lee Y, Matsushima K, Sugano S,
Sakaizumi M, Narita T, Ohishi K, Haga S, Ohta F, Nomoto H, Nogata
K, Morishita T, Endo T, Shin-I T, Takeda H, Morishita S, and Kohara
Y. 2007. The medaka draft genome and insights into vertebrate
genome evolution. Nature. 447: 714-719.
doi:10.1038/nature05846.
Kisselev O, and Gautam N. 1993. Specific interaction with
rhodopsin is dependent on the gamma subunit type in a G protein.
The Journal of biological chemistry. 268: 24519-24522.
Lamb TD. 2009. Evolution of vertebrate retinal photoreception.
Philosophical transactions of the Royal Society of London. Series
B, Biological sciences. 364: 2911-2924.
doi:10.1098/rstb.2009.0102.
Lania A, and Spada A. 2009. G-protein and signalling in
pituitary tumours. Hormone research. 71: 95-100.
doi:10.1159/000192446.
Larhammar D, and Risinger C. 1994. Molecular genetic aspects of
tetraploidy in the common carp Cyprinus carpio. Molecular
phylogenetics and evolution. 3:59-68.
doi:10.1006/mpev.1994.1007.
Larhammar D, Nordström K, and Larsson TA. 2009. Evolution of
vertebrate rod and cone phototransduction genes. Philosophical
transactions of the Royal Society of London. Series B, Biological
sciences. 364: 2867-2880. doi:10.1098/rstb.2009.0077.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,
McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD,
Gibson TJ, and Higgins DG. 2007. Clustal W and Clustal X version
2.0. Bioinformatics (Oxford, England). 23: 2947-2948.
doi:10.1093/bioinformatics/btm404.
Larsson TA, Olsson F, Sundstrom G, Lundin L-G, Brenner S,
Venkatesh B, and Larhammar D. 2008. Early vertebrate chromosome
duplications and the evolution of the neuropeptide Y receptor gene
regions. BMC evolutionary biology. 8.
doi:10.1186/1471-2148-8-184.
Lynch M, and Conery JS. 2003. The evolutionary demography of
duplicate genes. Journal of structural and functional genomics. 3:
35-44.
-
32
Mallo M, Wellik DM, and Deschamps J. 2010. Hox genes and
regional patterning of the vertebrate body plan. Developmental
biology. 344: 7-15. doi:10.1016/j.ydbio.2010.04.024.
Manuel A, Beaupain D, Romeo PH, and Raich N. 2000. Molecular
Characterization of a Novel Gene Family (PHTF ) Conserved from
Drosophila to Mammals. Genomics. 64: 216–220. doi:10.1006/gen.
Marfella CGA, and Imbalzano AN. 2007. The Chd family of
chromatin remodelers. Mutation research. 618: 30-40.
doi:10.1016/j.mrfmmm.2006.07.012.
Muradov H, Kerov V, Boyd KK, and Artemyev NO. 2008. Unique
transducins expressed in long and short photoreceptors of lamprey
Petromyzon marinus. Vision research. 48: 2302-2308.
doi:10.1016/j.visres.2008.07.006.
Nakatani Y, Takeda H, Kohara Y, and Morishita S. 2007.
Reconstruction of the vertebrate ancestral genome reveals dynamic
genome reorganization in early vertebrates. Genome research. 17:
1254-1265. doi:10.1101/gr.6316407.
Nelson SM, Frey RA, Wardwell SL, and Stenkamp DL. 2008. The
developmental sequence of gene expression within the rod
photoreceptor lineage in embryonic zebrafish. Developmental
dynamics. 237: 2903-2917. doi:10.1002/dvdy.21721.
Norum JH, Hart K, and Levy FO. 2003. Ras-dependent ERK
activation by the human G(s)-coupled serotonin receptors 5-HT4(b)
and 5-HT7(a). The Journal of biological chemistry. 278: 3098-3104.
doi:10.1074/jbc.M206237200.
Ohno S. 1999. Gene duplication and the uniqueness of vertebrate
genomes circa 1970-1999. Seminars in cell & developmental
biology. 10: 517-522. doi:10.1006/scdb.1999.0332.
Oldham WM, and Hamm HE. 2006. Structural basis of function in
heterotrimeric G proteins. Quarterly Reviews of Biophysics. 39:
117-166.
Ong OC, Yamane HK, Phan KB, Fong HKW, Bok D, Lee RH, and Fung
BKK. 1995. Molecular cloning and characterization of the G protein
γ subunit of cone photoreceptors. Journal of Biological Chemistry.
270:8495-8500
Panopoulou G, and Poustka AJ. 2005. Timing and mechanism of
ancient vertebrate genome duplications -- the adventure of a
hypothesis. Trends in genetics : TIG. 21: 559-567.
doi:10.1016/j.tig.2005.08.004.
Peng YW, Robishaw JD, Levine MA, and Yau KW. 1992. Retinal rods
and cones have distinct G protein beta and gamma subunits.
