Estimation of Genetic Diversity in Capsicum annuum L. Germplasm Using PCR-Based Molecular Markers

1 23

National Academy Science Letters ISSN 0250-541X Natl. Acad. Sci. Lett.DOI 10.1007/s40009-014-0236-5

Estimation of Genetic Diversity inCapsicum annuum L. Germplasm UsingPCR-Based Molecular Markers

Maneet Rana, Rajnish Sharma, ParulSharma, Sat Vrat Bhardwaj & ManishSharma

1 23

Your article is protected by copyright and all

rights are held exclusively by The National

Academy of Sciences, India. This e-offprint

is for personal use only and shall not be self-

archived in electronic repositories. If you wish

to self-archive your article, please use the

accepted manuscript version for posting on

your own website. You may further deposit

the accepted manuscript version in any

repository, provided it is only made publicly

available 12 months after official publication

or later and provided acknowledgement is

given to the original source of publication

and a link is inserted to the published article

on Springer's website. The link must be

accompanied by the following text: "The final

publication is available at link.springer.com”.

RESEARCH ARTICLE

Estimation of Genetic Diversity in Capsicum annuum L.Germplasm Using PCR-Based Molecular Markers

Maneet Rana • Rajnish Sharma • Parul Sharma •

Sat Vrat Bhardwaj • Manish Sharma

Received: 3 April 2013 / Revised: 29 October 2013 / Accepted: 1 November 2013

� The National Academy of Sciences, India 2014

Abstract The importance of germplasm characterization is

an important link between the conservation and utilization of

plant genetic resources in various breeding programmes. In

the present study, genetic variability and relationships among

twenty-four Capsicum annuum L. genotypes were tested

using PCR-based RAPD and ISSR molecular markers. The

level of polymorphism across genotypes was 42–44 % as

revealed by RAPD and ISSR, respectively. The highest

similarity was detected between PC-1, Feroz, Gajio, Kan-

daghat Selection-9 genotypes (96 %) and Feroz, Kandaghat

Selection-9 (93 %), by RAPD and ISSR markers, respec-

tively. It was concluded from the pooled analysis of both

molecular markers that genotypes ACC-2 and Mahog were

most distantly related to each other. Hence, it is recommended

that these two genotypes should be crossed to create a seg-

regating population with maximum genetic diversity. Fur-

ther, it is suggested that molecular markers are valid tags for

the assessment of genetic diversity in C. annuum germplasm.

Keywords Genetic diversity � RAPD �ISSR and Capsicum

Introduction

Capsicum annuum L. popularly known as sweet pepper,

bell pepper, capsicum and shimla mirch is a high value

solanaceous vegetable crop grown extensively in Karna-

taka, Tamil Nadu, Himachal Pradesh, Uttrakhand and

Darjeeling district of West Bengal. It is used either raw as

salad, cooked as vegetable, pickled or processed and is

appreciated worldwide for its flavor, aroma and color. It

has some medicinal properties and is used in treatment of

dropsy, colic, toothache and cholera [1]. Being an eco-

nomically important cultivated crop, genetic diversity is

essential for successful breeding and creation of new cul-

tivars [2]. Characterization and evaluation of crop varieties

based on morphological characteristics is often difficult,

since most of these characteristics are under the influence

of environmental factors. Developments in DNA based

technologies have revolutionized the utilization of molec-

ular markers in genetics and breeding studies [3, 4]. Ran-

dom amplified polymorphic DNA (RAPD-PCR) and inter-

simple sequence repeat polymerase chain reaction (ISSR-

PCR) technique have been widely used to quantify the

genetic variation due to its simplicity and power to detect

differences, even among closely related individuals, in

species of pepper [5]. Keeping in view the above consid-

erations and importance of germplasm characterization as

an important link between the conservation and utilization

of plant genetic resources, the present investigations were

carried out to analyze genetic diversity in C. annuum

germplasm using PCR based molecular markers (RAPD

and ISSR) analysis.

