Epidemiología del botulismo aviar en el Parque
Nacional de Las Tablas de Daimiel y otros humedales
de Castilla-La Mancha
Memoria presentada por
Ibone Anza Gómez
para optar al grado de doctor
por la Universidad de Castilla-La Mancha
VºBº de los Directores
Dr. Rafael Mateo Soria
Instituto de Investigación en Recursos
Cinegéticos IREC (CSIC-UCLM-JCCM)
Dra. Mª Dolors Vidal Roig
Facultad de Medicina de Ciudad Real
(UCLM)
UNIVERSIDAD DE CASTILLA-LA MANCHA.
DEPARTAMENTO DE CIENCIA Y TECNOLOGÍA AGROFORESTAL Y GENÉTICA
Epidemiology of avian botulism in the Tablas de
Daimiel National Park and other wetlands of Castilla-
La Mancha
Ibone Anza Gómez
PhD Thesis
Ciudad Real, 2014
Instituto de Investigación en Recursos Cinegéticos IREC (CSIC-UCLM-JCCM)
A mi familia y amigos
A todos los que luchan
por la conservación
AGRADECIMIENTOS
El mayor agradecimiento de esta tesis es para mis directores Rafa y Dolo por su
perseverancia, ganas de trabajar y convicción sin las cuales no se si hubiese sido posible
este trabajo y menos en cuatro años. Gracias a los dos porque me habeis facilitado
mucho el camino.
Por supuesto agradecer a mis padres “Aita” y “Ama” su apoyo incondicional en todo
momento, lo cual hace que estos tiempos que corren sean más llevaderos y me ha
permitido disfrutar del proceso de escribir esta tesis. Y al resto de mi familia, Lucia por
ser una hermana muy parecida a mi con la que me rio mucho, a mis abuelos porque sé
que les ilusiona esta tesis y a mis tios y primos, porque aunque no nos vemos mucho los
siento cercanos.
Ahora nombro sin orden de importancia según se me va ocurriendo…
Otro elemento muy importante en estos años ha sido “El Chaparrillo”, sus habitantes y
su veterinaria Elena que, además de ayudarme en muchos experimentos, me ha
enseñado muchas cosas de fauna, me ha dado la oportunidad de acercarme a las
“alimañas” que tanto me gustan y sobre todo ha hecho de Ciudad Real un lugar muy
interesante y divertido para mi…. en realidad fue el motivo principal por el que vine
aqui, porque siempre había querido estar en un Centro de Recuperación asi. También
tengo que agradecerle esos increíbles trekkings que hemos hecho y haremos.
A toda la gente del IREC por ser tan diversos y tener muchas ganas de aprender y
enseñar creando un ambiente “bichero” muy motivante. De la gente del IREC les
agradezco estos últimos meses y les doy animos para acabar conmigo a Ana y a Paco
que ya casi tienen la tesis también. Muchisimas gracias a todos los doctorandos de Rafa
que nos entendemos tan bién y nos damos ánimos mutuamente: Ana, Jaime, Nuria,
Jhon, Pilar, Mónica, Esther. También a los doctores y a los técnicos Manu, Pablo, Inés,
Sergio por sus buenos consejos. Importante agradecerle a Xurxo “el gallego” haberme
enseñado a diferenciar las aves acuáticas, algo que ha sido básico para realizar esta tesis.
Otro especial agradecimiento a Celia, Sandra y Jordi por su gran trabajo y ayuda en los
muestreos por Las Tablas y en nuestra querida Navaseca. Y a David Sánchez le
agradezco pasarme información sobre las depuradoras y sus opiniones sobre mis
resultados, siempre dispuesto a ayudar.
A la gente que me acogió durante mis dos estancias en París y Suecia, los técnicos y
predoctorales del departamento de anaerobios del Instituto Pasteur y en especial a
Hanna Skarin del SVA, Uppsala, que me enseño nuevas técnicas y se preocupó
muchísimo por mi durante mi estancia con ella a pesar de la gran cantidad de trabajo
que tenía.
A Chai tengo muchisimo que agradecerle, él ya lo sabe…suerte que lo encontré! por ser
el mejor compañero de aventuras, muy planeador y de gran confianza. Juntos hemos
aprendido muchas cosas de escalada, montaña y de la vida y las que
quedan……Rabadá….!!!!!! Y por suspuesto te agradezco los modelos de R.
Al Plafón por ser el centro de reunión para mis escaladas y aventuras por el monte, a su
gente tan autentica que me ofreció ese vínculo local que ahora tanto me une a esta tierra
llana. Sin estas aventuras, estos años de tesis no se como hubiesen sido… hubiese
publicado más?? Pues seguro que sí! Especial agadecimiento a los super Migueles por
haberme hecho una montañera fuerte casi como ellos y porque sin paciencia me han
hecho subir a casi todas las cumbres emblemáticas de España y ya casi he escalado 50
clásicas ibéricas…..y de los Migueles a Sevi también le agradezco sus razonamientos y
sus conocimientos informaticos que tantas veces me han salvado y puede que aun
tengan que salvar esta tesis. Aunque no sea del plafon a Manu el “artificiero” le
agradezco haberme enseñado esa ancestral técnica de los estribos y haberse embarcado
conmigo en la Oeste del Piku que tanto me obsesionó este verano y sin lo cual aun
estaría pensando en como subir a Picos de Europa y no hubiese terminado la tesis… Y a
Vari le agradezco haberme hecho romper la barrera del sexto grado en aquel viaje a
Chulilla.
A Marta del Circo Culipardo le agradezco muchísimo tener ese espacio reducido de
circo que ha mantenido mi poca flexibilidad y también le ha dado el punto bohemio que
le faltaba a Ciudad Real para ser casi perfecta…sigue dándonos clases de fuerza,
flexibilidad y aéreos porfavor!
Al grupo de los marcianitos Marchello, Tiri, Ana, Tula, Sergio, Rodri, Guili, Rafiki,
Angel y a la manada perdida Chipi y Ivan por su amistad andaluza-manchega, sus
diferentes puntos de vista y cada uno tiene lo suyo…
A mis amigas de toda la vida San, Ane, Ale, Amita, Nai porque me han animado
siempre y me dan ese bienstar de sentirte querido….y a todos los patxis de mi tierra de
la que tan orgullosa estoy. A Imanol mas que a los otros porque el también ayudó en
los muestreos de esta tesis. Y también a las que no lo han sido tan toda la vida pero si
muy amigas Itxaso, Sun y Lobna que me ayudaron a sacarme la carrera y el master.
A las chicas manchegas (y andaluzas) que me dan el toque femenino y yoguico, Covi,
Maria, Alba, Marisa y Raspa…y a Raspa le agradezco hasta el infinito haberme
mejorado la calidad de los gráficos en uno de los artículos.
Bueno y como en todos los agradecimientos seguro que se me olvida muchísima gente
pero nombrarlos a todos es imposible y tantos buenos recuerdos y tantas buenas
personas me hacen llorar asi que los dejo asi…..me siento muy afortunada de haberme
encontrado con toda la gente con la que me he encontrado a lo largo de mi ya larga vida.
Por último, les agradezco esta tesis a las aves acuáticas que viven en los humedales y
tantos misterios esconden, agenas a todos nuestros trabajos y preocupaciones, ellas son
la inspiración.
INTRODUCCIÓN GENERAL ..................................................................................... 1
1. El botulismo .............................................................................................................. 1
2. Botulismo aviar ....................................................................................................... 11
3. Pérdida de humedales: el caso de la reserva de la Biosfera de la Mancha-Húmeda 23
Referencias ..................................................................................................................... 29
ORGANIZACIÓN DE LA TESIS Y OBJETIVOS .................................................. 42
CAPÍTULO 1. Cepas de Clostridium botulinum de la misma rama causan el botulismo
aviar en el Sur y en el Norte de Europa .......................................................................... 44
1. Introduction ............................................................................................................. 47
2. Material and methods .............................................................................................. 48
3. Results ..................................................................................................................... 52
4. Discussion ............................................................................................................... 53
5. Conclusions ............................................................................................................. 55
Acknowledgements ........................................................................................................ 55
References ...................................................................................................................... 56
CAPÍTULO 2. Factores ambientales que influyen en la prevalencia de Clostridium
botulinum tipo C/D en humedales mediterráneos no permanentes ................................ 59
1. Introduction ............................................................................................................. 62
2. Material and methods .............................................................................................. 64
3. Results ..................................................................................................................... 69
4. Discussion ............................................................................................................... 78
Acknowledgments .......................................................................................................... 85
References ...................................................................................................................... 86
Supplemental material .................................................................................................... 93
CAPÍTULO 3. Eutrofización y bacterias patógenas como factores de riesgo de
botulismo aviar en humedales que reciben efluentes de estaciones depuradoras de aguas
residuales ........................................................................................................................ 97
1. Introduction ........................................................................................................... 102
2. Material and methods ............................................................................................ 104
3. Results ................................................................................................................... 113
4. Discussion ............................................................................................................. 122
5. Conclusions ........................................................................................................... 126
Acknowledgments ........................................................................................................ 127
References .................................................................................................................... 127
CAPÍTULO 4. Nueva perspectiva en la epidemiología de los brotes de botulismo aviar:
las moscas necrófacas como vectores de C. botulinum tipo C/D ................................. 135
1. Introduction ........................................................................................................... 138
2. Material and methods ............................................................................................ 141
3. Results and discussion ........................................................................................... 144
4. Perspectives ........................................................................................................... 149
Acknowledgments ........................................................................................................ 151
References .................................................................................................................... 151
CAPÍTULO 5. Diferencias en la susceptibilidad al botulismo y en la excreción de C.
botulinum tipo C/D entre especies de aves acuáticas ................................................... 156
1. Introduction ........................................................................................................... 160
2. Material and methods ............................................................................................ 162
3. Results ................................................................................................................... 168
4. Discussion ............................................................................................................. 175
5. Conclusions ........................................................................................................... 181
Acknowledgments ........................................................................................................ 181
References .................................................................................................................... 182
Supplemental material .................................................................................................. 188
DISCUSIÓN GENERAL ........................................................................................... 190
1. El agente causante de los brotes ............................................................................ 191
2. Historial de brotes en La Mancha Húmeda (Ciudad Real y Cuenca) y las aves
afectadas ....................................................................................................................... 192
3. Factores ambientales relacionados con los brotes y el problema de las aguas
residuales ...................................................................................................................... 194
4. Las moscas como vectores de C. botulinum tipo C/D........................................... 197
5. Las aves acuáticas como portadoras de C. botulinum tipo C/D ............................ 199
6. Invertebrados acuáticos como fuente alternativa de intoxicación ......................... 201
7. Síntesis .................................................................................................................. 202
Referencias ................................................................................................................... 204
CONCLUSIONES ...................................................................................................... 209
Intriducción general
1
INTRODUCCIÓN GENERAL
1. El botulismo
El botulismo es una intoxicación causada por la acción de las neurotoxinas
botulínicas (BoNTs) y caracterizada por una parálisis flácida de los músculos. Esta
enfermedad afecta a hombres y a animales vertebrados salvajes y domésticos como
aves, caballos, vacas, roedores, zorros y hurones de peletería y peces (Lindström et al.,
2004; Collins y East, 1998; Defilippo et al., 2013). El nombre “botulismo” deriva de la
palabra latina “botulus” que significa salchicha y se comenzó a usar en Europa Central
en el siglo XVIII para describir una enfermedad que producía parálisis muscular,
dificultades respiratorias, y un alto índice de mortalidad frecuentemente asociado al
consumo de salchichas (Peck et al., 2011).
1.1 Las neurotoxinas botulínicas BoNTs
Las BoNTs son proteínas que en base a sus características serológicas se
clasifican en 7 tipos denominadas de la A a la G, aunque recientemente se ha
descubierto un nuevo tipo, el H, que está aún por confirmar. Estas toxinas son muy
diversas y existen más de 40 subtipos con diferentes secuencias de aminoácidos
(Rossetto et al., 2014). Las BoNTs se encuentran entre las toxinas más potentes
conocidas y el Centro de Control y Prevención de Enfermedades de los Estados Unidos
(CDC) las ha clasificado en la “categoría A” entre los agentes de mayor riesgo para
ataques bioterroristas debido a su letalidad, su fácil producción y la necesidad de largos
cuidados intensivos en el hospital para su tratamiento en humanos (Arnon et al., 2001).
También se han incluido en la lista australiana de agentes bioterroristas y la Unión
Tesis doctoral – Ibone Anza Gómez
2
Europea las considera posibles agentes de agroterrorismo debido a los serios problemas
y pérdidas que causa entre animales domésticos (Woudstra et al., 2013).
1.2 Modo de acción
Las toxinas botulínicas son proteínas de 150 kDa con actividad de zinc-
endopeptidasa. Las BoNTs se secretan como toxinas progenitoras formadas por una
neurotoxina y por varios componentes proteicos no-tóxicos que las protegen y
transportan por el torrente circulatorio desde el intestino hasta su lugar de acción en la
unión neuromuscular (Rossetto et al., 2014). La toxina madura está formada por dos
cadenas de aminoácidos unidas por un puente disulfuro: la cadena pesada (H) de 100
kDa y la cadena ligera (L) de 50 kDa. La cadena H se une a la membrana sináptica de la
motoneurona y transloca la cadena L por endocitosis al citosol neuronal. Una vez en el
citosol, la actividad catalítica de la cadena L actúa cortando las proteínas del grupo
SNARE (acrónimo del inglés “Soluble NSF Attachment Receptor”), encargadas de la
exocitosis y liberación de acetilcolina, bloqueando así el impulso nervioso y
produciendo una parálisis flácida de los músculos (Rossetto et al., 2014). Cada tipo de
BoNT corta las proteínas tipo SNARE por un lugar diferente y específico: los tipos A y
E cortan SNAP-25, los tipos B, D, F y G cortan la sinaptobrevina, y el tipo C corta la
sintaxina y SNAP-25 (Breidenbach y Brunger, 2005) (Fig. 1). Las BoNT son muy
específicas y solo se unen a lugares concretos de las terminales nerviosas periféricas de
vertebrados, lo que explica su eficacia y potencia. La acción de las BoNT es reversible
in vivo y los afectados, si sobreviven, se recuperan del todo (Rossetto et al., 2014).
Intriducción general
3
SB
S-25
STX
Fig. 1. Mecanismo de acción de las BoNTS. (a) Modelo de intoxicación en 4 pasos (i) unión
específica de la cadena pesada (HC, negro) a receptores de la membrana neuronales de las
terminaciones nerviosas periféricas, (ii) endocitosis, (iii) translocación de la cadena ligera (LC,
círculo gris) al citosol neuronal mediada por la HC y (iv) LC cataliza la proteólisis en lugares
específicos de las proteínas SNARE encargadas de la liberación de acetilcolina al espacio
intersináptico. (b) Localizaciones de los lugares específicos de corte de las 7 BoNTs en las
proteínas SNARE: sinaptobrevina (SB), sintaxina (STX) y SNAP-25 (S-25). (Breidenbach y
Brunger, 2005).
1.3 El agente: Clostridium botulinum
Las BoNTs son sintetizadas por bacilos Gram-positivos, esporulados y
anaerobios estrictos del género Clostridium. Este género agrupa más de 150 especies
ampliamente distribuidas en el medio ambiente y en las regiones anaerobias del tracto
intestinal de vertebrados, donde se encuentran en forma de esporas de resistencia que
pueden perdurar durante mucho tiempo hasta que se dan las condiciones adecuadas para
su germinación (Rossetto et al., 2014). En concreto, las BoNT son producidas
principalmente por la especie Clostridium botulinum y secundariamente por Clostridium
baratii, Clostridium butyricum y Clostridium argentinense (Peck et al., 2011; Rossetto
et al., 2014).
Tesis doctoral – Ibone Anza Gómez
4
C. botulinum se subdivide en 7 tipos según la BoNT que produce aunque,
atendiendo a sus características genéticas y fisiológicas, también puede dividirse en
cuatro grupos (I-IV) tan diferentes entre sí que podrían considerarse especies distintas.
Cada grupo puede producir varias toxinas y una misma toxina puede ser producida por
diferentes grupos (Hill et al., 2007). El grupo I produce las toxinas A, B y F, el grupo II
produce las toxinas B, E y F, el grupo III la C y la D y el grupo IV la G, E y la F. En la
Tabla 1 se presentan las características permanentes de los diferentes grupos.
Los grupos I y II están asociados con brotes de botulismo humano y animales
mientras que el III es casi exclusivo de animales (Lindström y Korkeala, 2006).
Además, existen cepas que producen más de una toxina, como los serotipos Ab, Ba, Af
y Bf, y cepas que producen toxinas mosaico con características intermedias entre dos
toxinas (Lindström y Korkeala, 2006; Hill et al, 2007) como el tipo C/D y D/C que
afectan a aves y vacuno respectivamente (Takeda et al., 2005; Woudstra et al., 2012).
Tabla 1. Características permanentes de los diferentes grupos metabólicos de Clostridium sp
productores de neurotoxina botulínica (Popoff, 1995; Collins y East, 1998)
Características
GRUPO
I II III
IV
C.
argentinense
C.
butyricum
C.
baratii
Tipo de toxina A,B,F B,E,F C,D G E F
Proteólisis + - - + - -
Lipasa + + + - - -
Gelatinasa + + + + - -
Fermentación de la
glucosa + + + - + +
Tª de crecimiento (ºC) 10-48 3,3-45 15-50 20-45 10-50 20-50
Tª óptima (ºC) 30-40 25-30 30-37 30-37 30-37 30-37
Termo resistencia de las
esporas (ºC)
104-121
D 6-0,2
77-82
D 4-0,3
104
D 0,02-0,9
82-120
D 5,9
D= tiempo en minutos necesario para inactivar el 90% de las esporas a una determinada temperatura.
Intriducción general
5
Las BoNT están codificadas por el gen bot cuya localización en el genoma varía
con la cepa de C. botulinum. Así, las cepas de los serotipos A, B, E y F tienen el gen bot
insertado en el cromosoma bacteriano. Por su parte, las cepas de los serotipos C, D y sus
mosaicos tienen el gen bot incluido en un plásmido circular perteneciente a un profago
que presenta lisogenia inestable, es decir, el gen lo adquieren al infectarse con un virus
profago, lo pueden perder durante la multiplicación y volver a recuperarlo por
reinfección (Eklund y Poysky, 1974; Sakaguchi et al., 2005). Por último, las cepas del
serotipo G tienen el gen incluido en un plásmido (Hill et al., 2007).
1.4 Vías de intoxicación
Existen cuatro vías de intoxicación: la oral, la toxiinfección, la cutánea (a través
de heridas) y la iatrogénica (Rossetto et al., 2014).
La oral es la vía de intoxicación más común y se produce al ingerir la toxina
preformada en el exterior junto con el alimento. En humanos, está asociado a
conservas y carnes fermentadas en las que C. botulinum ha producido toxina
durante el proceso de anaerobiosis. Por su parte, en animales se asocia a la
ingestión de cadáveres o de los invertebrados que se desarrollan sobre ellos.
La toxiinfección se da principalmente en niños menores de un año dado que su
flora intestinal no está aún desarrollada y permite que C. botulinum colonice el
colon, donde produce toxina que pasa a la sangre (Midura et al., 1996). También
se puede dar en adultos con disfunciones intestinales o que han sido sometidos a
largos tratamientos con antibióticos (Rossetto et al., 2014). En animales, este
tipo de botulismo se ha descrito en potros (Swerczek et al., 1980) y se ha
sugerido que puede darse en pollos de engorde (Miyazaki y Sakaguchi, 1978).
Tesis doctoral – Ibone Anza Gómez
6
La vía cutánea es menos frecuente que las anteriores. En este caso, C. botulinum
se multiplica y produce toxina en el ambiente anaeróbico dentro de las heridas.
Se da sobretodo en personas drogodependientes por venopunción. También se
ha descrito en caballos, asociado a úlceras o castración (Bernard et al., 1987;
Liguori et al., 2008) y en pollos de engorde tras ser castrados (Trampel et al.,
2005).
El botulismo iatrogénico se asocia al abuso de Botox (marca comercial más
conocida de la forma de toxina botulinica cosmética; Rossetto et al., 2014).
1.5 Diagnóstico y métodos de detección
El diagnóstico del botulismo se basa en la sintomatología clínica (síntomas de
parálisis flácida) y en la ausencia de lesiones en la necropsia (si hay muertos) apoyado
en la confirmación laboratorial de la presencia de la toxina activa en sangre o en heces
de los pacientes o animales afectados (Rocke y Friend, 1999; Lindström y Korkeala,
2006). La detección del microorganismo, C. botulinum, en heces, contenido gástrico o
heridas ayuda a confirmar el diagnóstico (Lindström y Korkeala, 2006).
1.5.1 Cultivos y aislamiento del microorganismo
C. botulinum necesita un ambiente anaerobio para crecer lo que dificulta su
aislamiento; es necesario usar jarras anaerobias o cámaras de anaerobiosis, desoxigenar
todos los medios “previo uso” y usar indicadores de anaerobiosis. Para detectar y aislar
C. botulinum, primero se cultivan las muestras en medio líquido en el que se confirma la
presencia de la bacteria por bioensayo o por PCR, a continuación las muestras positivas
se cultivan en medio sólido y por último las colonias positivas se vuelven a confirmar
Intriducción general
7
(Lindström y Korkeala, 2006). Los medios líquidos más empleados son el “chopped-
meat-glucose-starch”; “cooked-meat medium”; “reinforced clostridial”; “fastidious
anaerobe” o medios que contengan combinaciones de triptona, peptona, glucosa,
levadura, y tripsina. Ninguno de estos medios es selectivo, por lo que permiten crecer
un gran número de microorganismos y dificulta el aislamiento. Para medios sólidos se
utiliza agar sangre o McClung Toabe Agar con yema de huevo, este último permite ver
la reacción lipasa y lecitinasa positivas que produce C. botulinum (Fig. 2), tampoco
existen medios sólidos selectivos (Lindstrom y Korkeala, 2006; Skarin et al., 2010). En
el caso de C. botulinum del grupo III tiene el problema añadido de que durante los
cultivos puede perder el fago que contiene el gen bot que codifica la neurotoxina
(Eklund et al., 1974), lo que hace imposible caracterizar las cepas aisladas por
bioensayo, ya que las colonias no producen toxina, o por PCR.
Fig. 2. Clostridium botulinum tipo C, cepa 07-BKT028387, en cultivo puro de McClung Toabe
agar. Halo opaco rodeando las colonias (lecitinasa +) y brillo iridiscente en la superficie de
desarrollo (lipasa +). (Imagen tomada del material suplementario de Skarin et al., 2010).
Tesis doctoral – Ibone Anza Gómez
8
1.5.2 Detección de neurotoxina
1.5.2.1 Bioensayo en ratón
El bioensayo en ratón es el método de referencia para la detección de la toxina
botulínica. Este test se basa en inyectar la muestra problema (suero u otra muestra
diluida en un tampón) intraperitonealmente a dos grupos de ratones de laboratorio: un
grupo con la muestra sospechosa y otro con la misma muestra neutralizada con
antitoxina polivalente o hervida (la toxina es termolábil). Si la muestra contiene la
toxina, los ratones que han recibido la muestra sin tratar desarrollan síntomas de
botulismo (pelo erizado, parálisis del tercio posterior, dificultad respiratoria que provoca
cintura de avispa y muerte), mientras que los ratones que han recibido la muestra tratada
sobreviven. Estos síntomas normalmente se desarrollan durante las primeras 24 horas,
pero pueden tardar varios días en aparecer. Posteriormente el tipo de toxina causante del
brote se determina mediante un test de neutralización con antitoxina específica (CDC,
1998). Varios ratones se inyectan con la muestra positiva neutralizada con una de las
antitoxinas de las que se sospecha; el ratón que sobrevive es el que había recibido la
antitoxina adecuada. Este método se puede usar para detectar toxina en suero, así como
en muestras biológicas (heces, alimentos, contenido gástrico…), ambientales
(sedimentos) y cultivos. La técnica es específica y sensible pero requiere mucho tiempo,
instalaciones para ratones y conlleva problemas éticos. Además, los resultados no son
siempre fáciles de interpretar ya que el ratón puede mostrar síntomas inespecíficos o
morir antes de darlos (CDC, 1998; Lindström y Korkeala, 2006), por eso se están
buscando técnicas de referencia alternativas.