Proceedings of the National Academy of Sciences of the United
States of America. 89: 10882-10886.
Putnam NH, Butts T, Ferrier DEK, Furlong RF, Hellsten U,
Kawashima T, Robinson-Rechavi M, Shoguchi E, Terry A, Yu J-K,
Benito-Gutiérrez E, Dubchak I, Garcia-Fernàndez J, Gibson-Brown JJ,
Grigoriev IV, Horton AC, de Jong PJ, Jurka J, Kapitonov VV, Kohara
Y, Kuroki Y, Lindquist E, Lucas S, Osoegawa K, Pennacchio LA,
Salamov AA, Satou Y, Sauka-Spengler T, Schmutz J, Shin-I T, Toyoda
A, Bronner-Fraser M, Fujiyama A, Holland LZ, Holland PWH, Satoh N,
and Rokhsar DS. 2008. The amphioxus genome and the evolution of the
chordate karyotype. Nature. 453: 1064-1071.
doi:10.1038/nature06967.
Qu Y, Glasco DM, Zhou L, Sawant A, Ravni A, Fritzsch B, Damrau
C, Murdoch JN, Evans S, Pfaff SL, Formstone C, Goffinet AM,
Chandrasekhar A, and Tissir F. 2010. Atypical cadherins Celsr1-3
differentially regulate migration of facial branchiomotor neurons
in mice. The Journal of neuroscience : the official journal of the
Society for Neuroscience 30: 9392-9401.
doi:10.1523/JNEUROSCI.0124-10.2010.
Reyes-Turcu FE, Shanks JR, Komander D, and Wilkinson KD. 2008.
Recognition of polyubiquitin isoforms by the multiple ubiquitin
binding modules of isopeptidase T. The Journal of biological
chemistry 283:19581-19592. doi:10.1074/jbc.M800947200.
-
33
Ritchey ER, Bongini RE, Code KA, Zelinka C, Petersen-Jones S,
and Fischer AJ. 2010. The pattern of expression of guanine
nucleotide-binding protein beta3 (GNB3) in the retina is conserved
across vertebrate species. Neuroscience. 169:1376-1391.
doi:10.1016/j.neuroscience.2010.05.081.
Sankoff D, Zheng C, and Zhu Q. 2010. The collapse of gene
complement following whole genome duplication. BMC Genomics. 11.
doi:10.1186/1471-2164-11-313.
Santel A, and Fuller MT. 2001. Control of mitochondrial
morphology by a human mitofusin. Journal of cell science. 114:
867-874.
Santini F, Harmon LJ, Carnevale G, and Alfaro ME. 2009. Did
genome duplication drive the origin of teleosts? A comparative
study of diversification in ray-finned fishes. BMC evolutionary
biology. 9. doi:10.1186/1471-2148-9-194.
Sato Y, and Nishida M. 2010. Teleost fish with specific genome
duplication as unique models of vertebrate evolution. Environmental
Biology of Fishes. 88: 169-188. doi:10.1007/s10641-010-9628-7.
Shan D, Chen L, Wang D, Tan Y-C, Gu JL, and Huang XY. 2006. The
G protein G alpha(13) is required for growth factor-induced cell
migration. Developmental cell. 10: 707-718.
doi:10.1016/j.devcel.2006.03.014.
http://www.ncbi.nlm.nih.gov/pubmed/16740474.
Sharman AC, and Holland PWH. 1998. Estimation of Hox gene
cluster number in lampreys. Journal of Developmental Biology. 42:
617-620.
Spring J. 1997. Vertebrate evolution by interspecific
hybridisation – are we polyploid? FEBS letters. 400: 2–8.
Steinert PM, and Roop DR. 1988. Molecular and cellular biology
of intermediate filaments. Annual review of biochemistry. 57:
593–625.
Sun W, Yu Y, Dotti G, Shen T, Tan X, Savoldo B, Pass AK, Chu M,
Zhang D, Lu X, Fu S, Lin X, and Yang J. 2009. PPM1A and PPM1B act
as IKKbeta phosphatases to terminate TNFalpha-induced
IKKbeta-NF-kappaB activation. Cellular signalling. 21: 95-102.
doi:10.1016/j.cellsig.2008.09.012.
Sundström G, Dreborg S, and Larhammar D. 2010. Concomitant
Duplications of Opioid Peptide and Receptor Genes before the Origin
of Jawed Vertebrates. PLoS ONE. 5: e10512.
doi:10.1371/journal.pone.0010512.
Sundström G, Larsson TA, Brenner S, Venkatesh B, and Larhammar
D. 2008a. Evolution of the neuropeptide Y family: new genes by
chromosome duplications in early vertebrates and in teleost fishes.
General and comparative endocrinology. 155: 705-716.
doi:10.1016/j.ygcen.2007.08.016.
Sundström G, Larsson TA, and Larhammar D. 2008b. Phylogenetic
and chromosomal analyses of multiple gene families syntenic with
vertebrate Hox clusters. BMC evolutionary biology. 8.
doi:10.1186/1471-2148-8-254.
