Evidence of Evolution Exploring Various Lines of Evidence for the Theory of Evolution
Dec 18, 2015
Evidence of Evolution
Exploring Various Lines of Evidence for the Theory of
Evolution
Lines of Evidence
• DNA Sequences
• Comparative Anatomy
• Embryology
• Transitional Fossils
• Biogeography
• “Genetic Tool Kit”
DNA Sequences
• Scientists are able to isolate pieces of DNA and determine the actual sequence of nucleotides
• Species that are more closely related tend to have more similarities in their DNA
DNA Sequences
• Leptin = protein hormone that is important for regulating body weight and metabolism
• Mice without properly functioning leptin gene are morbidly obese (right) compared to normal mice (left)
Leptin protein
DNA Sequences
• Compare actual sequences of DNA (leptin gene) between three different species= human, chimpanzee, mouse
• Predictions: how much similarity will there be? Who will be most closely related?
DNA Sequences
• First 60 nucleotides:Human: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct
Chimp: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct
Mouse: gaggga tcc ctgctccagc agctgcaagg taaggcccggggcgcgctact ttctcctcca
(Mouse sequence has been shifted to line up as much as possible.)
REMEMBER: Mutations can arise in the DNA sequence in a variety of forms, including nucleotide replacement, insertion, deletion, sequence inversion, etc.
DNA Sequences
• Nucleotides 121-180:Human: agtcaggagg gatgcagggc ggatggctta gttctggact atgatagctt tgtaccgagt
Chimp: agtcaggagg gaggcagggc ggatggctta gttctggact atgatagctt tgtaccgagt
Mouse: aggtcatgtg gacagcttgg tgttgaattc agtagttttg cagcgaggga ctctgcagac
Note how the mouse sequence compares, after so many mutations have accumulated.
REMEMBER: Mutations can arise in the DNA sequence in a variety of forms, including nucleotide replacement, insertion, deletion, sequence inversion, etc.
(Human and Chimp sequences are identical between nucleotides 61-120.)
Comparative AnatomySimilarities in structures
between species suggest they descended from a common ancestor.
Note the color-coded bones for the limbs of these 4 mammals – though different, they share many similar bones. Describe the function of each animal’s limb on your handout.
• http://www.eskeletons.org/
• Click “Comparative Anatomy” link
• Compare: human, chimpanzee, and squirrel monkey
• Predictions: Who would be the most similar and why? What similarities and differences might you expect?
• Follow the directions on your handout!
Comparative Anatomy
Embryology
Ernst von Baer (1828): the more closely related any two species are, the more similar their development as embryos.
In this game, you will look at pictures of embryos and guess what animal it is.
Is it a snake, chicken, possum, cat, bat or human?
Write your guess down on your handout, before you look at the answer!
Embryology
Snake!Are you sure that’s your prediction?
Embryology
Bat!Are you sure that’s your prediction?
Embryology
Cat!Are you sure that’s your prediction?
Embryology
Chicken!Are you sure that’s your prediction?
Embryology
Human!Are you sure that’s your prediction?
Embryology
Possum!Are you sure that’s your prediction?
Biogeography
• Marsupial distribution across the globe: http://evolution.berkeley.edu/evolibrary/article/0_0_0/lines_11
• Distribution today split on two sides of globe – how?
• Review a few facts of the distribution and marsupials, as well as the history of the Earth, then formulate hypothesis behind distribution
Biogeography is the study of the large-scale or global pattern of distribution of species, including the history and causes of this distribution.
For this activity, you will explore the history and cause behind the distribution of marsupials.
Biogeography
• Marsupial distribution across the globe: http://evolution.berkeley.edu/evolibrary/article/0_0_0/lines_11
• Distribution today split on two sides of globe – how?
• Review a few facts of the distribution and marsupials, as well as the history of the Earth, then formulate hypothesis behind distribution
Marsupials are a group of mammals that give birth to live young that develop in an outer pouch of the mother.
Koala
KangarooSugar Glider
Opossum
Bandicoot
Biogeography
There is no evidence of any marsupials able to swim across the ocean. No marsupial has been observed wandering across the Asian mainland. There does not appear to be any route of migration between the two populations of marsupials. How do you think some marsupials ended up halfway across the world from the others?
Biogeography
Continental Drift over millions of years – watch the movement of land masses
Biogeography
Continental Drift + Distribution of Marsupials
Biogeography
Similar reptilian Mesosaurus fossils found in both South America and Africa evidence of continental drift
(couldn’t swim the ocean, no land bridge continents once joined)
Biogeography
Similar reptilian Mesosaurus fossils found in both South America and Africa (couldn’t swim the ocean, no land bridge)
evidence of continental drift (continents once joined)
Transitional Fossils
• Archaeopteryx fossils: multiple specimen found in limestone in Germany
Archaeopteryx: Berlin specimen
Archaeopteryx: Eichstatt specimen
Archaeopteryx: Solnhofen specimen
Whale Evolution
• Video about the transitional forms in the evolution of whales – mammals evolving from land back to sea
• http://www.pbs.org/wgbh/evolution/library/03/4/l_034_05.html
“Genetic Tool Kit”
• Video about Homeobox genes and implications for evolution:
• http://www.pbs.org/wgbh/evolution/library/03/4/l_034_04.html
• Answer the questions on your handout
Eye Evolution
• Video about the evolution of the eye:
• http://www.pbs.org/wgbh/evolution/library/01/1/l_011_01.html
• Answer the questions on your handout