EUSci #4

Dr. Stephen Russell . Sonic Weapons . Animal Emotions . Moon ColoniesOptical Computing . Protein Folding . Designer Synapses . Exoplanets

Web 2.0 . Dr. Alex Weiss . Arts & Reviews . The Edinburgh School

Next Generation Sequencing

Perspectives on sequencing for the masses

You, Me & The MoonHuman colonization of our

nearest neighbour

The University of Edinburgh’s Science Magazine

Web 2.0How is the internet revolution changing the face of research?

Issue 4 September 2009 www.eusci.org

Dr. Stephen Russell: Curing Cancer with VirusesNick Charles profiles Edinburgh alumnus Stephen J Russell, MD, PhD.

What’s That Sound?Alan Boyd warns us that what you can’t hear can hurt you.

Animal Emotions Are No Laughing MatterIgnacio Viñuela-Fernandez investigates the science of laughter in animals.

You, Me & the MoonFrank Dondelinger argues why we should go back to the Moon and stay there.

Is There Light At The End of The Tunnel For All-Optical Computing?Ben Skuse introduces the next revolution in computing technology.

The Protein Folding ProblemJon Manning explores one of the great problems of biology.

Designer SynapsesKatie Marwick scratches her head over the methods and ethics of brain enhancement.

ExoplanetsEdward Duca explores other planets and the possibilties of a second Earth.

Can Web 2.0 Transform Science?Kate Ho taps into how the Internet can help researchers.

Features

12

040102242526283032

Back

Regulars

Sept

embe

r 20

09

Issue 4

contents

16

18

15

19

14

Cover image by Malgorzata Rygier, 4th year undergraduate in Medical Sciences.European Tree Frog (Hyla arborea) near Warsaw, Poland; 2009.

22

FOCUS: Next Generation Sequencing .............Editorials ......................................................................In Brief .........................................................................Initiatives .....................................................................Away from the Bench ..................................................Arts and Reviews .........................................................A Day in the Life of .......................................................History .........................................................................Dr Hypothesis ..............................................................Sci-word .......................................................................

20

23

Issue 4: September 2009

Editor-in-Chief Jonathan Manning

Managing Editors Katie Marwick & Ruth Milne

Pictures EditorsMelinda Hough & Aisling Spain

Production ManagerMelinda Hough

Focus EditorsJonathan Manning & Hayden Selvadurai

News EditorJames Beggs

Publicity OfficerRobbie Marwick

Advertising TeamRuth Milne, Rishikesan Ramaesh, Lasani Wijetunge

In BriefJames Beggs, Laura Dixon, Stylianos Serghiou,

Katherine Staines, Jorine Willems

Focus TeamCatriona Alexander, Kathrine Berggray, Edward Duca,

Jonathan Manning, Hayden Selvadurai

Features WritersAlan Boyd, Frank Dondelinger, Edward Duca, Kate Ho, Jonathan Manning,

Katie Marwick, Emily Pritchard, Ben Skuse, Ignacio Viñuela-Fernandez

Away from the BenchFrank Dondelinger

InitiativesKatherine Staines

A Day in the Life of…Joanna Brooks

Arts and ReviewsJulian Derry, Melinda Hough, Kirsten Shuler

HistoryOlle Blomberg

CrosswordJonathan Manning

Dr HypothesisLowri Griffiths

Page EditorsAlan Boyd, Edward Duca, Lowri Griffiths, Matthew Hartfield,

Annette Leonhard, Katie Marwick, Ruth Milne, Malgorzata Rygier, Stelios Serghiou, Kirsten Shuler, Lasani Wijetunge, Jorine Willems,

Lai Man Natalie Wu

Copy EditorsJim Clegg, Edward Duca, Frank Dondelinger, Sarah Farnworth,

Matthew Hartfield, Katie Marwick, Anneliese Norris, Emily Pritchard, Malgorzata Rygier, Stelios Serghiou, Kirsten Shuler, Jess Smith,

William Watt, Lasani Wijetunge

Pictures TeamCatriona Alexander, Laura Bailey, Mark Blaxter, Olle Blomberg,

Joanna Brooks, Amy Capper, Nick Charles, Xiaowen Chen, Sonya Hallett, Melinda Hough, Julia Kennedy, Amir Kirolos,

Malgorzata Rygier, Aisling Spain, Alex Weiss, Lasani Wijetunge

Production TeamMelinda Hough, Jonathan Manning, Ruth Milne,

Hayden Selvadurai, Lasani Wijetunge

EUSci PresidentMatthew Hartfield 01

Editorial

Welcome to EUSci Issue 4! We’ve a plethora of exciting pieces for you, from our Focus on the fascinating topic of Next Generation Sequenc-ing, to why we should go back to the moon and a profile of a suc-cessful Edinburgh alumnus. Added to that we have all your favourite Regular spots, including news of a fascinating Initiative from the British Science Association.

There are so many people to thank who have supported EUSci during production of this issue. Most important are our many con-tributors to all parts of the process, from authors to production, espe-cially our Pictures Editor Aisling Spain and Production Manager Melinda Hough. Crucial financial support has come from Professor Stephen Chapman, Professor John Mullins (funding from the BHF Centre of Research Excellence), and from the postgraduate Trans-ferable Skills office.

In an exciting development, EUSci has recently won £3,000 from the University’s Roberts fund for our training activities, and we

also owe thanks to everyone who supported this application. With this funding we’ll be able to support our printing costs, buy equipment for podcasting, and start a new series of accessible scientific semi-nars- look out for details on this.

The EUSci podcast continues to prosper under our Pod Master Alan Boyd and his team, with excit-ing content and interviews galore. If you haven’t listened yet you’re missing out- all episodes are avail-able from www.eusci.org or via iTunes.

The new academic year brings a host of new faces to Edinburgh’s sci-entific community. EUSci is always in need of new participants to help write articles, edit, illustrate and lay out. To write a Feature, simply submit it to [email protected] by October 5th; to write a Regular or participate in other aspects you can join the EUSci team - contact the editors at the same address for details. Enjoy reading Issue 4!

Jon Manning, Ruth Milne, Katie Marwick.

From The Editors

From The President

Hello scientists! Welcome to a new year and a new issue of EUSci, the science magazine of Edinburgh University.

Did you know that we don’t just produce this excellent magazine however? There are many ways to get involved with us. We produce and record a fortnightly podcast that takes a sideways look at recent science news.

This year also sees the launch of the seminar series in which writers get a chance to present their per-sonal scientific passion to a wider audience, and we are also launch-ing a sci-fi story competition. Does your inner author hold vivid

visions of Edinburgh’s future? If so, send in your tales! (Deadline: 5 February 2010.) There are even fun socials organised throughout the year.

All this requires help. EUSci is entirely run by volunteers and without them we wouldn’t exist. As well as magazine production there’s plenty of room to get in-volved in the society side of EUSci. If you’re interested in helping to organise a seminar or any other event, come to our stall at Freshers fair or visit our website, www.eusci.org. Look forward to meeting you!

Matthew Hartfield.

02September 2009

In BriefFor up-to-date news visit our website www.eusci.org

In B

rief

Synthetic biology short-circuits cell division

Researchers at the University of Edin-burgh have bypassed a process previ-ously thought essential for the successful replication of yeast.

During preparation for cell-division, the DNA of the cell condenses to form chromosomes, each containing a cen-tromere, which acts as an anchor for moving chromosomes around during cell division. Cells usually employ a par-ticular mechanism for the assembly of a functional centromere, but the Edin-burgh research showed that this process could be bypassed through the addition of synthetic heterochromatin (a biologi-cal structure containing DNA), which

triggered centromere formation.This finding could have tremendous

implications in the field of genetic dis-eases. Co-author Professor Robin All-shire of the University of Edinburgh said, “Our findings should help research aimed at developing human artificial chromosomes as vehicles for use in gene therapy. This is an example of the po-tential of the emerging field of synthetic biology – a new approach to understand-ing and solving problems in biological processes.”

The study, supported by the Wellcome Trust and Medical Research Council, was published in the journal Science. SS Chromosomes segregating in anaphase

Scientists at the Universities of Edinburgh and Manches-ter have developed a technique termed ‘rehydroxylation dating’ to date archaeological objects. This exciting new method promises to have significant implications for dating ceramic materials.

It is believed that rehydroxylation dating has the poten-tial to date objects up to 10,000 years old and in an array of materials; so far, the teams have only been able to de-termine the ages of objects up to 2000 years old. Profes-sor Chris Hall at the University of Edinburgh said, “This new technique could allow us to discover a great deal about ancient artefacts by pinpointing their age [ . . . ] We believe the method will become standard practice.”

In 2003, the researchers discovered a new law that pre-cisely defines how the rate of reaction between ceramic and water varies over time. By measuring the amount of water that is chemically combined with a ceramic, the law provides an ‘internal clock’ that can be used to assess the age of the material. Experimentation has proven successful with a range of brick and tile samples being correctly and accurately dated.

Their findings have been published online by the Pro-ceedings of the Royal Society A (20 May 2009). KS

The results of a study, partly undertaken by the University of Edinburgh, were published in Nature in June. The work provides for the first time solid reasons for the increased sus-ceptibility of larger host populations to the evolution of more virulent parasite strains, associated with greater mortality rates.

Scientists at the Universities of Edinburgh, Oxford and Western Ontario employed mathematical models to simulate the evolution of parasitic virulence in response to varying factors, such as parasite reproductive and dispersal rates. Their results suggest that smaller, structured populations (where only limited dispersal is possible) select for less viru-lent parasitic strains. This is in contrast to larger populations, which promote the evolution of more virulent and dangerous parasitic forms. This may be a consequence of increased com-petition for resources between individual parasites, alongside a reduction in the benefits received by the parasite offspring.

Dr. Andy Gardner of the University of Edinburgh’s School of Biological Sciences, who took part in the research, said, “Parasites that typically cause minor illnesses today could evolve to become deadly in future. Our findings have impor-tant implications for a world in which humans and their para-sites are increasingly mobile over a global scale.” SS

Globalization may increase parasite virulence

Water the key to successful dating?

If you found a wallet on the street, what would you do with it? Scientists have found that evolution may have already decided on your response.

Last year, 240 wallets were planted on the streets of Edinburgh and it is reassuring to know that half of them were returned. However, each wallet had one of four photographs in it to establish whether they can emotion-ally affect people so that they are more likely to return them. Photographs were of a smiling baby, a cute puppy, a happy family or a contented elderly couple. Some wallets had no image. The wallets also contained everyday items, such as membership cards and receipts, but no money, and were placed at least a quarter of a mile apart and away from litter bins and post boxes.

It was found that nine in ten wallets with the photograph of a baby were sent back, in comparison to a wallet with no photo in which just one in seven were sent back. About half of the other photo-graph containing wallets were sent back.

According to Dr. Wiseman, the psy-chologist behind this study, people have evolved a compassionate instinct towards infants so as to ensure the survival of future generations and this is what is re-flected in the results of this study.

So, if you want to increase the chances of your wallet being returned, the message is simple: put a picture of a cute baby in it. KS

How do you increase your chances of getting a lost wallet returned?

Would you return a lost wallet?

Eras

erG

irl

Roy

van

Hee

sbee

n

03www.eusci.org

In Brief

If you’d like to get involved with news writing for EUSci or have news/events you’d like covered in the next issue, email [email protected].

Tom

ek A

ugus

tyn

This is the aim of the Scottish Universities Life Sciences Alliance (SULSA), which met in Edinburgh for the first time on the 10th of June. Scientists from six universities across Scotland will bundle their expertise in a five-year project that aims to increase drug development and, ul-timately, help to create health and economic benefits for society.

In total £77 million will be invested in cell biology and drug discovery research, of which £27 million is funded by the Scottish Funding Council. The universities par-ticipating in the partnership are Edinburgh, Aberdeen, Dundee, Glasgow, St Andrews and Strathclyde.

According to the Director of SULSA, Professor Mike Tyers from the University of Edinburgh, “SULSA will build on [Scotland’s international leadership in the life sciences] by drawing together many of the country’s best scientists in this research pool. The alliance will enable our scientists to benefit from the latest technolo-gies to further our understanding of biology and to train the next generation of scientific leaders.”

Want to know more about SULSA? Please contact Ca-triona Kelly: [email protected]. JW

Scotland to remain big in biology

At the beginning of May, the Centre for Systems Biology at Edinburgh (CSBE) moved into the new C. H. Waddington building on the Kings Buildings Campus. The centre has as its core objective the modelling of dynamic biological systems and hosts a number of leaders in the field. Rigorous math-ematically-based biological models can be used to provide new insights and understanding, as well as make simulations of future experimental results, reducing the number of ex-periments required. This interaction is a key feature of the centre, with modellers and experimentalists juxtaposed.

As part of work to study the circadian clock, CSBE is de-veloping the use of a new model organism, Ostreococcus tauri, a pico-eukaryotic alga. This is a collaborative project with Francois-Yves Bouget, Universite Pierre and Marie Curie/CNRS, and offers the potential for cell-based assays not nor-mally possible in single plant cells. The model is attractive due to a simplified genetic framework for the circadian clock compared to the more common model plant, Arabidopsis thaliana. This simple experimental system should greatly fa-cilitate the interaction with mathematical modelling, as well as providing exciting new biological insights into the funda-mental cellular processes in the plant kingdom. LD

Centre for Systems Biology at Edinburgh (CSBE) is on the move

Scientists at the University of Edinburgh have shown that, in some cases, a ‘battle of the sexes’ can take place within the womb. Their research has shown that females with twin brothers may be dis-advantaged in life due to differences in foetal needs in the womb. The long-term study was conducted on a population of wild Soay sheep on the island of Hirta, St Kilda.

Results showed a 10% reduction in birth weight of female lambs who have a male co-twin, relative to those with a female co-twin. They also showed that females with a male twin sibling were less likely to survive their first winter and had fewer offspring in their life.

This was attributed to male embryos dominating the female embryo in the competition for nutrients in the womb, and the possible damage caused to the female embryo by exposure to the male’s hormones.

Edinburgh’s Dr. Peter Korsten who led the study said, “Male and female embryos have different needs at early stages of development, and this means that the female embryos may lose out to their brothers. […] Our findings show that conflict between male and female siblings can arise very early in life, po-tentially with long-term consequences.”

The research is published in Biology Letters. KS

‘Battle of the sexes’ begins before birth

Edinburgh scientists have discovered genes that could prove to be an Achilles’ heel for the parasite Trypansoma brucei, which causes sleeping sickness, and affects over 50,000 people in sub-Saharan Africa.

What makes T. brucei so infectious is its ability to inhabit the tsetse fly, which, like a mobile syringe, facilitates its infection of the host bloodstream. In the bloodstream the parasite is slender, but in the tsetse fly the parasite is stumpy, and unable to replicate in the bloodstream. The Edinburgh researchers found a set of genes involved in regulating the change in shape of the parasite. Drugs targeting these

genes could prevent stumpy parasites from adopting the slender, more harmful form of the parasite and replicating in the host bloodstream.