Materials and Methods

The present investigation was carried out in the Depart-

ment of Biotechnology, Dr YS Parmar University of Hor-

ticulture and Forestry, Nauni, Solan (HP) India. Twenty-

four genotypes of C. annuum L. were obtained from the

M. Rana � R. Sharma (&) � P. Sharma � S. V. Bhardwaj

Department of Biotechnology, Dr YS Parmar University of

Horticulture and Forestry, Nauni, Solan, HP 173 230, India

e-mail: [email protected]

M. Sharma

Department of Vegetable Sciences, Dr YS Parmar University of

Horticulture and Forestry, Nauni, Solan, HP 173 230, India

123

Natl. Acad. Sci. Lett.

DOI 10.1007/s40009-014-0236-5

Author's personal copy

Department of Vegetable Science of Dr YS Parmar Uni-

versity of Horticulture and Forestry, Nauni, Solan (HP)

India, which were previously collected from different

locations. These genotypes were inbred lines that were

selfed for two generations.

Molecular Markers Studies

Isolation of DNA was carried out from the leaves of Cap-

sicum germplasm by using CTAB method with some

modifications [6]. The DNA samples from the different

Capsicum genotypes were amplified using polymerase

chain reaction (PCR) using the protocol of Williams and

coworkers with a few modifications [7]. PCR was carried

out in a 25 ll reaction volume containing Taq DNA poly-

merase (3 U/reaction), Taq DNA polymerase buffer (19)

with 1.5 mM MgCl2, random decamer primers (10

pmol/reaction), deoxynucleotide triphosphate (dNTPs)

(25 mM) of Genei, Bangalore, India and template DNA

(50 ng/reaction). A total of 30 RAPD and 20 ISSR primers

were employed to characterize 24 genotypes of C. annuum

L. at their respective annealing temperatures (Tables 1; 2)

using a thermal cycler (Applied Biosystems, USA)

programmed to preliminary denaturation of DNA at 94 �C

for 4 min followed by 35 cycles of 94 �C for 1 min, 30 �C

for 1 min and 72 �C for 2 min. After 35 cycles, there was a

final step of 8 min at 72 �C followed by a 4 �C soak until

recovery. Products were analysed using 100 bp standard

molecular weight marker (GeNei, Bangalore, India) by

electrophoresis on 1.6 % agarose (GeNei, Bangalore, India)

gel in 1X TAE buffer for RAPD analysis and 2.0 % agarose

(GeNei, Bangalore, India) gel in 1X TAE buffer for ISSR

analysis containing ethidium bromide (10 mg/ml) respec-

tively and images were taken through Gel Documentation

Unit (Syngene, UK). Only those primers which produced

bands with all the samples were used to score for

polymorphism.

Similarity matrix was generated from binary data using

Jaccard Coefficient. The similarity matrix thus generated

was used for pair-group method with arithmetic average

(UPGMA) using software package NTSYS-PC 2.0 h [8].

Thus output data was graphically represented as dendro-

grams along with bootstrap values ([30) on the branches

using DARwin software for RAPD, ISSR and pooled

markers analysis, respectively. Marker index for RAPD

and ISSR markers was calculated in order to characterize

the capacity of each primer to detect polymorphic loci

Table 1 Amplified primers, their sequence, number of PCR amplified bands and amplicons obtained in RAPD analysis of C. annuum

S.N. Primer Sequence

(50–30)Annealing

temperature

(�C)

Number of bands Polymorphism

(%)

Amplified

product

range (bp)