Intriducción general
9
1.5.2.2 Métodos inmunológicos
Existen varios métodos inmunológicos para la detección de los diferentes tipos
de BoNT: radioinmunoensayo, difusión en gel, hemoaglutinación pasiva y ELISAs,
siendo este último el más utilizado (Lindström y Korkeala, 2006). Técnicamente, los
inmunoensayos son más sencillos, rápidos y permiten analizar un mayor número de
muestras que el bioensayo, pero la mayoría han resultado ser menos sensibles y
específicos. Los principales problemas de estas técnicas son que detectan toxina
biológicamente inactiva y que se pueden producir reacciones cruzadas entre toxinas
dando falsos positivos. Además, variaciones genéticas entre las diferentes toxinas
pueden repercutir en la afinidad de los anticuerpos, dando también falsos negativos
(Ekong, 2000; Lindström y Korkeala, 2006). A pesar de ello, estas técnicas se han
refinado y la sensibilidad y especificidad están alcanzando las del bioensayo (Ekong,
2000).
1.5.2.3 Espectrometría de masas (Endopep-MS)
La espectrometría de masas es el método desarrollado más recientemente. Se
basa en la detección in vitro de los péptidos que forman las toxinas botulínicas tras
cortar las proteínas SNARE por puntos específicos. Se han desarrollado ensayos para
las diferentes toxinas pero sólo se comercializan para el tipo A. Potencialmente esta
técnica podría reemplazar al bioensayo porque detecta toxina biológicamente activa y
porque está resultando ser muy sensible y específica. La gran desventaja es que necesita
equipos muy caros y personal especializado, por lo que no se puede instalar en todos los
laboratorios. Por otra parte, al ser un método novedoso aun no se ha validado con
muestras complejas como alimentos o heces (Lindström y Korkeala, 2006). El método
Tesis doctoral – Ibone Anza Gómez
10
en principio se desarrolló para las toxinas A, B, E y F que afectan a humanos (Kalb et
al., 2006) y posteriormente para las toxinas C y D que afectan a animales (Hedeland et
al., 2011).
1.5.3 Detección molecular del gen que codifica BoNT con la técnica PCR
Este método se basa en hacer millones de copias de partes específicas de genes
diana de un organismo para facilitar su detección en una muestra. En los últimos años,
se han desarrollado muchos protocolos de PCR para la detección de C. botulinum. Esta
técnica es sensible y específica, además es más rápida que el cultivo y el bioensayo, y
permite el análisis de un gran número de muestras, lo que es importante en estudios
epidemiológicos. Otra ventaja es que muchos laboratorios tienen los equipos necesarios
y personal cualificado para su uso (Lindström y Korkeala, 2006). La desventaja es que
la mayoría de los protocolos para C. botulinum (exceptuando alguno de PCR de
retrotranscriptasa inversa) solamente detectan el gen de la neurotoxina bot y no detectan
la actividad del gen ni la toxina. A esto se añade que, al detectar también células
muertas, puede dar falsos positivos (Wolffs, 2005; Lindström y Korkeala, 2006).
Además, en el caso de C. botulinum tipo III que puede perder el gen bot durante el
cultivo (Eklund et al., 1974), el número de falsos negativos aumenta. Otro problema es
que normalmente el número de células de C. botulinum presentes en las muestras es
muy bajo y aparecen en forma de esporas de resistencia, por lo que la detección directa
del microorganismo suele fallar. Además, muestras complejas como sedimentos y heces
suelen portar inhibidores de la PCR (Tebbe y Vahjen, 1993). Esta falta de sensibilidad
se puede solucionar mediante un paso previo de enriquecimiento de la muestra en caldo
de cultivo para germinar las esporas, aumentar el número de microorganismos y diluir
Intriducción general
11
los inhibidores (Franciosa et al., 1996; Lindström y Korkeala, 2006; Prèvot et al., 2007;
Vidal et al., 2011). La PCR no es adecuada por si sola para el diagnóstico de botulismo,
pero ayuda al aislamiento y caracterización de cepas de C. botulinum y permite estudios
ecológicos y epidemiológicos en los que se requiere analizar un gran número de
muestras en poco tiempo para detectar la presencia de la bacteria (Franciosa et al.,
1996).
2. El botulismo aviar
2.1 Historia
Los primeros brotes de botulismo aviar se identificaron alrededor de 1910 en el
oeste de América del Norte y en Canadá, donde regularmente se daban brotes de
mortalidad de millones de aves. A esta enfermedad se le llamaba “western duck
sickness” (fiebre occidental de los patos) o “limberneck” (cuello flexible, debido a la
característica caída del cuello que produce esta intoxicación en patos). Posteriormente,
en los años 30, estas mortalidades se asociaron con botulismo tipo C. Después se han
documentado brotes de botulismo aviar en Australia (1934), Rusia (1957), Suecia y
Dinamarca (1965), Inglaterra (1969), Holanda (1970), Sudáfrica (1965), Nueva Zelanda
(1971), Japón (1973), Argentina (1979) y Brasil (1981). El botulismo aviar ha sido
confirmado en al menos 28 países en todos los continentes menos en la Antártida
(Rocke, 2006).
Tesis doctoral – Ibone Anza Gómez
12
2.2 Tipos de C. botulinum causantes de botulismo aviar.
Anteriormente, los brotes de botulismo aviar se asociaban con C. botulinum tipo
C, pero en los últimos años se ha descubierto que, al menos en Europa y probablemente
en otras zonas del mundo, el mosaico tipo C/D es predominante y causa brotes tanto en
aves silvestres como domésticas (Skarin et al., 2010; Woudstra et al., 2012). El gen bot
del mosaico C/D comprende 2/3 de la parte amino terminal del gen bot tipo C y 1/3 de
la parte carboxil terminal del gen bot tipo D (Moriishi et al., 1996), por lo que la toxina
mosaico resultante se puede neutralizar tanto con antitoxina C como con la D. Además,
se ha demostrado que BoNT C/D es más letal para las aves que los tipo C o D (Takeda
et al., 2005). Por otra parte, en los Grandes Lagos de los Estado Unidos los brotes se
asocian con botulismo tipo E y afectan a aves piscívoras (Yule et al., 2006).
2.3 Importancia de la enfermedad
El botulismo aviar es una de las enfermedades de aves acuáticas más
importantes a nivel global porque anualmente mata a miles o incluso millones de
individuos de muchas especies diferentes (solo los buitres parecen ser resistentes),
incluyendo algunas en peligro y, además, parece que está extendiendo su rango
geográfico (Friend et al., 2001). En un solo brote pueden morir de cientos a millones de
aves, algunos ejemplos de mortalidades de aves acuáticas durante brotes de botulismo
en diferentes lugares del mundo se dan en la Tabla 2.
La propagación de esta intoxicación durante los brotes no depende de la
densidad ni de las especies de aves afectadas, por lo que las poblaciones de especies
más abundantes y distribuidas soportan bien las pérdidas por botulismo, mientras que,
un solo brote puede tener importantes consecuencias en la viabilidad de especies en
Intriducción general
13
peligro y/o con una distribución restringida (Rocke, 2006). Por ejemplo, en 1996
alrededor del 15-20% de la metapoblación occidental de pelícano blanco americano
(Pelecanus erythrorhynchos) murió durante un brote de botulismo (Rocke et al., 2005).
Más tarde, el botulismo mató a un número importante de ejemplares de dos especies en
peligro crítico: la espátula menor (Platalea minor) en Taiwan y el ánade de Laysán
(Anas laysanensis) en Hawaii (Chou et al., 2008; Work et al., 2010). El botulismo
también se ha asociado al declive del ánade rabudo (Anas acuta) en los Estados Unidos
(Friend et al., 2001).
Tabla 2. Ejemplos de mortalidades de aves acuáticas durante brotes botulismo (León-Vizcaíno et
al., 1979; Friend et al., 2001; Rocke, 2006; María Mójica et al., 2006; Defilippo et al., 2013)
Lugar Año Aves muertas
Utah, USA 1929 200.000
California, USA 1941 250.000
Doñana, España 1973 50.000
Doñana, España 1974 15.000
Firth of Forth, Gran Bretaña 1975 2.100
Doñana, España 1978 70.000
Doñana, España 1979 4.000
Mar Caspio, Rusia 1982 1.000.000
Victoria, Australia 1983 1800
La Pampa, Argentina 1996 1.300
Saskatchewan, Canadá 1996 134.000
Saskatchewan, Canadá 1997 1.000.000
Utah, USA 1997 500.000
Las Tablas de Daimiel, España 1999 10.000
El Hondo, España 2006 1400
Incheon, Corea del Sur 2008 2.000
Mar Báltico, Suecia 2000-2004 >10.000
Emilia-Romagna, Italia 2011 96
Tesis doctoral – Ibone Anza Gómez
14
2.4 Epidemiologia de los brotes en humedales de agua dulce
Los brotes de botulismo tipo C o C/D ocurren principalmente en humedales de
agua dulce. Estos humedales son ecosistemas muy complejos en los que múltiples
factores físico-químicos interactúan entre si, por lo que la epidemiología del botulismo
aviar también es compleja y los brotes son difíciles de predecir y prevenir. En un
humedal se pueden dar brotes recurrentes, mientras que en los de al lado no aparecen;
además, el índice de mortalidad también varía mucho entre años.
Las esporas de C. botulinum tipo C o C/D se encuentran ampliamente
distribuidas en los sedimentos de humedales y en el aparato gastrointestinal de sus
habitantes: invertebrados, peces y aves (Rocke, 2006; Espelund y Klaveness, 2014). La
prevalencia y densidad de esporas en sedimentos varía entre estudios [de un 4,5% en la
Camarga francesa (Smith y Moryson, 1977), a un 52% en California (Sandler et al.,
1993) o un 80% en Austria (Zechmeister et al., 2005)] y no parece ser un factor
determinante ni limitante para la aparición de los brotes, porque se han dado brotes en
zonas con bajas prevalencias (Sandler et al., 1993).
2.4.1 Factores predisponentes o iniciadores
Existen varios factores ambientales que predisponen a la aparición de los brotes.
El factor más importante parece ser la temperatura del agua, sobre todo por encima de
20 ºC, acompañada de pH entre 7,5 y 9 y potencial redox negativo (Rocke y Samuel,
1999; Rocke et al., 1999; Rocke, 2006). También aumenta el riesgo de brotes el
aumento de materia orgánica y de la biomasa en agua (Rocke et al, 1999). Así, la
temperatura parece ser la fuerza que mueve muchos procesos biológicos en el sedimento
y que junto con la descomposición de la materia orgánica influye en el pH y disminuye
Intriducción general
15
la cantidad de oxígeno disuelto y el potencial redox, permitiendo el desarrollo de C.
botulinum en el sedimento (Perez-Fuentetaja et al., 2011) (Fig. 2). Además, C.
botulinum necesita altas temperaturas para multiplicarse lo que explica que la gran
mayoría de los brotes se den en verano-otoño (Rocke y Friend, 1999).
Temperatura ambientalNivel del agua
Descomposición materia orgánica
Actividad en sedimento (bacteriana/química)
Temperatura
Oxígeno disuelto
Conductividad
Multiplicación C. botulinum
Riesgo de brote de
botulismopH=
Potencial redox Riesgo de que la
toxina pase a la cadena trófica
Fig. 2. Hipótesis sobre las condiciones ambientales que pueden producir brotes de botulismo en
los Grandes Lagos de Norte América (Pérez-Fuentetaja et al., 2011).
Una vez que C. botulinum empieza a multiplicarse en el ambiente, para que los
brotes se expandan la toxina tiene que llegar a las aves. Algunas aves como los azulones
(Anas platyrhynchos) filtran el sedimento para alimentarse y otras como los patos
cucharas (Anas clypeata) filtran la materia orgánica en descomposición del agua,
pudiendo en ambos casos ingerir la toxina durante este proceso (Rocke, 2006). También
se han descrito numerosos invertebrados (a los que las BoNTs no les afecta), plantas
acuáticas y algas como portadores de la toxina y del microorganismo (Espelund y
Klaveness, 2014). De todos estos vectores, las larvas de moscas necrófagas son las que
acumulan mayores concentraciones de toxina (Duncan y Jensen, 1976), por lo que son
las principales responsables de la propagación de los brotes a través del ciclo “larva de
mosca-cadáver” característico del botulismo aviar (ver apartado 2.4.2; Wobeser, 1997).
Tesis doctoral – Ibone Anza Gómez
16
Los brotes también pueden iniciarse sin necesidad de que se produzcan
condiciones de anaerobiosis en el sedimento de los humedales. En este caso, el
desencadenante sería una mortalidad (por cualquier causa) de aves u otros animales
cuyos cadáveres contengan C. botulinum. El ambiente anaerobio y las altas
temperaturas que se dan en dichos cadáveres permiten la multiplicación y toxinogénesis
de C. botulinum en ellos, expandiéndose el brote a continuación a través del ciclo “larva
de mosca-cadáver” (Reed y Rocke, 1992). Por ejemplo, Soos y Wobeser (2006)
identifican como factor iniciador de los brotes recurrentes de botulismo en un lago
canadiense los cadáveres de pollos de una colonia de gaviotas de Franklin (Leucophaeus
pipixcan).
2.4.2 Propagación de los brotes: ciclo “larva de mosca-cadáver”
Las mayores concentraciones de toxina durante los brotes se concentran en los
cadáveres, ya que en ellos se dan las condiciones necesarias de calor, anaerobiosis y
nutricionales para el crecimiento de C. botulinum (Smith y Turner 1987; Reed y Rocke,
1992). Los invertebrados necrófagos que se alimentan de ellos, principalmente larvas de
moscas, acumulan la toxina sin ser afectados y actúan como su vehículo hacía aves
sanas que se alimentan de dichas larvas. La toxicidad de las larvas de mosca puede
llegar a 400.000 DLR/g (DLR, dosis letal para ratón) (Duncan y Jensen, 1976) y siendo
la DL50 (dosis letal para el 50% de una población expuesta) para aves de 36.000-43.000
DLR/kg, una sola larva toxica es suficiente para matar un pato (Rocke, 2006). La
mayoría de las aves no se alimenta directamente de cadáveres, pero las larvas de moscas
tienden a dispersarse (Gomes et al., 2006), momento en el que pueden ser ingeridas por
aves sanas. Tras la ingestión, las aves enferman y mueren generando nuevo sustrato
Intriducción general
17
para el desarrollo de más C. botulinum y su toxina. Así, el ciclo se auto-perpetua (Fig.
3) hasta que las condiciones ambientales dejan de ser favorables para el crecimiento de
la bacteria o las larvas. Esto se produciría, por ejemplo cuando, se da una bajada de la
temperatura, cuando los cadáveres son eliminados por depredadores o recogidos por
hombres o cuando las aves se abandonan el humedal (Reed y Rocke, 1992; Rocke,
2006; Soos y Wobeser, 2006). Este ciclo es único entre las intoxicaciones porque la
toxina que se genera en los cadáveres produce el envenenamiento secundario de más
individuos, haciendo que la epidemiología se asemeje a la de una enfermedad infecciosa
(Wobeser, 1997). La eficacia para propagar la intoxicación por este mecanismo es muy
alta. Por ejemplo, Evelsizer et al. (2010) demostraron que los azulones (Anas
platyrhynchos) expuestos a 5-11 y >11 cadáveres/ha tenían 3,5 y 13 veces más riesgo de
morir por botulismo que los azulones que habitaban en lugares donde no había
cadáveres. Además, asociaron el riesgo de morir a la densidad de cadáveres infestados
con larvas tóxicas y no a la densidad de cadáveres sin larvas.
Fig. 3. Ciclo “larva de mosca-cadáver” por el cual los brotes de botulismo aviar se propagan
exponencialmente.
Tesis doctoral – Ibone Anza Gómez
18
2.5 Sintomatología y diagnóstico del botulismo aviar
Los brotes se caracterizan por la aparición de un gran número de aves de
diferentes especies (Fig. 4) muertas o enfermas en la orilla de los humedales (Rocke y
Friend, 1999). Normalmente, las mortalidades ocurren en épocas estivo-otoñales cuando
las temperaturas ambientales son altas. Las aves enfermas presentan síntomas de
parálisis flácida ascendente: se propulsan con las alas por el agua, sufren parálisis de la
membrana nictitante o tercer párpado, y en estadios más avanzados parálisis del cuello
(Fig. 4) y muerte, bien porque se ahogan o por parada cardio-respiratoria. La necropsia
de las aves muertas no muestra lesiones características, y estas suelen presentar un buen
estado nutricional y el estómago vacío (Rocke y Friend, 1999; Rocke, 2006).
Fig. 4. Varias especies de aves muertas recogidas durante un brote de botulismo en la Laguna de
Navaseca (Daimiel, Ciudad Real) en 2010 (Imagen de la izquierda, tomada por Rafael Mateo).
Parálisis flácida del cuello en un azulón afectado por botulismo (imagen de la derecha, tomada
por Elena Crespo).
El diagnóstico del botulismo en aves acuáticas se basa en los signos de campo y
la sintomatología clínica de las aves afectadas, anteriormente descrita. Además, se debe
Intriducción general
19
confirmar la presencia de la toxina botulínica en la sangre de varios ejemplares
afectados para descartar otras posibles causas de mortalidad de aves acuáticas silvestres
como: intoxicaciones por biotoxinas de algas u otros tóxicos (por ejemplo
organoclorados) y enfermedades infecciosas de tipo bacteriano o vírico (Rocke y
Friend, 1999; Sonne et al., 2012). La toxina en sangre se detecta mediante el bioensayo
en ratón y la identificación del tipo de BoNT causante del brote se realiza con las
antitoxinas C, D o E (normalmente implicadas en el botulismo aviar). Alternativamente,
para la detección de las toxinas tipo C y/o D en sangre, tejidos y heces de aves, se han
publicado varios ensayos de ELISA (Thomas, 1991; Rocke et al., 1998; Zechmeister et
al., 2005), pero ninguno ha remplazado al bioensayo. También se ha publicado un
protocolo de espectrofotometría de masas para la detección de toxinas C y D en suero e
hígado de aves con buenos resultados de sensibilidad (Hedeland et al., 2011).
Actualmente, la técnica más usada para el estudio del botulismo aviar es la PCR.
Como se ha comentado anteriormente esta técnica no está indicada para el diagnóstico
individual, pero lo apoya. Por otra parte es un método de elección para estudios
epidemiológicos y existen varios protocolos de PCR convencional (Franciosa et al.,
1996; Prévot et al., 2007), anidada (Williamson et al., 1999) y a tiempo real (Sánchez-
Hernández et al., 2008; Lindberg et al., 2010; Anniballi et al., 2011) para la detección
de los genes que codifican las neurotoxinas tipo C y D en muestras ambientales y de
tejidos de animales. También existen PCR específicas para detectar los genes de los
mosaicos C/D y D/C (Takeda et al., 2005; Woudstra et al., 2012).
Tesis doctoral – Ibone Anza Gómez
20
2.6 Medidas de control
Clostridium botulinum es una bacteria ubicua que se encuentra en el ambiente,
especialmente en sedimentos de los humedales y en el tracto gastrointestinal de sus
habitantes, por lo que eliminarla, en principio, es imposible. Además, la prevención de
los brotes es muy difícil dada la compleja epidemiología de esta enfermedad que los
hace impredecibles. Por eso, en líneas generales se han propuesto varias medidas para
reducir las pérdidas por botulismo, aunque no existen muchos estudios sobre su eficacia
(Rocke y Friend, 1999; Cromie et al., 2012). Algunas de estas medidas son las
siguientes:
Documentar las condiciones ambientales, localizar zonas donde se dan brotes
más frecuentemente y registrar en qué fechas para identificar zonas de riesgo
donde implantar sistema de vigilancia y retirada de cadáveres. La vigilancia de
estos puntos debe comenzar entre 10 y 15 días antes de las fechas de riesgo y
terminar entre 10 y 15 días después de la “época de botulismo” para evitar que
se desencadene el ciclo “larva de mosca-cadáver”.
Evitar cambios bruscos en el nivel del agua en los meses calurosos, ya que estos
pueden causar la muerte de invertebrados y peces que aportarán materia
orgánica para el desarrollo inicial de C. botulinum en sedimentos.
Construir humedales accesorios al lado de humedales de riesgo para evacuar a
las aves en caso de brote (desecando los humedales afectados).
Reducir la entrada de materia orgánica (como puede ser la procedente de aguas
residuales) en los humedales, particularmente en meses cálidos.
Oxigenar el agua, por ejemplo, mejorando el flujo de agua.
Intriducción general
21
Recoger todos los cadáveres de vertebrados, especialmente durante los brotes,
enterrarlos y quemarlos. También vigilar que no se acumulen cadáveres en zonas
de aguas someras importantes para limícolas.
Evitar causas de mortalidad externas como líneas de alta tensión cerca de
humedales con muchas aves, dado que pueden matar suficiente número de
animales para comenzar un brote por el ciclo “larva de mosca-cadáver”.
Otros autores han recomendado medidas como quitar la vegetación muerta para
evitar acumulación de materia orgánica, agitar el agua estancada o crear orillas con
bordes profundos (para evitar el calentamiento del agua). De todas estas
recomendaciones, solamente la retirada de cadáveres ha demostrado ser efectiva (Reed
y Rocke, 1992). Aún así, esta estrategia es costosa y no previene los brotes, además, la
eficacia de esta medida varía según las características del humedal. En humedales
grandes con mucha vegetación e islas es más difícil encontrar los cadáveres y un único
cadáver tóxico puede ser suficiente para matar un gran número de aves sanas. En un
estudio elaborado por Cliplef y Wobeser (1993) se estimó que sólo se llegaba a recoger
un 32% de los cadáveres.
Actualmente en Castilla-La Mancha se han establecido dos tipos de medidas de
prevención. Por un lado, en el caso de la Laguna de la Veguilla en Alcázar de San Juan,
donde los brotes de botulismo eran muy frecuentes, la laguna se deja desecar
naturalmente en verano vertiendo el agua de la depuradora (que la abastece la mayor
parte del año) a la junta de los ríos Záncara y Cigüela. Esta medida ha dado buenos
resultados porque no se registran brotes desde el año 2008. Por otro lado, en la zona del
Parque Natural de las Tablas de Daimiel y en concreto en la laguna de Navaseca, donde
los brotes son recurrentes, la guardería del Parque y la Junta de Comunidades de
Castilla la Mancha y personal contratado por el Ayuntamiento de Daimiel prospectan
Tesis doctoral – Ibone Anza Gómez
22
las orillas y retiran todos los animales muertos o enfermos que encuentran durante la
época de riesgo de botulismo.
2.7 El botulismo aviar en España
El botulismo aviar es una enfermedad endémica en España donde se registran
brotes prácticamente todos los veranos, tanto en el norte como en el sur. Los primeros
brotes de botulismo descritos datan de 1973 y 1974 en las Marismas del Guadalquivir
(Parque Nacional de Doñana) y alrededores. Durante el periodo estival de estos años se
retiraron 50.000 aves acuáticas muertas el primer año y 15.000 el segundo, de más de
una veintena de especies. A partir de entonces, a lo largo de los años 70 y 80, se
registraron brotes en esa zona casi anualmente. En los veranos de 1975 y 1977 estas
mortalidades se asocian por primera vez a C. botulinum tipo C mediante el bioensayo en
ratón (León-Vizcaíno et al., 1979). En 1978 se registró también en esta zona uno de los
brotes más graves ocurridos en España con alrededor de 70.000 aves afectadas. Este
brote fue relacionado con la desecación natural de las marismas (las aguas poco
profundas pueden ser un factor de riesgo) y la contaminación proveniente del río
Guadalquivir. Posteriormente, en 1983, ante la amenaza de que un brote acabase con las
últimas Malvasías cabeciblancas (Oxyura leucocephala) de la población española, que
estaba en proceso de recuperación (actualmente la población es más abundante y
distribuida, con alrededor de 2.000 ejemplares censados en 2013), se investigó la
presencia de C. botulinum en 3 lagunas cordobesas donde habitaban dichos ejemplares.