Co-author of the work, Professor Keith Matthews of the University of Edinburgh said, “Our findings pinpoint a set of genes that could help make this parasite much less harmful to people and animals. We hope this will lead to a search for therapies that can limit the impact of this parasite or prevent the spread of sleeping sickness.”

If you would like to find out more, contact: Professor Keith Matthews, e-mail: [email protected]. JB

Could these genes be the Achilles’ heel for sleeping sickness?

Trypanosoma brucei in the bloodstream of humans

Wik

iCom

mon

s

Soay sheep on Hirta, St. Kilda

ACTGACTGTATGTAGAGATACAATTTGTATAGGCCGCCCGATACATATAAATACTGACTGTATGTAGAGATACAATTTGTATAGGCCGCCCGATACATATAAATACTGACTGTATGTAGAGATACAATTTGTATAGGCCGCCCGATACATATAAATCTGACTGTATGTAGAGATACAATTTGTATGGCCCCCGATACATATAAATACTGACTGTATGTAGAGATACAATTTGTATAGGCCGCCCGATACATATAAATGACTGTATGTAGAGATACAATTTGTATAGGCCGCCCGATACATATAAATACTGACTGTATGTAGAGATACAATTTGTATAGGCCGCCCGATACATATAAACGCCCGATACATATAAATACTGACTGTATGTAGAGATACAATTTGTATAGGCCGCCCGATACATATAAATGTAGAGATACAATTTGTATAGGCCGCCCGATACATATAAATGTAGAGATACAATTTGTATAGGCCGCCCGATACATATAAATGTAGAGATACAATTTGTATAGGCCGCCCGATACATATAAATATACATATAAATCTGACTGTATGTAGAGATACAATTTGTATAGGCCCCCATACATATAAATCTGACTGTATGTAGAGATACAATTTGTATAGGCCCCCATACATATAAATCTGACTGTATGTAGAGATACAATTTGTATAGGCCCCCATACATATAAATCTGACTGTATGTAGAGATACAATTTGTATAGGCCCCCATACATATAAATTCTGACTGTATGTAGAGATCCCGATCGATACATTTCA

Next Generation Sequencing

At the completion of the first draft of the human genome in the year 2000, Professor Fred Sanger said, "I never thought it would be done as quickly as this." Despite Professor Sanger’s justifiable surprise given the sequencing technology of the time (which he invented in 1975), a low-quality draft had taken ten years to produce and the final sequence would take three more. The effort required was immense, involving hundreds of scientists and sequencing machines in the United States, Canada, New Zealand and Britain.

In 2004, the first of the ‘next generation’ sequencing (NGS) machines was released by 454 Life Sciences and is now, amongst others, in widespread use. Their inherent ‘massively parallel’ approach allows routine sequencing of millions of short sequence fragments simultaneously, producing sequence data at speeds far exceeding that of Sanger’s method. Crucially, all machines work without the need for living cells and do not use electrophoresis (a slow separation technique) as required by the Sanger process.

In 2008, several new genomes were released, including that of James Watson, each completed in less than two months. The ‘1000 Genome Project,' launched in January 2008, will produce - you guessed it - 1000 genomes. The results will shed light on human variation and, by comparison with phenotype, its im-plications. Large portions of the genomes of extinct creatures such as Neanderthals and mammoths have been revealed. Beyond genomes, NGS is ideally suited to ‘transcriptomics,’ the study of gene usage in cells and tissue. Many other applications exist, and more appear all the time.

This issue’s Focus shines a light on this exciting field. Edinburgh’s resident sequencing guru shares his views, we learn more about transcriptomics, and the problems associated with processing large data volumes are revealed. Finally, we also consider the ethical implications. Whom would you trust with your genome?

Jon Manning is a postdoc in the Center for Cardiovascular Science.

(Timeline) Emily Pritchard is a PhD student in the Human Genetics Unit

at the Western General Hopital.

September 200904

Focu

s

Phot

o cr

edits

: M

esse

lsohn

-Sta

hl -

Emily

Pri

tcha

rd, S

cien

ce co

ver c

ourt

esy

of S

cien

ce M

agaz

ine,

logo

s with

per

miss

ion

of re

spec

tive c

ompa

nies

, all

othe

r im

ages

from

wik

i com

mon

s

Semi-conserva-tive replication of DNA proved by Meselson and Stahl.

Sanger invents ddNTP sequencing - this involves synthesising DNA, teminating on known base pairs, then separating on the basis of size.

Applied Biolsystems launch SOLiD.

The Illumina Genome Analyser launched.

Roche launch their (454) GS FLX, the first next generation sequencer.

Mathies publishes dye based sequencing. The sequencing reaction can be done in a single tube, then separated by capillary tube and read by a computer.

The draft sequence of the human genome published simultaneously by the charitably funded Human Genome Project, who used heirarchical shotgun, and the privately funded Celera, who used Whole Genome Shotgun. This project started in 1993, and was not fully completed until 2003.

The nematode Caenorhabditis elegans has its 98Mb genome sequenced, the first multicellular organism.

Haemophilus influenzae is the first whole organism to have its genome sequenced. Whole Genome Shotgun of this 1,830kb genome took almost a year.

Sanger publishes the first DNA genome, by Shotgun sequencing. Shotgun involves cutting the genome up at random and sequencing the fragments. Bacteriophage Φ X174 has a 5,386bp genome.

The first RNA genome sequence is published by Friers. Bacteriophage MS2’s genome is 3,569 bases long.

Roche release the genome of James Watson, the whole process took a matter of weeks.

2008

2

007

200

6 2

004

200

0

199

8

1

995

1

995

197

7

1976

19

75

195

8

1953 The double

helix structure of DNA published by Watson and Crick.

Sequence of events

www.eusci.org05

Focus

Hero of neglected genomes, the en-thusiastic and mildly eccentric Mark Blaxter has been at the forefront of DNA sequencing technology in Edinburgh for years. His research and sequencing service centre, the GenePool, is home to some of the UK’s most advanced DNA sequencing machines and as he explains to EUSci, has helped make high throughput DNA sequencing accessible and cost effective to labs in Edinburgh and across Scotland.

How did you get into DNA sequencing as a career?As part of my Zoology degree I actually did Southern hybridisation and DNA isolation and all sorts of molecular biology things. At that point, I got the molecular biology bug and so for my

PhD I was very proud to get two papers out with sequence in them totalling 3.6 kilobases. That’s about a kilobase a year of sequencing, and by today’s standards not very fast. After my postdoc, when I came back to Edinburgh, it just happened to be at the time when people had been successful in getting some funding for first generation sequencing machines doing Sanger sequencing at an incredible rate and I’ve been managing sequencing here ever since.

Why did you set up GenePool and what were your original aims for the centre?Originally my involvement in running a DNA sequencing service here in Edinburgh was so that I could get access to reasonable cost, reasonable throughput sequencing. It’s always been

the case that the big sequencing centres like big projects. So, for example, the Sanger Institute has been absolutely brilliant in pushing sequencing forward

globally but it would never do small projects. The idea was always to have a facility that could do those small projects that would help people locally – and me, because I wanted to do sequencing from obscure organisms that nobody else was really interested in.

From then it’s built up as new tech-nologies have arrived: people have requested access to them and we’ve tried to access money to deliver those technol-ogies. Now the GenePool is a recognised sequencing centre for the Scottish Uni-versities Life Sciences Alliance, the Medical Research Council, and the Natural Environment Research Council. So we end up having a duty to sequence to a large group of customers and users across Scotland and the UK.

What is next generation sequencing and how does it differ from traditional Sanger sequencing?In my PhD I sequenced 3.6 kilobases, which was a long and drawn out affair, and to do that I had to cut DNA up into bits that were small enough, clone them in bacteria, isolate the bacteria, isolate the DNA from the bacteria and sequence it…so it’s a process that

The idea was always to have a facility that could

do those small projects

”

“

A GenePool technician demonstrates the Illumina SOLEXA sequencer to students

Edinburgh’s own DNA sequencing guru, Professor Mark Blaxter, talks to EUSci about bringing next generation sequencing technology to Edinburgh

Mark Blaxter: Sequencer

Mar

k Bl

axte

r

Mar

k Bl

axte

r

07www.eusci.org

Focus

involves handling lots of separate bits of DNA. And what the first generation of sequencing machines (the ones that the human genome was sequenced on) did was automate a lot of that process. But still you had to clone the DNA. So the first revolution in next generation sequencing – the current market of machines if you like – is that they avoid bacterial cloning altogether.

They do this by single molecule PCR (polymerase chain reaction), where you isolate single DNA molecules - by either sticking them on a little resin bead or sticking them on a piece of glass - and then doing PCR in such a way that all the products are located in the same place, so they either all stick to the same bead or they stick in the same place on the glass. This process generates about 1000 copies of the DNA molecule to start off with and the delight in that is you no longer have to do cloning in bacteria, so it’s massively parallel. The Roche 454 technology, which we run here for example, does about a million separate sequence reads at a time and our Illumina Solexa does about 100 million at a time.

So next generation technologies use sequencing by synthesis. How does this actually work?Once you’ve done the single molecule amplification you can generate the sequence in a couple of different ways. Roche 454 works by using pyrosequenc-ing where you add the bases one at a time – so A then G, T and C – and you count the number of bases added by measuring the amount of phosphate that’s released when that reaction happens. So it’s quite a simple chemical reaction: every time you add a base, phosphate is given off and you can measure that by simple bio-chemistry. You can do that in a massively parallel way with millions of tiny little reactors, tiny little test tubes if you like, that give you sequence reads of up to 450 bases. So you get about a million reads each of 450 bases from the Roche 454 instrument, and it’s likely those reads are going to get longer and longer.

For the Illumina Solexa technology the sequencing is different. It’s very similar to old-style Sanger sequencing, except that with Sanger sequencing once you’ve labelled a DNA strand to say which base was present, that DNA strand was finished. With Solexa sequencing, a terminated strand is actually reversible so it can carry on being sequenced. Reversing the termination involves treating it with chemicals, and that

limits the amount of sequence you can get out, so the Solexa machine only does 50-75 bases of sequence per read, but it does this on between 80 and 100 million DNA molecules at a time. Again read length will likely go up to about a hundred bases per read.

Why have these technological advances created such hype in the field of sequencing?It is absolutely a sea change in what people can do in terms of experimen-tal research and genetics. It’s changed high throughput DNA sequencing from something that could only be done in large, industrial-scale academic sequencing centres - and that could only be done if you had millions of pounds worth of funding - to something you could consider as part of a normal research programme. For example, here in Edinburgh we’ve been running sequencing for a long time, but we’ve

never been able to offer the sort of throughput that people doing clinical genetics or people doing mass screens of populations needed, just because it would cost too much.

How has next generation sequencing at GenePool been received by the local research community?We have hundreds of users of our Sanger sequencing technology and getting on

for over a hundred users of our next generation technologies. We’ve found that people in Edinburgh who sponsored the birth and the growth of the GenePool have always been very enthusiastic, especially about getting us to try new technologies.

What are your plans for GenePool over the next five or so years?We’re just about to start doubling in size. We’re now one of the Medical Research Council’s three UK sequencing hubs and they’ve given us enough money to double both the number of people involved in the GenePool and the number of instruments we’re running. The plan in the next three years is to bed that expansion in, deliver lots more data to people, and after that there are next-next-generation machines coming out – third generation sequencing machines – and it’s probable that we’ll invest in those.

Do you think we’ll soon be seeing the end of Sanger sequencing?Its demise has been heralded but I think it’s a bit early. In the GenePool last year we did 215,000 Sanger reactions, which is our largest number in a year yet – and that’s despite the fact that we generated a hundred gigabases of data using next generation sequencing tech-nologies. Because it’s based on a clone-by-clone approach, Sanger sequencing is great for surveying individuals. So if you want to survey anything indi-vidually in the wild, or anything indi-vidually in a lab experiment to look for specific changes, Sanger sequencing is still a great way to do it.

Hayden Selvadurai is a PhD student in the Centre for Integrative Physiology.

A GenePool technician interprets a sequence readout on the Roche 454 sequencer

It's changed high throughput DNA sequencing from something that

could only be done in large industrial-scale sequencing centres

“

”

Mar

k Bl

axte

r

08September 2009

Focu

s

DNA sequencing costs are plummet-ing due to next generation sequencing (NGS). This has opened the door to a whole new set of applications, since high-throughput sequencing is now within the reach of a well-funded re-search lab. This piece outlines four major recent medical applications of NGS.

Somatic disease: the formation of the International Cancer Genome ConsortiumCancer is a disease rooted in abnormali-ties found in our genome. Throughout our lives DNA damage and improper replica-tion results in the accumulation of muta-tions. This can result in a cell or group of cells having uncontrolled cell-growth, becoming malignant and causing cancer. NGS allows researchers to sequence the genomes of cancer cells in hundreds of in-dividuals with a specific tumour type, and match them to normal samples. A whole-genome resequencing approach was used to study the acute myeloid leukaemia genome and identified eight single nucle-otide substitutions which had not previ-ously been linked with the disease.

The sequencing of DNA methylation patterns (the methylome), mRNA and non-coding RNA levels (the latter two comprise the transcriptome) will be an incredibly powerful tool in probing the development and progression of cancers, deepening knowledge of their underlying genetic and molecular mechanisms. Fur-thermore, coupling this data to clinically relevant information can aid development of better treatments and diagnostic meas-ures. To this end, in April 2009, the In-ternational Cancer Genome Consortium

(ICGC) was founded. It brings together at least 9 countries and £500 million to sequence 50 different cancers within 10 years.

Inherited and Common disease: the 1000 Genomes ProjectAnother large scale genome sequencing project is underway: the 1000 Genomes Project, which aims to sequence 1000 people over an estimated three year period. When the project is in full swing it will sequence the equivalent of two human genomes per 24 hours. The aim is

to catalogue genetic variants, both indi-vidual mutations and structural variants (chromosomal rearrangements, dele-tions or duplications) that are present at a frequency of 0.5 percent within genes or 1 percent or greater through-out all DNA. Mining this information catalogue should speed up the process of finding both rare genetic variants and the genetic influences on common disease. This project will add an impor-tant layer of information to the initial Human Genome Project data. Consid-ering the value of this information, the attached price tag seems reasonable at a mere £50 million, again emphasising the power of NGS.

Pathogens: HIV treatmentThe above projects attempt to understand human diseases which arise due to defects in human genetics. However, viral, bacte-rial and fungal pathogens affect many more lives per year worldwide. Since culturing pure pathogenic species can be difficult, NGS allows the sequencing of the appro-priate human sample followed by identifi-cation of the DNA that isn’t human. This is being used to great effect in the manage-ment of human immunodeficiency virus (HIV). It allows a diagnosed patient’s serum to be sequenced and the mutational status of their virus to be identified. This allows the doctor to prescribe a patient-specific drug cocktail, of which over 20 exist.