Number of

amplified

fragments

PIC

valueTotal Monomorphic Polymorphic

1. OPA-05 AGGGGTCTTG 30 5 4 1 20.00 200–1,200 106 0.34

2. OPA-18 AGGTGACCGT 30 12 6 6 50.00 150–1,800 178 0.88

3. OPB-01 GTTTCGCTCC 32 2 2 0 00.00 350–900 48 0.00

4. OPB-17 AGGGAACGAG 32 7 1 6 85.71 250–1,400 69 0.76

5. OPB-18 CCACAGCAGT 30 9 4 5 55.55 200–900 95 0.84

6. OPD-12 CACCGTATCC 32 10 3 7 70.00 100–1,800 79 0.85

7. OPE-03 CCAGATGCAC 32 4 3 1 25.00 250–800 84 0.39

8. OPF-17 AACCCGGGAA 30 7 5 2 28.57 200–1,050 136 0.42

9. OPG-04 AGCGTGTCTG 32 3 2 1 33.33 300–800 52 0.54

10. OPH-17 CACTCTCCTC 32 12 5 7 58.33 150–1,350 196 0.89

11. OPL-18 ACCACCCACC 32 3 3 0 00.00 350–950 72 0.00

12. OPP-05 CCCCGGTAAC 32 6 6 0 00.00 150–950 144 0.00

13. OPP-12 AAGGGCGAGT 30 17 10 7 41.17 150–1,350 302 0.93

14. OPU-01 ACGGACGTCA 32 7 5 2 28.57 50–900 136 0.47

15. OPU-20 ACAGCCCCCA 32 5 4 1 20.00 200–800 112 0.33

16. OPY-07 AGAGCCGTCA 30 11 4 7 63.63 200–1,400 203 0.89

17. C-42 CCAGATTTTCTG 32 5 4 1 20.00 150–950 99 0.29

18. C-45 GGACAAGTAATG 32 10 2 8 80.00 150–1,250 88 0.87

Total 135 73 62 2,199

Average band/primer 7.5 4.05 3.44

% Polymorphism 45.92 %

M. Rana et al.

123

Author's personal copy

among the genotypes. PIC value was calculated using the

formula [9];

PIC = 1 - R(Pij)2, where Pij is the frequency of the ith

pattern revealed by the jth primer summed across all pat-

terns revealed by the primers.

Results and Discussion

RAPD Studies

Of the 30 random RAPD primers used, only 18 were able

to amplify the genomic DNA (Table 1). Fifteen random

primers were found polymorphic and the three were found

monomorphic. The rest of 12 primers failed to amplify the

genomic DNA uniformly and were not included into fur-

ther analysis. For a total of 18 primers, the number of bands

varied from 2 with OPB-01 to 17 with primer OPP-17,

respectively with fragment size ranging from 150 to

1,800 bp (approx.) for all the informative primers. The

total number of amplified fragments for each primer were

counted and found to be 2,199. A total of 135 bands were

amplified, of which 62 (45.92 %) were polymorphic and 73

(54.07 %) were monomorphic across all the subjected

genotypes. On an average, total number of bands generated

per primer was 7.5 of which 3.44 were polymorphic and

4.05 were monomorphic (Table 1). However, 99 marker

levels in C. annuum were obtained, of which 63 (63.33 %)

were polymorphic and 36 (36.36 %) were monomorphic

across the genotypes with total number of bands generated

per primer was 6 of which 3.9 were polymorphic and 2.25

were monomorphic [10].

The PIC value provides an estimate of the discrimina-

tory power of a locus or loci, by taking into account not

only the number of alleles that are expressed, but also

relative frequencies of these alleles. Referring to PIC value

recorded for all the informative RAPD primers, the PIC

vary from a minimum of 0.00 for OPB-01, OPL-18 and

OPP-05 followed by 0.29 for C-42 and maximum of 0.93

for OPP-12 with an average of 0.54 (Table 1). Our results

with respect to PIC values are consistent with the findings

of Yumnam et al. [11] corresponding to an average PIC

value of 0.52 in C. annuum landraces. A total of seven

primers (OPY-07, C-45, OPB-18, OPH-17, OPD-12, OPB-

17, OPF-17) were able to fingerprint the six genotypes of

C. annuum namely ‘EC-579997’, ‘UHF-14’, ‘Kandaghat

Selection-9’, ‘Kannauel’, ‘Local Collection Bilaspur’ and

‘California Wonder’ by giving 8 unique bands of sizes

1,300, 600, 950, 600, 1,400, 1,150, 400, and 1,150 bp,

respectively. These can be used as molecular markers to

label and identify different cultivated species. Such unique

bands were also reported while accessing genetic vari-

ability in Capsicum species using RAPD markers [12]. The

similarity coefficient values determined using Jaccard’s

coefficient based on eighteen RAPD markers ranged from

0.40 to 0.96. The mean similarity index was found to be

0.68 indicating that high level of diversity exists among the

genotypes. Our results holds good with the previous

investigations while estimating genetic diversity in C.