Ninguna de esas tres lagunas tenía historia de brotes ni se encontró el patógeno en el
sedimento (Contreras de Vera et al., 1987). Así, durante los años 80 se realizaron varios
estudios sobre botulismo aviar en lagunas andaluzas (donde los brotes eran frecuentes),
Intriducción general
23
principalmente sobre prevalencia del patógeno en sedimentos y para intentar localizar
zonas de riesgo. Las prevalencias encontradas variaron entre un 53% en sedimentos
positivos en una laguna de Sevilla y un 1,7% en las Marismas de Odiel (Contreras de
Vera et al., 1987; Contreras de la Vera et al., 1989; García et al., 1992). Otro humedal
español donde se registran brotes frecuentes de botulismo es el embalse de Hondo,
situado al sureste de la provincia de Alicante. Por ejemplo, durante el verano de 2006 un
brote afecto a 1.800 aves (1.200 muertas y 600 vivas) de 25 especies diferentes, de las
enfermas, se recuperó un 67% (María-Mojica et al., 2006). En los humedales castellano-
manchegos esta enfermedad también es endémica y el brote más grave ocurrió en Las
Tablas de Daimiel en 1999 donde se recogieron más de 10.000 aves muertas.
3. Pérdida de humedales: el caso de la reserva de la Biosfera de la
Mancha-Húmeda
Los humedales son áreas donde el agua es el principal factor que controla el
medio ambiente, sus plantas y animales asociados. Según el Convenio Ramsar (tratado
internacional que sirve de marco para la conservación de los humedales), los humedales
se definen como “áreas de marisma, pantano, turbera o con agua, ya sea natural o
artificial, permanente o temporal, con agua estática o en movimiento, fresca, salobre o
salada, incluyendo aguas marinas cuya profundidad no exceda los 6 metros”. Los
humedales se encuentran entre los ecosistemas más productivos del mundo dado que
aportan agua y productividad primaria de la que dependen miles de especies de plantas
y animales (Ramsar, 2009).
Globalmente, estos ecosistemas están desapareciendo y con ellos muchas
poblaciones de aves acuáticas están experimentando serios declives. En 2008, el 17% de
Tesis doctoral – Ibone Anza Gómez
24
las especies de aves acuáticas estaban consideradas globalmente amenazadas y en 2006,
un estudio indicó que el 40% de las 1.200 poblaciones de aves acuáticas de las que se
conocía su tendencia estaban en declive y sólo el 17% en aumento (Birdlife, 2008a). La
intensificación y expansión de la agricultura y crecimiento descontrolado están entre las
mayores amenazas (Birdlife, 2004a). Por ejemplo, en las llanuras de Sanjiang (China) se
ha perdido alrededor del 70% de las 3,5 millones de ha de zonas húmedas con la
consecuente pérdida de biodiversidad y degradación del medio (Song et al., 2014). Las
presas, embalses y puertos también afectan a una alta proporción de los sistemas
fluviales, con la consiguiente pérdida de humedales (Birdlife, 2008a) y la
contaminación generada por la agricultura y la industria está causando la degradación de
un alto número de ellos (Birdlife, 2008b). Por último, el cambio climático está alterando
los ciclos hidrológicos y la vegetación de algunos humedales (Werner et al., 2013).
En la zona de la Mancha Húmeda (25.000 ha), donde se desarrollan los estudios
de esta tesis, también se ha producido una importante pérdida de humedales en los
últimos 60 años. Esta región se localiza en la cuenca alta del río Guadiana (Castilla-La
Mancha) y fue denominada Reserva de la Biosfera en 1980 por la UNESCO. El
humedal más representativo son Las Tablas de Daimiel en Ciudad Real, que fue
declarado Parque Nacional en 1973, precisamente con la intención de proteger dicho
humedal con sus aves acuáticas de la desecación debida a la Ley del 17 de julio de 1956
sobre “Saneamiento y colonización de los terrenos pantanosos que se extienden
inmediatos a las márgenes de los ríos Guadiana, Cigüela y Záncara y afluentes”.
Posteriormente, en 1982 el parque fue incluido en la lista Ramsar de humedales de
importancia internacional y en 1988 fue declarado Zona de Especial Protección para las
Aves (ZEPA). Este humedal, representativo de los humedales de zonas semiáridas, es
una llanura de inundación formada en la confluencia del río Cigüela (agua salina) y el
Intriducción general
25
Guadiana (agua dulce) y también es zona de descarga del acuífero 23. Esta región, y en
concreto Las Tablas de Daimiel, era importante por el gran número de especies de aves
acuáticas y flora palustre que albergaba, de especial importancia el pato colorado (Netta
ruffina), símbolo del parque, y la masiega (Cladium mariscus) (Pérez et al., 2001;
Álvarez-Cobelas et al., 2001).
Del total de las 6.000 ha que cubrían Las Tablas hace 60 años, actualmente
quedan protegidas 1.928 ha. La degradación de las zonas húmedas en esta región
comenzó en los años 50 con la desecación de humedales para evitar malaria y conseguir
más tierras para la agricultura (Pérez et al., 2001), así en estos años se desecaron
alrededor del 70% de las zonas húmedas de La Mancha Húmeda (Fornés et al., 2000) y
la superficie del Las Tablas se redujo a 1/7 (Álvarez-Cobelas et al., 2001).
Posteriormente, el problema se agravó a partir de los 70 cuando las nuevas tecnologías
permitieron la extracción de agua subterránea por medio de bombas de extracción para
la irrigación, y se produjo un aumento incontrolado de pozos. Así, de las 30.000 ha que
estaban dedicadas a la irrigación en 1960 se pasó a 150.000 en el 2003. Entre 1970 y
1990 el nivel del acuífero bajó a razón de 1 m/año, llegando a perderse alrededor de 22
metros. Este proceso permitió el desarrollo económico de la zona pero también acabo
con gran parte de los humedales que quedaban y su biodiversidad. (Martínez-Santos et
al., 2008). Además, durante los años 90 se alternaron periodos de sequía extrema
(típicos de la zona) que empeoraron la situación. Esta sobreexplotación resultó en la
degradación de los humedales superficiales y arroyos que se alimentaban del acuífero,
se alteró el curso y cauce de los ríos, e incluso se produjo la combustión espontanea de
la turba (Martínez-Santos et al., 2008). A estos problemas de escasez hay que añadir
que, debido al desarrollo agrícola e industrial, la contaminación orgánica de aguas
superficiales y subterráneas aumentó considerablemente hasta que se instalaron
Tesis doctoral – Ibone Anza Gómez
26
depuradoras en los años 80 (Martínez-Santos et al., 2008). En 1980 se declaró el
acuífero sobreexplotado y se intentaron tomar medidas para la recuperación de las
Tablas de Daimiel. En principio estas medidas estaban dedicadas a mantener la lámina
de agua y las poblaciones de aves acuáticas: se transvasó agua de la cuenca del Tajo, se
construyeron presas para retener el agua de Las Tablas e incluso se bombeó agua
subterránea. Más tarde se intentó recuperar el acuífero, verdadero problema de la falta
de agua, prohibiendo crear nuevos pozos y controlando el número de los existentes
(legales e ilegales). La eficacia de estas medidas ha sido cuestionada (Martínez-Santos
et al., 2008), aunque parece que en los últimos años el Parque Nacional y el acuífero se
han regenerado en gran medida, en parte debido a un periodo de abundantes lluvias. En
la figura 5 se muestra la evolución temporal de la profundidad de la lámina de agua del
acuífero en relación a estos acontecimientos. Una de las últimas medidas estudiadas
para el mantenimiento del Las Tablas de Daimiel ha sido la de mantener el nivel hídrico
con aguas residuales urbanas tratadas (Navarro et al., 2011), aunque se debe estudiar las
consecuencias que podría tener esta acción en un ecosistema tan singular. Actualmente
la mayoría de los humedales restantes y cauces de río de la reserva están protegidos.
Intriducción general
27
Fig. 5. Evolución de la profundidad de lámina de agua (nivel del acuífero) hasta el 2005 en
relación a las políticas medioambientales y otros acontecimientos importantes del momento
(gráfica tomada de Martínez-Santos et al., 2008).
3.2 Las aves acuáticas y los humedales de aguas residuales
Debido a la pérdida global de humedales naturales, las aves acuáticas se están
volviendo cada vez más dependientes de hábitats artificiales como humedales
abastecidos con aguas residuales (Murray y Hamilton, 2010; Orlowski, 2013). Algunos
de estos humedales están reconocidos como zonas importantes para las aves (ZEPAs).
Por ejemplo, las lagunas de tratamiento de aguas residuales de Phakalane en Botswana
(Birdlife, 2014a), el Western Treatment Plant en Mebourne (Murray y Hamilton, 2010;
Birdlife 2014b) o las estaciones de aguas residuales de Wroclaw en Polonia (Orlowski,
2013). En determinados lugares, este tipo de humedales sostienen poblaciones de
especies de aves acuáticas amenazadas, como es el caso de las población reproductora
Tesis doctoral – Ibone Anza Gómez
28
de Malvasía cabeciblanca en la Mancha, que cría en varias lagunas asociadas a
depuradoras como la laguna de Navaseca, en Daimiel o la laguna del Pueblo, en Pedro
Muñoz, o la población invernante, también de Malvasía cabeciblanca, en Israel (Hadad
y Moyal, 2007). Además, la importancia de estos humedales podría aumentar dado que
en países en vías de desarrollo, donde actualmente se pierden más zonas húmedas, se
está promoviendo su uso para el saneamiento de las aguas residuales (Kiviasi, 2001). El
problema es que hay poca información sobre cómo construir y/o manejar este tipo de
humedales “artificiales” con el propósito de conservar las aves acuáticas, por lo que
podrían entrañar riesgos para ellas, sobretodo sanitarios, dado que las aguas residuales
pueden aportar contaminación química, como compuestos orgánicos bromados o
disruptores endocrinos, y/o biológica, como enterobacterias (Markman et al., 2008;
Okafor, 2011; Gilchrist et al., 2014).
Muchos de los humedales de La Mancha Húmeda reciben vertidos de origen
urbano de forma habitual, en su mayoría procedentes de depuradoras, con mayor o
menor nivel de eficacia (Sánchez, 2013). Por un lado, estos aportes mantienen los
niveles hídricos y aumentan la carga orgánica del agua (dado que aportan mucho
nitrógeno y fósforo que permite el crecimiento del fitoplancton), lo que inicialmente
favorece a las aves acuáticas, pero también aportan contaminación, química y biológica,
y producen la eutrofización de las aguas (Pérez et al., 2001; Okafor, 2011) que a largo
plazo les puede perjudicar. Por ejemplo, humedales protegidos como las lagunas del
Pueblo, Longar, Manjavacas, Larga, Pozo de la Puerta, Navaseca, Alcázar o la
Inesperada, reciben aguas residuales (Pérez et al., 2001). Como se ha comentado en el
apartado 2.4.1. “Factores predisponentes o iniciadores” las mortalidades de aves por
otras causas pueden desencadenar los brotes de botulismo (Murphy et al., 2000; Soos y
Wobeser, 2006), ya que los cadáveres son el sustrato ideal para la multiplicación de C.
Intriducción general
29
botulinum tipo C/D con la consecuente producción de toxina. En este sentido, bacterias
comunes en aguas residuales como C. perfringens tipo A, Escherichia coli patógena
para las aves (APEC) o Sallmonella spp. (Skanavis y Yanko, 2001; Sahlström et al.,
2004; Okafor, 2011) pueden causar la muerte de aves (Benskin et al., 2009), lo que
aumentaría el riesgo de brotes de botulismo en los humedales abastecidos con aguas
residuales o incluso en Las Tablas de Daimiel en el caso de que se inundasen
artificialmente con este tipo de aguas para paliar los efectos de sequías. También se ha
sugerido que las aguas residuales pueden ser un factor de riesgo de botulismo aviar
porque aumentan la biomasa de invertebrados acuáticos y pueden alterar otras
características físico-quimicas de las aguas que favorezcan el establecimiento y
proliferación de C. botulinum, aunque no existen evidencias (Murray y Hamilton,
2010). Dado el riesgo que conlleva el uso de aguas residuales tratadas para la
conservación de humedales, se evidencia que son necesarios más estudios sobre los
efectos adversos que el vertido de estas aguas pueda tener sobre ellos y sobre la sanidad
de las aves acuáticas que los habitan, incluyendo el riesgo de botulismo aviar que es una
de las enfermedades que afecta a más especies y causa más bajas. La presente tesis tiene
el objetivo de abordar precisamente algunos de estos aspectos de la ecología del
botulismo aviar en humedales abastecidos con aguas residuales tratadas.
Referencias
Anniballi, F., Auricchio, B., Delibato, E., Antonacci, M., De Medici, D., Fenicia, L.
2012. Multiplex real-time PCR SYBR Green for detection and typing of group
III Clostridium botulinum. Veterinary Microbiology 154, 332e8.
Tesis doctoral – Ibone Anza Gómez
30
Álvarez-Cobelas, M., Cirujano, S., Sánchez-Carrillo, S. 2001. Hydrological and
botanical man-made changes in the Spanish wetland of Las Tablas de Daimiel.
Biological Conservation 97, 89-98.
Arnon, S.A., Schecter, R., Inglesby, T.V., Henderson, D. A., Bartlett, J. G., Ascher, M.
S., Eitzen, E., Fine, A. D., Hauer, J., Layton, M., Lillibridge, S., Osterholm,
M.T., O’Toole, T., Parker, G., Perl, T. M., Russell, P.K., Swerdlow, D.L., Tonat,
K. 2001. Botulinum toxin as a biological weapon: medical and public health
management. JAMA 285, 1059–1070.
Benskin, C.M., Wilson, K., Jones, K., Hartley, I.R. 2009. Bacterial pathogens in wild
birds: a review of the frequency and effects of infection. Biological Reviews 84,
349-373.
Bernard, W., Divers, T.J., Whitlock, R.H., Messick, J., Tulleners, E. 1987. Botulism as
a sequel to open castration in a horse. Journal of the American Veterinary
Medical Association 191, 73-4.
BirdLife International. 2004a. Agricultural intensification threatens Important Bird
Areas in Europe. Presented as part of the BirdLife State of the world's birds
website. Disponible en: http://www.birdlife.org/datazone/sowb/casestudy/140.
Consultado: 19/08/2014
BirdLife International. 2004b. Large dams and barrages are an increasing threat to
wetland-dependent birds. Presented as part of the BirdLife State of the world's
birds website. Disponible en:
http://www.birdlife.org/datazone/sowb/casestudy/150. Consultado: 19/08/2014
BirdLife International. 2008a. Waterbirds are showing widespread declines, particularly
in Asia. Presented as part of the BirdLife State of the world's birds website.
Intriducción general
31
Disponible en: http://www.birdlife.org/datazone/sowb/casestudy/71. Consultado:
12/08/2014.
BirdLife International. 2008b. Pollution from agriculture, forestry and industry has
significant impacts on birds. Presented as part of the BirdLife State of the
world's birds website. Available from:
http://www.birdlife.org/datazone/sowb/casestudy/155. Checked: 21/08/2014
BirdLife International. 2014a. Important Bird Areas factsheet: Phakalane sewage
lagoons, near Gaborone. Disponible en: http://www.birdlife.org. Consultado:
13/08/2014
BirdLife International. 2014b. Important Bird Areas factsheet: Werribee and Avalon.
Disponible en: http://www.birdlife.org. Consultado: 13/08/2014
Breidenbach, M.A., Brunger, A.T. 2005. New insights into clostridial neurotoxin–
SNARE interactions. TRENDS in Molecular Medicine 11, 377-381.
Centers for Disease Control and Prevention (CDC): Botulism in the United States,
1899-1996. 1998. Handbook for Epidemiologists, Clinicians, and Laboratory
Workers, Atlanta, GA. Centers for Disease Control and Prevention. Descarga
PDF: http://www.cdc.gov/ncidod/dbmd/diseaseinfo/files/botulism.PDF
Chou, S.J., Shieh, Y.C., Yu, C.Y. 2008. Hematologic and biochemistry values for
black-faced spoonbills (Platalea minor) with and recovering from botulism.
Journal of Wildlife Diseases 3, 781-784.
Cliplef, D.J., Wobeser, G. 1993. Observations on waterfowl carcasses during a botulism
epizootic. Journal of Wildlife Diseases 29, 8-14.
Collins, M.D., East, A.K. 1998. Phylogeny and taxonomy of the food-borne pathogen
Clostridium botulinum and its neurotoxins. Journal of Applied Microbiology 84,
5-17.
Tesis doctoral – Ibone Anza Gómez
32
Contreras de Vera, A., León, L., Carranza, J., Hermoso de Medoza, M., Garrido, F.
1987. Botulismo aviar en zonas húmedas de la campiña de Sevilla y Córdoba.
Medicina Veterinaria 4, 173-180.
Contreras de Vera, A., León, L., Cubero, M.J. 1989. Distribución de esporos botulínicos
en lagunas andaluzas. Oxyura 5, 119-126.
Cromie, R.L., Lee, R., Delahay, R.J., Newth, J.L., O’Brien, M.F., Fairlamb, H.A.,
Reeves, J.P., Stroud, D.A. 2012. Ramsar Wetland Disease Manual: Guidelines
for Assessment, Monitoring and Management of Animal Disease in Wetlands.
Ramsar Technical Report No. 7. Ramsar Convention Secretariat, Gland,
Switzerland.
Defilippo, F., Luppi, A., Maioli, G., Marzi, D., Fontana, M.C., Paoli, F., Bonilauri, P.,
Dottori, M., Meriald, G. 2013. Outbreak of type C botulism in birds and
mammals in the Emilia Romagna region, Northern Italy. Journal of Wildlife
Diseases 49, 1042–1046.
Duncan, R.M., Jensen, W.L. 1976. A relationship between avian carcasses and living
invertebrates in the epizootiology of avian botulism. Journal of Wildlife
Diseases 12, 116–126.
Eklund, M.W., Poysky, F.T. 1974. Interconversion of type C and D strains of
Clostridium botulinum by specific bacteriophages. Applied Microbiology, 27,
251-258.
Eklund, M.W., Poysky, F.T., Meyers, J.A., Pelroy, G.A. 1974. Interspecies conversion
of Clostridium botulinum type C to Clostridium novyi type A by bacteriophage.
Science 186, 456-458.
Ekong, T. 2000. Immunological detection of botulinum neurotoxins. Anaerobe 6, 125–
127.
Intriducción general
33
Espelund, M., Klaveness, D. 2014. Botulism outbreaks in natural environments – an
update. Frontiers in Microbiology (ecollections) 5, 287, 1-7.
Evelsizer, D.D., Clark, R.G., Bollinger, T.K. 2010. Relationships between local carcass
density and risk of mortality in molting mallards during avian botulism
outbreaks. Journal of Wildlife Diseases 46, 507-13.
Fornés, J., Rodriguez, J.A., Hernández, N., Llamas, M.R. 2000. Possible solutions to
avoid conflicts between water resources development and wetland conservation
in the "La Mancha Húmeda" Biosphere Reserve (Spain) Physics and Chemistry
of the Earth, Part B: Hydrology, Oceans and Atmosphere 25, 623-627.
Franciosa, G., Fenicia, L., Caldiani, C., Aureli, P. 1996. PCR for detection of
Clostridium botulinum type C in avian and environmental samples. Journal of
Clinical Microbiology 34, 882–885.
Friend, M., McLean, R.G., Dein, F.J. 2001. Disease emergence in birds: challenges for
the twenty-first century. The Auk 118, 290-303.
García, A., León, L., Cubero, M.J., Contreras de Vera, A. 1992. Sobre la baja
prevalencia de Clostridium botulinum en humedales de las marismas de Odiel
(Huelva). Oxyura 6, 49-51.
Gilchrist, T.T., Letcher, R.J., Thomas, P., Fernie, K.J. 2014. Polybrominated diphenyl
ethers and multiple stressors influence the reproduction of free-ranging tree
swallows (Tachycineta bicolor) nesting at wastewater treatment plants. Science
of the Total Environment 472, 63–71.
Gomes, L., Conde, W.A., Von Zuben, C.J. 2006. A review of postfeeding larval
dispersal in blowflies: implications for forensic entomology.
Naturwissenschaften 93, 207-215.
Tesis doctoral – Ibone Anza Gómez
34
Hadad, E., Moyal, C. 2007. Preference of the White-headed duck Oxyura leucocephala
for wastewater reservoirs in the Judean Plain, Israel. Sandgrouse 29, 70-78.
Hedeland, M., Moura, H., Båverud, V, Woolfitt, A.R., Bondesson, U., Barr, J.R. 2011.
Confirmation of botulism in birds and cattle by the mouse bioassay and
Endopep-MS. Journal of Medical Microbiology 60, 1299–1305.
Hill, K.K., Smith, T.J., Helma, C.H., Ticknor, L.O., Foley, B.T., Svensson, R.T.,
Brown, J.L., Johnson, E.A., Smith, L.A., Okinaka, R.T., Jackson, P.J., Marks,
J.D. 2007. Genetic diversity among botulinum neurotoxin-producing clostridial
strains. Journal of Bacteriology 189, 818-832.
Kalb, S.R., Moura, H., Boyer, A.E., McWilliams, L.G., Pirkle, J.L., Barr, J.R. 2006.
The use of Endopep-MS for the detection of botulinum toxins A, B, E, and F in
serum and stool samples. Analytical Biochemistry 351, 84–92.
Kivaisi, A.K. 2001. The potential for constructed wetlands for wastewater treatment and
reuse in developing countries: a review. Ecological Engineering 16, 545–560.
León-Vizcaíno, L., Miranda, A., Carranza, J., Perea, A. 1979. Intoxicación botulínica en
aves acuáticas silvestres en la marisma del Guadalquivir (Coto Doñana). Acta
Vertebrata 6, 120-123.
Lindberg, A., Skarin, H., Knutsson, R., Blomqvist, G., Båverud, V. 2010. Real-time
PCR for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering
a chimeric C/D sequence-application on outbreaks of botulism in poultry.
Veterinary Microbiology 146, 118-123.
Liguori, V., De Iuliis, P., Fenicia, L., Anniballi, F., Aureli, P. 2008. A case of wound
botulism in a foal affected by gastric ulcers in Italy. Journal of Equine
Veterinary Science 28, 476–478.
Intriducción general
35
Lindström, M., Korkeala, H. 2006. Laboratory diagnostics of botulism. Clinical
Microbiology Reviews 19, 298–314.
Lindström, M., Nevas, M., Kurki, J., Sauna-aho, R., Latvala-Kiesilä, A., Pölönen, I.,
Korkeala, H. 2004. Type C botulism due to toxic feed affecting 52,000 farmed
foxes and minks in Finland. Journal of Clinical Microbiology 42, 4718-4725.
María-Mojica, P., Mateo, P., Izquierdo, A., Ferrández, M., Morán, S., Rubio, F.,
Gerique, C., Echevarrias, J.L., Sánchez, J.A., García-Fernández, A. J. 2006.
Control de un brote de botulismo en el Parque Natural “El Hondo” (Alicante).
Jornadas Ibéricas de Centros de Recuperación, GREFA, CosmoCaixa Madrid 2,
3 y 4 de Noviembre.