Microbiota: The Human Microbiome ProjectAnother gap in knowledge involves the interaction of healthy and diseased indi-viduals with their commensal microbiota, which outnumber the body’s own cells ten fold. The Human Microbiome Project, announced by the National Institute of Healthcare in 2007, aims to identify and characterise this microbiota at a cost of $115 million over five years. This will boost the number of species of sequenced micro-biota to at least 1,000. The project should allow the development of new biomarkers of health or disease through identifica-tion of the exact microbiota a patient has. This information might also allow the de-velopment of strategies to intentionally manipulate a patient’s microbiota to aid their recovery. Furthermore, it will also improve understanding of the nutritional requirements of humans, allowing the development of a set of nutritional guide-lines that takes into account our personal microbiome.

The scope of these projects stems from the gathering of a vast amount of genomic and gene expression data. So further studies will be needed to fully reap the benefits of the genetic information and immediate benefits are unlikely. However, they offer the foundations of the personal-ised medicine of the future which will ul-timately customise disease treatment and prognosis to the individual.

Edward Duca is a PhD student in the Centre for Cardiovascular Science.M

ister

Cas

tro

MedicalApplications

£500 million to sequence 50

different cancers within 10 years

“

”

1000

Gen

omes

Pro

ject

; Wel

lcom

e Tru

st

www.eusci.org09

Focus

Transcript-what?Transcription is the process by which cells make a RNA copy of a gene from DNA. These pieces of RNA are called transcripts. Transcripts are used as blueprints to produce proteins and making multiple copies of them allows multiple copies of proteins to be made. All of the RNA in a cell is collectively termed the ‘transcriptome.' The tran-scriptome reflects which genes are being used and their levels of expression.

Transcriptomics is the study of the tran-scriptome. The variations in gene usage between different cell types and states are particularly interesting. For example, transcriptomes will vary between a heart cell and a brain cell, a dividing cell and a dying cell, a healthy cell and a diseased cell. Transcriptomics is not just a ‘glorified abacus’ of gene outputs, it can also be used to study gene structure by mapping the structures of the RNA transcripts back to the DNA genome.

TechnologiesIn transcriptomics the transcriptome is sequenced and, the sequences are mapped back to the reference genome, enabling scientists to establish which genes are being expressed. Tradition-ally, transcriptomes were studied by a ‘Northern blot’ analysis that checks for only one transcript at a time. This made it impossible to study the whole tran-scriptome. The arrival of microarrays just over a decade ago heralded the era of transcriptomics. Microarrays are small chips that contain thousands of known DNA sequences. For the first time it was possible to identify the expression of thousands of transcripts at once.

However, microarrays have several disadvantages. They can only detect the presence of known sequences, so new sequences cannot be identified. It is also difficult to tell very similar sequences apart. This could be avoided by sequencing all the transcripts indi-vidually using older methods such as chain-termination but it would be very expensive and laborious. The intro-duction of next generation sequencing methods allow a complex transcript mixture to be sequenced in one run at relatively low cost using high throughput parallel sequencing.

Next GenerationNext generation systems all follow the same general method. RNA is extracted from the sample cells, cut into appropriate sized pieces for the chosen technology and converted into DNA. Adaptor molecules are attached to the ends of the DNA, which is amplified, attached to the chosen technology platform and then sequenced. The returned sequencing information can then be mapped to the reference genome or transcriptome and the abundance of each transcript is measured. So far Illumina’s Solexa, ABI’s SOLiD and Roche’s 454 sequencing tech-nologies have been used for this purpose.

Pros and ConsThe next generation of sequencing tech-nologies have several advantages over the older hybridization methods. Most importantly they enable the detection of novel or unknown transcripts; not only within well studied organisms

such as mice but also in previously unsequenced species. They successfully detect transcripts with low expression and accurately measure transcripts with high expression (microarrays can only measure expression up to the number of probes on the chip). They provide exact, reliable sequence information, furthering our understanding of gene structure, not just expression. Furthermore, the new technologies are cheaper per run and can work on a smaller sample quantity.

The next generation technologies are a great improvement on older methods but still have their disadvantages. The preparation stages contain many complicated steps which increase the difficulty of preparing the samples. Although cheaper per run than the older technologies, the initial cost of the machines is currently prohibitive to most groups and so there are relatively few machines available for use, resulting in long waiting times for results. The data output from the sequencing is huge (in the region of 1 terabyte of data per run) this presents data processing and storage issues that must also be addressed at a cost. On a biological note, complex tran-scriptomes are still difficult to map completely, requiring more runs which increases cost.

PotentialNext generation sequencing technolo-gies and their ability to detect novel sequences have opened up the field of transcriptomics. Previously studied transcriptomes are being improved and new transcriptomes are being annotated. It is even possible to sequence the tran-scriptome for a single cell alone. This exciting and informative field has been, and will continue to be, aided by next generation sequencing technologies.

Catriona Alexander is a PhD student at the Roslin Institute.

The transcriptome reflects which genes

are being used

”

“

Mar

k Bl

axte

r

Next Generation Transcriptomics: Beyond Microarrays

Transcriptome extraction and sequencing is a routine lab technology

Cat

rion

a A

lexa

nder

10September 2009

Focu

s

The increase in the capacity of next generation sequencing (NGS) technol-ogies to produce data is out-pacing the growth of computer speed. Storing, collating and processing this data are jobs for bioinformaticists, a breed of scientist with a foot in both biology and computing. When an organism’s genome sequence is first constructed, the principle challenge is ‘assembly’ of the sequence fragments output by NGS into a genome. With this ‘reference’ in place, a number of other analyses are made possible.

De novo sequence assembly‘De novo’ sequencing of a genome, which is sequencing without a reference from a related species, is perhaps the most obvious NGS application. However, the output data is also the most difficult to handle; it’s like putting together a jigsaw puzzle without seeing the picture. Many ingenious algorithms have been written to accomplish the task. Sequencing is often done at very high ‘coverage’, re-peatedly sequencing the same region from multiple start points, using reads of different lengths from different sequenc-ing technologies. Overlaps between reads are used to put the puzzle together. Ideally, all the pieces of the puzzle should be examined together to get the best

assembly, meaning that the information needs to be held in a computer’s working memory. This becomes impossible for large genomes. The genome must be broken down or approached differently, increasing the complexity of the task.

Analysis with a reference genomeA reference genome is a powerful tool for comparative genetic analyses. When sequencing a new genome, a reference can be used as a ‘scaffold’ to produce the new genome sequence in a relatively simple manner. Comparing the sequenc-es of transcripts with a reference genome allows a scientist to determine from which gene the transcript was read.

The principle challenge of compara-tive analysis with a reference is the need to account for mis-matches between newly derived sequence and the refer-ence. Such mis-matches can be the result of normal variability between organ-isms, or of small mistakes made by the sequencing technologies. When genes are 'read' to produce a transcript, sec-tions of sequence known as introns are removed, which must be accounted for to match a transcript to the genome in transcriptomics studies.

Issues such as these mean that new sequences produced by NGS must be ‘aligned’ to the genome, finding the best

match while tolerating a limited number of mis-matches. This may yield multiple candidates for the best total sequence match, particularly in repetitive regions.

The work goes onSome of the problems described have been solved; others are still the subject of intense research. The pace of progress in next generation sequencing has all sci-entists racing to catch up, and bioinfor-maticists are no exception.

Jon Manning is a postdoc in the Centre for Cardiovascular Science.

The ability to sequence an entire human genome in three weeks is fanning the flames of the fierce squabbles waged over the social implications of genetics. The rapid progress of DNA sequencing is fundamental to this debate as genome sequencing provides a crucial starting

point in the daunting task of under-standing our approximately 20-25,000 genes. The prospective benefits are enormous – with molecular knowledge of the machinery of life the search for cures for devastating and elusive genetic disorders is greatly enhanced. But de-tailed knowledge of the blueprint of life also provides the potential to modify and control it. The ethical issues around this knowledge and its practical use are worth considering while the new and exciting science continues to advance relentlessly.

The rapid development of science slashes open a Pandora’s box of new scenarios and ethical issues previously considered mainly in science fiction. The time lag between advancement of technology and the slow process of legislation leaves many questions unan-swered and accountability unassigned. Insurance companies rejoice, cheating parents despair. Humans unavoidably and continuously shed their genetic material, allowing its easy collection and analysis with or without consent. The detailed information it can provide

leaves a lot of power in the scientist's hands as genetic information about our strengths and weaknesses can be easily abused. This has already been seen in cases regarding other sensitive health information, where employers and in-surance companies have viewed private HIV test results and dismissed or stig-matised individuals. Which insurance company would insure someone with a known risk of early onset cancer, heart disease and diabetes? The lack of public understanding of the balance and inter-play between genetics and environment can easily lead to prejudice and stig-matisation based on poorly grounded assumptions.

In this era of professional specialisation our awareness of the impact of our work on the world can be poor. We cannot let fear of the new and unknown stop our quest for knowledge, but it's worth at least considering what to do with this knowledge as it accumulates. Or at least ask for help from a few ethicists…

Kathrine Berggrav is an undergraduate in Medical Sciences.

Bioinformatics: Coping with the Data

How Secure is your Genome?

Sony

a H

alle

tt

Sony

a H

alle

tt

Sony

a H

alle

tt

12September 2009

Gue

st A

utho

r

Tragedy. It is an emotion with great power. It’s not that unusual that tragedy and suffering are motivational factors in one’s life. What is unusual, in this circumstance, is that the tragedy that motivated Stephen Russell to dedicate his life to virotherapy had nothing to do with viruses. The tragedy was a fire that took the life of his sister and her husband when Russell was in medical school here at the University of Edinburgh.

Building the Foundations at Edinburgh

Russell was in his third year at Edinburgh when he received the bad news. As he traveled home on the train to be with his family, he immersed himself in his studies to block out the painful thoughts. He filled his mind with microbiology and virology.

“It was during that journey that I decided that viruses had not been used to do what they’re best at, which is destroying tissue. It was at that moment that I decided I would spend my life

developing viruses that would destroy cancer,” says Russell.

“It became a very firm decision,” says Russell, “so it made all my job choices fairly easy because I knew what my ultimate goal was. Back in those days it was a crazy, off-the-wall concept. If people asked you what you wanted to do with your career and you said

you wanted to develop viruses to fight cancer, they would say ‘Thank you very much, next please’.”

However, adversity and challenge didn’t sway Russell. He stayed on course. After graduating from Edinburgh, Russell did his house officer/senior house officer jobs at Falkirk District General Hospital, followed by the Western General Hospital and Royal Infirmary in Edinburgh. He went on to train in general medicine and haematology at North Tees General Hospital in Stockton-on-Tees, University College Hospital in London and Addenbrooke’s Hospital in Cambridge.

“I knew that I wanted to develop a new modality and actually apply it clinically,” Russell says. “I was either going to specialise in oncology or haematology. I decided on haematology because the haematologists at that time in the UK had more involvement in the basic lab component of the discipline.”

“Haematologists in the UK would run the hospital lab, process tissue samples, and look at the blood and bone marrow from the patients. They would make sure that all of the blood work and blood testing was conducted in the right way and they would have patient contact as well. They would take care of inpatients and outpatients with lymphomas and leukemia. That was the appeal of haematology for me,” says Russell. “It was the whole bench-to-bedside component of clinical care that I would be involved in. It seemed to me

to be a better base from which to then move into my desired career of doing oncolytic viral therapy.”

Engineering Viruses in the Lab

Russell’s haematology training began in 1985 when he was employed as a registrar at University College Hospital in London. He then moved to the Cell

and Molecular Biology Section of the Chester Beatty Laboratories at the Royal Marsden Hospital in London in 1987 to undertake his Clinical Research Fellowship on the retroviral/parvoviral transfer of interleukin genes to cancer cells as a novel approach to cancer immunotherapy. This work formed the basis of his PhD, awarded in 1990 from the University of London, and led to a clinical gene therapy trial at the Royal Marsden.

“It was at the Royal Marsden that I moved into a truly basic science laboratory,” says Russell. “I worked in the lab of a woman named Mary Collins. At that time, Mary had just returned from the US, where she had learned new techniques on how to engineer viruses to shift genes around. She was a bit skeptical of what I was proposing as the long-term goal, but because she was already engineering viruses and using them to deliver genes, she was quite happy that I was interested in that and agreed to take me into her lab.”

“Moving into a research lab was probably the most difficult transition for me. Every time you move from junior school to senior school or senior school to college, you’re always at the bottom of the pile and you don’t know how to do things. But moving into a lab, it was all do-it-yourself. In this lab, you had to be able to clone, to pipette, to do everything properly. You had no one to rely on but yourself. It was tough to move from a position of authority to being ignorant of everything in the

Dr Stephen Russell: Using Measles to Cure CancerNick Charles profiles Edinburgh alumnus Stephen J. Russell, MD, PhD

Stephen J. Russell, MD, PhD

It was at that moment that I decided I would spend my life developing viruses

that would destroy cancer

“”

May

o C

linic

13www.eusci.org

Guest A

uthor

laboratory,” says Russell.

Russell explains that Mary Collins was a tough taskmaster. “She was pretty tough, but that was good,” he says. “She didn’t say, ‘You’re a doctor, we’ll treat you special.’ Instead, she would say ‘You have to catch up with the rest.’ That’s where I became familiar with how to engineer viruses. Towards the end of that period, I was developing my own ideas and moving into viruses, other than the ones I had been given as a project. So, I had a superb three-year experience doing the PhD under her tutelage there.”

After working at the Royal Marsden, Russell went to Cambridge to complete both his clinical and his research training. He arranged for a position at Cambridge that was a hybrid between clinical practice and research in the lab. His success in that position led to a promotion to consultant in haematology where he got to run his own lab. “I can’t tell you how good that felt. It meant that I could focus on what I wanted to do all along, which was to develop viruses for the treatment of cancer,” he says.

Leading Molecular Medicine at Mayo Clinic

With seven years at Cambridge under his belt, Russell was offered the position of Chair of Gene Therapy. It was right

around this time that he was contacted by the Mayo Clinic in Rochester, Minnesota.

“Mayo Clinic called and described the scope of the molecular medicine program to me. They had seven faculty positions to fill, an entire floor of a modern research building, and the funds available to make a manufacturing

facility for producing clinical grade viruses and to form a toxicology group to conduct the pre-clinical studies required by government agencies in support of early phase clinical trials. I thought they were going to offer me one of the faculty

positions, but instead they said, ‘We need someone to run it, and we’ve been told that you would be a good person to approach.’ I couldn’t believe what was happening,” Russell explains. “Once I was at the Mayo Clinic, I was awestruck by the scale of the opportunity, but I also thought that it was precisely what I was looking for in terms of taking this virotherapy work all the way through to clinical implementation. It was all too exciting to resist.”

First Human to Receive the Virus

One of the most significant landmarks for the Gene and Virus Therapy Program that Russell directed took place on 12 July 2004. It was on this date that a patient with ovarian cancer received an intraperitoneal (into the body cavity) infusion of a recombinant measles virus that was designed, constructed, pre-clinically tested, and manufactured by Russell’s team. This was the first time that a genetically engineered measles virus had ever been tested in human subjects. The virus used in this study kills cancer cells but spares normal cells. There are two other ongoing Phase I clinical trials in the molecular medicine department at the Mayo Clinic using their measles strains as anticancer agents: one for recurrent glioblastoma multiforme and another for multiple myeloma.