annuum [13–15]. The cluster tree analysis showed that the

Table 2 Amplified primers, their sequence, number of PCR amplified bands and amplicons obtained in ISSR analysis of C. annuum

S.N. Primer Sequence

(50–30)Annealing

temperature

(�C)

Number of bands Polymorphism

(%)

Amplified

product

range (bp)

Number of

amplified

fragments

PIC

valueTotal Monomorphic Polymorphic

1. ISSR-808 AGAGAGAGAGAGAGAGC 48 3 2 1 33.33 150–350 54 0.49

2. ISSR-810 GAGAGAGAGAGAGAGAT 48 8 2 6 75.00 200–900 89 0.80

3. ISSR-811 CACCACACACACACAAT 48 8 3 5 62.50 220–900 155 0.87

4. ISSR-818 CACACACACACACACAG 50 5 3 2 40.00 250–950 95 0.53

5. ISSR-819 GTGTGTGTGTGTGTGTA 48 3 3 0 00.00 200–600 72 0.00

6. ISSR-822 TCTCTCTCTCTCTCTAC 48 6 1 5 83.33 200–1,000 75 0.83

7. ISSR-824 TCTCTCTCTCTCTCTCG 50 2 2 0 00.00 200–700 48 0.00

8. ISSR-825 ACACACACACACACACT 48 5 0 5 100.00 150–600 69 0.85

9. ISSR-847 CACACACACACACACAGC 52 4 3 1 25.00 600–1,400 83 0.41

10. ISSR-849 GTGTGTGTGTGTGTGAA 48 5 3 2 40.00 250–900 99 0.57

11. ISSR-851 GTGTGTGTGTGTGTGTCG 52 5 4 1 20.00 250–750 107 0.33

12. ISSR-857 ACACACACACACACACGGTC 56 5 4 1 20.00 200–1,100 113 0.37

Total 59 30 29 1,059

Average band/primer 4.91 2.5 2.46

% Polymorphism 49.15 %

Estimation of Genetic Diversity in Capsicum annuum L. Germplasm

123

Author's personal copy

C. annuum genotypes were broadly divided into two major

clusters comprising of 22 and 2 genotypes respectively,

which branched at similarity value of 0.58. Maximum

similarity of 96 % was found between PC-1, Feroz and

Gajio, Kandaghat Selection-9 respectively (Fig. 1). Rad

et al. [14] also obtained two major clusters while evaluat-

ing genetic diversity in Capsicum spp. comprising of 38

and only one genotype, branched at similarity coefficient of

0.46.

ISSR Studies

Out of 20 ISSR primers used, only 12 were able to amplify

the genomic DNA (Table 2). Ten ISSR primers were

polymorphic and two were monomorphic. A total of 59

clear and reproducible bands were amplified from 24

genotypes using 12 selected ISSR primers (Table 2). The

number of bands varied from 2 with ISSR-824 to 8 with

primer ISSR-810 and ISSR-811, respectively with frag-

ment size ranging from 50 to 1,400 bp (approx.) for all the

informative primers. The total number of amplified frag-

ments for each primer were counted and found to be 1,059.

On an average, total number of bands generated per primer

was 4.91 of which 2.46 were polymorphic and 2.5 were

monomorphic (Table 2). Lijum and Xuexiao [16] observed

135 amplicons in 28 pepper plants by ISSR-PCR using 13

primers, of which 102 polymorphic loci, accounting for

75 % of the total loci and 33 (25 %) were monomorphic

across the genotypes with total number of bands generated

per primer was 10.38 of which 8.50 were polymorphic and

1.88 were monomorphic. The results clearly showed that

ISSR primers were more efficient in revealing DNA

polymorphism among the genotypes.