Markman, S., Leitner, S., Catchpole, C., Barnsley, S., Müller, C.T., Pascoe, D.,
Buchanan, K.L. 2008. Pollutants increase song complexity and the volume of the
brain area HVC in a songbird. PLoS ONE 3: e1674.
doi:10.1371/journal.pone.0001674.
Martínez-Santos, P., De Stefano, L., Llamas, M.R., Martínez-Alfaro, P.E. 2008.
Wetland restoration in the Mancha occidental aquifer, Spain: A critical
perspective on water, agricultural, and environmental policies. Restoration
Ecology 16, 511-521.
Midura, T.F. 1996. Update: infant botulism. Clinical Microbiology Reviews 9, 119-125.
Miyazaki, S., Sakaguchi, G. 1978. Experimental botulism in chickens: the cecum as the
site of production and absorption of botulinum toxin. Japanese Journal of
Medical Science and Biology 31, 1-15.
Moriishi, K., Koura, M., Abe, N., Fujii, N., Fujinaga, Y., Inoue, K., Oguma, K. 1996.
Mosaic structures of neurotoxins produced from Clostridium botulinum types C
and D organisms. Biochimica et Biophysica Acta 1307, 123–126.
Tesis doctoral – Ibone Anza Gómez
36
Murphy, T., Lawson, A., Nalewajko, C., Murkin, H., Ross, L., Oguma, K., McIntyre, T.
2000. Algal toxins—Initiators of avian botulism? Environmental Toxicology 15,
558-67.
Murray, C.G., Hamilton, A.J. 2010. Perspectives on wastewater treatment wetlands and
waterbird conservation. Journal of Applied Ecology 47, 976–985.
Navarro, V., García, B., Sánchez, D., Asensio, L. 2011. An evaluation of the application
of treated sewage effluents in Las Tablas de Daimiel National Park, Central
Spain. Journal of Hydrology 401, 53-64.
Okafor, N. 2011. Pollution of aquatic systems: Pollution through eutrophication, fecal
materials, and oil spills. In Environmental Microbiology of Aquatic and Waste
Systems, Springer, Netherlands. p 151-183.
Orłowski, G. 2013. Factors affecting the use of waste stabilization ponds by birds: A
case study of conservation implications of a sewage farm in Europe. Ecological
Engineering 61, 436–445.
Peck, M.W., Stringer, S.C., Carter, A.T. 2011. Clostridium botulinum in the post
genomic era. Food Microbiology 28, 183-91.
Pérez, M., Aramburu, M.J., González, J.L. (Eds). 2001. Reserva de la Biosfera de La
Mancha-Húmeda: retos y oportunidades de futuro. Ministerio de Medio
Ambiente y Medio Rural y Medio Marino y la Comunidad Autónoma de
Castilla-La Mancha Descargable en:
http://pagina.jccm.es/medioambiente/planes_programas/reservabiosfera_mancha
_humeda.pdf
Pérez-Fuentetaja, A., Clapsadl, M.D., Getchell, R.G., Bowser, P.R., Lee, W.T. 2011.
Clostridium botulinum type E in Lake Erie: inter-annual differences and role of
benthic invertebrates. Journal of the Great Lakes Research 37, 238–244.
Intriducción general
37
Popoff, M.R. 1995. Ecology of neurotoxigenic strains of clostridia. In: Montecucco, C.
(Ed). Clostridial neurotoxins. Springer Verlag Berlin and Heidelberg pp 161-
195.
Prévot, V., Tweepenninckx, F., Van Nerom, E., Linden, A., Content, J., Kimpe, A.
2007. Optimization of polymerase chain reaction for detection of Clostridium
botulinum type C and D in bovine samples. Zoonoses and Public Health. 54,
320–327.
Ramsar, 2009. What are wetlands? Consultado el 19 de Agosto del 2014:
http://www.ramsar.org/cda/es/ramsar-about-faqs-
whatarewetlands/main/ramsar/1-36-37%5E7713_4000_2__
Reed, T.M., Rocke, T.E. 1992. The role of avian carcasses in botulism epizootics.
Wildlife Society Bulletin 20, 175-182.
Rocke, T.E. 2006. The global importance of avian botulism. In Boere, G.C., Galbraith,
C.A., Stroud, D.A. (eds) Waterbirds around the world. The Estationery Office:
Edinburg, UK. pp. 422-426.
Rocke, T.E., Converse, K., Meteyer, C.U., McLean, B. 2005. The impact of disease in
the American White Pelican in North America. Waterbirds 28, 87-94.
Rocke, T.E., Euliss, N.H. Jr., Samuel, M.D. 1999. Environmental characteristics
associated with the occurrence of avian botulism in wetlands of a Northern
California refuge. Journal of Wildlife Management 63, 358-368.
Rocke, T.E., Friend, M. 1999. Avian botulism. In Friend, M., Franson, J.C (eds). Field
manual of wildlife diseases: general field procedures and diseases of birds.
Washington, D.C.: U.S. Dept. of the Interior, U.S. Geological Survey. pp. 271-
282.
Tesis doctoral – Ibone Anza Gómez
38
Rocke, T.E., Samuel, M.D. 1999. Water and sediment characteristics associated with
avian botulism outbreaks in wetlands. Journal of Wildlife Management 63,
1249-1260.
Rocke, T.E., Smith, S.R., Nashold, S.W. 1998. Preliminary evaluation of a simple in
vitro test for the diagnosis of type C botulism in wild birds. Journal of Wildlife
Diseases 34, 744-751.
Rossetto, O., Pirazzini, M., Montecucco, C. 2014. Botulinum neurotoxins: genetic,
structural and mechanistic insights. Nature Reviews Microbiology 12, 535-49.
Sakaguchi, Y., Hayashi, T., Kurokawa, K., Nakayama, K., Oshima, K., Fujinaga, Y.,
Ohnishi, M., Ohtsubo, E., Hattori, M., Oguma, K. 2005. The genome sequence
of Clostridium botulinum type C neurotoxin-converting phage and the molecular
mechanisms of unstable lysogeny. Proceedings of the National Academy of
Sciences of the USA 102, 17472-17477.
Sánchez, D. 2013. Diseño y modelización de humedales para el tratamiento de efluentes
de depuradora. Aplicación en el entorno del Parque Nacional de la Tablas de
Daimiel. Tesis doctoral. Universidad de Castilla la Mancha, Ciudad Real,
España.
Sánchez-Hernández, L., Cifuentes, A., Jiménez, B., Mateo, R., González, R. 2008.
Detection of Clostridium botulinum neurotoxin coding genes: analysis of PCR
products by real time versus capillary gel electrophoresis methods. European
Food Research and Technology 227, 495–502.
Sandler, R.J., Rocke, T.E., Samuel, M.D., Yuill, T.M. 1993. Seasonal prevalence of
Clostridium botulinum type C in sediments of a northern California wetland.
Journal of Wildlife Diseases 29, 533-539.
Intriducción general
39
Sahlström, L., Aspan, A., Bagge, E., Danielsson-Tham, M.L., Albihn, A. 2004.
Bacterial pathogen incidences in sludge from Swedish sewage treatment plants.
Water Research 38, 1989-1994.
Skanavis, C., Yanko, W.A. 2001. Clostridium perfringens as a potential indicator for
the presence of sewage solids in marine sediments. Marine Pollution Bulletin 42,
31-35.
Skarin, H., Lindberg, A., Blomqvist, G., Aspán, A., Båverud, V. 2010. Molecular
characterization and comparison of Clostridium botulinum type C avian strains.
Avian Pathology 39, 511-518.
Smith, G.R., Moryson, C.J. 1977. The low prevalence of Clostridium botulinum in the
lakes, marshes and waterways of the Camargue. The Journal of Hygiene 78, 33-
37.
Smith, G.R., Turner, A. 1987. Factors affecting the toxicity of rotting carcasses
containing Clostridium botulinum type C. Epidemiology and Infection 98, 345–
351.
Song, K., Wang, Z., Du, J., Liu, L., Zeng, L., Ren, C. 2014. Wetland degradation: its
driving forces and environmental impacts in the Sanjiang Plain, China.
Environmental Management 54, 255-271.
Sonne, C., Olsen Alstrup, A.K., Therkildsen, O.R. 2012. A review of the factors causing
paralysis in wild birds: Implications for the paralytic syndrome observed in the
Baltic Sea. Science of the Total Environment 416, 32–39.
Soos, C., Wobeser, G. 2006. Identification of primary substrate in the initiation of avian
botulism outbreaks. Journal of Wildlife Management 70, 43-53.
Swerczek, T.W. 1980. Experimentally induced toxicoinfectious botulism in horses and
foals. American Journal of Veterinary Research 41, 348-350.
Tesis doctoral – Ibone Anza Gómez
40
Takeda, M., Tsukamoto, K., Kohda, T., Matsui, M., Mukamoto, M., Kozaki, S. 2005.
Characterization of the neurotoxin produced by isolates associated with avian
botulism. Avian Diseases 49, 376-381.
Tebbe, C.C., Vahjen, W. 1993. Interference of humic acids and DNA extracted directly
from soil in detection and transformation of recombinant DNA from bacteria and
a yeast. Applied and Environmental Microbiology 59, 2657–2665.
Thomas, R.J. 1991. Detection of Clostridium botulinum types C and D toxin by ELISA.
Australian Veterinary Journal 68, 111-113.
Trampel, D.W., Smith, S.R., Rocke, T.E. 2005. Toxicoinfectious botulism in
commercial caponized chickens. Avian Diseases 49, 301-303.
Vidal, D., Taggart, M.A., Badiola, I., Mateo, R. 2011. Real-time polymerase chain
reaction for the detection of toxigenic Clostridium botulinum type C1 in
waterbird and sediment samples: comparison with other PCR techniques.
Journal of Veterinary Diagnostic Investigation 23, 942–946.
Werner, B.A., Johnson, W.C., Guntenspergen, G.R. 2013. Evidence for 20th century
climate warming and wetland drying in the North American Prairie Pothole
Region. Ecology and Evolution 3, 3471–3482.
Williamson, J.L., Rocke, T.E., Aiken, J.M. 1999. In situ detection of the Clostridium
botulinum Type C1 toxin gene in wetland sediments with a nested PCR assay.
Applied and Environmental Microbiology 65, 3240–3243.
Wobeser, G. 1997. Avian botulism – another perspective. Journal of Wildlife Diseases
33, 181–186.
Wolffs, P., Norling, B., Rådström, P. 2005. Risk assessment of false positive in
quantitative real-time PCR results in food, due to detection of DNA originating
from dead cells. Journal of Microbiological Methods 60, 315–323.
Intriducción general
41
Work, T.M., Klavitter, J.L., Reynolds, M.H., Blehert, D. 2010. Avian botulism: a case
study in translocated endangered Laysan ducks (Anas laysanensis) on Midway
Atoll. Journal of Wildlife Diseases 46, 499–506.
Woudstra, C., Skarin, H., Anniballi, F., Fenicia, L., Bano, L., Drigo, I., Koene, M.,
Bäyon-Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012.
Neurotoxin gene profiling of Clostridium botulinum types C and D native to
different countries within Europe. Applied and Environmental Microbiology 78,
3120-3127.
Woudstra, C., Aberg, A.T., Skarin, H., Anniballi, F., De Medici, D., Bano, L., Koene,
M., Löfström, C., Hansen, T., Hedeland, M., Fach, P. 2013. Animal botulism
outcome in the AniBioThreat project. Biosecurity and Bioterrorism: Biodefense
Strategy, Practice, and Science 11, 177-182.
Yule, A.M., Barker, I.K., Austin, J.W., Moccia, R.D. 2006. Toxicity of Clostridium
botulinum Type E neurotoxin to Great Lakes fish: implications for avian
botulism. Journal of Wildlife Diseases 42, 479–493.
Zechmeister, T.C., Kirschner, A.K., Fuchsberger, M., Gruber, S.G., Suess, B.,
Rosengarten, R., Pittner, F., Mach, R.L., Herzig, A., Farnleitner, A.H. 2005.
Prevalence of botulinum neurotoxin C1 and its corresponding gene in
environmental samples from low and high-risk avian botulism areas. ALTEX
22, 185–195.
Tesis doctoral – Ibone Anza Gómez
42
ORGANIZACIÓN DE LA TESIS Y OBJETIVOS
Esta tesis se ha realizado en el marco de dos proyectos otorgados por el Organismo
Autónomo de Parques Nacionales del Ministerio de Agricultura, Alimentación y Medio
Ambiente, a través del programa de ayudas a la investigación en materias relacionadas con
la Red de Parques Nacionales en 2003 y 2009.
El primer proyecto se tituló “Análisis del riesgo de intoxicación por botulismo en
Malvasía cabeciblanca y otras especies de aves acuáticas en las Tablas de Daimiel y
humedales cercanos” (referencia OAPN 99/2003) y el segundo proyecto, continuación y
complemento del primero, se tituló “Estudio de los riesgos sanitarios para las aves acuáticas
asociados con el abastecimiento de las Tablas de Daimiel y otros humedales manchegos
con agua residuales urbanas tratadas” (referencia OAPN 35/2009).
Durante el primer proyecto se desarrolló una PCR a tiempo real para detectar C.
botulinum tipo C que permitiera analizar un gran número de muestras para estudios
epidemiológicos y se validó un método para usar esta PCR con muestras ambientales.
Posteriormente, el Capítulo 1 está orientado a aislar y caracterizar cepas de C. botulinum
productoras de brotes de botulismo aviar en humedales manchegos para determinar qué tipo
los causa. En el Capítulo 2 comienza el estudio de la ecología de C. botulinum tipo C/D y
se busca obtener una visión global sobre la frecuencia y causas del botulismo aviar en Las
Tablas de Daimiel y humedades colindantes. Los principales resultados de este estudio dan
pie al segundo proyecto y siguientes capítulos. En primer lugar, los brotes parecían ser más
frecuentes en humedales abastecidos con aguas residuales por lo que en el Capítulo 3 los
objetivos fueron identificar asociaciones entre los cambios que producen los vertidos de
Organización de la tesis y objetivos
43
aguas residuales en humedales y la aparición de brotes de botulismo, y estimar el grado de
exposición de las aves acuáticas a patógenos bacterianos procedentes de aguas residuales,
sobre todo con vistas a abastecer Las Tablas de Daimiel en caso de sequía. En segundo
lugar, tanto en el Capítulo 2 como en el 3 se detectan moscas calíforas (de hábitos
necrófagos) capturadas durante brotes de botulismo positivas a C. botulinum, lo que indica
que pueden tener un papel en la epidemiología de los brotes, por lo que en el Capítulo 4 se
estudia el posible papel de las moscas adultas en la propagación de los brotes. Por último,
dado el gran número de especies que se ven afectadas en la región por botulismo (datos
recogidos en el Capítulo 2), en el Capitulo 5 el objetivo es estimar la susceptibilidad al
botulismo de las principales especies de aves acuáticas que habitan en humedales
manchegos, con especial atención al efecto de la enfermedad sobre la malvasía
cabeciblanca y también valorar el papel de las aves como portadoras y dispersoras de C.
botulinum tipo C/D.
Así con esta serie de estudios pretendemos aportar nueva información sobre las
causas y consecuencias de esta enfermedad tan frecuente en la región e intentar aportar
soluciones, o al menos medidas preventivas, para que no se produzcan de nuevo episodios
como la gran mortalidad ocurrida en Las Tablas de Daimiel en 1999.
44
CAPÍTULO 1
Cepas de Clostridium botulinum de la misma rama causan el
botulismo aviar en el sur y en el norte de Europa
Cultivo puro de C. botulinum tipo C/D. Fotografía de Hanna Skarin.
Anza, I., Skarin, H., Vidal, D., Lindberg, A., Båverud, V., Mateo, R. 2014. The same clade
of Clostridium botulinum strains is causing avian botulism in southern and northern
Europe. Anaerobe 26, 20-23.
Capítulo 1
45
Cepas de Clostridium botulinum de la misma rama causan el botulismo aviar en el sur
y en el norte de Europa
RESUMEN
El botulismo aviar es una enfermedad paralizante causada por las neurotoxinas (BoNTs)
producidas por Clostridium botulinum, normalmente por el tipo C/D. Es una enfermedad
seria tanto para aves acuáticas como para pollos de granja en Europa. El objetivo de este
estudio fue comparar la genética de cepas aviares de C. botulinum aisladas en España con
cepas aisladas en Suecia usando la técnica de electroforesis en gel de campo pulsado
(EGCP). Se aislaron quince cepas de muestras aviares procedentes de España usando una
técnica de separación inmunomagnética. Las cepas aisladas fueron caracterizadas por PCR ,
y todas fueron identificadas como la genoespecie Clostridium novyi sensu lato y ocho
albergaban el gen que codifica la neurotoxina tipo C/D. El análisis con EGPC reveló cuatro
pulsotipos muy similares, de los cuales dos contenían cepas de ambos países. También
demostró que los brotes en aves salvajes y domésticas pueden ser causados por las mismas
cepas. Estos resultados apoyan la hipótesis de una expansión clonal del mosaico C/D por
Europa y da información importante para futuros estudios epidemiológicos basado en esta
técnica.
Tesis doctoral – Ibone Anza Gómez
46
The same clade of Clostridium botulinum strains is causing avian botulism in southern
and northern Europe
ABSTRACT
Avian botulism is a paralytic disease caused by Clostridium botulinum-produced botulinum
neurotoxins (BoNTs), most commonly of type C/D. It is a serious disease of waterbirds and
poultry flocks in many countries in Europe. The objective of this study was to compare the
genetic relatedness of avian C. botulinum strains isolated in Spain with strains isolated in
Sweden using pulsed-field gel electrophoresis (PFGE). Fifteen strains were isolated from
Spanish waterbirds using an immunomagnetic separation technique. Isolates were
characterized by PCR, and all were identified as the genospecies Clostridium novyi sensu
lato and eight harbored the gene coding for the BoNT type C/D. PFGE analysis of the
strains revealed four highly similar pulsotypes, out of which two contained strains from
both countries. It also showed that outbreaks in wild and domestic birds can be caused by
the same strains. These results support a clonal spreading of the mosaic C. botulinum type
C/D through Europe and give relevant information for future epidemiological studies.
Capítulo 1
47
1. Introduction
Clostridium botulinum is an anaerobic spore-forming bacterium capable of
producing botulinum neurotoxins (BoNTs), responsible for botulism. The species can be
divided into four physiological and phylogenetical groups (I to IV), with seven different
serotypes of BoNTs, type A to G. The four groups correspond to different species at a
genetic level, but are considered the same species because of their capability for producing
BoNTs. Strains belonging to C. botulinum group III produce BoNTs of types C and D,
which are associated with botulism in animals (Collins and East, 1998; Hill et al., 2007).
Genetic recombination events between these two serotypes have resulted in mosaic forms
that comprise parts from both BoNT/C and BoNT/D genes; these are referred to as type
C/D or D/C. It has been shown that chimeric type C/D is more lethal to avian species than
either type C or D (Moriishi et al., 1996; Takeda et al., 2005). In Europe, Woudstra et al.
(2012) detected the mosaic forms in samples collected from cases of animal botulism from
France, Italy and the Netherlands but did not find types C or D. They proposed a clonal
spreading of the chimeric types in Europe, although subtyping data has so far not been
available to confirm this.
In central Spain, avian botulism outbreaks in wetlands occur almost every year and
kill thousands of waterbirds, including endangered species as the white-headed duck
(Oxyura leucocephala). Vidal et al. (2013) reported 13 outbreaks in wetlands between 1978
and 2008 where the mosaic type C/D form was confirmed with a conventional PCR method
in samples from waterbirds found dead during the outbreaks. On the southeast coast of
Sweden there were high levels of mortalities of seabirds, mainly herring gull (Larus
Tesis doctoral – Ibone Anza Gómez
48
argentatus), between 2000 and 2004. All birds examined were confirmed to have died from
botulism (Neimanis et al., 2007). Large outbreaks of botulism in poultry flocks in Sweden
have also been described (Lindberg et al., 2010; Skarin et al., 2010). In a study by Skarin et
al. (2010), strains of C. botulinum isolated from herring gulls and broilers collected during
botulism outbreaks in Sweden and Norway were subtyped by pulsed-field gel
electrophoresis (PFGE). All the isolates contained the mosaic type C/D BoNT gene and
composed few pulsotypes. They proposed a common source of contamination could have
existed between the Scandinavian outbreaks, but as the genetic diversity of C. botulinum
group III is poorly known, it could not be confirmed. Our objective was to study the genetic
diversity of C. botulinum avian strains by investigating the genetic relatedness between
strains from Spain and Scandinavia.
2. Material and methods
2.1 Production of polyclonal antibodies towards spores of C. botulinum type C and C/D
strains
Antibodies were produced in order to facilitate isolation of strains from naturally
contaminated samples. Spores from six type C and C/D strains were produced as previously
described by Lindberg et al. (2010), with the addition of four intervals of five minutes
sonication and one hour incubation at 37 °C. The spores were washed in PBS supplemented
with 0.1% Tween 20 (PBST), centrifuged at 6000 x g for 5 min, and resuspended in 1 ml
1% formaldehyde solution with 0.1% Tween 20 and incubated for three days at 37 °C.
Spore concentration was determined by counting in a Bürker chamber. A concentration of
Capítulo 1
49
106 spores/ml was used for injection into rabbits using the standard protocol as described
by the producer (Innovagen). Antibodies from the second serum sample (taken day 63)
were IgG purified by the manufacturer (Innovagen). Antibodies (5 mg/ml) were
biotinylated using a EZ-Link NHS-PEG4-Biotin biotinylation kit (Thermo Fisher
Scientific).
2.2 Isolation of strains by immunomagnetic separation
Samples from 41 waterbirds collected from four different botulism outbreaks
occurring between 2010 and 2011 in three wetlands in south-central Spain were used for
isolation (Fig. 1).
Fig.1. Map of Spain showing the locations of the three wetlands (star) where the strains were
isolated from.
The samples included 38 livers, 6 caeca and 2 maggot pools. Pre-enrichment of the samples
was performed as previously described by Skarin et al. (2010). Briefly, 1 g of each sample
Tesis doctoral – Ibone Anza Gómez
50
was inoculated into 9 ml pre-reduced tryptose-peptone-glucose-yeast extract (TPGY) broth
supplemented with 0.1% l-cysteine-HCl and 0.14% NaHCO3, heated for 15 min at 70 ºC
and incubated anaerobically at 37 ºC for two days. A volume of 10 µl of the overnight
cultures was washed in PBST (centrifugation at 6000 x g for 5 min) and resuspended in
PBST with 1% bovine serum albumin (PBSTB) and 50 µg biotinylated polyclonal
antibodies developed towards spores of type C and C/D strain, see above. The samples
were incubated at 25°C for 30 min and then centrifuged 10 min 10 000 x g to remove
unspecific antibodies. The pellets were resuspended in phosphate-citrate buffer (pH 4) with
0.1% Tween-20, mixed with 10 µl streptavidin-coated Dynabeads T1 (Invitrogen Life
technologies) and incubated at 25 °C for 30 min. A magnetic rack was used to wash the
magnetic beads, which were washed 1 time with phosphate-citrate buffer pH 4 with 0.1%
Tween-20, twice with PBSTB and finally dissolved in 100 µl PBST. The bead suspensions
were heated to 70 °C for 10 minutes (to kill vegetative cells) and streaked on McClung
Toabe agar (supplemented with 0.1% l-cysteine-HCl and 0.14% NaHCO3). Agar plates
were incubated anaerobically at 37 ºC for 2 days. Colonies positive for lipase and
lecithinase were cultured overnight at 37 ºC in 9 ml TPGY broth. Cells were harvested by
centrifugation at 3000 x g for 15 min prior to DNA extraction (as described below).