Russell credits much of his success to his education at Edinburgh. While in school, he earned the following honors and awards: Distinctions in Microbiology and Surgery, Class Medal in Microbiology, and the Beany Prize in Anatomy and Clinical Surgery.

“I had an affinity for Edinburgh,” he says. “I had five years there at medical school and two years after that doing the equivalent of a residency. It’s a wonderful place to live and a wonderful place to be a student.”

Nick Charles is an internationally published medical

journalist based in America.

Human cancer cells before (A), and after (B) infection by the reengineered measles virus. Infected cells fuse together to form large, single masses, which eventually die as a result of the self-destruction message they receive from the measles virus. Healthy cells are left alone.

In the sterile environment of the Mayo Clinic Viral Vector Production Facility, technicians harvest MV-CEA virus from cells grown in culture

Edinburgh is a wonderful place to live and be a student

“”

May

o C

linic

May

o C

linic

Is one person’s noise another’s music? Sometimes it’s not just a noise, it’s a weapon, or the cause of a ghostly appari-tion. Welcome to the odd and interesting world of infrasound.

The human ear can hear frequencies from around 20 to 20,000 Hertz (Hz). Sound pressure levels are measured on the decibel (dB) scale, where an increase of 3 dB corresponds to a doubling of the sound pressure in Pascals. Prolonged exposure to >85 dB can cause long term hearing loss and tinnitus, while 120 dB is the threshold of pain with the possibility of immediate hearing damage.

To an acoustics student, the concept of sound as a weapon is both abhorrent and intriguing. There are well-documented cases of pop and heavy metal music being used to intimidate enemies (see Lieutenant Colonel Kilgore in Apocalypse Now playing Wagner from his helicopters), but few substantiated stories of bona-fide ‘sound weapons’ use the physiological effects of sound to incapacitate the opposing force. But just what are those effects?

Infrasound is any sound with a fre-quency of less than 20 Hertz. As hearing becomes less sensitive with decreasing frequency, the sound pressure level must be increased. At high enough levels and at certain frequencies, infrasound can cause organ damage, pop eardrums and cause anxiety, fear or religious experiences in humans.

Experiments in weaponised sound began with Dr. Zippermeyer towards the end of World War II, with the German Windkanone or ‘Whirlwind Canon’, which was designed to shoot down Allied aircraft by creating a vortex of sound. This vortex was created artificially, generat-ing explosions and directing the resulting shockwaves through specially designed

nozzles at the target. Though apparently successful at a short range, the effect could not be recreated at a high altitude. Range and focus have always been the downfall of the acoustic weapon. A similar device called the Luftkanone, also designed by Zippermeyer, used methane and oxygen to produce a rapid series of explosions which were built up using acoustic reflectors into a high pitched tone. Though lethal to animals and uncomfortable to humans at close quarters, the effect did not have suf-ficient range or mobility to be directed at a moving target.

The next pioneer of infrasound was the French scientist Vladimir Gavreau, born in Russia as Vladimir Gavronsky. In the 1960’s, he conducted research into the bouts of nausea and dizziness plaguing his team of robotics researchers while in their laboratory. The cause was originally at-tributed to ‘building sickness,’ though the biological pathogens that were assumed to be causing the sickness were never discov-ered. The symptoms eased when certain windows in the lab were blocked, yet no noxious chemicals were detected. Eventu-ally, the source was traced by engineers to a poorly installed air-conditioning motor, which was said to be producing ‘nauseat-ing vibrations.’ Battling through continued nausea, the team eventually measured a frequency of 7 Hz. The motor was exciting a resonant mode in the large concrete ven-tilation duct below it. This vibration was

then coupling to the air in the rest of the large building, amplifying the infrasonic effect. The effect was similar to the vibrat-ing tongue at the base of an organ pipe, or the reed on a clarinet.

The discovery also explained the action of the windows in reducing the effect, as these changed the extent of acoustic cou-pling between the air in the building and

outside, reducing the frequency and inten-sity of the infrasound.

It is now known that 7 Hz is one of the most dangerous infrasonic frequencies. It corresponds to the median alpha-rhythm (‘A type’ of brainwave related to waking relaxation) frequencies in the brain and is

also alleged to match the resonant frequen-cy of some internal organs, causing rup-tures after periods of prolonged exposure. Another interesting effect occurs at 19 Hz, the resonant frequency of the eyeball.

In the mid 90’s, Vic Tandy, a lecturer at Coventry University, was working late in a supposedly haunted laboratory in the University of Warwick, when a ghostly ap-parition appeared in his peripheral vision. Turning to look at it, the ‘ghost’ disap-peared. However, the phenomenon reap-peared the next day: Tandy was working on a fencing foil which started vibrating while clamped, but only in certain parts of the room. The cause was again attributed to an extractor fan, this time causing an infrasonic frequency of 18.98 Hz. In 1998, Tandy and psychologist Dr. Tony Law-rence published their findings which lead to investigations of other haunted places, among them the vaults and chambers under Edinburgh’s South Bridge, where in-frasonic frequencies were also detected.

What other phenomena are caused by infrasound? Will it ever be a viable weapon? Only further research will tell us; all I know is that I want a bigger stereo.

Alan Boyd is a Masters student in Acoustics and Music Technology.

14September 2009

Alan Boyd warns us that what you can’t hear can hurt you

Windkanone was designed to shoot down aircraft by creating a vortex of sound

“”

Am

ir K

irolo

s

What’s That Sound?

Am

y C

appe

r

15www.eusci.org

Wik

iCom

mon

s

In recent years, growing public concerns about animal welfare have prompted a wealth of scientific research devoted to studying the ability of animals to expe-rience negative emotions such as pain or anxiety, and to provide a methodol-ogy with which to measure them, mainly through quantification of their behav-iour. Much less is known, however, about how animals might experience the kind of emotions that are on the other side of the spectrum, such as happiness and joy.

The study of animal emotions is fraught with enormous difficulties. Some are con-ceptual and practical: how can you possi-bly access what is by definition a subjective experience? Others are attitudinal: you cannot study something if you believe, as many scientists who disregard animal emotions do, that it does not exist or that it cannot be measured.

In The Expression of the Emotions in Man and Animals (1872), Charles Darwin argued that the differences between emo-tions experienced by humans and those experienced by other animals are not a matter of kind but of degree, suggesting an evolutionary continuum. However, al-though any person who has spent enough

time looking at other animals with an at-tentive eye would be certain of their rich emotional lives, it can prove extremely challenging to confer animal emotions with scientific legitimacy.

Recent research has provided insights into one of the most obvious expressions of joy: laughter. It appears that we are not the only ones laughing. In an article published in Current Biology, Marina Davila Ross and collaborators describe a study in which they tickled infant and juvenile orangu-tans, gorillas, chimpanzees and bonobos, and compared the acoustics of their vo-calisations to those of human infants. The findings of this study reveal both similari-ties and differences in the acoustic proper-ties of laughter across the species studied. Bonobos and chimpanzees, who are evolu-tionarily closest to us, show, like humans, shorter and faster laughter vocalisations than the rest of the species in the study. Bonobos also have more control over the range of tones they can voice. The authors of this study conclude that the origins of human laughter can be traced back to the last common ancestor of humans and great apes, 10 to 16 million years ago.

The question that remains is: do these emotional expressions have the same func-tion in humans and apes? Robert Provine, one of the world’s leading researchers on laughter, has suggested that human laugh-ter predates speech as a way of establishing positive social bonds. This might explain why laughing on your own is less fun. Re-search in non-human primates has shown that laughter is exhibited during positive social interactions such as play. Orangu-tans respond to their playmates’ ‘open-mouth faces’, which are the equivalent of human smiling, by rapidly mimicking this facial expression. It appears that these behaviours serve the purpose of not only communicating a positive social emotion but also of strengthening social bonds by ‘infecting’ playmates with the same posi-tive emotion.

A rudimentary form of laughter has even been discovered in rats. Jaak Panksepp and collaborators have identified 50 kiloHertz

ultrasonic ‘chirping’ vocalisations in juve-nile rats, emitted during rough-and-tumble play. They have shown that these vocali-zations can be elicited by tickling bodily areas toward which rats normally direct their invitations to play, such as the nape of the neck. The tickle response seems to fa-cilitate social bonding, since the research-ers found that rats would seek out hands that have tickled them in the past rather than those that have only petted them for an equal amount of time. They also found

that rats did not emit laugh-like vocalisa-tions in situations associated with fear and stress, suggesting that, in order to engage in this type of behaviour, rats need to feel in a comfortable and safe environment. Panksepp has suggested that 50 kiloHertz ultrasonic calls have a communicative role and that they can be interpreted as an index of “social joy.” Tickling-associated laughter in rats could thus provide a model for the study of the sub-cortical neural cir-cuitry within the mammalian brain that is involved in the generation of emotions as-sociated with positive social interactions.

As further evidence of the emotional capabilities of animals is accruing, it seems that it is not the differences between humans and other animals that make the most exciting subjects for research, but rather the similarities between ‘them’ and ‘us’. We might be unable to communicate verbally with animals, but now we know that we can have a laugh with them, while doing good science.

Ignacio Viñuela Fernandez is a Research Associate at the Royal (Dick)

School of Veterinary Studies.

Ignacio Viñuela-Fernandez investigates the science of laughter in animals

Laughter predates speech as a way of

establishing positive social bonds

“

”

Sony

a H

alle

tt

Animal Emotions Are No Laughing Matter

16September 2009

In 1972, the Vietnam War had been going on for thirteen years, and was destined to continue for three more. The Cold War was in full swing, and the Troubles in Northern Ireland killed 500 people. On television, Columbo was reassuring us that criminals always get caught and Jon Pertwee was still the Doctor. People wore hot pants and bell-bottomed trousers, the first personal computers were just begin-ning to appear, and most telephones had rotary dials. And on 14 December 1972, astronaut Eugene Cernan took a last look at the Montes Taurus before stepping back into the Lunar Module and leaving the Moon behind.

If you had told Cernan at that moment what the next 37 years were going to look like, he would probably have had trouble believing you. The present looks a whole lot different from the future that a man in 1972 may have imagined. But the real shocker for Commander Cernan would not be the end of the Vietnam War, the collapse of the Soviet Union, or peace in

Northern Ireland. No, as he looks at a world of cell phones, computers in every home, skinny jeans and Columbo still in reruns, 75-year-old Eugene Cernan must have one burning question: Why haven’t we been back to the Moon yet?

A Thorny Issue

Human space flight is a contentious subject at the best of times. There is the question of safety; tragedies like the Challenger and Columbia disasters are fresh in everyone’s mind, and the pos-sibility of having a crew stranded on the Moon or on Mars is probably giving more than a few NASA administrators nightmares. Robotic exploration, it is argued, is both safer and less expensive, since it does not require us to go to all the extra trouble of trying to keep astro-nauts alive during the journey.

And yet, the idea of humans in space has an undeniable romantic appeal. There is a reason why John F. Kennedy did not say, in 1961, that America should commit to “landing a probe on the Moon and re-turning it back safely to the Earth.” He insisted on landing a man on the Moon, despite the dangers, because only that image of the brave explorer would gal-

vanise the people into supporting his project. One could argue that human space exploration is not only essential, it is inevitable if we want to have a chance at extending the lifespan of our species beyond that of our planet.

NASA has finally come to recognise this and is planning a return to the Moon, as well as a human mission to Mars. The really exciting news, however, is that this

time, we are not only going to the Moon; we are staying there. Current plans call for a permanent base on the Moon to be constructed between 2019 and 2024. Other governments have had similar ideas; the European Space Agency, Russia, China, Japan and India have all announced plans for moon bases.

The notion of a base on the Moon has been around for at least a century. During the 1940s and 1950s, advances in rocket technology encouraged the US Army to come up with a plan for a

military outpost on the Moon, dubbed ‘Project Horizon.’ The project had to be abandoned after it proved entirely unfeasible using the technology of the time. During the Apollo space pro-gramme, the idea of a lunar base was revisited, but never implemented. Since then, several plans for lunar bases have been proposed, but none have made it past the planning stages.

Frank Dondelinger argues why we should go back to the Moon and stay there

Why haven’t we been back to the moon yet?

““

A girl holds The Washington Post of Monday, July 21, 1969

Jack

Wei

r

NA

SA

Buzz Aldrin’s footprint on the Moon

Xia

owen

She

n

Technical Challenges

You may wonder what all the fuss is about. Why would we want to build a base on the Moon, basically a giant lump of rock floating in space, when there is much more interesting science to be done on say, Mars? While this is certain-ly a fair point, it is useful to learn to walk before one tries to run. The Moon is a lot closer than Mars, and it is a lot easier to transport resources and supplies for a moon base than it would be for a base on Mars. Also, if anything should go wrong, a rescue mission to the Moon would have a better chance to get there in time. A moon base would allow us to test the waters and prepare for the chal-lenges that we will face when building permanent bases on other planets.

That said, a moon base already poses non-trivial challenges. First, there is the problem of energy. The Moon has few resources, and certainly none that could be used for energy generation right away. For that reason, NASA is said to be looking at a small nuclear reactor to power its lunar outpost. Another option that worked well for the International Space Station is solar power. However, the lunar night lasts about 14 days, making this only viable for a base at one of the poles, or in conjunction with fuel cells that store the energy produced by the solar panels during the lunar day.

Keeping human beings alive on the Moon presents another challenge. The lack of atmosphere results in no protec-tion against radiation or solar flares. This means that defensive measures such as radiation shields and burying sensitive parts of the base in the lunar soil become essential. Asteroid impacts are a further danger. The low gravity on the Moon may also lead to deterioration of muscles and bones in the crew members, although the long-term effects of low gravity (as opposed to zero gravity) have not been studied extensively.

It is unlikely that any moon base built in the next few decades would be complete-ly self-sufficient. For that reason, trans-port to and from the lunar surface is es-sential for resupply and repair missions. NASA is currently developing a lunar lander, dubbed Altair, that will take the role of the Apollo Lunar Module. Altair can take up to four astronauts to the lunar surface and back into lunar orbit, where Orion, the new spacecraft also being developed by NASA, will take them back to Earth. Currently, Altair is not designed to be reused, and will

have to be discarded after each mission. However, rumour has it that a reusable Altair may be planned for the future.

Future Rewards

There is no doubt that a moon base will provide a useful step in our explora-tion of the rest of the solar system, but there are likely to be more immediate benefits for science. Astronomy could benefit from the construction of an ob-servatory on the far side of the Moon. Shielded from radio emissions from the Earth, such an observatory would have the potential to make completely new discoveries, allowing us to discover distant stars. Scientists on the Moon could also study the effect of micrograv-ity on humans, and further explore the

geology of the Moon. Meanwhile, back on Earth, the prospect of a moon base, and NASA investment money, will stim-ulate the development of new technolo-gies for dealing with the harsh environ-ment. Look forward to advances in solar panels, fuel cells, recycling systems, growing plants in closed environments, and much more. These advances will in-evitably create new industries that are going to fuel the economy.

It’s almost inevitable that the first moon base will be operated by a pow-erful nation, or a collection of nations.