The PIC values varied from a minimum of 0.00 for

ISSR-824 and ISSR-19 followed by 0.33 for ISSR-851 and

maximum of 0.87 for ISSR-811 with a mean of 0.60

(Table 2). However, mean PIC value of 0.88 was observed

using microsatellite markers for assessing genetic relation

in C. annuum cultivars [17]. In the present study, a total of

two primers (ISSR-810 and ISSR-822) were able to fin-

gerprint the three genotypes of Capsicum namely ‘HC-

201’, ‘LC-1’ and ‘PC-2’ by giving unique bands of sizes

400, 1,250 and 200 bp, respectively. Such unique bands

were also reported using ISSR markers for accessing

genetic variability in Capsicum species [12]. The similarity

coefficient values determined using Jaccard’s coefficient

based on twelve ISSR markers ranged from 0.26 to 0.93.

The mean similarity index was found to be 0.60 indicating

that high level of diversity exists among the genotypes.

Likewise, similarity coefficient values ranging from 0.11 to

Fig. 1 Dendrogram obtained from RAPD analysis among Capsicum annuum L. genotypes

M. Rana et al.

123

Author's personal copy

0.96 was obtained using Jaccard’s coefficient thus, indi-

cated substantial diversity present in the germplasm. The

cluster tree analysis showed that the C. annuum genotypes

were broadly divided into two major clusters comprised of

18 and 6 genotypes, respectively which branched at simi-

larity value of 0.56 (Fig. 2). Feroz and Kandaghat Selec-

tion-9 revealed the highest similarity (93 %), clustering

together in ISSR phylogeny. Similarly, two major clusters

were obtained while assessing genetic diversity in C.

annuum [16, 17].

Pooled Analysis of RAPD and ISSR Studies

For pooled RAPD and ISSR studies, the similarity coeffi-

cient was as low as 0.41 to as high as 0.95 indicated sub-

stantial diversity present in the germplasm. Maximum

similarity coefficient 0.95 was observed between Feroz and

Kandaghat Selection-9 while minimum 0.41 was observed

in PC-1 and Local Bilaspur with a mean value of 0.68. The

present results hold well with the results of [12] having a

pooled range of 0.19–0.89 with a mean value of 0.54.

Summarizing RAPD and ISSR results, Feroz and Kan-

daghat Selection-9 revealed the highest similarity (95 %)

based on pooled RAPD and ISSR phylogeny. Although

these two accessions were collected from different loca-

tions for the present study, their close genetic similarity

indicates that these must have originated from the same

parents and could have migrated to different locations for

cultivation point of view.

Further, the cluster tree analysis obtained after pooled

RAPD and ISSR analysis showed that 24 C. annuum

genotypes were grouped in two clusters viz; A and B

comprising of 21 and 3 genotypes, respectively which

branched at similarity value of 0.58 with the maximum

similarity of 95 % was found between Feroz and Kan-

daghat Selection-9 (Fig. 3). Group A comprised local as

well as commercial genotypes while group B predomi-

nantly comprised local genotypes. This grouping further

strengthened previous findings that DNA based data can

reliably be used for studying phylogenetic relationship

among various accessions of a species based on geographic

origin [18–20]. It is concluded from the pooled analysis of

both molecular markers that genotypes ACC-2 and Mahog

are most distantly related to each other. Hence, it is rec-

ommended that these two genotypes should be crossed to

create a segregating population with maximum genetic

diversity. Further, it is suggested that molecular markers

Fig. 2 Dendrogram obtained from ISSR analysis among 24 Capsicum annuum L. genotypes

Estimation of Genetic Diversity in Capsicum annuum L. Germplasm

123

Author's personal copy

are valid tags for the assessment of genetic diversity in C.

annuum germplasm.

Acknowledgments Authors are thankful to Department of Science

& Technology (DST), New Delhi whose equipment facilities pro-

vided in one of the ongoing research project are fully utilized for

carrying out molecular characterization work.