2.3 DNA extraction and identification of strains by PCR
DNA was automatically extracted in the BioRobot® EZ1 workstation (Qiagen) with
an elution volume of 50 μl. The identity of the isolates was confirmed using a real-time
PCR, which amplifies a sequence of a chromosomal gene (coding for 50S ribosomal
protein L10) using primers F_50SRP (GGAACCAACCTACCGAGGAT) and R_50SRP
Capítulo 1
51
(CCGTAGCCACCTCCTTAACA). The software Gegenees (Agren et al., 2012) was used
to define the chromosomal target, which was conserved among strains belonging to C.
novyi sensu lato (C. botulinum group III, C. novyi and C. haemolyticum) (Skarin et al.,
2010). Primers were designed using the Primer3 software (Rozen and Skaletsky, 2000).
The real-time PCR mixture (25 l) consisted of 12.5 l PerfeCTa SYBR® Green SuperMix
Low ROX (Quanta BioSciences), 10 M of each primer and approximately 10 ng of
template. The real-time PCR conditions consisted of initial denaturation and Taq
polymerase activation at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and
60 °C for 60 s, followed by a melting curve analysis. The same master mix and PCR
program were applied in the BoNT characterization PCR assays described next. The
presence of the gene coding for the BoNT type C light chain was investigated using the
primers described by Lindberg et al. (2010). Positive samples were further analysed by
primers (D-III_F and D-III_R) targeting the C-terminal part of the heavy chain of type D,
thus confirming the mosaic type C/D (Woudstra et al., 2012). All PCR reactions were
performed in a 7500 real-time PCR system (Applied Biosystems).
2.4 Subtyping of the strains by PFGE analysis
The PFGE analysis was performed following the protocol optimized by Skarin et al.
(2010) using restriction enzyme SmaI (New England BioLabs). Two Swedish avian type
C/D strains (V891 and BKT015925), isolated from herring gull and slaughter chicken in
2007 and 2008, respectively, along with a type C strain (C-Stockholm) isolated from mink
were included in the PFGE comparison. From previous analysis by Skarin et al. (2010), the
two Swedish avian strains represented two different pulsotypes of high similarity, where
Tesis doctoral – Ibone Anza Gómez
52
one included only strains from wild birds from Sweden and the other included strains from
chicken from Sweden and Norway. Comparisons of PFGE patterns and cluster analysis
were performed with the BioNumeric 6.5 software (Applied Maths). The level of similarity
between the DNA patterns was estimated using the Dice coefficient correlations and the
clusters were done with the unweighed pair group method using arithmetic averages. The
position tolerance was set at 2% and the optimization value at 1%.
3. Results
In total, 15 strains were isolated by immunomagnetic separation from 14 waterbirds
of different species from three wetlands in Spain (Fig. 2). All the isolates were positive for
the C. novyi sensu lato chromosomal gene and eight carried the type C/D BoNT gene. All
strains were analyzed by PFGE and 11 of them generated bands with a sufficient quality for
computer analysis. The comparison of the SmaI restriction profiles of the Spanish strains
with the Swedish avian strains revealed a very high level of similarity. All avian strains
could be grouped into four different pulsotypes, which shared more than 93% similarity
(Fig. 2). The first pulsotype consisted of two strains originating from two different wetlands
in Spain. The second pulsotype consisted of five Spanish strains from two different
wetlands, and the Swedish strain from chicken (BKT015925). The third pulsotype
consisted of three Spanish strains from two different wetlands, and the Swedish strain
isolated from a gull (V891). The fourth pulsotype consisted of only one Spanish strain. The
type C strain (C-Stockholm) formed a more distant branch (58.8% similarity) to the avian
Capítulo 1
53
strains. The four isolated strains that generated banding patterns of lower quality did not
correspond to additional pulsotypes.
Fig.2. Dendrogram of C. botulinum type C/D isolates from wild birds from Spain, one Swedish C.
botulinum type C/D isolate from chicken (BKT015925) and one from herring gull (V891), and the
C. botulinum type C strain C-Stockholm (C-St) isolated from mink.
4. Discussion
The immunomagnetic separation technique was found to be valuable for isolation of
C. botulinum group III strains, something which have previously been described to be
challenging (Skarin et al., 2010; Woudstra et al., 2012). C. botulinum isolates from birds in
Europe and Japan seem to be predominantly of type C/D (Takeda et al., 2005; Skarin et al.,
2010; Vidal et al., 2013). In fact, in some European countries, the mosaic forms (C/D and
D/C) are the most common types overall in samples from animal botulism outbreaks
(Woudstra et al., 2012). This is supported in this study, with strains isolated from Spanish
avian samples characterized by real-time PCR into type C/D. The Spanish strains isolated
Tesis doctoral – Ibone Anza Gómez
54
in this study were found to be genetically very similar to strains isolated from both wild
birds and chicken in Scandinavia and it was not possible to discriminate between strains
based on origin of isolation. This also shows that outbreaks in wild and domestic birds can
be caused by the same strains. Woudstra et al. (2012) suggested a clonal spread of the
mosaic types through Europe. Our results support this hypothesis as we found the same
strains in two distant parts of Europe with different climate and aquatic ecosystems. It was
shown by Skarin et al. (2010) that the two Swedish strains used in this study, which
generated two pulsotypes of >93% similarity, were genomically highly similar. The major
difference between the strains was the content of plasmids. However, neither of the two
unique plasmids (one in each strain) contains a SmaI site, so the explanation for the
difference in PFGE patterns is more likely attributed to the difference in locations of mobile
elements, which are scattered in both genomes (Skarin et al., 2011). It is unlikely that the
restricted diversity in strains is limited to the most southern and northern parts of Europe. It
is more likely that there is one clade, representing closely related strains, responsible for the
majority of avian botulism outbreaks across Europe and to be blamed for the death of
thousands of wild and domesticated birds. It is possible that C. botulinum is exposed to
strong selection that favors the survival of a particular genotype in a specific niche. Genetic
analysis of more C. botulinum group III strains is needed to clarify if the diversity can be
correlated to niche, such as the animal species. Migratory waterbirds (Anatidae and
shorebirds) are considered vehicles for spread throughout Europe acting as passive vectors
for aquatic organisms (Green et al., 2002). The waterbird species used in this study for
isolation of C. botulinum, except for the white-headed duck and the black-winged stilt
Capítulo 1
55
(Himantopus himantopus), all migrate between Scandinavian countries and Spain
(SEO/Birdlife, 2012).
5. Conclusions
Comparisons between the C. botulinum type C/D strains isolated from wild birds in
Spain and type C/D strains isolated from wild and domesticated birds in Scandinavia
revealed a very high level of genetic similarity. It is likely that there is one clade of closely
related strains mainly responsible for causing avian botulism in Europe. Our data show that
conclusions about the geographical origin of a strain cannot be drawn from comparisons
based on genetic relatedness alone.
Acknowledgements
This research was supported by/executed in the framework of the EU-project
AniBioThreat (Grant Agreement: Home/2009/ISEC/AG/191) with the financial support
from the Prevention of and Fight against Crime Programme of the European Union,
European Commission – Directorate General Home Affairs. This publication reflects the
views only of the author, and the European Commission cannot be held responsible for any
use which may be made of the information contained therein. The project was also
sponsored by the Spanish Ministry of Environment (Grant OAPN 035/2009). IA was
supported by a JAE PRE grant from the Spanish Council of Research (CSIC). The IMS
methodology was financed by the Norwegian Agricultural Authority, Animalia,
Felleskjøpet fôrutvikling, Fiskå Mølle and Norgesfôr through the Norwegian Research
Tesis doctoral – Ibone Anza Gómez
56
Council (Grant Number 199375/I99). We gratefully acknowledge the efforts of the field
personnel who submitted carcasses and the staff of the wildlife rehabilitation centers.
References
Agren, J., Sundström, A., Håfström, T., Segerman, B. 2012. Gegenees: fragmented
alignment of multiple genomes for determining phylogenomic distances and genetic
signatures unique for specified target groups, Plos One 7, e39107.
Collins, M.D., East, A.K. 1998. Phylogeny and taxonomy of the food-borne pathogen
Clostridium botulinum and its neurotoxins. Journal of Applied Microbiology 84, 5–
17.
Green, A.J., Figuerola, J., Sánchez, M.I. 2002. Implications of waterbird ecology for the
dispersal of aquatic organisms. Acta Oecologica 23, 177–189.
Hill, K.K., Smith, T.J., Helma, C.H., Ticknor, L.O., Foley, B.T., Svensson, R.T., Brown,
J.L., Johnson, E.A., Smith, L.A., Okinaka, R.T., Jackson, P.J. Marks, J.D. 2007.
Genetic diversity among botulinum neurotoxin-producing clostridial strains. Journal
of Bacteriology 189, 818-832.
Lindberg, A., Skarin, H., Knutsson, R., Blomqvist, G., Båverud, V. 2010. Real-time PCR
for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering a
chimeric C/D sequence-application on outbreaks of botulism in poultry. Veterinary
Microbiology 146, 118-123.
Capítulo 1
57
Moriishi, K., Koura, M., Abe, N., Fujii, N., Fujinaga, Y., Inoue, K., Oguma, K. 1996.
Mosaic structure of neurotoxins produced from Clostridium botulinum types C and
D organisms. Biochimica et Biophysica Acta 1307, 123-126.
Neimanis, A., Gavier-Widén, D., Leighton, F., Bollinger, T., Rocke, T., Mörner, T. 2007.
An outbreak of type C botulism in herring gulls (Larus argentatus) in southeastern
Sweden. Journal of Wildlife Diseases 43, 327-736.
Rozen, S., Skaletsky, H. 2000. Primer3 on the WWW for general users and for biologist
programmers. Methods in Molecular Biology 132, 365-386.
SEO/BirdLife. 2012. Análisis preliminar del banco de datos de anillamiento de aves del
Ministerio de Agricultura, Alimentación y Medio Ambiente, para la realización de
un atlas de migración de aves de España. SEO/BirdLife-Fundación Biodiversidad,
Madrid. http://www.seo.org/resultados-seguimiento-de-aves/?PRO=PM&ESP=750.
Skarin, H., Håfström, T., Westerberg, J., Segerman, B. 2011. Clostridium botulinum group
III: a group with dual identity shaped by plasmids, phages and mobile elements.
BMC Genomics 12, 185.
Skarin, H., Lindberg, A., Blomqvist, G., Aspán, A., Båverud, V. 2010. Molecular
characterization and comparison of Clostridium botulinum type C avian strains,
Avian Pathology 39, 511-518.
Takeda, M., Tsukamoto, K., Kohda, T., Matsui, M., Mukamoto, M., Kozaki, S. 2005.
Characterization of the neurotoxin produced by isolates associated with avian
botulism. Avian Diseases 49, 376-381.
Vidal, D., Anza, I., Taggart, M.A., Pérez-Ramírez, E., Crespo, E., Hofle, U., Mateo, R.
2013. Environmental factors influencing the prevalence of Clostridium botulinum
Tesis doctoral – Ibone Anza Gómez
58
type C in non-permanent Mediterranean wetlands. Applied and Environmental
Microbiology 79, 4264-4271.
Woudstra, C., Skarin, H., Anniballi, F., Fenicia, L., Bano, L., Drigo, I., Koene, M., Bäyon-
Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012. Neurotoxin gene
profiling of Clostridium botulinum types C and D native to different countries
within Europe. Applied and Environmental Microbiology 78, 3120-3127.
59
CAPÍTULO 2
Factores ambientales que influyen en la prevalencia de
Clostridium botulinum tipo C/D en humedales mediterráneos
no permanentes
Muestreo en las Navas de Malagón, Ciudad Real. Fotografía de Ibone Anza
Vidal, D., Anza, I., Taggart,
M.A., Pérez-Ramírez,
E., Crespo, E., Hofle,
U.,
Mateo, R.
2013. Environmental factors influencing the prevalence of Clostridium botulinum type
C/D in non-permanent Mediterranean wetlands. Applied and Environmental
Microbiology 79, 4264-4271.
Tesis doctoral – Ibone Anza Gómez
60
Factores ambientales que influyen en la prevalencia de Clostridium botulinum tipo
C/D en humedales mediterráneos no permanentes
RESUMEN
Entre 1978 y 2008, se han registrado 13 brotes de botulismo aviar en humedales de La
Mancha Húmeda (Castilla-La Mancha). Estos brotes causararon la muerte de alrededor
de 20.000 aves de más de 50 especies, incluyendo especies globalmente amenazadas
como la malvasía cabeciblanca (Oxyura leucocephala). En este estudio encontramos
una asociación significativa entre el número de de aves muertas en cada brote y la
temperatura media de Julio (siempre > 26 ºC). El clostridio fue detectado mediante PCR
a tiempo real en el 5,8% de las 207 muestras de sedimento recogidas entre 2005 y 2008
en humedales manchegos. Su presencia en sedimentos fue significativamente asociada
con bajas concentraciones de Cl-
y altas de materia orgánica. Se analizaron 75 tractos
digestivos de aves encontradas muertas durante brotes de botulismo y C. botulinum fue
detectado en el 38,7% de ellos. La prevalencia de C. botulinum fue de 18,2% (n= 22
pools) en invertebrados acuáticos (quironómidos y corixidos) y 33,3% (n= 18 pools) en
invertebrados necrófagos (Sarcophagidae y Calliphoridae), incluyendo dos pools de
moscas necrófagas adultas capturadas cerca de cadáveres de aves. La presencia de la
bacteria en moscas adultas abre nuevas perspectivas en la epidemiología del botulismo
aviar dado que estas podrían transportar esporas de C. botulinum entre cadáveres.
Capítulo 2
61
Environmental factors influencing the prevalence of Clostridium botulinum type
C/D in non-permanent Mediterranean wetlands
ABSTRACT
Between 1978 and 2008, 13 avian botulism outbreaks were recorded in the wetlands of
La Mancha Húmeda (Central Spain). These outbreaks caused the deaths of around
20,000 birds from over 50 species, including globally endangered white-headed ducks
(Oxyura leucoceophala). Here, a significant association was found between the number
of dead birds recorded in each botulism outbreak and the mean temperature in July
(always >26ºC). The presence of C. botulinum type C/D in wetland sediments was
detected by real-time PCR (qPCR) in 5.8% of 207 samples collected between 2005 and
2008. Low concentrations of Cl- and high organic matter content in sediments were
significantly associated with the presence of C. botulinum. Seventy five digestive tracts
of birds found dead during botulism outbreaks were analysed; C. botulinum was present
in 38.7% of them. The prevalence of C. botulinum was 18.2% (n = 22 pools) in aquatic
invertebrates (Chironomidae and Corixidae) and 33.3% (n = 18 pools) in necrophagous
invertebrates (Sarcophagidae and Calliphoridae), including two pools of adult
necrophagous flies collected around bird carcasses. The presence of the bacteria in the
adult fly form opens up new perspectives in the epidemiology of avian botulism since
these flies may be transporting C. botulinum from one carcass to another.
Tesis doctoral – Ibone Anza Gómez
62
1. Introduction
Botulism poisoning is caused by the ingestion of a potent neurotoxin (botulinum
neurotoxin [BoNT]) secreted by Clostridium botulinum that produces flaccid paralysis
and death. Seven toxin subtypes have been designated (from A to G), with type C most
frequently involved in cases of avian botulism (Mitchell and Rosendal, 1987; Rocke and
Friend, 1999), followed by types D and E. Avian botulism has been diagnosed around
the world (except in the Antarctic) and is considered the most important avian disease in
terms of mortality (Rocke, 2006). Recently, some cases of botulism in animals in
Europe and Japan were caused by mosaics of types C and D toxin, for which a higher
lethal activity is observed in mouse in comparison to other types of BoNT (Takeda et
al., 2005; Lindberg et al., 2010; Skarin et al., 2010). This mosaic C/D type toxin seems
to be predominant in European waterfowl and cross–reacts against type C antisera in the
commonly used mouse bioassay (Woudstra et al., 2012).
Clostridium botulinum type C is not considered overtly pathogenic, but acts as a
saprophytic bacterium that uses a neurotoxin (BoNT) to kill in order to create an
appropriate medium for its maintenance (Peck, 2009). The exponential mortality
observed during outbreaks of avian botulism has been associated with the life cycle of
necrophagous flies and their maggots. The maggots act as a carrier of BoNT from
decomposing bird carcasses to live birds (Duncan and Jensen, 1976; Shayegani et al.,
1984; Evelsizer et al., 2010a). In terms of botulism outbreaks, there are several
predisposing factors which have complex relationships (Rocke, 2006). One of these
factors is the abundance of C. botulinum spores in the environment, which may in turn
depend on local soil, sediment, and water properties (Marion et al., 1983; Wobeser et
al., 1987; Contreras de Vera et al., 1991; Sandler et al., 1993; Babinszky et al., 2008).
Capítulo 2
63
The high temperatures that are reached in summer in wetlands favour the growth of C.
botulinum in carcasses or in decomposing organic material (Borland et al., 1977;
Wobeser and Galmut, 1984; Woo et al., 2010). Bird mortality due to other causes can
contribute to botulism by providing carcasses where C. botulinum can grow and initiate
an outbreak (Soos and Wobeser, 2006; Evelsizer et al., 2010b). Finally, the
susceptibility of certain bird species or individuals to the BoNT toxin may be an
important determinant (Dohms and Cloud, 1982; Wobeser, 1988; Rocke, 2006).
Botulism can be a significant risk for endangered waterbird species, especially
for those with populations concentrated in just a few wetlands or on islands, where an
outbreak may reduce their numbers dramatically (Work et al., 2010). White-headed
duck (Oxyura leucocephala) and marbled teal (Marmaronetta angustirrostris) are
endangered and vulnerable (IUCN, 2012) waterfowl species and southern Spain is one
of their population strongholds within the Western Palearctic (Torres-Esquivias, 2008).
Some of the wetlands used by these species as breeding sites in Spain, such as El Hondo
on the Mediterranean coast, La Mancha Húmeda in central Spain and the Guadalquivir
Marshes in southern Spain, can be considered areas where avian botulism is endemic,
since outbreaks occur there almost every summer (Villalba et al., 1989, León-Quinto et
al., 2004; Vidal et al., 2011). Botulism may therefore continue to drive these already
vulnerable species toward a more critical status and reduce the efficacy of important
conservation efforts made over recent decades (Torres-Esquivias, 2004).
Here, we compiled available data on botulism outbreaks in the wetlands of La
Mancha Húmeda for the last 20 years and explored their association with
meteorological data. The presence of C. botulinum type C in wetland sediments was
assessed using real-time PCR (quantitative PCR [qPCR]) and the relationship between
its occurrence and the physicochemical characteristics of the sediments analysed.
Tesis doctoral – Ibone Anza Gómez
64
Moreover, the presence of C. botulinum in aquatic invertebrates and necrophagous flies
sampled during botulism outbreaks was studied to evaluate their role in the
epidemiology of these episodes.
2. Material and methods
2.1 Study area.
The study area consisted of wetlands in Castilla-La Mancha (central Spain), and
the study focused on the National Park of Tablas de Daimiel and nearby wetlands where
botulism outbreaks have been recorded since 1978 (Fig. 1). Tablas de Daimiel was
declared National Park in 1973, Special Protection Area for Birds in 1988 and was
included in the Ramsar List in 1982. The National Park now protects the remaining
1,675 ha of a wetland that 50 years ago comprised 6,000 ha (Álvarez-Cobelas and
Cirujano, 1996). Four of the wetlands studied also receive inputs from wastewater
treatment plants from nearby towns/villages (Fig. 1). We included two reservoirs
because birds from the natural wetlands often use these sites for feeding or resting since
there are large areas of shallow water with abundant vegetation present (Fig. 1).
The climate in this area is cold-temperate continental, with a pronounced dry
season and annual rainfall of around 400-500 mm. All the lagoons studied are between
603 and 670 m above sea level (Álvarez-Cobelas and Cirujano, 1996).
Manjavacas, Alcázar de San Juan and Pedro Muñoz lagoons are characterized
by a salt concentration >5 g/l even at the height of flooding, and they have historically
shown marked seasonality in terms of water level (since water supplies to these lagoons
were originally limited only to rainfall and runoff).
Capítulo 2
65
Fig. 1. Locations of the studied wetlands in Castilla-La Mancha. Most sites were located in the
province of Ciudad Real; only Manjavacas was located in Cuenca. The surface areas (in
hectares) are shown in parentheses on the map. Inh, inhabitants.
However, water discharged from wastewater treatment plants into these lagoons
has altered their more natural hydrological character (Cirujano and Medina, 2002).
Navaseca lagoon is a highly eutrophic artificial wetland which is close to Tablas de
Daimiel Park (6.5 km away).
2.2 Historic data and sample collection.
Waterfowl mortalities due to botulism outbreaks were compiled from official
data recorded between 1978 and 2008 by the regional government (Junta de
Comunidades de Castilla-La Mancha [JCCM]). The diagnosis of avian botulism was
based on clinical observations made by veterinary staff at the Wildlife Rehabilitation
Centres of JCCM and confirmed by mouse bioassay with a hexavalent antitoxin
Tesis doctoral – Ibone Anza Gómez
66
provided by the Center for Disease Control and Prevention, Atlanta, GA, USA, and
undertaken at the Spanish National Institute of Toxicology. The mouse bioassay was
performed using sera from eight birds from five different outbreaks that occurred in
Mancha Húmeda between 1998 and 2002.
Monthly meteorological data (minimum, maximum and mean temperatures,
number of days >25 ºC, mean rainfall and mean humidity) for the study area between
1997 and 2008 were obtained from the Spanish National Institute of Statistics
(http://www.ine.es).
A total of 207 sediment samples were collected between 2005 and 2008 in the
studied wetlands. In July 2005, sediment samples were collected in Tablas de Daimiel
(n = 14), Alcázar de San Juan (n = 24), Pedro Muñoz (n = 15), Manjavacas (n = 9),
Vicario (n = 8) and Vega del Jabalón (n = 2). In January 2006, sediment samples were
collected in Tablas de Daimiel (n = 11), Vega del Jabalón (n = 9) and Vicario (n = 10).
Additionally, between 2006 and 2008, sediment samples were collected in
wetlands where avian mortalities had been detected during the summer, i.e., in Tablas
de Daimiel in 2007 (n = 68), Alcázar de San Juan in 2006 to 2008 (n = 13), Navaseca in
2008 (n = 14) and Jabalón in 2008 (n = 2). Sediment samples (50 to100 g) were
collected from the upper 0-5 cm. Benthic invertebrates, mostly larvae of chironomids
(non-biting midges), and water column invertebrates, mostly corixids (water bugs),
were collected during sediment sampling and processed in pools grouped by sampling
site.
Carcasses of 75 birds from 18 species were sampled during avian mortalities
detected in the wetlands studied. These samples included gastric contents, intestines,
cecum and cloacal swabs, although not all could be taken from each bird. Additionally,
5 pools of adult necrophagous flies, mostly Calliphoridae and Sarcophagidae families,
Capítulo 2
67
were caught flying around bird carcasses, as were 10 pools of maggots, 3 of eggs and 1
of pupae (of Calliphoridae), collected directly from bird carcasses. All samples were
frozen immediately at -30 ºC and stored until analysis.
2.3 Detection of C. botulinum: pre-enrichment cultures, qPCR and PCR for type C/D.
All samples were processed as previously described by Vidal et al. (2011).
Detection followed a protocol that included the preenrichment of the sample by culture,
DNA extraction, and the detection of the gene encoding for the toxin by qPCR.
Cultivation of samples was performed in a commercial cooked meat broth
supplemented with vitamin K1, glucose and hemine (BD BBL cooked meat medium
with glucose, hemin and vitamin K,; BD, NJ, USA) using an anaerobe container system
(BD GasPak EZ; BD, NJ, USA) over a period of 3-5 days at 40 ºC. DNA extraction was
performed using two commercial kits for DNA extraction: the PowerSoil DNA isolation
kit (MoBio, Carlsbad, CA, USA) and the DNAeasy blood and tissue kit (Qiagen,
Hilden, Germany), for sediments and animal tissue samples respectively (following the
manufacturer’s recommendations). qPCR was performed as described previously
(Sánchez-Hernández et al., 2008), including encoding genes of both type C and type
C/D mosaic toxins, and has been adapted for environmental samples by Vidal et al.