However, there is no reason why a private corporation could not build a base on the Moon in the future. Google is already sponsoring the Lunar X Prize, offering $20 million for the first team to successfully land a robot on the Moon. Once that has been achieved, landing people on the Moon and building a base seems distinctly possible for private or-ganisations. In 50 years time, you may be able to spend your holidays in the Mare Nectaris.

Space exploration has had a bumpy history, and the new plans for moon bases may well come to nought. But when we do return to the Moon, as I believe we will, let us hope that it will be in the spirit of the words that Com-mander Eugene Cernan spoke when he stepped off the surface of the Moon, “As we leave the Moon at Taurus Littrow, we leave as we came and, God willing, as we shall return, with peace and hope for all mankind.”

Frank Dondelinger is a PhD student in Systems Biology.

17www.eusci.org

Lunar base concept drawing from NASA (2006)

“ A moon base will likely provide immediate benefits for science

“N

ASA

Lunar habitat at NASA Langley Research Center

NA

SA

Our insatiable desire for faster, cheaper and more powerful computers has driven huge advances in electronics over the past few decades. Yet an im-pending brick wall in the development of conventional electronic technologies is triggering research into a variety of fields to explore radical alternative con-cepts. Whilst ideas such as the quantum computer remain in their infancy, others are being developed and tested today. The potential advantages of optical computing have lead a growing number to believe that light will replace electric-ity in the computers of the future.

The main obstacles holding back ad-vances in conventional computing origi-nate from fundamental properties of electronic circuitry, and are consequently a major worry for computer scientists. Inside every computer, information is transferred as an electric current carried by free flowing electrons. The maximum velocity of an electron is about 1/10th the speed of light, hence the speed of information transfer is highly limited. In microchips, electron traffic is directed by millions of switches known as tran-sistors. Transistors are linked by metal circuits, which are in turn etched onto silicon wafers. The silicon wafers provide insulation between each of the circuits, but as the circuits become progressively

more tightly packed the silicon’s insulat-ing properties begin to fail, leading to short circuits. This means that there is a natural limit on how many circuits and transistors can be crammed into a given space. As these components get smaller and sit closer together their electrons also become increasingly compressed and therefore generate a great deal of

heat. The fans we can hear buzzing away inside our laptops and PCs are struggling to cope with this excessive heat, which is indicative of the poor energy efficien-cy of modern computers, and can only get worse as processors become more powerful.

All of these problems and more could be overcome by replacing electronic circuits with all-optical circuitry. Data transfer would be at the speed of light and optical transistors would guide light signals, which are travelling minutely close together or even overlapping, without creating heat. There are further benefits when we look at the basic prop-erties of optics. Wires would no longer be needed, and the manipulation of individ-ual beams’ polarisations or wavelengths would allow data signals to travel through each other and emerge unaltered. This would enable optical data paths to handle multiple light beams carrying different sets of data in parallel, in contrast to elec-tronic circuits which handle data bits one at a time. A higher degree of parallelism would dramatically increase processing power resulting in, for example, computa-tions that would normally take 11-hours on your home computer being performed in less than an hour. Other possible ben-efits include three-dimensional circuit-ry, which would dramatically increase processing power, and very high energy-efficiency. High-capacity holographic memory would also become feasible, al-lowing multiple bits of information to be recorded in the same space and instanta-neously accessed at the same time. All of these potential advances would be impos-sible with conventional circuitry.

While there remain huge leaps to be made before all-optical computers become a reality, many optical devices are already in use today. Fibre-optic cables span the Earth’s oceans and are continu-ously transmitting huge amounts of data across continents. Laser printers and scanners sit in every office and DVDs are optically scanned in our PCs. Yet most of these devices still rely heavily on slow

electronic components. The first photonic transistor was tested

in 1989 and since then two decades of research have yielded many novel optical devices, which in the future could replace their electronic counterparts. Logic gates, devices that perform operations such as addition and multiplication, have already been built and would be the building blocks of more complex devices in an optical computer processor. Optical switches, interconnects and memories have also been manufactured.

All of these advances in optical technol-ogy are promising but it will take several years before an all-optical computer is seen in shops. Optical materials, re-quired to guide light waves, are far from mass production. Balancing issues such as expense and power consumption will plague companies for years to come and current optical devices are neither small nor complex enough for commercial in-terest to be truly sparked. A lot of research and development is required before new micro-optic components can be realised.

Many researchers believe that the best way forward for now is to meld electron-ics and optics, taking the best of both technologies to create optoelectronic hybrid computers. Optical interconnects and simple switches can be used for speed while electronic circuitry can cover more complex functions. As new advances in optical computing arrive, electronics will slowly be pushed out and a new era of high-speed computing will begin.

Ben Skuse is a PhD student in the School of Mathematics & Statistics.

18September 2009

Mal

gorz

ata

Ryg

ier

Many optical devices are already

in use today

Ben Skuse introduces the next revolution in computing technology

Fourth Time’s the Charm

“”

Am

ir K

irolo

s

Is there light at the end of the tunnel for all-optical computing?

19www.eusci.org

”“

In these ‘post genomic’ years, DNA gets a lot of press for the impact genome se-quences will have on our lives, which will indeed be phenomenal. But ulti-mately our genome is a set of blueprints for the key players in molecular biology - proteins. It is proteins that perform the functions that make life as we know it possible - providing structure, forming the antibodies that help us fight disease, carrying signals and catalysing chemical reactions. A protein molecule’s function is determined by a precise three dimen-sional structure created by folding of a chain of constituent amino acids, which often occurs spontaneously. This ‘protein folding problem’ has long been one of the big questions in biology.

Proteins are chains of up to several hundred units known as amino acids, taken from an alphabet of around 20 and repre-sented by triplets of bases in the coding regions of DNA. To understand a protein’s function, we must determine its structure, which is commonly attempted in the labo-ratory using methods such as X-ray crystal-lography. However, ‘solving’ structures in this way only works on a subset of proteins and is a long and expensive process. Some-times it’s possible to make a guess at the structure of a protein by comparing it to

a relative with an already solved structure. To some ‘structural biologists’ however, this solution is a little unsatisfying. Because many soluble proteins have the ability to fold spontaneously in solution, their 3D structure must be encoded in their se-quence and for these proteins at least we should simply be able to infer structure directly from sequence. Unfortunately, the situation is rather more complex.

The problem has historically been a lack of a full understanding of the biophysi-cal properties that bring about protein folding. Some general principles have been known for some time; for example, that certain classes of amino acid don’t mix well with water, so tend to be buried inside the structure when a protein folds. The trouble is that the links between amino acids can adopt any of a number of different orienta-tions and the protein as a whole therefore has a large number of possible shapes to adopt. In fact, it has been estimated that no protein of average size could adopt all such conformations within the age of the universe - a problem known as Levinthal’s paradox after the scientist who first pointed it out.

Because of this, for many years it was thought a protein sequence would navi-gate through a series of intermediate partially-folded states, before the target structure was reached. In recent decades, however, this idea has changed, with work pioneered by Peter Wolynes of UCSD, and Ken Dill of UCSF. For an analogy, imagine a busy restaurant kitchen, where each part of a dish is produced in parallel by a different individual and assembled in steps so that your meal appears in record time. The proposed mechanism works the same way, invoking a hierarchical folding mechanism, by which various regions of the sequence form clusters, fold independ-ently, and subsequently agglomerate in a progressive manner. This mechanism is supported by research in which folding has been sped up by the mutation of amino acids thought to participate in these clus-ters. Such experiments have led research-ers to the belief that they understand most

of the underlying principles of protein folding and that future refinements and in-creases in computing power will provide a definitive solution. Virtual, low-resolution folding of very small proteins has also been demonstrated which have demonstrated that scientists are on the right track.

For many years, many simplifications and optimisations have been necessary to model protein folding. To simulate every atom in lifelike detail is simply not feasi-ble, even on the most powerful computers. However, increases in available comput-

ing power do mean that these simplifica-tions don’t have to be so simple, moving a more complete solution within reach. One fascinating development on this front is the invention of Stanford University’s Folding@home (http://folding.stanford.edu/), and related software, which allow you to contribute your computer’s idle time to protein folding. Who knows? You or your computer could make a scientific breakthrough.

The way a protein folds is crucial for un-derstanding its function, and for altering or fixing that function. A number of human diseases, particularly those involved in neu-rodegeneration, are the result of mis-folded proteins, an understanding of which might some day lead to treatments. Rational drug design, rather than the frequently random approach used to date, is critically de-pendent on the knowledge of the protein structures involved in disease, which can frequently be tricky membrane proteins which are particularly difficult to solve in the laboratory. Many problems remain, but structure prediction has come a long way since the days of Levinthal, and full struc-ture prediction may be within reach.

Jon Manning is a postdoc in the Centre for Cardiovasucular Science.

3D structure must be encoded in

protein sequences

Laur

a Ba

iley

Jon Manning explores one of the great problems of biology

THE PROTEIN FOLDING PROBLEM

Laur

a Ba

iley

20September 2009

What made you pick up this maga-zine? Were you in search of an attrac-tive fire-starter, or did you have high hopes of mind-broadening articles?

Enhancing our brains is something most of us attempt every day. Going to lectures, eating oily fish, exercise, reading EUSci will all to a greater (or lesser) extent improve our brains. However, newer, more direct approach-es are offering greater enhancement clout. Pharmacological enhancement is available right now. Brain prostheses are already in use by some and likely to be available to the majority within our lifetimes. Overall, our ability to make our brains feel and fire as we wish is in-creasing rapidly. But should the pros-pect of being able to dictate events at our synapses excite us, or scare us?

What’s your Neuro-Tipple?

Do you ever drink at parties to be more ‘sociable?’ For millennia humans have tweaked their brain chemistry with substances such as alcohol, tobacco and caffeine. For decades mental illness has been treated by drugs able to influence mood and mental abili-

ties. Some of these medications can not only normalise unhealthy brains, but enhance normal brains. Until re-cently, side effects prevented their use other than to treat illness. However, psychiatric medications are becom-ing increasingly targeted and specific,

opening up their use to make healthy people ‘better’ than normal.

The overt use of brain enhancing drugs is not widely acceptable; we are not yet in A Brave New World. However, some arguably healthy people can still legiti-mately access brain enhancing medi-cation via their use in mental illness. Difficulties in placing a dividing line along the spectrum of mental illness to normality can allow an ‘over-reach’ of diagnosis, and treatment, into the healthy population.

Depression is a classic example where at one end of the continuum there is a

risk of making a medical problem out of normal variation. Long term low moods can by lifted by SSRIs (selective serotonin reuptake inhibitors) such as fluoxetine (Prozac). However, giving SSRIs to healthy people does not seem to have blanket mood enhancing

effects. Instead, outcomes seem more subtle, with a reduction in negative thoughts, less awareness of negative images, and an increase in cooperative behaviour.

The drug marketed to alleviate ADHD (attention deficit hyperactivity dis-order), methylphenidate (Ritalin), has stronger brain enhancing poten-tial. In those with or without ADHD it can reduce reaction times, increase concentration and enhance problem solving abilities. This has led ambi-tious parents to seek unfounded di-agnoses of ADHD for their children. Some hockey coaches hand out Ritalin before matches. It can be used to aid revision and exam performance: in 2001 it was used by 7% of college stu-dents in the United States overall, and up to 25% in some universities. Several senior academics recently admitted in Nature that many of their colleagues used stimulants to aid their work and called for use of cognitive enhanc-ers by the healthy to be legalised and regulated.

Medications can also enhance brain function in other areas. Modafenil can help keep narcoleptics awake, but also mitigate the mental effects of sleep deprivation in people without sleep disorders. Acetylcholinesterase inhibitors such as donepezil can slow memory loss in Alzheimer’s disease,

Katie Marwick scratches her head over the methods and ethics of brain enhancement

“ Senior academics admit to using stimulants to aid their work

“

Designer SynapsesSo

nya

Hal

lett

Lasa

ni W

ijetu

nge

but also improve memory in young healthy individuals.

Making the Most of your Brainwaves

Medications developed to treat neu-ropsychiatric disorders are currently being used to enhance the abilities of healthy people. But, pharmacology is not the only way to enhance and extend the brain’s repertoire. Record-ing electrical activity in the brain and using it to drive external devices opens up a wide array of ‘brain-apps.’

As with neuropharmacology, the tech-nology has been medically pioneered by the drive to alleviate suffering. Four quadriplegics now have electrodes implanted in their motor cortices that allow them to think of an action and have it performed by an external device. For example, controlling tel-evisions, moving computer cursors, switching lights on and off or even moving a robotic arm.

Less invasive technology has been de-veloped for the gaming market. Light-weight headsets can be used to measure a basic brainwave electroencephalo-gram and hence move objects on a computer screen, or in the physical world. For example, by correlating the size of brainwaves with the strength of an air jet, degree of concentration can guide a ball around an obstacle course. Your next Christmas present could be the £60 Star Wars headset which har-nesses ‘The Force’ to shift balls up and down a tube. Whether or not you get a kick out of being a Jedi, the principle proved is exciting: a non-invasive brain to computer interface which could be used to control anything a computer can control.

Use your Brain to Save the World

Having souped up brains could come in handy. Most people would like to be more cheerful, more alert, smarter, need less sleep and have a better memory. We might never again lose our keys…

Certain professions could particularly benefit. The military is investigating the use of concentration enhancers and sleep reducing agents. Aircraft controllers or surgeons performing lengthy operations could benefit from cognitive stimulants. Doctors working night shifts could take modafanil and reduce fatigue-induced errors. If evi-dence showed that patient care was im-proved, would it be wrong of doctors to refuse to take an enhancer?

At a societal level, making everyone smarter could help crack difficult prob-lems. Reverse climate change perhaps, cure cancer, be slightly less confused by quantum mechanics. If coopera-tive behaviour could be increased by widespread SSRI use, maybe we could stop having so many wars? Could the Middle East conflict be resolved or obesity reduced as comfort eating became unnecessary? So why not put Prozac in the water?

Pause for Thought

It’s a no-brainer to realise that there are several objections to brain en-hancement, both practical and ethical. There are always side effects. Although modern psychoactive medications are

more selective than their predeces-sors, there are no ‘magic bullets.’ For example, SSRIs can cause headache, nausea and sexual dysfunction and methylphenidate can cause growth re-tardation in children.

There may also be unknown side effects associated with long-term use of brain enhancing medications. One concern is resource allocation. Our brains have been optimised by millions of years of evolution. Given that we’re still not sure what sleep does, should we be experimenting with ways to reduce it? Maybe remembering lots of detail would prevent us from general-ising? Maybe concentrating always on the task in hand would prevent creative daydreaming?

An ethical issue is the low likelihood that access to brain enhancing tech-nology will be equitable. Taken to the extreme, a super-race of enhanced humans could be created alongside an underclass of the non-enhanced. However, inequality already exists and is tolerated for many factors associated with a general increase in mental abili-ties, such as nutrition, exercise and education.