References

1. Vyrodova AP, Andryshchenka VK, Zatuliveter VI (1988) Con-

tent of beta carotene in various vegetables. Fjiziologiya Bik-

ohimiya Kultrunykh Rasteni 20:167–171

2. Maric S, Bolaric S, Martincic J, Pejic I, Kozumplik V (2004)

Genetic diversity of hexaploid wheat cultivars estimated by

RAPD markers, morphological traits and coefficients of parent-

age. Plant Breed 123:366–369

3. Paterson AH, Tanksley SD, Sorrells ME (1991) DNA markers in

plant improvement. Adv Agron 46:39–90

4. Rafalski JA, Vogel JM, Morgante M, Powell W, Tingey CS

(1996) Generating and using DNA markers in plants, in non

mammalian genomic analysis: a practical guide. In: Birren B, Lai

E (eds). Academic Press, New York, p 73–134

5. Ryzhova NN, Kochieva EZ (2004) Analysis of microsatellite loci

of the chloroplast genome in the genus Capsicum (pepper). Russ J

Genet 40:892–896

6. Doyle JJ, Doyle JJ (1990) Isolation of plant DNA from fresh

tissues. Focus 12:13–15

7. Williams JGK, Kubelik AR, Ratalski KJ, Tingey SV (1990) DNA

polymorphisms amplified by arbitrary primers are useful as

genetic markers. Nucleic Acids Res 18:6531–6535

8. Rohlf FJ (1998) NTSYS-pc: numerical taxonomy and multi-

variate analysis system. Version 2.02e. Exeter publications,

Setauket

9. Nei M, Tajima F, Tateno Y (1983) Accuracy of estimated phy-

logenetic trees from molecular data. J Mol Evol 19:153–170

10. Bhadragoudar MR, Patil CG (2011) Assessment of genetic

diversity among Capsicum annuum L. genotypes using RAPD

markers. Afr J Biotechnol 10:17477–17483

11. Yumnam JS, Tyagi W, Pandey A, Meetei NT, Rai M (2012)

Evaluation of genetic diversity of chilli landraces from north

eastern India based on morphology, SSR markers and the Pun1

locus. Plant Mol Biol Rep 30:1470–1479

12. Thul ST, Darokar MP, Shasany AK, Khanuja SPS (2012)

Molecular profiling for genetic variability in capsicum species

based on ISSR and RAPD markers. Mol Biotechnol

51(2):137–147

13. Sitthiwong K, Matsui T, Sukprakarn S, Okuda N, Kosugi Y

(2005) Classification of pepper (Capsicum annuum L.) accessions

by RAPD analysis. Biotechnology 4:305–309

14. Rad MB, Hassani ME, Mohammadi A, Lessan S, Zade SG (2009)

Evaluation of genetic diversity in Capsicum spp. as revealed by

RAPD markers. Acta Hortic 829:275–278

15. Sanatombi K, Sen MS, Sharma GJ (2010) DNA profiling of

Capsicum landraces of Manipur. Sci Hortic 124:405–408

16. Lijun O, Xuexiao Z (2012) Inter simple sequence repeat analysis

of genetic diversity of five cultivated pepper species. Afr J Bio-

technol 11:752–757

Fig. 3 Pooled dendrogram obtained from RAPD and ISSR analysis

M. Rana et al.

123

Author's personal copy

17. Patel AS, Sasidharan N, Vala AG, Vinay K (2011) Genetic

relation in Capsicum annuum L. cultivars through microsatellite

markers: SSR and ISSR. Electron J Plant Breed 2:67–76

18. Olmstead RG, Sweere JA, Spangler RE, Bohs L, Palmer JD

(1999) Phylogeny and provisional classification of the solanaceae

based on chloroplast DNA. In: Nee M, Symon DE, Jessup JP,

Hawkes JG (eds) Solanaceae IV advances in biology and utili-

zation. Royal Botanic Gardens, Kew, London, pp 111–137

19. Knapp SL, Bohs MN, Spooner DM (2004) Solanaceae: a model

for linking genomics with biodiversity. Comput Funct Genomics

5:285–291

20. Gopinath K, Radhakrishnan NV, Jayaral J (2006) Effect of

propiconazole and difenoconazole on the control of anthracnose

of chilli fruit caused by Colletotrichum capsici. Crop Prot

25:1024–1031

Estimation of Genetic Diversity in Capsicum annuum L. Germplasm

123

Author's personal copy