Takahashi T, Tanaka H, Iguchi N, Kitamura K, Chen Y, Maekawa M,
Nishimura H, Ohta H, Miyagawa Y, Matsumiya K, Okuyama A, and
Nishimune Y. 2004. Rosbin: a novel homeobox-like protein gene
expressed exclusively in round spermatids. Biology of reproduction.
70: 1485-1492. doi:10.1095/biolreprod.103.026096.
Van de Peer Y, Maere S, and Meyer A. 2009. The evolutionary
significance of ancient genome duplications. Nature reviews.
Genetics. 10: 725-32. doi:10.1038/nrg2600.
Venkatesh B, Kirkness EF, Loh Y-H, Halpern AL, Lee AP, Johnson
J, Dandona N, Viswanathan LD, Tay A, Venter JC, Strausberg RL, and
Brenner S. 2007. Survey sequencing and comparative analysis of the
elephant shark (Callorhinchus milii) genome. PLoS biology. 5: e101.
doi:10.1371/journal.pbio.0050101.
Walls GL. 1935. The Visual Cells of Lampreys. British Journal of
Ophthalmology. 19: 129-148. doi:10.1136/bjo.19.3.129.
-
34
Wang D, Tan Y-C, Kreitzer GE, Nakai Y, Shan D, Zheng Y, and
Huang XY. 2006. G proteins G12 and G13 control the dynamic turnover
of growth factor-induced dorsal ruffles. The Journal of biological
chemistry. 281: 32660-32667. doi:10.1074/jbc.M604588200.
Waterhouse AM, Procter JB, Martin DMA, Clamp M, and Barton GJ.
2009. Jalview Version 2--a multiple sequence alignment editor and
analysis workbench. Bioinformatics (Oxford, England). 25:
1189-1191. doi:10.1093/bioinformatics/btp033.
Watson AJ, Katz A, and Simon MI. 1994. A fifth member of the
mammalian G-protein beta-subunit family. Expression in brain and
activation of the beta 2 isotype of phospholipase C. The Journal of
biological chemistry. 269: 22150-22156.
Wettschureck N, and Offermanns S. 2005. Mammalian G Proteins and
Their Cell Type Specific Functions. Physiological Reviews. 85: 1159
-1204. doi:10.1152/physrev.00003.2005.
Wharton KA Jr. 2003. Runnin’ with the Dvl: Proteins That
Associate with Dsh/Dvl and Their Significance to Wnt Signal
Transduction. Developmental Biology. 253: 1-17.
doi:10.1006/dbio.2002.0869.
Wilkie TM, Gilbert DJ, Olsen AS, Chen XN, Amatruda T, Korenberg
JR, Trask BJ, de Jong P, Reed RR, Simon MI, Jenkins NA, and
Copeland NG. 1992. Evolution of the mammalian G protein alpha
subunit multigene family. Nature genetics. 1: 85-91.
doi:10.1038/ng0592-85.
Wolfe KH. 2001. Yesterday’s polyploids and the mystery of
diploidization. Nature reviews. Genetics 2: 333-41.
doi:10.1038/35072009.
Yamagata M, and Sanes JR. 2010. Synaptic localization and
function of Sidekick recognition molecules require MAGI scaffolding
proteins. The Journal of neuroscience : the official journal of the
Society for Neuroscience 30: 3579-3588.
doi:10.1523/JNEUROSCI.6319-09.2010.
Yan K, Kalyanaraman V, and Gautam N. 1996. Differential ability
to form the G protein betagamma complex among members of the beta
and gamma subunit families. The Journal of biological chemistry.
271: 7141-7146.
-
35
Appendix
Neighbouring gene families of GNAT and GNAI
Figure 14: N-J tree with all PHTF family members.
-
36
Figure 15: N-J tree including all RSBN gene family
members.
-
37
Figure 16: N-J tree with all RBM family members.
-
38
Figure 17: NJ tree of all SEMA3 family members.
-
39
Figure 18: N-J tree with all PPM family members.
-
40
Figure 19: NJ tree of all the MAGI gene family
members.
-
41
Figure 20: NJ tree of all CELSR gene family members.
-
42
Figure 21: NJ tree of all PTPN gene family members.
-
43
Figure 22: NJ tree of all CACNA2D family members.
-
44
Figure 15: NJ tree of all PLASMINOGEN gene family
members.
-
45
Neighbouring gene families of GNB
Figure 24: NJ tree of all CHD family members.
-
46
Figure 25: NJ tree of all USP family members.
-
47
Figure 26: NJ tree of all DVL family members.
-
48
Figure 27: NJ tree of all IFFO family members.
-
49
Figure 28: NJ tree of all MFN gene family members.
-
50
Figure 29: NJ tree of all PEX family members.
-
51
Figure 30: NJ tree of all SCNN family members.
ExamensarbetesframsidaLagman.David.report.finishedLagman.David.report.finished.2Lagman.David.report.finished.3Lagman.David.report.finished.4Lagman.David.report.finished.5