(2011). The amplicon of the qPCR is within the amino-terminal domain of the heavy
chain, and it specifically addresses position 2014 bp for the forward primer and 2112 bp
for the reverse primer using the BoNT sequence of the type C/D mosaic strain 03-009
(GenBank Accesion Number AB200360) (Takeda et al., 2005). In order to confirm
whether field samples were positive to type C/D mosaic, a total of 30 samples were also
tested with a standard PCR by the method of Takeda et al. (2005). The sensitivity of
Tesis doctoral – Ibone Anza Gómez
68
this PCR was compared to the qPCR using an isolated strain from the gastric content of
a black-headed gull (Chroicoceplus ridibundus), collected in the summer of 2005 in an
outbreak that occurred in La Veguilla lagoon (internal reference IREC-B136) which
was quantified by the most probable number technique (MPN) technique.
2.4 Determination of the physicochemical characteristics of the sediments.
Each fresh sediment sample (10 g) was mixed with 30 ml of deionized water for
30 minutes on a shaker. The pH was measured in the solution after 2 minutes. The
solution was vacuum-filtered through a 0.45 µm filter paper. This filtrate was then used
to determine water-soluble PO4-, NO3
-, NO2
- and Cl
- by means of UV-Vis
spectrophotometry using SprectroquantTM
kits (Merck, Darmstadt, Germany). Moisture
and organic matter content were determined sequentially, first by drying the sample at
120 °C in an oven to calculate the amount of free and combined water present in the
sample, and then by heating in a muffle furnace at 450 °C to calculate the percentage
loss on ignition (% LOI).
2.5 Statistical analysis.
The relationship between avian mortality rate (due to botulism outbreaks) and
meteorological data was analysed with Spearmans’s correlation coefficient (rS). The
frequency of detection of C. botulinum in different types of samples was compared by
means of chi-square test or Fisher exact probability tests. Physicochemical
characteristics of sediments were compared among wetlands with one-way analysis of
variance (ANOVA) tests. Post-hoc differences were studied with Tukey tests. The
association between the presence of C. botulinum and the physicochemical
Capítulo 2
69
characteristics of the sediments was studied with generalized linear models (GLM) with
a binary logistic distribution. The presence of C. botulinum (negative or positive) was
used as the dependent variable and the physicochemical characteristics of the sediments
were used as the predictors. Physicochemical data were log-transformed when
necessary to approach a normal distribution. The studied models initially included all
the known predictors, but only those with higher significance were retained in the final
models following a backward stepwise procedure. Significance for the statistical
analyses was set at p≤0.05 and analyses were performed with IBM SPSS Statistics
19.0.0.
3. Results
3.1 Description of avian botulism outbreaks.
Between 1978 and 2008, 13 botulism outbreaks were recorded within the study
area. Around 20,000 individuals from more than 50 species from 18 families (Table 1
and Table S1 in the supplemental material) were found dead by environmental
authorities during these outbreaks. The most frequently affected family was Anatidae,
followed in smaller numbers by Rallidae and Scolopacidae (Table 1). In terms of
species, the highest mortality rates were reported for mallards (Anas platyrhynchos),
Eurasian coot (Fulica atra), gadwall (Anas strepera) and Northern shoveler (Anas
clypeata) (Table S1). Two threatened waterfowl species (IUCN, 2012), the endangered
white-headed duck and the near-threatened ferruginous duck (Aythya nyroca) were also
found dead in small numbers during these outbreaks. The presence of BoNT was
confirmed by mouse bioassay in seven birds (six mallards and one common teal [Anas
Tesis doctoral – Ibone Anza Gómez
70
crecca]) collected in four different outbreaks prior to 2002. One negative sample was
from a black-headed gull which was sampled during recovery and finally released.
A significant association was found between the number of dead birds counted
during the botulism outbreaks and the mean temperature in July (rs = 0.745, p = 0.005).
Most of these outbreaks (9 out of 13) were initiated or occurred in July and all occurred
when the mean temperature during this month was above 26 ºC (Fig. 2). No other
correlations were found between botulism mortality and the rest of the meteorological
data.
Fig. 2. Relationship between avian mortalities (log transformed data) detected in botulism
outbreaks and the mean temperature during the month of July between 1997 and 2008 (rS =
0.745; P = 0.005). Shown is the regression (solid line) with 95% confidence interval (broken
lines).
71
Table 1. Official mortality rates of birds grouped by families due to avian botulism outbreaks in Castilla-la Mancha wetlands between 1978 and 2008.
Family N of species Year Total
1978 1998 1999 2002 2004 2005 2006 2008
Podicipedidae 4 83 2 10 0 1 0 3 0 99
Ardeidae 1 18 0 344 0 12 41 3 0 418
Ciconiidae 1 1 0 3 1 4 4 9 0 22
Phoenicopteridae 1 0 0 0 3 2 0 0 0 5
Anatidae 12 2.755 251 9.572 1 93 454 489 172 13.787
Accipitridae 2 4 0 0 0 0 0 2 0 6
Phasianidae 1 1 0 0 0 0 0 0 0 1
Rallidae 3 348 603 850 3 34 41 112 19 2.010
Recurvirostridae 2 513 191 38 11 15 6 29 2 805
Charadridae 4 577 0 7 6 1 1 2 1 595
Scolopaciae 12 1.081 0 21 0 4 0 0 10 1.116
Glareolidae 1 0 0 0 0 0 0 1 0 1
Laridae 3 316 343 117 16 4 0 65 2 863
Sternidae 6 64 0 18 1 0 1 60 0 144
Tytonidae 1 1 0 0 0 0 0 0 0 1
Laniidae 1 1 0 0 0 0 0 0 0 1
Passeriformes 1 0 0 0 0 0 0 4 0 4
Columbidae 1 0 0 0 0 0 0 1 0 1
Total 57 5.763 1.390 10.980 42 170 548 780 206 19.879
Tesis doctoral – Ibone Anza Gómez
72
3.2 Identification of C. botulinum type.
The strain isolated from one black-headed gull was confirmed as the type C/D
mosaic with the conventional PCR and qPCR. The sensitivity of the qPCR with this
strain was around 2.5 spores/ml (1 to 6 spores, 95% confidence interval), whereas for
the conventional PCR it was about 250 spores/ml (Table 2 and Fig. 2). The presence of
the type C/D mosaic was also confirmed by conventional PCR in 16 of 22 field samples
that were previously positive to the qPCR.
Table 2. Sensitivity of the qPCR (Vidal et al., 2011) and conventional PCR (cPCR) (Takeda et
al., 2005) using serial ten-fold dilutions of a reference strain (IREC-B136), tested in triplicate.
Mean Spores/ml
(NMP)
Positive replicates
cPCR (type C/D mosaic)
Positive replicates
qPCR
Mean Ct qPCR
250000 3/3 3/3 28,43
25000 3/3 3/3 30,42
2500 1/3 3/3 32,45
250 1/3 3/3 34,89
25 0/3 3/3 37,56
2.5 0/3 3/3 39,56
0.25 0/3 0/3 0
0.025 0/3 0/3 0
0.0025 0/3 0/3 0
Capítulo 2
73
Fig. 2. A: Detection limit of cPCR for type C/D mosaic using primers CD/Fw and D/Rv from
Takeda et al. (2005); M=100 bp DNA ladder; lines 1-6 ten-fold dilutions of reference strain
(IREC-B136): from 25000 to 0.25 UFC/ml; lines 7 and 8 strain IREC-CB13 (from outbreak of
2010, not included in the paper), line 7 is 790 UFC/ml and line 8 is 79 UFC/ml (both positives
to qPCR). B: Samples positives by qPCR (lines 1-3, tissues; lines 4-6, invertebrates; lines 7-9,
cloacal swabs; line 10 strain IREC-B136; line 11: negative control).
3.3 C. botulinum in environmental samples and birds.
The overall prevalence of C. botulinum type C/D in preenriched sediment
samples was 5.8%. By wetland, Alcázar de San Juan wetland showed the highest
prevalence, followed by Vega del Jabalón and Tablas de Daimiel wetlands, with values
of 10.8%, 9.5% and 6.5% respectively (Table 4). Most of the positive sediments (10 out
of 12) were collected during botulism outbreaks which always started in June or July
(Table 3). Interestingly, none of the 14 sediments collected during the Navaseca
outbreak which started at the end of September 2008, were positive by qPCR (Table 3).
Tesis doctoral – Ibone Anza Gómez
74
Table 3. Distribution of botulism positive sediments by year and by wetland (positive
sediments/total sediments sampled).
Wetland Year Month Botulism
outbreak
Positives/total
analyzed
Total positives
by wetland
Tablas of Daimiel Park 2005 Jul No 1/14 6/93
2006 Jan No 0/11
2007 Ag Yes 5/50
Sep Yes 0/18
Navaseca 2008 Sep Yes 0/14 0/14
Alcazar Lagoons 2005 Jul Yes 1/24 4/37
2006 Jul No 0/1
2007 Sep No 0/1
2008 Jul Yes 3/11
Manjavacas lagoons 2005 Jul No 0/9 0/9
Pedro Muñoz lagoons 2005 Jul No 0/15 0/15
Jabalon Reservoir 2005 Jul Yes 2/10 2/21
2006 Jan No 0/9
2008 Ag No 0/2
Vicario Reservoir 2005 Sep Yes 0/8 0/18
2006 Jan No 0/10
Total 12/207
All the physicochemical characteristics of the sediments were found to differ
among wetlands (Table 5), and the characteristics that were significantly associated with
the presence of toxigenic C. botulinum type C/D were lower Cl- (Wald's χ
2 = 4.54; p =
0.033) and higher %LOI (Wald's χ2
= 5.08; p = 0.024). These effects were observed in
the final model which included %LOI, Cl-, moisture, pH and NO3
-. The effect of Cl
- was
maintained across all locations (Fig. 3A), whereas the effect of %LOI was more marked
at Tablas de Daimiel (Fig. 3B).
During botulism outbreaks, the prevalence of C. botulinum type C/D was 18.2%
(4/22) in pools of aquatic invertebrates and 33.3% (6/18) in pools of necrophagous
Capítulo 2
75
invertebrates (Table 4). Positive aquatic invertebrate samples corresponded to two pools
of chironomid larvae from sediment and two pools of corixids from the water column.
Positive necrophagous invertebrate samples corresponded to two pools of adults, one
pool of pupae and three pools of maggots of Sarcophagidae and Calliphoridae flies
collected from or around bird carcasses.
The presence of C. botulinum type C/D was detected in the digestive tract
content of 38.7% of affected birds (Table 4). Within the positive birds, C. botulinum
was more frequently detected in the cecum samples (16/22 [73%]), followed by cloacal
swabs (4/7 [57%]), intestine (14/26 [54%]) and gastric content (10/29 [34%]) (Table S2
in the supplemental material). In positive birds for which several samples were
available, detection of C. botulinum was more frequent (p = 0.012) in cecum samples
(15/18 [83%]) than in gastric content samples (5/18 [28%]).
B
A
Fig. 3. Differences in physicochemical properties of sediments between samples in the absence
of Clostridium botulinum type C/D. A. Concentration of Cl- (Wald’s χ
2 = 4.54; p = 0.033). B.
Organic matter content (% loss on ignition) of sediments from Tablas de Daimiel (Wald's χ2
=
5.08; p = 0.024). dw, dry weight.
76
Table 4. Presence of Clostridium botulinum in different environmental samples taken from wetlands in Castilla-La Mancha between 2005 and 2008.
Wetland Outbreak years Sediment Benthic
invertebrates
Water column
invertebrates
Waterfowl
carcasses
Necrophagous flies
N +a % N +
b % N +
c % N + % N +
d %
Tablas de Daimiel 2007 93 6 6.5 3 0 0 - - - 11 4 36.4 - - -
Navaseca Lagoon 2008 14 0 0 7 1 14.3 6 2 33.3 24 7 29.2 10 2 20
Alcázar de San Juan
Lagoons
2006, 2008 37 4 10.8 - - - - - - 29 11 37.9 7 3 42.9
Manjavacas Lagoon - 9 0 0 - - - - - - - - - - - -
Pedro Muñoz Lagoons 2006 15 0 0 - - - - - - - - - - - -
Vega del Jabalon Reservoir 2005 21 2 9.5 - - - 6 1 16.7 11 7 63.6 1 1 100
Vicario Reservoir 2005 18 0 0 - - - - - - - - - - - -
Alle 207 12 5.8
A 10 1 10.0
AB 12 3 25.0
B 75 29 38.7
B 18 6 33.3
B
a All but two positive samples were collected during botulism outbreaks. b Positive benthic invertebrates were Chironomidae. c Positive water column invertebrates were
corixids. d Positive necrophagous flies were adults, pupae and larvae of Sarcophagidae and Calliphoridae. e Percentages of presence of C. botulinum were not significantly
different between sample types sharing a superscript capital letter.
77
Table 5. Physicochemical characteristics of sediments from wetlands in La Mancha.
Wetland
Zone
N
pH Moisture (%) Organic matter (%)a PO4
- (ppm)
a NO3
- (ppm)
a NO2
- (ppm)
a Cl
- (ppm)
a
Mean SE Mean SE Mean SE Mean SE Mean SE Mean SE Mean SE
Tablas de Daimiel 182 7.68AB
0.01 58.0C 1.0 17.9
B 0.8 21.44
ABC 1.75 369.0
ABC 21.2 2.41
A 0.67 1,263
A 138
Morenillo 36 7.60 0.03 57.0 3.3 20.3 1.0 39.36 4.69 548.0 83.1 3.34 1.01 1,132 179
Tablazo 70 7.72 0.02 49.8 1.1 8.5 0.3 10.96 1.94 339.8 21.9 3.39 1.65 1,133 193
Exhibit Lagoon 1 7.76 57.9 15.1 21.31 279.1 0.48 6,047
Permanent Lagoon 75 7.67 0.02 66.1 0.6 25.7 1.1 22.61 2.54 311.6 20.4 1.07 0.14 1,383 261
Alcázar S. Juan 30 8.31C 0.05 25.1
A 2.0 12.1
AB 0.9 28.18
ABC 5.92 371.5
ABC 39.5 4.58
A 1.47 34,987
C 6,058
La Veguilla 10 8.09 0.08 14.5 1.2 7.7 1.3 21.45 15.86 480.6 84.4 7.64 3.42 3,705 1,568
Las Yeguas 10 8.30 0.09 31.5 1.4 15.1 0.8 27.83 4.25 381.5 57.1 2.04 1.22 66,870 9,335
C. Villafranca 10 8.54 0.05 29.2 3.9 13.6 1.1 35.26 7.69 252.4 42.5 4.06 2.44 34,386 6,588
Manjavacas 10 8.43C 0.06 26.8
A 1.7 14.4
AB 1.6 35.42
BC 10.18 482.4
C 92.3 1.65
A 0.57 32,544
C 4,922
Pedro Muñoz 24 7.81B 0.05 38.2
B 3.3 16.5
B 1.1 43.07
C 12.04 427.7
BC 52.7 17.30
B 6.61 13,262
B 2,220
Pueblo 14 7.78 0.07 48.3 3.5 18.5 1.5 62.04 19.14 479.7 73.6 19.77 7.24 8,722 2,004
Retamar 10 7.84 0.07 24.1 2.4 13.6 1.1 16.50 3.70 354.8 71.2 13.83 12.62 19,619 3,794
Vega del Jabalón 20 8.50C 0.15 40.3
B 3.2 7.3
A 1.5 13.16
AB 6.51 183.1
A 17.2 0.36
A 0.09 414
A 133
Vicario 20 7.52A 0.07 44.4
B 1.9 8.3
A 0.4 8.16
A 2.66 249.1
AB 24.1 0.59
A 0.09 1,330
A 279
aDry weight (d.w.) basis; Means sharing a superscript capital letter were not significantly different between wetlands
Tesis doctoral – Ibone Anza Gómez
78
4. Discussion
The present study shows that outbreaks of avian botulism have been regularly
observed over the last 30 years in the wetland area known as “Mancha Húmeda” in
central Spain, despite the relatively low occurrence of C. botulinum (5.8%) in sediment
samples. These outbreaks have affected around 20,000 birds from over 50 species
(mainly waterfowl, rallids and waders) and occurred especially when the mean
temperature in July was above 26 ºC. In parallel with the presence of C. botulinum, the
highest risk of botulism may occur in wetlands with lower salinity (low Cl- levels) and
high organic matter content.
Mouse bioassays performed at the Spanish Institute of Toxicology with
hexavalent antitoxin have confirmed the presence of BoNT in outbreaks that occurred
between 1998 and 2002. Subsequently, outbreaks that occurred up until 2009 have been
confirmed by mouse bioassay at the National Game Institute (IREC), Ciudad Real,
Spain, and samples taken during these outbreaks have been determined to be positive
both to the C antitoxin (C. botulinum antitoxin type C; catalog no. BS0611, lot 05-
0100, Centers for Disease Control and Prevention, Atlanta, GA, USA) and to the type D
antitoxin in the Institute Pasteur in all cases. In addition, some field samples were
positive for the type C/D mosaic which suggests that C. botulinum producing avian
botulism in Mancha Húmeda is probably due to this type (as is the case in other parts of
Europe [Woudstra et al., 2012]). Negative results using PCR in a few samples that were
positive by qPCR can be explained by the lower sensitivity inherent in conventional
PCR compared to qPCR, and also because the threshold cycles (CTS) in the qPCR were
later (data not shown). The present work has been focused on the detection of C.
botulinum rather than the presence of the neurotoxin. The qPCR has proved to be a
Capítulo 2
79
sensitive tool for the detection of C. botulinum in the environment and its
ecoepidemiological study.
In general, the wild birds most frequently affected by botulism are waterfowl
and shorebirds (Rocke and Friend, 1999; Rocke, 2006; Friend, 2002). In our study,
69.3% of registered mortality corresponded to the Anatidae family, and 12.6% to
shorebird species (Scolopacidae, Recurvirostridae and Charadridae). The mallard was
the most affected species, and represented 50% of the reported mortality; the same
proportion as observed by Woo et al. (2010) in an outbreak that occurred in Korea in
2008. In addition, Shayegani et al. (1984) reported high percentages for Anseriformes
(56%) and lower percentages for shorebirds (6.6%) in mortalities caused by botulism in
New York State. The mallard duck is one the most abundant species in wetlands of our
study area and elsewhere, and therefore, it commonly suffers losses during botulism
outbreaks (Rocke, 2006; Shayegani et al., 1984). Outbreaks of botulism are an
especially significant conservation issue when they affect endangered species with
limited local or global distribution. In such cases, isolated population hotspots are
highly sensitive to catastrophic events such as unusual weather events or disease
outbreaks. For example, a single botulism outbreak produced an estimated die-off of 15-
20% of the western metapopulation of American white pelican (Pelecanus
erythrorhynchos) (Rocke et al., 2005), and another in Taiwan caused the death of 73
black-faced spoonbill (Platalea minor), while global populations are now estimated at
only 1,600 mature individuals (IUCN, 2012; Chuang et al., 2005). In another event, 181
critically endangered Laysan ducks (Anas laysanensis) died during a botulism outbreak
at Midway Atoll (Hawaii), out of a global population of approximately 500-680 mature
individuals (Work et al., 2010; IUCN, 2012). It should be noted that threatened species
such as the endangered white-headed duck, were also found dead during the botulism
Tesis doctoral – Ibone Anza Gómez
80
outbreaks reported here (Table S1) despite the scarcity of the species in the studied
wetlands. Although the Spanish population of this species has increased from less than
100 birds in 1978 to around 2,200 birds in 2007, in Ciudad Real province (where most
of our sampling sites were located), the September 2007 census recorded only 139 birds
(Torres-Esquivias, 2008). The world population for this species has been estimated to
be between just 7,900 and 13,100 individuals (around 5,300 – 8,700 mature individuals
[IUCN, 2012]) and is in decline. Botulism may therefore be a major concern in terms of
conservation efforts aimed at this species.
In principle, an avian botulism outbreak is essentially unpredictable, but, it is
now known that various environmental factors play a predisposing role in epidemics.
These factors include temperature, salinity of the substrate, pH, redox potential (of the
surface water and soil/sediment porewater), dissolved oxygen level and sediment/soil
organic matter content (Babinszky et al., 2008; Rocke and Samuel, 1999; Murphy et al.,
2000). Moreover, large epidemic outbreaks are favored by the presence of botulism
intoxicated avian carcasses and the maggots that feed on them. This acts to amplify the
number of intoxicated birds as they feed on BoNT bearing maggots, in a process known
as the carcass-maggot cycle (Wobeser, 1997). This cycle is favored by temperatures
above 20 ºC which facilitates the growth of C. botulinum in the bird carcasses (Soos and
Wobeser, 2006; Rocke and Bollinger, 2007). As observed here, the majority of
outbreaks recorded in La Mancha Húmeda wetlands started in July and correlated with
mean temperatures above 26 ºC in this month. The temperature in July frequently
reached 40 ºC during the day within the study period, which is optimal for the growth of
C. botulinum type C in an appropriate substrate (Rocke and Bollinger, 2007). In this
regard, global warming may increase the risk of a botulism outbreak in the area. Natural
temporary wetlands would probably be affected by persistent drought whereas artificial
Capítulo 2
81
wetlands, such as lagoons receiving treated wastewater, may persist as the only habitat
for waterbirds. Rising temperatures may increase the frequency of botulism outbreaks
by reducing the number of low risk saline habitats and favoring the growth of C.
botulinum itself.
In Castilla-La Mancha we have rarely observed botulism outbreaks in spring or
autumn, as reported in some wetlands in America (Rocke and Friend, 1999; Wobeser et
al., 1983), Europe (Hubálek and Halouzka, 1991) and Asia (Woo et al., 2010). The only
registered case in our dataset was an outbreak observed in Navaseca lagoon, which
started at the end of September 2008, when there was a mean temperature of just 20.5
ºC. The cause of this episode is still unknown. The outbreak began just after a short
period of heavy rain, which exceeded the carrying capacity of the wastewater treatment
plant that feeds treated water into this lagoon. Further research is necessary to
understand the possible epidemiological association between wastewater,
enteropathogens and botulism outbreaks, since many of the botulism epidemics in our
study area occurred in wetlands that receive significant inputs from wastewater
treatment plants. A feasible hypothesis is that some bacteria of fecal origin could
initially cause mortality of a few birds. The onset of several botulism outbreaks has
indeed been associated with previous bird mortalities due to other causes, i.e., due to
starvation, bacterial or parasitic infections, predation or pesticide poisoning (Woo et al.,
2010; Soos and Wobeser, 2006). In turn, this may initiate the carcass-maggot cycle
within the optimal environment offered by the decomposing carcass. The likelihood of
this happening may be heightened after a high rainfall storm event when relatively
untreated sewage may be flushed through the briefly overburdened wastewater
treatment plant.
Tesis doctoral – Ibone Anza Gómez
82
Detection rates for C. botulinum type C in the soils/sediments analysed in our
study area (5.8%) were similar to those observed in other affected wetlands in Spain
(1.7 to 18% [Contreras de Vera et al, 1987; Contreras de Vera et al, 1991]) and Florida
(5.6% [Marion et al., 1983]). However, these values were far lower than in other
wetlands in Austria (74 to 83% [Zechmeister et al., 2005]), California (52% [Sandler et
al., 1993]), Canada (38% [Wobeser et al., 1987]) or the UK (19.4 to 51.5% [Smith et
al., 1982]). The marked seasonality of many Mediterranean wetlands may reduce the
persistence of C. botulinum in sediments. For example, Sandler et al. (1993) found that
the presence of C. botulinum in marshes that remained flooded was higher than in
marshes that were drained in the spring and flooded in the fall. Other factors, such as the
high salinity prevailing in most of the La Mancha Húmeda wetlands may also affect the
long-term presence of C. botulinum in sediments. We have observed a clear negative
association between soluble Cl- levels in sediments and the detection of C. botulinum.