A final ethical concern is the small matter of the point of life. For some, happiness is the meaning of life, and for many, there is a deep-rooted feeling that one should work to achieve success and happiness. Would we be content to replace “no pain, no gain” with “pop a pack, just sit back”? Is happiness from a pill different to happiness from a friendship? If happiness is the point of life, and we can in due course achieve it through chemical means, does it devalue the meaning of our existence? Such concerns don’t seem to stop us enjoying cheer-up chocolate…

Worryingly, enjoyable foodstuffs aside, brain-enhancing medications have arrived. They are already in wide-spread use outside medical contexts. As understanding of neuropsychiatric disorders improves, more and better drugs are likely to be developed. Brain-computer interfaces already exist for limited purposes, and are likely to open up an increasing range of brain controlled outputs in the future. The question is not whether or not to enhance our brains, but how to do so safely and ethically. Navigating the complex issues ahead may well need all the brain boosting tricks we can manage...

Katie Marwick is a Junior Doctor

based in Edinburgh.

21www.eusci.org

The Star Wars Force Trainer headset available from Uncle Milton this holiday season

Unc

le M

ilton

... a super-race of enhanced humans could be created...

““

Ever walked along a sandy beach and wondered about the number of grains of sand? Ever tried counting them? I, for one, have never managed to count them all. However, there are probably more stars in our universe (estimated at 7×1022) than grains of sand while 10% probably have planets circling them. Any planets outside our solar system are known as exoplanets. The first was discovered in 1992 and over 350 are now known. This continued search for other planets, especially those similar to Earth, resonates strongly with human nature.

The most common technique for de-tecting other worlds is the ‘radial ve-locity’ method. Technically, a planet does not orbit a star. Both objects orbit a point at their mutual centre of mass - the greater the relative mass, the smaller the orbit. Because this point

is close to the centre of the star, the star’s ‘orbit’ is evident only as a slight wobble, which we can detect, and thereby infer the presence of a planet. This technique alone has detected over 320 planets. Last April it detected Gilese 581e, the smallest exoplanet ever discovered. This planet is only 1.9 times the Earth’s mass and is the 5th planet to be discovered within the solar system Gilese 581, hence the letter ‘e’, out of 37 solar systems currently known. However, it is too close to its star and therefore outside the fabled ‘Goldilocks Zone.’ This is the region

where water is liquid, and therefore the most likely place for the existence of life as we know it. Planets have been found inside this region, but none even close to the size of the Earth.

‘Radial velocity’ can only estimate the minimum mass of a planet. But another technique, known as the ‘transit method,’ can help plunder more of its secrets, such as its size, density and the presence of an atmosphere and its composition. This method takes advantage of the chance crossing of a planet in front of its star, when ob-served from our point of view. This causes the star’s light to dip slightly, the larger the planet, the bigger the dip. The ‘transit method’ discovered its first planet, HD209458 b, in 1999, al-though it had already been discovered by the ‘radial velocity’ method. This planet continued to pop up in the news when further measurements proved a stratospheric atmosphere was present. This was an amazing find given that HD209458 b is 150 light years away, compared to only 8 light-minutes between the Sun and the Earth. This planet is very, very far away.

Our universe is an amazing place: we have found exoplanets with water, carbon dioxide and methane, some of the main building blocks of life; yet for now, oxygen has eluded us. Exoplanets exist which are hot enough to easily melt iron, or so old as to have been created less than a billion years after the universe started and 8 billion years before our solar system. The variety of exoplanets is immense and shows no real patterns. Some are nearly double the size of Jupiter, others 13 times its mass. Some are composed mostly of the lightest element in the universe, hydrogen, whilst others have super-heated cores of solid water. Nothing escapes the imagination of the uni-verse. However, until now, an Earth-like planet has eluded us: we are still unique. Nevertheless, this probably has more to do with the limitations of our

techniques (of which more exist than this article highlights) than with a pos-sible lack of Earth-like planets. This is soon to change following the launch of NASA’s Kepler mission last March. It will use the ‘transit method’ to hunt through a hundred thousand stars for planets even smaller than Earth. Fur-thermore, the European Space Agency is planning to launch the Darwin probe, which will have the equivalent of six Hubble Space Telescopes, and will be able to directly image Earth-like planets.

Why should we even bother? Doesn’t it make more sense to invest these huge sums of money to help solve climate change or world poverty? Humans are born explorers and space is truly our final frontier. More practically however, money invested in funding the development of this frontier tends to have a very high long-term return rate in the form of spin-off technol-ogy. A recent estimate suggests that for every dollar invested, you get a $20 return. The discovery of other worlds might also teach us to start appreciat-ing our Earth. It might show us what happens when you do certain things to a planet: for example, Venus’ extreme heat is the result of a runaway green-house effect.

Edward Duca is a PhD student in the Centre for Cardiovascular Science.

22September 2009

Am

ir K

irolo

s

We have found exoplanets with

some of the main building blocks

of life

“

”

Edward Duca explores other planets and the possibilities of a second Earth

NA

SA

Gilese 581e

23www.eusci.org

It is indisputable that the Internet has transformed our lives. Recently, a new set of web-based innovations termed Web 2.0 have emerged. A phenomenon driven by the commercial world, Web 2.0 advocates user created content (blogs and wikis), multimedia on demand (YouTube) and greater personalisation (Google search, Facebook). Web 2.0’s appeal is its focus upon users, allowing them to be part of a community and placing emphasis on en-gagement and participation. In essence, Web 2.0 technologies embody the idea of the read/write web; a second version of the Internet where users contribute as much as consume.

Web 2.0 has relevance to science. The need to effectively and efficiently tackle large scientific problems has resulted in a drive for more collaborative work across boundaries: geographical, disciplinary or organisational. This perspective is being widely adopted and taken seriously by the research councils. Evidence of this can be seen in funding for large-scale programmes such as the UK’s E-Science programme – a £190 million programme funding the de-velopment of next-generation computer-based scientific tools, based partly at the University of Edinburgh.

Web 2.0 could offer the scientific re-search community massive benefits if adopted and used correctly. Facebook, Bebo and Twitter are not only procrastina-tion tools. Social networking sites enable a stable platform for collaboration and keeping in touch with colleagues from all over the world. It is about building long-term relationships, managing your per-sonal network, and providing a place to

share opinions (and heated debates) in an easy way. In another example, blogging has enabled easy dialogue between early career and experienced researchers.

There are interesting implications for ed-ucation too. Some lecturers have adopted these methods in creating a community for students to discuss topics, share knowl-edge and foster the teacher/learner rela-

tionship. Without Facebook, your average professor would be hard-pressed to find the time, resources and expertise to set up an online forum on their lecture topics. After that hurdle, they would have to en-courage their students to use it. Whilst the latter might still pose a challenge, Web 2.0 has certainly lowered the barriers to build-ing communities.

Newer technologies such as Twitter, could prove revolutionary in the future. Twitter is a social networking and micro-blogging tool where people broadcast messages of up to 140 characters. Imagine if Twitter were to be used in a large-scale, distributed project. Each scientist could publish a short ‘tweet’ on their progress allowing others to follow and keep up-to-date without phone calls or email. It reduces the problem of large geographical distances, promoting truly global collabo-rative work.

Resources like Facebook and Twitter are predominantly text-based, but the ease with which video-based content can now be generated and distributed opens fascinating possibilities. For instance, The Journal of Visualized Experiments is a peer-reviewed video journal for biological re-search. Each article is a video which details the problem, the experimental method and the results. This fosters research transpar-ency and expertise exchange for complex techniques.

Video can also enable knowledge trans-fer outside of experimental science. As

an engaging medium, video is an excel-lent way of providing a brief introduc-tion to technical topics. A University of Edinburgh-based startup company, Vidi-owiki, uses videos to enable users to in-vestigate and identify cross-overs between disciplines. Each academic has their own profile and can publish papers and record video snippets of their work. Users can get

a quick overview through the video, access more details by reading the materials (typ-ically research papers) and spend as much time as they like examining the subject in greater detail.

It seems inevitable that Web 2.0 will impact the way research is conducted, but there are some concerns. Privacy is an important matter researchers have to con-sider before publishing their data online, work-related or otherwise. Scientific com-munities are highly competitive and thus tension exists between the desire for trans-parency and scientific secrecy. Likewise, for researchers conducting work in con-troversial areas (such as animal testing), greater openness might not be welcomed.

In relation to social networks, the line between private and public lives becomes blurred as personal and professional net-works cross: how do we keep our lives separate? Also, there is the problem of in-formation overload. Managing increasing numbers of communication channels will become more difficult, and a skill which many young researchers have to learn as their careers progress.

The challenge is to recognise and explore innovative uses of Web 2.0 to enhance current practices for research communi-ties. It has the potential to enable a para-digm shift in the way that we collaborate and enable knowledge transfer.

Kate Ho is a PhD student in the School of Informatics.

“”

Wus

el00

7

Lasa

ni W

ijetu

nge

Kate Ho taps into how the Internet can help researchers

Video can enable knowledge transfer outside of experimental science

Can Web 2.0 Transform Science?

24September 2009

Initi

ative

s

The British Science Association is a UK charity which aims to promote science to the general public and to facilitate scientific interactions. The Edinburgh and South East Scotland branch is prominent within the organisation and organises many exciting events including the new ‘Film and Science’ discussion series, which is quickly becoming a huge success.

The British Science AssociationThe British Science Association (formally know as the BA) was founded in York in 1831 with intentions that still remain today: “a British Association for the advancement of science, having for its objects, to give a stronger impulse and more systematic direction to scientific inquiry.” The annual meetings were held across the UK, and highlights include the coining of the term “scientist,” the first use of the term “dinosaur” and the debate on Darwinism between Huxley and Wilberforce in 1860. Nearly 180 years later, the semi-annual meetings still take place at the British Science Festival and generate great public and media interest.

The Edinburgh and South East Scotland BranchThere are 33 branches across the UK and their input is essential to the success of the British Science Association. Comprising volunteers from all ages and scientific backgrounds, the branches aim to inspire and engage the local public through various science-related events. The Edinburgh and South East Scotland branch was formed and opened in November 2003 by Dame Julia Higgins, the former president of the British Science Association. The committee is a diverse and enthusiastic one which holds informal meetings in The Meadow Bar, Edinburgh, discussing recent science

news. One of the committee members will introduce the meeting’s discussion topics, either taken from the British Science Association weekly news digest (a weekly email received by those registered on the website), or from the general media. This leads on to open discussion; at times

the attendees will divide into smaller groups to discuss particular issues raised. Other events have included star-gazing at Soutra Aisle in the Scottish Borders, ‘Beer, Bugs, and Brewing’ ‘Celebrating Scottish Photographic Development’ at the Camera Obscura in Edinburgh and a visit to the Falkirk Wheel.

Film EventsEarlier this year, the branch organised their first of a series of film events, a novel and exciting idea for the British Science Association, which took place at the Filmhouse on Lothian Road. The aim is to provide the general public with some light entertainment with a scientific theme. Each film and discussion feature begins with a short talk from a local guest speaker on a scientific or technical topic portrayed in a film. The film is then shown, and viewers are invited afterwards for an open discussion of the related themes.

With the Darwin 200 celebration in mind, the first event was Inherit the Wind, with a lecture aiming to show how the evolution versus creationism debate was portrayed. Almost 50 people remained after the film to take part in the discussion, which was particularly interesting when one audience member raised the question about the astronomical aspects of evolution. As there were a few astronomers in the audience, this soon became a heated discussion.

The second film run was Close Encounters of the Third Kind, an old but enjoyable film. The speaker for the event was Mr. Duncan Forgan (Institute for Astronomy, University of Edinburgh) who had recently published a paper presenting a numerical test for hypotheses of extraterrestrial life and intelligence. His lecture and the film led to discussions

of “are they really out there?” - a question on many people’s minds.

Since then, the British Science Association has successfully run Eternal Sunshine of the Spotless Mind, a sold-out event with psychiatrist Dr. Stephen Potts discussing memory and memory erasure,

and Snow Cake with the theme of autism, featuring Dr. Stephan Matthiesen, the current Chair-person of the Edinburgh and South East Scotland branch of the British Science Association. Future events will include The Constant Gardner and The Prestige.

The speakers for the film events are also being interviewed on camera to provide a short introduction to their scientific background and to describe the theme of the film featured. These appear on the Edinburgh and South East Scotland branch website and are produced by the branch’s committee.

Julia Kennedy, branch secretary for events and the organiser of the film programme, said, “It is amazing to see the film series in action as last summer it was merely a plan I had scribbled down on a piece of paper. I had not realised how enthusiastic the rest of the committee would be about it, and had definitely not realised that I would ever actually see it happen - now I know that there is a possibility that any event I propose may be put into action.”

“The Edinburgh and South-East Scotland branch has many opportunities for people to volunteer with us as we are always looking for assistance organising and setting up events, as well as recording and producing the short films. We are always open to event suggestions and are happy to meet with people outside the committee to discuss such ideas,” she says.

If you would like to get involved in the British Science Association, please contact Julia on [email protected] or visit the website at www.britishscienceassociation.org.

Katherine Staines & Julia Kennedyare PhD students at Edinburgh University

Light Entertainment & Enlightment: A film/talk SeriesKatherine Staines and Julia Kennedy discuss the British Science Association in Edinburgh

The film events aim to provide the general public with light entertainment

along a scientific theme

“”

Julia

Ken

nedy

Discussion introducing Eternal Sunshine of the Spotless Mind in May 2009

25www.eusci.org

Ask a random scientist how they use the web for their work, and they will probably come up with a dozen examples: whether it is accessing online journals, collaborating with colleagues on a wiki, or even just booking hotel rooms for a conference. Ask them about science communication, however, and they might well point you towards the website of the BBC, the Guardian, or another news source of their choice.

Despite this, not everybody is content to let the media establishment be the only provider of science news for the public. More and more scientists are beginning to realise the full potential of the web and what it can do for public understanding of science. These people are trying to do for science on the web what pioneers like Carl Sagan and David Attenborough did for science on television: make it accessible, immediate and fun.

Most accessible, and probably most numerous, are the science blogs. These days, anyone with five minutes to spare can set up a blog for free, and many scientists have done so. There are even blogging communities for scientists, such as the scienceblogs.com, which hosts Pharyngula, the blog of biologist and vocal atheist PZ Myers. Myers is an

associate professor at the University of Minnesota who somehow manages to find the time in between teaching and research to enlighten his audience about advances in evolutionary biology and the follies of creationism.

For some, science communication has become a full-time job. Astronomer Phil Plait started his blog, Bad Astronomy, that dwells on astronomy, space, and common misconceptions about them, while still employed at Sonoma State University. After the enormous success of his blog, Plait was able to quit his job and become

a full-time science writer, as well as president of the James Randi Educational Foundation, which aims to promote critical thinking. Plait reasons that blogs like Bad Astronomy are important to correct the public’s perception of science as “science portrayed incorrectly becomes absorbed by the public.”

Not every scientist blogger writes about science news or the latest in pseudoscience. Some have taken on the equally important job of describing the daily life and challenges of being a scientist. One such person is Female Science Professor, an anonymous blogger who only tells us that she works as a professor in a physical sciences field. When asked for her reasons for blogging, she wrote, “I wanted to write about issues [...] that were not being addressed from the perspective of a (somewhat angry) senior female science professor.” Her blog gives an insightful and often amusing account of the life of a science professor, and occasionally reveals the shocking sexism that still exists in the world of academia.