Likewise, other studies have reported a negative effect of salinity on C. botulinum
growth (Segner et al., 1971; Webb et al., 2007) and botulism occurrence (Rocke and
Friend, 1999). Further, the highest risk of occurrence for avian botulism outbreaks has
been associated with a soil pH value between 7 and 8 (Rocke and Samuel, 1999). We
have not observed a significant effect of pH on the presence of C. botulinum in the
sediments studied here, but most of our observed values were within this cited range of
risk. Another important factor (not studied here) is redox potential. Negative values for
this parameter, indicative of reducing/low oxygen conditions in the sediment, have been
associated with a higher risk of a botulism outbreak (Rocke and Samuel, 1999).
Wetlands studied here tended to have a positive redox potential, but this may be lower
in lagoons fed by wastewater treatment plants or locally near wastewater outfalls as a
result of the higher input of fresh organic matter/nutrients (Hijosa-Valsero et al., 2012).
Capítulo 2
83
Wetlands that receive treated wastewater may therefore pose a higher risk for botulism
initiation because they may tend to be more affected by eutrophication (which may
induce reducing sedimentary conditions) or provide a substrate (by causing the death of
a bird by other means) for toxin production. The continuous unnatural water
input/influx may also remove the key annual drought period and reduce salinity
compared to other temporal wetlands.
Invertebrates, mainly maggots from necrophagous flies, play a crucial role in
botulism outbreaks as vehicles for the BoNT toxin which then causes mortality in the
birds feeding on them (Wobeser, 1997). Hubálek and Halouzka (1991) analyzed various
invertebrates during a botulism outbreak, and detected BoNT at high concentrations in
necrophagous larvae and pupae of the blow flies Lucilia sericata and Calliphora
vomitoria which were collected from bird carcasses. In turn, the risk of mortality due to
avian botulism tends to be higher in wetlands with higher densities of maggot-laden
carcasses (Evelsizer et al., 2010b). Duncan and Jensen (1976) compared the toxicity of
different invertebrate species collected from or near carcasses, and again found that
Calliphoridae larvae (collected from carcasses) pose the greatest risk. Toxicity was also
analyzed in adult invertebrate forms, and 4 out of 15 samples of Calliphoridae flies were
toxin positive. We have detected C. botulinum type C/D not only in larvae and pupae,
but also in adults of Calliphoridae and Sarcophagidae flies. The presence of the bacteria
in the adult fly provides a new aspect to be considered in the epidemiology of avian
botulism, since these flies may be actively transporting C. botulinum type C/D from one
carcass to another.
Other invertebrates collected around carcasses, such as ptychopterid fly larvae,
leeches and sow bugs, have been shown to contain BoNT, albeit at concentrations that
were lower than in blowfly larvae (Duncan and Jensen, 1976; Hubálek and Halouzka,
Tesis doctoral – Ibone Anza Gómez
84
1991). During mass mortalities of waterbirds produced by C. botulinum type E in North
America, benthic invertebrates have been identified as potential vectors of spores
(Pérez-Fuentetaja et al., 2011). Here, we detected C. botulinum in samples of
chiromonids and corixids that were collected around bird carcasses, but their potential
risk as carriers of toxin seems to be limited (Duncan and Jensen, 1976).
The overall prevalence of C. botulinum in the digestive tract of bird carcasses
collected during botulism outbreaks was 38.5%, and it was more frequently detected in
the lower tract (bowel or cecum) than in the upper tract (gastric content). This
difference in distribution may reflect the preference of C. botulinum type C/D for the
lower tract (especially the cecum) for postmortem growth of the bacteria. Alternatively,
it may reflect its premortem prevailing presence. The presence of C. botulinum type C
in the digestive tract of birds can be explained by the ingestion of vegetative cells and/or
spores (Haagsma, 1991); furthermore, the bacteria could persist in the ceca of healthy
birds where it may act as a substrate for toxin production after death (Zhu et al., 2002).
We have noted that cloacal swabs can give similar results to cecum samples in terms of
detecting the presence of C. botulinum type C/D. This may indicate that cloacal swabs
could be a specimen of choice in live birds suspected of botulism poisoning, or could be
used to study possible carriers of the microorganism in epidemiological studies.
Overexploitation of groundwater resources in the agricultural land around the La
Mancha Húmeda wetlands has completely changed their natural water regime. Tablas
de Daimiel, which was historically a regionally important permanent wetland, currently
undergoes extended periods of drought. In contrast, other historically temporary saline
lagoons have now been transformed into permanent freshwater lagoons due to the
continuous input provided by wastewater treatment plants. Navaseca is one such
artificial lagoons. Our analysis of its physicochemical characteristics indicates that it
Capítulo 2
85
represents a significant risk in terms of its potential to host/induce local botulism
outbreaks which may then be disseminated by vectors to nearby wetlands like Tablas de
Daimiel National Park, where the highest numbers of birds concentrate and where the
greatest implication for certain endangered avian species may exist.
Acknowledgments
We thank Victor Diez for information provided regarding botulism outbreaks
recorded by the personnel of the JCCM. We also appreciate the cooperation of staff
from the Tablas of Daimiel National Park and of the Environmental Agents from
Castilla-La Mancha (JCCM). Finally we also thank Elena de Prada for help with sample
collection at the Wildlife Rehabilitation Centre of “El Chaparrillo”. This study was
granted by the Spanish Ministry of Environment (OAPN 099/2003 and OAPN
035/2009). Dolors Vidal was supported with a JAE DOC contract from the Spanish
Council of Research (CSIC). Mark Taggart was supported by a Juan de la Cierva
Fellowship from the Spanish Ministry of Science and Innovation (MICINN). Ibone
Anza was supported by a JAE PRE grant from CSIC and Elisa Pérez-Ramírez was
supported by a I3p grant from CSIC. We thank the Department of Bacteriology of the
National Veterinary Institute in Uppsala and the Unit of Anaerobic Bacteria and Toxins
of the Pasteur Institute in Paris for their receptivity and collaboration during two stays
of Ibone Anza at these institutions.
Tesis doctoral – Ibone Anza Gómez
86
References
Álvarez-Cobelas, M., Cirujano, S. 1996. Las Tablas de Daimiel. Ecología Acuática y
Sociedad. Organismo Autónomo de Parques Nacionales, Ministerio de Medio
Ambiente, Madrid, Spain, p. 368.
Babinszky, G., Csitári, C., Józsa, S. 2008. Observations on environmental factors in
connection with avian botulism outbreaks in a Hungarian wetland habitat. Acta
Microbiologica et Immunologica Hungarica 55, 455–464.
Borland, E.D., Moryson, C.J., Smith, GR. 1977. Avian botulism and the high
prevalence of Clostridium botulinum in the Norflok Broads. Veterinary Record
100, 106–109.
Chuang, W.C., Shieh, Y.C., Chen, S.H., Lee, Y.F., Tsai, K.Y., Tsai, S.S. 2005.
Outbreaks of botulism due to type C1 toxin in black-faced spoonbills (Platalea
minor). Taiwan Veterinary Journal 31, 267-273.
Cirujano, S., Medina, L. 2002. Plantas acuáticas de las lagunas y humedales de Castilla-
la Mancha. In Cirujano S, Medina L. (ed), Real Jardín Botánico, CSIC and Junta
de Comunidades de Castilla-La Mancha, Madrid, Spain, p. 340
Contreras de Vera, A., García Fernández, A., Cubero Pablo, M.J., León-Vizcaíno, L.
1991. Low prevalence of C. botulinum in Spanish wetlands with a tidal regime.
Veterinary Record 128, 187–188.
Contreras de Vera, A., León-Vizcaíno, L., Carranza Guzmán, J., Hermoso de Mendoza,
M., Garrido Abellán, F. 1987. Botulismo aviar en zonas húmedas de la campiña
de Sevilla y Córdoba. Medicina Veterinaria 4, 173-179.
Dohms, J.E., Cloud, S.S. 1982. Susceptibility of broiler chickens to Clostridium
botulinum type C toxin. Avian Diseases 26, 89–96.
Capítulo 2
87
Duncan, R.M., Jensen, W.L. 1976. A relationship between avian carcasses and living
invertebrates in the epizootiology of avian botulism. Journal of Wildlife
Diseases 12, 116–126.
Evelsizer, D.D., Bollinger, T.K., Dufour, K.W., Clark, R.G. 2010a. Survival of radio-
marked mallards in relation to management of avian botulism. Journal of
Wildlife Diseases 46, 864–877.
Evelsizer, D.D., Clark, R.G., Bollinger, T.K. 2010b. Relationships between local
carcass density and risk of mortality in molting mallards during avian botulism
outbreaks. Journal of Wildlife Diseases 46, 507–513.
Friend, M. 2002. Avian disease at the Salton Sea. Hydrobiologia 473, 293–306.
Haagsma, J. 1991. Pathogenic anaerobic bacteria and the environment. Revue
Scientifique et Technique de L’Office International des Epizooties 10, 749-764.
Hijosa-Valsero, M., Sidrach-Cardona, R., Bécares, E. 2012. Comparison of interannual
removal variation of various constructed wetland types. Science of the Total
Environment 430, 174-183.
Hubálek, Z., Halouzka, J. 1991. Persistence of Clostridium botulinum type C toxin in
blow fly (Calliphoridae) larvae as a possible cause of avian botulism in spring.
Journal of Wildlife Diseases 27, 81–85.
IUCN. 2012. IUCN Red List of Threatened Species (ver. 2012.1). Available at:
http://www.iucnredlist.org. (Accessed: 12 March 2013).
León-Quinto, T., de la Vega, A., Lozano, A., Pastor, S. 2004. Summer mortality
of waterbirds in a Mediterranean wetland. Waterbirds 27, 46–53.
Lindberg, A., Skarin, H., Knutsson, R., Blomqvist, G., Båverud, V. 2010. Real-time
PCR for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering
Tesis doctoral – Ibone Anza Gómez
88
a chimeric C/D sequence-application on outbreaks of botulism in poultry.
Veterinary Microbiology 146, 118-123.
Marion, W.R., O’Meara, T.E., Riddle, G.D., Berkhoff, H.A. 1983. Prevalence of
Clostridium botulinum type C in substrates of phosphate-mine settling ponds and
implications for epizootics of avian botulism. Journal of Wildlife Diseases 19,
302–307.
Mitchell, W.R., Rosendal, S. 1987. Type C botulism: the agent, host susceptibility, and
predisposing factors. In Eklund, W., Dowell, V.R.Jr. (eds). Avian botulism: an
international perspective, Charles C. Thomas, Springfield, Illinois, USA. p 55-
71.
Murphy, T., Lawson, A., Nalewajko, C., Murkin, H., Ross, L., Oguma, K., McIntyre, T.
2000. Algal toxins – Initiators of avian botulism? Environmental Toxicol.ogy
15, 558-567.
Peck, M.W. 2009. Biology and genomic analysis of Clostridium botulinum. Advanced
Microbial Physiology 55, 183–265.
Pérez-Fuentetaja, A., Clapsadl, M.D., Getchell, R.G., Bowser, P.R., Lee, W.T. 2011.
Clostridium botulinum type E in Lake Erie: Inter-annual differences and role of
benthic invertebrates. Journal of the Great Lakes Research 37, 238-244.
Rocke, T., Converse, K., Meteyer, C., Mclean, R.G. 2005. The impact of disease in the
American white pelican in North America. Waterbirds 28 (Special Publication
1), 87-94.
Rocke, T.E. 2006. The global importance of avian botulism. In Boere, G.C., Galbraith,
C.A., Stroud, D.A. (eds). Waterbirds around the world, The Stationery Office,
Edinburgh, UK. p 422-426.
Capítulo 2
89
Rocke, T.E., Bollinger, T.K. 2007. Avian botulism. In Thomas, N.J., Hunter, D.B.,
Atkinson, C.T. (eds). Infectious diseases of wild birds, Wiley-Blackwell, Ames,
Iowa, USA, p 377-416.
Rocke, T.E., Friend, M. 1999. Avian botulism, In Friend, M., Franson, J.D. (eds). Field
manual of wildlife disease. General procedures and diseases of birds, USGS
National Wildlife Health Center, Washington, USA. p 271-281.
Rocke, T.E., Samuel, M.D. 1999. Water and sediment characteristics associated with
avian botulism outbreaks in wetlands. Journal of Wildlife Management 63,
1249-1260.
Sánchez-Hernández, L., Cifuentes, A., Jiménez, B., Mateo, R., González, R. 2008.
Detection of Clostridium botulinum neurotoxin coding genes: analysis of PCR
products by real time versus capillary gel electrophoresis methods. European
Food Research and Technology 227, 495–502.
Sandler, R.J., Rocke, T.E., Samuel, M.D., Yuill, T.M. 1993. Seasonal prevalence of
Clostridium botulinum type C in sediments of a northern California wetland.
Journal of Wildlife Diseases 29, 533–539.
Segner, W.P., Schmidt, C.F., Boltz, J.K. 1971. Enrichment, isolation, and cultural
characteristics of marine strains of Clostridium botulinum type C. Applied
Microbiology 22, 1017–1024.
Shayegani, M., Stone, W.B., Hannett, G.E. 1984. An outbreak of botulism in waterfowl
and fly larvae in New York State. Journal of Wildlife Diseases 20, 86–89.
Skarin, H., Lindberg, A., Blomqvist, G., Aspán, A., Båverud, V. 2010. Molecular
characterization and comparison of Clostridium botulinum type C avian strains.
Avian Pathology 39, 511-518.
Tesis doctoral – Ibone Anza Gómez
90
Smith, G.R., Oliphant, J.C., White, W.R. 1982. Clostridium botulinum type C in the
Mersey estuary. Journal of Hygiene 89, 507–511.
Soos, C., Wobeser, G. 2006. Identification of primary substrate in the initiation of avian
botulism outbreaks. Journal of Wildlife Management 70, 43-53.
Takeda, M., Tsukamoto, K., Kohda, T., Matsui, M., Mukamoto, M., Kozaki, S. 2005.
Characterization of the neurotoxin produced by isolates associated with avian
botulism. Avian Diseases 49, 376-381.
Torres-Esquivias, J.A. 2004. Malvasía cabeciblanca, Oxyura leucocephala. In Madroño,
A., González, C., Atienza, J.C. (eds). Libro Rojo de las Aves de España.
Dirección General para La Biodiversidad-SEO/BirdLife, Madrid, Spain.
Torres-Esquivias, J.A. 2008. La malvasía cabeciblanca. In Ballesteros, G., Cabrera, M.,
Echevarrías, J.L., Lorenzo, J.A., Raya, C., Torres-Esquivias, J.A., Viedma, C.
(eds). Tarro Canelo, cerceta pardilla, porrón pardo, malvasía cabeciblanca y
focha moruna en España. Población en 2007 y método de censo. SEO/BirdLife,
Madrid, Spain. p 54-69.
Vidal, D., Taggart, M.A., Badiola, I., Mateo, R. 2011. Real-time polymerase chain
reaction for the detection of toxigenic Clostridium botulinum type C1 in
waterbird and sediment samples: comparison with other PCR techniques.
Journal of Veterinary Diagnostic Investigation 23, 942–946.
Villalba, E.J., Haagsma, J., Díaz, E.J., Gasca, A. 1989. Niveles de contaminación por
Clostridium botulinum y sus toxinas en diferentes hidrohábitats del Parque
Nacional de Doñana. Medicina Veterinaria 6, 559-561.
Webb, M.D., Pin, C., Peck, M.W., Stringer, S.C. 2007. Historical and contemporary
NaCl concentrations affect the duration and distribution of lag times from
Capítulo 2
91
individual spores of nonproteolytic Clostridium botulinum. Applied and
Environmental Microbiology 73, 2118-2127.
Wobeser, G. 1988. Effects of botulism on ducks drinking saline water. Journal of
Wildlife Diseases 24, 240–245.
Wobeser, G. 1997. Avian botulism – Another perspective. Journal of Wildlife Diseases
33, 181–186.
Wobeser, G., Galmut, E.A. 1984. Internal temperature of decomposing duck carcasses
in relation to botulism. Journal of Wildlife Diseases 20, 267–271.
Wobeser, G., Marsden, S., MacFarlane, R.J. 1987. Occurrence of toxigenic Clostridium
botulinum type C in the soil of wetlands in Saskatchewan. Journal of Wildlife
Diseases 23, 67–76.
Wobeser, G., Rainnie, D.J., Smith-Windsor, T.B., Bogdan, G. 1983. Avian botulism
during late autumn and early spring in Saskatchewan. Journal of Wildlife
Diseases 19, 90–94.
Woo, G.H., Kim, H.Y., Bae, Y.C., Jean, Y.H., Yoon, S.S., Bak, E.J., Hwang, E.K., Joo,
Y.S. 2010. Outbreak of botulism (Clostridium botulinum type C) in wild
waterfowl: Seoul, Korea. Journal of Wildlife Diseases 46, 951–955.
Work, T.M., Klavitter, J.L., Reynolds, M.H., Blehert, D. 2010. Avian botulism: a case
study in translocated endangered Laysan ducks (Anas laysanensis) on Midway
Atoll. Journal of Wildlife Diseases 46, 499–506.
Woudstra, C., Skarin, H., Anniballi, F., Fenicia, L., Bano, L., Drigo, I., Koene, M.,
Bäyon-Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012.
Neurotoxin gene profiling of Clostridium botulinum types C and D native to
different countries within Europe. Applied and Environmental Microbiology 78,
3120-3127.
Tesis doctoral – Ibone Anza Gómez
92
Zechmeister, T.C., Kirschner, A.K., Fuchsberger, M., Gruber, S.G., Suess, B.,
Rosengarten, R., Pittner, F., Mach, R.L., Herzig, A., Farnleitner, A.H. 2005.
Prevalence of botulinum neurotoxin C1 and its corresponding gene in
environmental samples from low and high risk avian botulism areas. ALTEX 22,
185–195.
Zhu, X.Y., Zhong, T., Pandya, Y., Joerger, R.D. 2002. 16S rRNA-based analysis of
microbiota from the cecum of broiler chickens. Applied and Environmental
Microbiology 68, 124-137.
93
Supplemental material
Table S1. Official mortality rates of birds species due to avian botulism outbreaks in wetlands of Castilla-la Mancha between 1978 and 2008.
Family Bird species (cont) 1978 1998 1999 2002 2004 2005 2006 2008 Total
Podicipedidae Podiceps cristatus 7 7
Podiceps nigricollis 61 2 63
Tachybaptus ruficollis 22 3 1 26
Podiceps sp 3 3
Ardeidae Ardea cinerea 2 37 2 1 1 43
Ardea purpurea 18 1 19
Ardeola ralloides 3 3
Bubulcus ibis 8 39 1 48
Egretta alba 1 1
Egretta garzetta 14 271 1 1 287
Ixobrychus minutus 6 6
Nycticorax nycticorax 2 8 1 11
Ciconiidae Ciconia ciconia 1 3 1 4 4 9 22
Phoenicopteridae Phoenicopterus ruber 3 2 5
Anatidae Anas acuta 67 1 68
Anas clypeata 888 7 47 31 31 1,004
Anas crecca 637 37 13 107 41 835
Anas penelope 3 3
Anas platyrhynchos 933 168 8127 46 339 478 79 10,170
94
Family (cont) Bird species (cont) 1978 1998 1999 2002 2004 2005 2006 2008 Total (cont)
Anas querquedula 11 11
Anas strepera 34 1361 1 8 5 18 1,427
Aythya ferina 98 71 2 2 173
Aythya nyroca 1 1
Netta rufina 82 3 85
Oxyura leucocephala 1 5 2 8
Tadorna tadorna 1 1 2
Accipitridae Buteo buteo 1 1
Circus aeruginosus 4 1 5
Phasianidae Alectoris rufa 1 1
Rallidae Fulica atra 345 587 750 3 32 35 112 16 1,880
Gallinula chloropus 2 16 75 2 6 3 104
Rallus rallus 1 25 26
Recurvirostridae Himantopus himantopus 307 191 38 11 15 6 16 2 586
Recurvirostra avossetta 206 13 219
Charadridae Charadrius alexandrinus 66 66
Charadrius dubius 95 95
Charadrius hiaticula 40 1 41
Vanellus vanellus 376 7 6 1 1 2 393
Scolopaciae Actityis hypoleucos 7 1 8
Calidris alpina 51 51
Calidris canutus 6 6
Calidris ferruginea 163 163
95
Family (cont) Bird species (cont) 1978 1998 1999 2002 2004 2005 2006 2008 Total (cont)
Calidris minuta 296 296
Gallinago gallinago 75 2 1 6 84
Limosa limosa 75 75
Philomachus pugnax 275 19 2 296
Tringa glareola 2 2
Tringa nebularia 12 1 13
Tringa ochropus 4 1 2 7
Tringa totanus 115 115
Glareolidae Glareola pratincola 1 1
Laridae Larus michahellis 1 1
Larus ridibundus 316 343 117 15 4 2 797
Larus spp 65 65
Sternidae Chlidonias hybridus 19 18 37
Chlidonias niger 7 7
Gelochelidon nilotica 34 1 1 36
Sterna nilotica 60 60
Sterna albifrons 1 1
Sterna hirundo 3 3
Tytonidae Tyto alba 1 1
Laniidae Lanius senator 1 1
Passeriformes Calandrella brachydactila 4 4
Columbidae Columba libia 1 1
Total 5,763 1390 10,980 42 170 548 780 206 19,879
Tesis doctoral – Ibone Anza Gómez
96
Table S2. Samples analyzed in botulism positive birds by outbreak and wetland.
Year Site Bird
reference
Larvae Gastric
content
Intestine Caecum Cloacal
swab
2005 Jabalón BOT32 - - +
BOT33 - - +
BOT34 + +
BOT35 + +
BOT38 - +
BOT39 - +
BOT40 + -
2006 Alcázar A66/07 + +
A117/07 + - +
2007 Tablas A244/07 - - +
A235/07 - - +
A238/07 - +
A237/07 + -
2008 Alcázar A 136/08 + -
A144/08 - +
A145/08 + - +
A146/08 + - -
Cig 16 - + -
Focha 13 + - + +
Reidora 6 - - + +
Reidora 7 - + +
Reidora 8 + - + +
Navaseca A08 188 - - + +
A08 196 + - - -
A08 201 - + + +
A08 211 - - + +
A09 001 - + - -
A09 003 - + + +
A09 006 - + - -
97
CAPÍTULO 3
Eutrofización y bacterias patógenas como factores de riesgo de
botulismo aviar en humedales que reciben efluentes de
estaciones depuradoras de aguas residuales
Explosión de Lemna spp en la Laguna de Navaseca. Fotografía de Rafael Mateo
Anza, I., Vidal, D., Laguna, C., Díaz-Sánchez, S., Sánchez, S., Chicote, A., Florín, M.,
Mateo, R. 2014. Eutrophication and bacterial pathogens as risk factors for avian botulism
outbreaks in wetlands receiving effluents from urban wastewater treatment plants. Applied
and Environmental Microbiology 80, 4251-4259.
Tesis doctoral – Ibone Anza Gómez
98
Eutrofización y bacterias patógenas como factores de riesgo de botulismo aviar en
humedales que reciben efluentes de estaciones depuradoras de aguas residuales.