Science blogs are of varying quality and popularity, and not everybody is satisfied with the occasionally less than stellar writing. One such person is Ginger Campbell MD, who hosts The Brain

Science Podcast. (Podcasts, for those not in the know, are like home-made radio shows that can be downloaded and listened to on your MP3 player). Campbell started her podcast out of a personal interest in neuroscience, but she soon became more involved in the science podcasting scene. In 2008, she set up sciencepodcasters.org, which serves as a portal for finding science podcasts. (Full disclosure: The EUSci podcast is featured on sciencepodcasters.org). According to Campbell, the goal of sciencepodcasters.org was to make the smaller independent science podcasts

more accessible. Campbell thinks that podcasts and blogs are an opportunity for deeper exposition of science topics. “The advantage that bloggers and podcasters have over traditional media,” she says, “is that we are not constrained by their ‘sound bite’ mentality.”

We have covered blogging and podcasting, but what about video content? While blogging only requires a keyboard and an internet connection, and anyone with a decent microphone can record a podcast, the entry barrier for producing science videos is still a bit higher. For that reason, science videos on the web are limited to sponsored sites such as TED.com and videolectures.net, and only famous scientists like Richard Dawkins or Richard Wiseman have YouTube channels. However, with digital video recorders becoming cheaper all the time, it is only a matter of time until passionate science advocates seize the opportunity.

The scientists in this article have all decided to be active online for varied reasons. Some want to educate and talk about their favourite science topics in detail. Others want to highlight problems and issues that they encounter. There is also the simple enjoyment of having a dialogue with a diverse audience that the web provides. Whatever your reason, if you feel that you have something to say, then blog it, podcast it or stream it. Science and the public can only gain from it.

Frank Dondelinger is a PhD student in Systems Biology.

Some bloggers have taken on the job of describing the daily life of a scientist

“”

Aw

ay from the Bench

Mal

gorz

ata

Ryg

ier

Scientist.net - The Future of Science Communication?Frank Dondelinger looks at how scientists harness the web to communicate their work

Recommended Links:- http://scienceblogs.com/ - Blogging community for scientists- http://scienceblogs.com/pharyngula/ - Pharyngula: Biology & atheism blogging- http://blogs.discovermagazine.com/badastronomy/ - Astronomy, spaceflight & pseudoscience- http://science-professor.blogspot.com/ - The truth about being a professor & woman- http://www.sciencepodcasters.org/ - Portal for science podcasts- http://www.ted.com/ - Videos from TED, the technology and science conference

Science blogger at work

“Art is born of the observation and investigation of nature.”

Cicero (106 BC - 43 BC)

“Great art picks up where nature ends.”Marc Chagall (1887 – 1985)

The artist Alistair Gentry once discussed Darwin’s relationship with the artistic el-ements of society, “Darwin himself was also following tropes and imagery that [were] already present in the culture, not only other scientists or proto-scientists but also fiction and philosophical texts from the mid-1800s onwards that were obsessed by the idea of degeneration or devolution [...] e.g. Poe’s Murders in the Rue Morgue in which the crimes are com-mitted by an ape human enough to lust and mutilate, but not human enough to control its savagery, or Shelley’s monster, a refined and sensitive intellect destined to commit murderous and loathsome acts [...] I’d consider the influence of art and fiction on Darwin in addition to vice versa. In fact I think there’s more traffic in the former direction.”

Similarly, in his The Decay Of Lying - An Observation, Oscar Wilde claimed that, “Life imitates art far more than art imitates Life”.

Accepting that science also feeds the arts, the suggestion is that art may act in a bidirectional communion with science, better allowing us a balanced perspec-tive. Can art really bring values to sci-entific objectivity? The possibility is certainly suggested by an extraordinary piece of art that we have at the Universi-ty of Edinburgh. It beautifully imagines Darwin’s insight within The Descent of Man and then extends the metaphor to consider the ethics of scientific progress. Meanwhile its iconography is strongly suggestive of Darwin’s personal strug-gle over how his findings challenged orthodoxy.

Within a small semicircular recess in the main stairwell of the Ashworth Labs, King’s Buildings campus of the Univer-sity of Edinburgh, there is a statuette of a female common chimpanzee sitting on top of a disorganised stack of books. Like the “Alas, poor Yorick! I knew him...”

scene in Hamlet, she holds a human skull in her right forepaw. The other forepaw supports her chin, meditatively. Her right foot grasps a set of calipers, stead-ied by her left foot. Two of the books can be identified. One is titled simply DARWIN and is The Origin of Species, or more likely The Descent of Man, while the Bible is open at Genesis displaying the quote from the encounter between Eve and the serpent, “Eritis sicut deus” (“And ye shall be as God ...”), but the second half, “scientes bonum et malum” (“... knowing good and evil”), has been torn out.

This famous statuette is the Affe mit Schädel (“Ape with Skull”), created by the late-19th century German sculptor Hugo Rheinhold, and first exhibited at the 1893 Great Berlin Art Exhibition.

But what does it mean? One of the great things about the statuette, and a large part of its attraction, are the many possible interpretations. What do the separate elements suggest? The studious ape. The stack of books. The calipers. Looking to other works by Rheinhold for answers, an explicit message from Dynamite in the Service of Mankind cau-tions against imprudent use of technol-ogy. Likewise, in the case of the Affe mit Schädel, we might decipher a warning

against the application of scientific ra-tionalism carried out in the absence of morals. This is certainly a concern that has often been directed at science; for example, nuclear technology, genetic engineering and the recently proposed banning of primate experimentation.

Alternatively, the statuette in part sym-bolises Darwin’s own studious career, including his engagement with the ques-tion of human origins, his empiricism, the exacting inspection of his own ideas informed through his assessment of other literature and, ultimately, his own realization of the conflict between evo-lution and creationism.

The statuette turns the tables, placing a non-human hominid in what we know is a position only possible for humans. It acts as a powerful reinforcement of our primitive ancestry, a fact expertly con-firmed by Charles Darwin.

In this sense, the Affe mit Schädel is a clever integration of art and science, but it is not a ‘Darwinian’ piece of art, as much as it is Darwin.

More information on the Affe mit Schädel is available at http://darwinmonkey.com

Julian F. Derry is author of Darwin in Scotland (Whittles, 2009).

September 2009

Art

s an

d Re

view

s

Julian Derry asks if art can introduce values to scientific objectivity?

The statuette partly symbolises

Darwin’s own studious career

26

Thinking Kong

Mel

inda

Hou

gh

“

”

Affe mit Schädel (“Ape with Skull”) by German sculptor Hugo Rheinhold, 1893

27www.eusci.org

Arts and Review

s

If hearing the term pathologist makes you think of TV shows such as CSI or the organ scandal at Alder Hey hospital, be prepared to have your horizons expanded by this fascinating and compelling book. A Matter of Life and Death makes you think about the link between life and death and changes your perception of pathologists.

The book was born out of a BBC Radio series presented by Sue Arm-strong in the wake of the Alder Hey controversy when a pathologist at Alder Hey hospital removed organs from children without their parents’ consent. The series was designed to increase the public’s knowledge of pa-thology and to introduce them to real-life pathologists. Armstrong expands this concept in her book by interview-ing various specialised pathologists from around the world. The interviews explore the pathologists’ personal backgrounds, what sparked their inter-est in pathology and, perhaps most im-portantly, what it is that a pathologist does at work every day.

Contrary to popular belief, most pa-thologists are not involved in forensic pathology, but study diseases affecting the living. In one curious example, the pathologist interviewed was research-ing a rare lung disease when she was diagnosed with that disease herself. She later presented her own case at a medical meeting and continues to work in pathology, despite a heart-lung transplant. Another pathologist relates his involvement in trying to retrieve

the Spanish flu virus from samples held in the massive US Armed Forces of Pa-thology archives. The information he has uncovered about this deadly pan-demic is particularly relevant given the current H1N1 flu epidemic.

One of the most valuable insights this book gives is a seldom heard ex-planation as to why tissues samples are so vital to pathology. Scientists themselves explain that tissues should be retained for future study, not to add to some macabre collection, but to help future researchers learn more about how disease processes work and to assist in the efforts to treat or cure diseases. A Matter of Life and Death brilliantly helps to dispel the idea that pathologists are simply ‘doctors of death’ and instead reveals them as doctors who are constantly working to improve the health of the living.

Kirsten Shuler is a PA in the Division of Clinical Neurosciences.

Book Reviews

Kirsten Shuler reviews A Matter of Life and Death: Conversations with Pathologists by Sue Armstrong.

“Where does it come from—this quest, this need to solve life’s mysteries when the simplest of questions can never be answered?” With Mohinder Suresh’s probing question, the hit science-fiction show Heroes was launched in 2006. At times offbeat and dark, we were rapidly hooked into the story of normal people discovering they possess extraordinary talents that could change the world. Yvonne Carts-Powell’s first book, The Science of Heroes, explores the science and plausibility behind these superpowers.

Ms. Carts-Powell utilises Heroes to present accessible and easy to read morsels of the complex research at the cutting-edge of diverse subjects ranging from physics to neurobiology to stem cell research. After introducing the mechan-ics of science (for non-practitioners), she explains the genetic probability of evolv-ing a superpower before diving into our favorite characters. Subsequent chapters are centred around a particular character in order to explore the field or key con-cepts underlying the plausibility of their ability: Hiro’s space and time travel intro-duces the physics of time; Claire’s cellular regeneration showed us just how much we know about immunology and stem cells; and Claude’s invisibility might be more plausible than most of us realize. There are

also creative explanations for improbable abilities such as Nathan’s ability to fly. The book is more than a simple summary of science. Historical anecdotes and wacky analogies from cuttlefish to ‘assume an orbital Wylie E. Coyote’ abound. Ms. Carts-Powell ultimately challenges us to consider the nature of a hero and how we use the abilities we each possess.

Aimed squarely at the non-scientist, this concise text provides the kind of back-ground one might wish more of the general public possessed. Surprisingly, it also chal-lenged me, a biomedical researcher, to

think about some of the wider implica-tions of my own research. You don’t have to be a fan of the series to enjoy this book. However, by explaining the underlying reality of one of the most culturally rele-vant science-fiction series in decades, Ms. Carts-Powell is introducing a new genera-tion to the power of science and reveals how quickly we are catching-up with the avant-garde ideas of Victorian writers and Gene Roddenberry’s Star Trek.

Melinda Hough is a postdoc at Syracuse University.

Melinda Hough reviews The Science of Heroes: The Real-Life Possibilities Behind the Hit TV Show by Yvonne Carts-Powell.

Melinda Hough and Kirsten Shuler give their thoughts on recent science literature

Berk

ley

Trad

e

Dun

dee U

nive

rsity

Pre

ss

28September 2009

A D

ay In

The

Life

Of

Dr. Alexander Weiss is a lecturer in Psychology at the University of Edinburgh and has travelled the world to learn more about the evolutionary basis of personality in humans and non-human species. He is a consulting editor for the Journal of Personality and Social Psychology, received the Behaviour Genetics Association’s Thompson Award, and has pioneered the concept of ‘co-vitality,’ which refers to the co-existence within individuals of positive psychological characteristics.

Dr. Weiss’s research focuses on great apes, the taxonomic family in which humans reside. Asides from humans, this family includes gorillas, chimpanzees, bonobos, and orangutans. Here, Dr. Weiss talks to Joanna Brooks about investigating personality in great apes.

How did you become interested in comparative personality research?Approximately two years into my undergraduate degree in Psychology at California State University, Los Angeles, I really became interested in the behavioural differences (and similarities) between humans and non-human species. I then followed up these interests by taking a Master’s Degree in Comparative Psychology at California

State University, Long Beach and a PhD at the University of Arizona. My interest in personality developed when I saw how cross-species comparisons could help us to understand more about the structure and evolution of personality. In particular, comparative personality

studies may help us understand the selective pressures that shaped the important evolutionary differences between apes and man. Since then, I also developed an interest in how personality can have an impact on mortality, aging, well-being and depression.

How do you study personality?In humans, personality is most commonly explored using the ‘Five-Factor Model’ which conceptualises personality within five different domains: neuroticism, extraversion, openness to experience, agreeableness, and conscientiousness. Within each domain there is a continuum of the personality attribute so, for example, a person could score highly on extraversion but low on neuroticism. The ‘Five-Factor Model’ has been widely

used to describe individual differences in human personality across different cultures, age groups and genders. I have used an instrument based on the ‘Five-Factor Model’ to study personality in non-human species like chimpanzees and orangutans.

Is personality in non-human species a recent concept?Great ape personality has been described by early luminaries in the field, including Robert Yerkes who wrote about it in 1939. Donald Hebb did some work along these lines in the late 1940s. Moreover, field researchers like Jane Goodall described the presence of personalities and there was some early work on personality in a small number of chimpanzees at Gombe National Park, Tanzania, in the 1970s.

What type of comparative studies have you conducted?I have collaborated with zoological parks in the United States and Australia via the ‘ChimpanZoo’ program of the Jane Goodall Institute. Also, I have more recently engaged in research with collaborators in Japan and at research centres like Yerkes National Primate Research Center. In one fairly recent study involving chimpanzees at Yerkes National Primate Research Center and chimpanzees at various zoological parks, research staff and employees who were very familiar with the chimpanzees were asked to rate their personality using a questionnaire. The questions focused on personality attributes like dominance, submissiveness, shyness, stability and jealousy. It was interesting to find that the personality ratings of the chimpanzees in the research centre were comparable to the personality ratings of chimpanzees in zoological parks and that the personality characteristics in general were quite stable between the two groups. This is congruent with the type of cross-cultural research that is conducted with humans.

Joanna Brooks learns about personality in great apes from Dr Alex Weiss

Many individuals deny the existence of personality in non-human animals

“”

A Day in the Life of…A Primatologist

Alexander Weiss being given a tour of the Sanwa Kagaku Kenkyusho Co. Sanctuary in Kumamoto Prefecture, Japan

Mih

o In

oue-

Mur

ayam

a

A D

ay In The Life Of

We have also explored whether or not the structure of orangutan personality is similar to chimpanzees and humans. Because orangutans are the most distant great ape related to humans and chimpanzees, important information about the evolutionary history of personality can be obtained. Our study involved orangutans housed in zoological parks across the United States, Canada and Australia. Zoo employees who were very familiar with the orangutans completed personality

questionnaires. Personality traits such as extraversion, agreeableness, and neuroticism were observed in the orangutans, suggesting that personality traits can be shared between humans, chimpanzees and orangutans.

What is a typical day in the field like?It depends on where I am working. I have recently been working in Japan at the Tama Zoo in Tokyo. It has been open since 1958 and provides animals with an extensive natural environment, and at the Japan Monkey Centre in Inuyama, which houses a wide variety of monkeys and apes. My working day in Japan would typically start at 6am and finish around 8pm. In general, each day is variable and can involve liaising with zoo personnel to collect ratings, discussing differences in the personality of the chimpanzees and monkeys with colleagues such as Professor Miho Inoue-Murayama, analysing data, or giving presentations during a typhoon with the power going on and off throughout. My main goal in Japan was to collect data to allow me to explore whether or not Japanese raters score the personality of chimpanzees in a different way to raters in the United States. I became interested in this possibility while thinking about how cultural differences between Japanese and American raters may give rise to differences in rating techniques. As it happens, we found a high consistency in rating technique between the Japanese and American raters.

Is non-human personality a controversial field?It is absolutely a controversial field. There are many individuals who deny the existence of personality in non-human animals. Moreover, the charge of anthropomorphism, of humans projecting personality onto other species, has dogged the field for some time. Many say that the use of questionnaires is an inappropriate way to assess the personality of our non-human cousins and other animals and that the only possible way to measure

animal personality is by behavioral observations. I’m the first person who will point out the shortcomings of using questionnaires and the need for plurality in research methods. However, I still think that questionnaire-based studies yield useful data.

What is the most important thing about research with primates?It is very important that primates in zoos are housed in conditions that are as close to their natural habitat as possible.

This means having plenty of room to roam around, lots of trees or wooden structures to climb on, other primates to interact with, a balanced healthy diet, and also ‘enrichment programs’ which typically involve volunteers or employees at the zoo or research centre giving the primates puzzles or tasks to solve.

What are the disadvantages of this type of research?The research can takes a long time to complete. In addition, the more powerful and convincing studies are those that employ multiple approaches and techniques but doing so typically means the study you are conducting will take even longer to complete than a normal set of experiments.

What advice would you give to young researchers embarking on a career in

comparative research?Basically, study species you either have always loved or have come to love. This makes every working day a joy to wake up to and gives you the motivation to keep going. Also, get to know the species by spending time informally observing them at zoos nearby or in other facilities; just see how they live their lives. Finally, take courses and become proficient in advanced methodology and statistics. This will greatly increase your chance of getting employed in the kind of position that will let you pursue your interests in animal behaviour.

Dr Weiss’ next trip will be to follow in the footsteps of Jane Goodall to Gombe, Tanzania. He plans to collect ratings of personalities of the wild chimpanzee there and compare his results with the extensive data already collected on the population.

Joanna Brooks is a PhD student in the Department of Psychology.

“”

Study species you have always loved or have come to love

Dr. Alex Weiss, primatologist

Ale

x W

eiss

Chimpanzee at the Tennōji Zoo in Osaka, Japan

Ale

x W

eiss

29www.eusci.org

30September 2009

His

tory

The University of Edinburgh is not only famous for its place in the history of science, but also for its place in the history of the social study of science. In the 1970s, a small interdisciplinary research group in the newly formed Science Studies Unit proposed a radical and controversial way of studying scientific knowledge itself as a social and cultural phenomenon. The group’s approach became known as the ‘strong programme’ in the sociology of scientific knowledge.

In the 1960s, a debate was raging in the UK over a perceived lack of mutual understanding between people trained in the arts and humanities (including most politicians) and those trained in the science and engineering disciplines. The debate had been ignited by a public lecture entitled The Two Cultures, given by the physicist and novelist Charles Percy Snow. Snow argued that intellectual life in the UK was divided into two cultures, one comprised of the literary intellectuals who dominated public and political life, and the other comprised of scientists and engineers. In particular, Snow observed that the literary intellectuals were not aware of what was going on in the sciences at the time.

In the wake of this debate, the Science Studies Unit was established in 1966 in the Faculty of Science and Engineering at the initiative of the geneticist Conrad Hal Waddington. The unit’s primary goal was to provide courses for science students that would broaden their horizons beyond mathematics and the skills of laboratory practice (even though, if Snow was right, it was rather

students in the humanities who needed their horizons broadened). In the hands of director David Edge, a radio

astronomer and science journalist, the unit quickly became much more than an educational resource. Today, the unit is so famous for its research in the so-called ‘strong programme’ that this is often simply referred to as ‘The Edinburgh School’.

The birth of the ‘Strong Programme’

After establishment, the unit was soon staffed by a group of four: David Edge himself; the philosopher and experimental psychologist David Bloor; the molecular biologist Barry Barnes; and the historian Gary Werskey (soon replaced by Steven Shapin). Besides teaching, they had plenty of time to do research.

John Henry has been at the Science Studies Unit since 1986. He is a historian of science and the unit’s current director. He says that the work of the unit took a direction that Waddington might not have expected.

“The unit didn’t introduce science students to art, history or literature in order to bridge a gap between

two cultures,” he says. “Instead, they introduced questions about how science and scientists fit into the larger

scheme of culture and society. They were not the only ones in the world to think about science in this way, as a cultural phenomenon, but they were definitely among the pioneers.”

Before the 1970s, sociologists interested in science had focused on the structure of scientific communities and questions about how values and norms influenced the behaviour of scientists. However, while sociologists might explain why people believe in, say, certain claims of religion, no attempt was made to explain why certain scientific beliefs became accepted and endorsed. What was distinctive about The Edinburgh School was that it broke with this tradition. Its proponents argued that sociologists and historians of science should explain the formation of all beliefs in the same kind of way, whether or not those beliefs are perceived to be true. For example, the current acceptance of the belief that DNA is the molecular basis of genetic inheritance merits the same kind of sociological explanation as the acceptance among Jehovah’s witnesses of the belief that precisely 144,000 people will go to heaven after Armageddon.

This so called ‘symmetry principle’ has been controversial, largely because some people have taken it to imply that the former (true) belief is no better or more warranted than the

Olle Blomberg looks back on the history of science studies at University of Edinburgh

Science is a cultural phenomenon“ ”

The Edinburgh School broke with tradition

“”

The Edinburgh SchoolM

elin

da H

ough

©Melinda Hough, 2009.

Professor John Henry (left) and Dr. Steve Sturdy (right) principle fellows of the Edinburgh School.

31www.eusci.org

Historylatter (false) belief. Advocates of the ‘strong programme’ argue that this is not the case, and insist that they regard science as providing the best technical knowledge available. But they believe that in order to get a better understanding of the role of science in society, a better understanding of the cultural context of scientific beliefs and practices is needed.

The Science Studies Unit Today

Today, the unit is located in Chisholm House in High School Yards, and the academic staff, consisting of six people, research everything from the history of Renaissance science and the history and sociology of psychiatry to the development of military technology and the relationship between scientific medicine and medical policy in the UK.

Even though the number of academic staff at the unit has not grown much since its birth, many now prominent sociologists of science and technology have come through the unit at some point in their career, and have taken the new discipline to other universities, or to other departments in Edinburgh. In 1987, the government recognised the unit as one of four major centres of excellence in science studies in the UK.

Besides giving courses in science and society, history of science, and history of medicine to first and second year undergraduates, the unit also offers as Master of Science programme.

Science and the Public

The relationship between science and the public has changed somewhat since C.P. Snow’s days. Since the heated debates about genetically modified organisms, politicians and science

policy-makers have been forced to take social and ethical perspectives on scientific research much more seriously. In addition, scientists have become better at communicating with the public. According to John Henry, they generally do this much better than researchers in the arts and humanities.

“There is a large public demand for popular science, and people are eager to know about the latest discoveries,” Henry says. “People say that no one can really understand string theory, but scientists at least give it a stab and try to explain what it is they are doing.

But take contemporary classical music on the other hand, with composers such as Stockhausen. What are modern music composers doing? They are not even trying to explain it to a larger audience.”

Future Science and Society

Steve Sturdy did his PhD in the unit after studying biology at Cambridge and philosophy of science at University of Western Ontario in Canada. He has been a lecturer at the unit since 1994. Sturdy says that understanding the relationship between science and wider society, at a global level, seems to be more important than ever. He urges that we figure out how “science can best benefit everybody” whether they live in scientifically and technically advanced countries, in emerging countries like China and India, or in less developed countries.

“I think there is an even bigger need for our courses today. We have more students and there is a wider recognition in society that there is a need for social perspectives on science and technology,” he says. “The public have become more aware of the ties between research and industry, especially in the life sciences, and of its social implications.”

Olle Blomberg is a PhD student in Philosophy.

Professor John Henry (left), director of the Science Studies Unit, and Dr. Steve Sturdy (right), lecturer in the unit (and currently Deputy Director of the ESRC Genomics Forum)

Olle

Blo

mbe

rg

“”

There is a need for social perspectives on science and technology

1966: The Science Studies Unit is founded by David Edge, who recruits

the philosopher David Bloor and sociologist Barry Barnes. The historian Steven Shapin joins shortly thereafter.

1970: The journal Social Studies of Science is founded by David Edge &

Roy MacLeod.

1987: The Science Studies Unit is recognised by the Univerity Grants

Committee as one of the four major UK Centres of Excellence in

Science Studies.

1992: The Science Studies Unit moves from the Faculty of Science &

Engineering to the Faculty of Social Sciences.

2001: The Science Studies Unit becomes part of the newly formed

School of Social & Political Studies.

Dr.

Hyp

othe

sis

Dr HypothesisEUSci’s resident brainiac answers your questions. Email [email protected] with your questions for the next issue.

Hi Dr. Hypothesis;I was examining my feet the other day and wondered whether toeprints are as unique as fingerprints? What is it that makes fingerprints (and toe-prints) so unique to the individual?

-Budding CSI Mo

The answer to the first part of your ques-tion is yes, your toeprints and footprints are as unique as your fingerprints. In 1952 Lanarkshire police took William Gourley into custody under accusation of breaking into a bakery safe. The only evidence against him was a toeprint found in some flour at the crime scene. After taking the suspect’s foot and toe-prints, a match was confirmed and Mr. Gourley was convicted.

Fingerprints are patterns of ridges, grooves and swirls on our skin, which help us to grip. The patterns are unique to individuals and do not alter through-out life. There are no two people in the world with the exact same finger or toe-print, even individual fingerprints are different from your other fingers. Iden-tical twins who have the same DNA have different finger and toeprints, al-though the patterns are thought to be similar.

The reason for this is that finger and toeprints are formed during the devel-opment of the foetus in the womb and therefore they are not determined en-tirely by your genetics. The ultimate pattern of fingerprints is believed to be influenced by a combination of factors during pregnancy including nutrition, the position of the foetus within the womb (which could explain why twins

have different fingerprints) and even slight differences in umbilical cord length. Because no two pregnancies are the same, neither are two sets of fingerprints.

Dear Dr. Hypothesis;This summer my face erupted in freck-les, as usual. What exactly are freckles and why do they come out more often in summer?

Many thanks,-Freckly Fiona

Freckles are basically small clusters of a pigment known as melanin, which gives skin its colour (more melanin leads to darker skin). Having freckles is predominantly genetic with the major gene involved being melanocortin-1-receptor, which was discovered by re-searchers at Leiden University Medical Center in the Netherlands. Freckles can be seen on anyone but are most com-monly observed on people with a paler complexion, blue eyes or red hair. They are usually found on areas of the skin exposed to the sun such as the face, arms and shoulders.

The reason that they come out during sunshine is because the ultraviolet rays that come from the sun activate melano-cytes, which are the skin cells that produce melanin. This is then released into surrounding cells causing freck-les to appear darker and more numer-ous. So it’s an increase in the melanin produced by melanocytes, not an in-crease in the number of melanocytes. Melanin is actually thought to protect the skin from sun damage by reflecting

and absorbing ultraviolet rays; the darker pigment protects the lower skin layers from further damage. During the winter months when there is less sun, many people notice that their freckles fade away.

Dr. Hypothesis;My son came home from school all confused yesterday as he had been learning about the eye, and his teach-er told him that we actually see things upside down? He asked me if this was true but I have no idea. Please help.

-Confused Colin

Back to basics: the reason we see is that light bounces off objects and straight into the front of our eye. The light then travels through the lens, which changes the direction of the light so that the image is flipped and is projected upside down onto your retina on the back of your eye. So yes, your son is technically right about the upside down thing. The retina then transfers the image into an electrical signal, which travels along the optic nerve, which connects your eye to your brain. The brain then switches the image back the right way up and tells us what we see. It is believed that for the first few days of a baby’s life they see everything upside down, because they have not yet become used to their vision. It’s the same reason why we have two retinas but still only see one of eve-rything; two messages reach the brain (one from each retina) and the brain deciphers them to produce one image. Our brain is constantly working hard to make images easier to see.

The answers to the following clues have all featured in EUSci (magazine, news site at www.eusci.org or podcast) or the general science media in recent months. See if you can guess them all!

Across

1. Creature capable of ‘jamming’ bat radar (9)3. DARPA’s vegetarian robot (4)4. An item you won’t be needing this sum-mer after all, according to the met office (8)6. Put a picture of one of these in your wal-let, and it will probably be returned if you lose it (4)9. Famous godless blogger (7)12. The European doughnut recently re-ported to be at threat from budget overruns (4)13. Mutations of this gene may be linked to increased risk of allergic conditions (9)14. Microprocessor developed in Edinburgh with great promise for mobile devices (6)16. Photosynthetic algae recently suggested as a potential source of oil (7)17. More interesting than bananas- for chimps at least (5)18. Male monkeys providing this regularly seem to ‘get lucky’ more often (4)20. Famous man of the protein folding para-dox (9)22. Nickname for a recently discovered and contentious fossil (3)23. Type of food that may not provide the nutritional benefits its proponents suggest (7)24. Home university of Dr. John Quinn (8)25. Losing body parts is not such a problem if you’re one of these (7)

Down

2. Israeli company that recently developed a sperm-shaped robot that could crawl through your veins (8)

Sci-wordTest your grey matter with these (mostly) science-related cryptic clues

3. Longest one this century was ob-served in July (7)5. Doing this can be an effective pain-killer (8)7. Useful as an elephant repellent - once its residents have moved out (7)8. Sounds like a good way to wipe out algal blooms (10)10. Special sheep variety used to dem-onstrate a ‘battle of the sexes’ in the womb (4)

11. One of these creatures was recently found fossilised in amber, preserved along with bacteria it its gut (7)15. Recent research adds weight to the claim that this may stave off or reverse Alzheimer’s (6)19. Country that recently withdrew from CERN (7)21. Best place to tickle a rat to elicit a giggle (4)

Email your answers to [email protected]. The first person to email correct answers to all the clues will receive a £10 book voucher.

Last issue’s answersAcross: 1. Acres; 4. Cowslip; 9. Ohm; 10. Figment; 12. Tepal; 13. Yeasty; 14. Ideology; 16.+22. Myocardial infarction; 17. Gaia; 20. Nerd; 22. (See 16.); 25. Cathodic; 26. Cilial; 28. Fermi; 29. Isthmus; 31. Ice; 32. Rostrum; 33. Colic; Down: 2. Chi; 3. Spectral; 4. Cite; 5. Withdrawal; 6. Lepton; 7. Polyoma; 8. Emery; 10. Feynman; 11. Guano; 15. Identifier; 18. Annulus; 19. Ecliptic; 21. Rotifer; 23. Ilium; 24. Cobras; 25. Curie; 27. Film; 30. Uzi

Sci-Word