RESUMEN
Debido a la escasez de agua en la reserva de la biosfera de “La Mancha-Húmeda”, el uso de
aguas residuales ha sido propuesto como solución para la conservación de humedales
naturales amenazados. Además, las depuradoras de agua de muchos pueblos de la región
vierten sus efluentes en lagunas naturales cercanas. El botulismo aviar parece ser más
frecuente en esas lagunas por lo que hipotetizamos que los patógenos aviares presentes en
las aguas residuales pueden causar mortalidades de aves acuáticas que desencadenen los
brotes de botulismo. Para comprobarlo, muestreamos durante un año 24 puntos distribuidos
en tres humedales, dos que reciben aguas residuales y uno control que no las recibe
directamente. En cada punto recogimos sedimentos, agua, heces de aves e invertebrados y
los analizamos para Escherichia coli (APEC), Salmonella spp., Clostridium perfringens
tipo A y Clostridium botulinum tipo C/D. También determinamos varios parámetros
fisicoquímicos de sedimento y agua. En general, la presencia de APEC, C. perfringens y C.
botulinum fue significativamente mayor en muestras de los humedales que reciben aguas
residuales. El inicio de un brote en la laguna de Navaseca durante el periodo de estudio
coincidió con altas temperaturas en el agua y alta demanda biológica de oxígeno, un bajón
en el potencial redox del agua, en los niveles de clorofila a y de sulfato, y un incremento en
el carbono inorgánico. La mayor frecuencia de C. botulinum en las heces de aves recogidas
en Navaseca en el momento previo al brote indica que existen aves portadoras del bacilo y
Capítulo 3
99
resalta la importancia de que se produzca un brote si estas mueren (por cualquier causa
como por ejemplo enfermedades bacterianas) y C. botulinum comience a producir toxina en
sus cadáveres.
Tesis doctoral – Ibone Anza Gómez
100
Eutrophication and bacterial pathogens as risk factors for avian botulism outbreaks
in wetlands receiving effluents from urban wastewater treatment plants
ABSTRACT
Due to the scarcity of water resources in the “Mancha Húmeda” Biosphere Reserve, the use
of treated wastewater has been proposed as a solution for the conservation of natural
threatened floodplain wetlands. In addition, wastewater treatment plants of many villages
pour their effluent into nearby natural lakes. We hypothesized that certain avian pathogens
present in wastewater may cause avian mortalities which would trigger avian botulism
outbreaks. With the aim of testing our hypothesis, 24 locations distributed in three
wetlands, two that receive wastewater effluents and one serving as a control, were
monitored during a year. Sediment, water, waterbird faeces, and invertebrates were
collected for the detection of putative avian pathogenic Escherichia coli (APEC),
Salmonella spp., Clostridium perfringens type A and Clostridium botulinum type C/D.
Also, water and sediment physicochemical properties were determined. Overall, APEC, C.
perfringens and C. botulinum were significantly more prevalent in samples belonging to the
wetlands which receive wastewater. The occurrence of a botulism outbreak in one of the
studied wetlands coincided with high water temperatures and sediment 5-day biochemical
oxygen demand (BOD5), a decrease in water redox potential, chlorophyll a, and sulfate
levels, and an increase in water inorganic carbon levels. The presence of C. botulinum in
bird faeces before the onset of the outbreak indicates that carrier birds exist and highlights
Capítulo 3
101
the risk of botulinum toxin production in their carcasses if they die by other causes such as
bacterial diseases, which are more probable in wastewater wetlands.
Tesis doctoral – Ibone Anza Gómez
102
1. Introduction
Water management is an essential aspect for the sustainable development of semi-
arid Mediterranean regions like “La Mancha Húmeda” Biosphere Reserve in the Central
Spanish Plateau where recent drought periods have stressed the balance between crop
irrigation and the conservation of wetlands (Martínez-Santos et al., 2008) such as Las
Tablas de Daimiel National Park, the most representative Spanish floodplain ecosystem
(Álvarez-Cobelas et al., 2001; Fornés et al., 2000). In this situation of growing water
scarcity, the use of treated wastewater has been proposed for the maintenance of Tablas de
Daimiel National Park and to conserve its biodiversity (Navarro et al., 2011). Within this
region, many wastewater treatment plants already spill their effluents into natural lakes due
to the absence of rivers near villages and also to maintain waterbird populations. On the one
hand, these wastewater lakes provide permanent resting and breeding areas for many
species of waterbirds, including endangered species as the white-headed duck (Oxyura
leucocephala), but on the other hand, pouring wastewaters has modified the ecology of the
lakes in many ways, decreasing salinity, increasing eutrophication, and attenuating their
natural hydrological cycles of drought-flooding periods (Florín and Montes, 1999).
Moreover, this practice constitutes a health risks for birds because improperly treated
effluents are an important source of pollutants and microorganisms, including avian
bacterial pathogens (Benskin et al., 2009; Okafor, 2011). A recent study revealed the role
of invertebrates living on sewage filter beds as vectors of environmental pollutants that can
affect immune function, neural development, and behavior in male starlings (Sturnus
vulgaris) (Markman et al., 2008). Previous research linked the deaths of brown pelicans
Capítulo 3
103
(Pelecanus occidentalis) with the presence of pathogenic clostridia on raw sewage
discharges (Ankerberg, 1984). Later on, enterocolitic bacteria, mainly Salmonella, were
isolated from up to 58% of sick or dead waterbirds collected during the summer in a
Mediterranean wetland (León-Quinto et al., 2004). Strikingly, avian botulism outbreaks in
“La Mancha Húmeda” frequently occur in lakes supplied with effluents from wastewater
treatment plants (Vidal et al., 2013).
Avian botulism is an intoxication produced by botulinum neurotoxins (BoNTs)
which results in a flaccid paralysis of the muscles and the death of the affected birds.
BoNTs are exotoxins produced by Clostridium botulinum, a strictly anaerobe spore-
forming bacteria which is present in the sediments of wetlands and in the digestive tracts of
waterbirds and fishes (Nol et al., 2004; Rocke, 2006). There are seven confirmed types of
BoNTs (A-G); the most frequent in Europe is the mosaic type C/D (Woudstra et al., 2012;
Anza et al., 2014). High water temperatures and increases in the invertebrate biomass,
which frequently occur in wastewater ponds, may attract waterbirds for feeding and provide
optimal conditions for the occurrence of botulism outbreaks, although there is still not
enough evidence to support this hypothesis (Murray and Hamilton, 2010). Other factors
such as pH between 7.5 and 9, low redox potential (Eh), decreasing turbidity, and low
salinity also contribute to botulism risk in wetlands (Rocke and Samuel, 1999; Murray and
Hamilton, 2010; Vidal et al., 2013). Avian mortalities due to any cause have the potential
to be a major initiating factor of botulism outbreaks because they provide carcasses for the
initial multiplication and toxinogenesis of C. botulinum (Soos and Wobeser, 2006). In this
framework, urban wastewater that enters the wetlands has to be considered a potential
Tesis doctoral – Ibone Anza Gómez
104
source of avian pathogenic bacteria that may cause mortalities on a few waterbirds, with the
risk of initiating a botulism outbreak affecting larger numbers of individuals.
With this study, we aim (1) to evaluate the risk for waterbirds derived from the
presence of pathogenic bacteria in wetlands that receive wastewater and (2) to study
possible changes on the ecological characteristics of the wetlands produced by wastewater
and how these changes may favour the presence of C. botulinum type C/D and the
outbreaks.
2. Material and methods
2.1 Study area.
The study area included wetlands located in “La Mancha Húmeda” Biosphere
Reserve, a region situated in south-central Spain that covers a total surface of 25,000 ha
(Fig. 1). The climate in this area (≈600 m above sea level) is cold-temperate continental,
with a pronounced dry season and average annual rainfall between 400 to 500 mm. Within
this region, we monitored three wetlands affected to different degrees by the effluent from
urban wastewater treatment plants as follows (in the order of least to most affected): Tablas
de Daimiel National Park (TDNP), Veguilla lake, and Navaseca lake. TDNP is a floodplain
located in the junction of Cigüela and Guadiana rivers with a maximum flooded surface of
1.675 ha (Álvarez-Cobelas and Cirujano, 1996). This wetland occasionally receives the
input of poorly treated wastewater from towns located upstream. Navaseca lake (24.3 ha) is
located in the vicinity of TDNP (at a distance about 6.5 km). This lake was seasonal in the
past, but now it is permanently flooded and highly eutrophic because it receives the
Capítulo 3
105
effluents of the wastewater treatment plant of Daimiel town. Veguilla lake (128 ha) is a
semi-artificial saline and seasonal wetland included in the complex of Alcázar de San Juan
Natural Reserve (695 ha). It receives discontinuous inputs from the wastewater treatment
plant of Alcázar de San Juan town with the purpose of maintaining waterbirds breeding
populations. The effluent is alternatively discharged into a floodplain at the junction of
Záncara and Cigüela rivers, especially in summer, when the lake is naturally desiccated to
avoid avian botulism outbreaks. There is a landfill near Veguilla where some bird species
that inhabit the lagoon [i.e, gulls [Larus sp.] and white storks [Ciconia ciconia]) usually
feed. Botulism is endemic in this region, and in the last 20 years, outbreaks have occurred
in the three studied wetlands being more frequent in Veguilla and Navaseca lakes (Vidal et
al., 2013).
Spain
Fig. 1. Location of the three studied wetlands, wastewater treatment plants and the nearby towns.
Tesis doctoral – Ibone Anza Gómez
106
2.2 Field sampling and data collection.
Each wetland was sampled on seven occasions from April 2010 to February 2011.
In each visit, samples of surface and interstitial water, sediment, aquatic invertebrates,
carrion flies and waterbird faeces were collected. Samplings were performed once per
season in spring (April), autumn (November), and winter (February), and monthly during
summer (June-September), when botulism outbreaks are more likely. An additional
sampling visit to Navaseca lake was performed during the onset of a botulism outbreak
(Fig. 2).
Fig. 2. Diagram of the data collection and analysis
Capítulo 3
107
Water and sediment samples were collected in 12 sampling stations in TDNP, 6 in
Navaseca and 6 in Veguilla. Sampling stations were broadly distributed within each
wetland shore to obtain a wide coverage. Sediment samples were collected from the upper
5 cm at 3 random positions with a metal core sampler 7 cm in diameter, and pooled
subsamples were kept in plastic bags with zip closure. Interstitial water was collected in
three 15-ml vacuum tubes, each one with Rhizom soil moisture samplers (Eijkelkamp
Agriserch Equipment). Approximately 1,500 ml of surface water were collected per site,
and 300 ml of it was filtered in the field with Whatman GF/C filters (GE Healthcare Ltd.)
in order to preserve its stability against biogeochemical changes until processing in the
laboratory. Filtered material was weighed to calculate the seston (total and volatile solids),
and filtered water was used for the analysis of nutrients (NO2-, NO3
-, NH4
+, PO4
3-), total
organic carbon (TOC), and major ions (SO42, Cl
-, Ca
2+, Na
+, K
+, Mg
2+), while gross surface
water was used for 5-day biochemical oxygen demand (BOD5) and alkalinity
determinations. Besides, three replicate measurements of temperature, redox potential (Eh),
pH, dissolved oxygen, chlorophyll a, turbidity and conductivity of surface water were taken
in situ with a Hydrolab®
DS5X multiprobe (Hach Hydromet). Water depth was measured
with a stiff meter (Fig. 2). Water and sediment samples were maintained in dark conditions
at 4 °C until processing in the laboratory so as to avoid alterations. During the summer,
water samples could not be collected from some stations within TDNP and Veguilla
because they were dry.
Aquatic invertebrates and carrion flies were collected in the same sampling stations.
Aquatic invertebrates were captured from the water with a sieve of 0.5-mm-pore-size mesh
and kept alive in sterile plastic containers. Carrion flies were captured using homemade
Tesis doctoral – Ibone Anza Gómez
108
cone traps that were hung on the shore vegetation of the wetlands for 24 h. After that time,
the traps were closed, taken to the laboratory and frozen to kill the trapped flies. Aquatic
invertebrates and flies were identified and pooled according, at least, to the taxonomic
family. Samples of aquatic invertebrates included specimens of non-biting midge larvae
(Chironomidae), water boatmans (Corixidae), back swimmers (Notonectidae), crustaceans
(Ostracoda, Copepoda and Cladocera), bladder snails (Physidae) and beetle larvae
(Coleoptera). Samples of flies included specimens of the families Calliphoridae,
Sarcophagidae, Ephydridae, Anthomyiidae, Muscidae and Ulidiidae.
Fresh waterbird faeces (n=30) were collected on each wetland per sampling visit.
Before samples were taken, the distribution of waterbirds on the shore of the wetlands was
observed in order to assign the faeces collected in each site a taxonomic group. The
samples were collected under aseptic conditions using sterile swabs and plastic bags.
Additionally, gull faeces were also collected in a landfill beside Veguilla on May 2010
(Fig. 2). The sampled families included Anatidae (ducks and geese), Rallidae (rails),
Scolopacidae (waders), Laridae (gulls), Ciconiidae (storks), Phoenicopteridae (flamingos)
and Ardeidae (herons).
2.3 Chemical analysis of water and sediment samples.
Sediment samples were analyzed for water and organic matter content (loss on
ignition, LOI), pH, and conductivity following standardized procedures (de Caluwe and van
Logtestijn, 1998). BOD5 was measured with an OxiTop system (WTW). Surface water
samples were analyzed for total and volatile solids, BOD5, total alkalinity, NO2-, NH4
+,
Capítulo 3
109
PO43-
, SO42-
, Cl-, Ca
2+, Na
+, K
+ and Mg
2+ following colorimetric methods and NO3
- with
an ion-selective electrode (Metrohm), and inorganic, organic and total carbon levels were
measured with a total organic carbon analyzer (TOC-VCSN, Shimadzu) (Golterman and de
Graaf, 1992; APHA, 1998). The same parameters were determined in interstitial water
samples, except total and volatile solids, alkalinity and BOD5 (Fig. 2).
2.4 Microbiological analysis.
Microbiological analysis included three avian bacterial pathogens associated with
wastewater and C botulinum type C/D. The avian bacterial pathogens were avian
pathogenic Escherichia coli (APEC), Salmonella spp. and C. perfringens type A (Benskin
et al., 2009; Murray and Hamilton, 2010). For APEC detection in sediment and faeces,
samples were streaked directly onto McConkey agar plates (Scharlau) and incubated at 37
°C for 24 h. For surface water, 100-ml samples were filtered through a 0.45-µm-pore-size
filter (Millipore) using a filter holder manifold and glass filter holders (Nahita; Auxilab),
and then the filter was placed into 9 ml of buffered peptone water (BPW) broth (Scharlau)
and incubated at 37 °C for 24 h; afterwards, 1 ml was streaked onto McConkey agar plates.
Isolation and identification of APEC were performed by multiplex PCR following a
method previously described (Johnson et al., 2008; Díaz-Sánchez et al., 2013). Briefly, an
initial gross screening of APEC was done in the growth from the first streaking area of the
culture plate so as to discard negative samples. The presence of APEC was tested by
multiplex PCR for the following five virulence genes highly conserved among APEC
isolates: the aerobactin siderophore receptor gene (iutA), the episomal increased serum
Tesis doctoral – Ibone Anza Gómez
110
survival gene (iss), the episomal outer membrane protease gene (ompT), the putative avian
haemolysin gene (hlyF), and the salmochelin siderophore receptor gene (iroN). In
accordance with Johnson et al. (2008), E. coli isolates can be considered APEC when they
contain at least 4 of these 5 genes. DNA was extracted by boiling 10 µl of the first streaking
area into 200 µl sterilized ultrapure water for 5 min, the solution was centrifuged at 12,000
× g 5 min, and the supernatant was used as PCR template. Afterwards for each PCR-
positive culture, 10 individual E. coli-like colonies obtained from the MacConkey agar
plates were tested again for the presence of the 5 virulence genes and were considered
putative APEC when harbouring at least four. The resulting putative APEC isolates were
confirmed biochemically as E. coli by the API 20E system (bioMérieux) (Fig. 2).
Detection of Salmonella spp. was done according to international official
standardized procedures (ISO, 2002). Briefly, samples of sediment and faeces were pre-
enriched in 9 ml of Rappaport-Vassidialis (RV) broth (Oxoid) and incubated aerobically for
48 h at 42 °C. Surface water was analyzed using the same filtered water used for APEC,
and 1 ml of the BPW broth was passed to 9 ml RV broth. At 24 and 48 h, 1 ml of the
culture in RV broth was streaked onto a XLT4 agar (Biokar diagnostics) plates and
incubated 24 h at 37 °C. The resulting suspected isolates were confirmed biochemically to
be Salmonella spp. by the use of a API 20E system (bioMérieux) (Fig. 2).
For the detection of Clostridium perfringens type A (containing the cpa -α-toxin
gene), sediment and faeces samples were directly streaked onto tryptose sulphite
cycloserine agar (TSCA) (Scharlau). For surface water, 100-ml samples were filtered
through a 0.45-µm-pore-size filter (Millipore) which was placed directly onto TSCA plates.
All the samples were then incubated anaerobically in an anaerobe container system (BD
Capítulo 3
111
GasPakTM 129 EZ) at 37 °C for 48 h. Suspected individual black colonies were streaked
onto a new TSCA plate and incubated as described before. Then, six toxin genes (cpa -α-
toxin-, cpb -β-toxin-, cpb2 -β2-toxin-, etx -e-toxin-, iap -ι-toxin- and cpe -enterotoxin) were
detected using the PCR assay described by van Asten et al. (2009) and colonies containing
the α-toxin gene were classified as C. perfringens type A. Only the samples collected
during the first three sampling visits were tested for C. perfringens.
Sediments, surface water (as processed for APEC), aquatic invertebrates, fly pools,
and bird faeces were processed for detection of C. botulinum type C/D as previously
described by Vidal et al (2011). Briefly, samples were cultured in 9 ml of commercial
cooked meat broth supplemented with vitamin K1, glucose and hemin (BD BBL Cooked
meat medium with glucose, hemin and vitamin K) using an anaerobe container system (BD
GasPakTM 129 EZ) over a period of 3 to 5 days at 40 °C. DNA was extracted by boiling
the pellet obtained from 1 ml of the culture broth in 300 µl of distilled water. The solution
obtained after centrifugation 12,000 × g 5 min was used as PCR template. Real-time PCR
was performed according to Sánchez-Hernández et al. (2008) (Fig. 2). This PCR assay
amplifies genes encoding both type C and type C/D mosaic toxins, but as we have
confirmed the presence in the study area of the mosaic type C/D whereas we have not
detected type C (Vidal et al., 2013; Anza et al., 2014), we assumed that type C/D is the
causative agent. Furthermore, the mosaic type prevails in avian botulism outbreaks in
Europe (Woudstra et al., 2012) and the botulism outbreak that occurred in Navaseca was
confirmed as type C/D by the mouse bioassay.
Tesis doctoral – Ibone Anza Gómez
112
2.5 Statistical analysis.
Mean values of physicochemical parameters from sediments and water were
compared among wetlands with one-way analyses of variance (ANOVA) tests. Post-hoc
differences were studied with the least significant differences (LSD) test. The frequency of
detection of the four pathogens in sediment, water, aquatic invertebrates, fly pools, and bird
faeces from the three wetlands were compared by the chi-square tests or Fisher’s exact
probability tests. Associations between the presence of APEC, C. perfringens and C.
botulinum and the physicochemical characteristics of water and sediments were studied
using generalized linear models (GLM) with a binary logistic distribution. The number of
samples positive to Salmonella spp. in sediments and water was too low to be included in
this analysis. The absence or presence of the bacteria (negative or positive) was used as the
dependent variable, while the physicochemical characteristics of sediments and water as
predictors and zone (wetland) and season as fixed factors. Physicochemical characteristics
that had less than 150 observations for models of C. botulinum and APEC and less than 70
for C. perfringens were not included in the GLM models so as to guarantee a minimum
sample size. Non-normally distributed variables were transformed to logarithms (log10)
values to fulfill the normality requirements of parametric tests. The distribution of the four
pathogens (including Salmonella spp.) in bird faeces was also studied with GLM using
“wetland”, “season” and “bird family” as fixed variables and the presence of each pathogen
as dependant variable. Corrected Akaike’s Information Criteria (AICc) was used to
compare alternative models (Burnham and Anderson, 2002). To select the best model, all
possible combinations of fixed effects were compared using the “dredge” function (Barton,
2011), and models with differences of less than 2 AICc points from the best value (ΔAICc
Capítulo 3
113
= 0) were considered to have the same empirical support (Burnham and Anderson, 2002).
The level of significance of the tests was established at p<0.05. The analyses were
conducted with IBM SPSS Statistics 19 program and R 2.12.2 (R Core Team 2010; used
only for AICc).
3. Results
3.1 Physicochemical parameters of water and sediment.
Most of the physicochemical parameters measured in surface water significantly
differed among wetlands (Table 1). Navaseca and Veguilla showed signs of eutrophication
and degradation due to the input of treated wastewaters as indicated by a higher turbidity,
total and volatile solids, BOD5, total carbon, and NH4+ and PO4
3- concentrations. In
addition, Navaseca showed higher levels of chlorophyll a and dissolved oxygen and lower
water Eh. Veguilla revealed the highest values of conductivity, Cl-, SO4
2-, K
+, Na
+ and
Mg2+
, due to the natural salinity present in this area. Analogous trends were observed for
the parameters measured in interstitial water and sediment (Table 2). In addition, NO3-
concentration in interstitial water was higher in the lakes receiving treated wastewater.
3.2 Prevalence of avian pathogenic bacteria and C. botulinum type C/D.
The prevalence of APEC, C. perfringens type A and C. botulinum type C/D
observed in most environmental samples were considerably higher in Navaseca and
Veguilla than in TDNP (Table 3). APEC was mainly present in waterbird faeces (16.9 to
35.6%); C. perfringens was widely distributed in water (16.7 to 62.5%), sediment (11.1 to
Tesis doctoral – Ibone Anza Gómez
114
83.3%), and waterbird faeces (59.9 to 90.4%); C. botulinum mainly appeared in sediment
samples (2.4 to 20.8%) and Salmonella spp. in a small number of faeces collected in
Veguilla (3.6%).
In the gull faeces collected from the landfill close to Veguilla, we detected the
highest prevalences of Salmonella (30%) and APEC (37%) and the lowest of C.
perfringens type A (30%), while C. botulinum type C/D was absent. The observed
prevalence of C. perfringens and APEC in waterbird faeces from the three wetlands
significantly differed among birds taxa. The highest prevalence of C. perfringens was
detected in faeces of Laridae (80.5%), Anatidae (70.5%) and Rallidae (70%) and the
highest prevalence of APEC in faeces of Ciconidae (61.9%). Finally, though differences
were not significant, Salmonella spp. appeared more frequently in faeces of Laridae (3.5%)
and Ciconiidae (9.5%) and C. botulinum in faeces of Rallidae (2.9%; Table 4).
Capítulo 3
115
Table 1. Physicochemical parameters of surface water from three wetlands differing in affection by
wastewater (Navaseca the most and TDNP the least). The values are based on data collected during 8
visits throughout one year.
Wetland
Navaseca Veguilla TDNP
Parameters N Meana SD N Mean
a SD N Mean
a SD P
Maximum depth
(cm) 12 29.5
A 3.53 18 25.2
B 3.29 29 41.0
A 3.92 0.01
Tº (ºC) 48 21.8A 8.14 38 17.6
B 7.41 78 19.1
AB 7.37 0.03
Conductivity
(µS/cm) 48 3662
B 917 38 9876
A 14470 78 2447
B 833 <0.01
pH 45 8.29A 0.39 36 8.23
A 0.56 78 7.84
B 0.82 <0.01
Redox potential
(Eh) (mV) 48 281
96.22 38 327
98 78 309 117 0.13
Chlorophyll a
(µg/L) b
48 128A 111 37 27.3
B 46.1 76 19.8
B 44.4 <0.01
Turbidity (NTU) b 42 108
A 157 32 83.2
A 102 67 56.1
B 104 <0.01
Oxygen saturation
(%) 48 158
A 109 38 120
B 80.9 77 95.7
B 61.7 <0.01
Volatile solids
(mg/L) 24 46.5
A 33.5 24 51.1
A 92.5 39 7.12
B 6.72 <0.01
Total solids (mg/L) b
24 58.1A 41 24 137
A 271 39 13.3
B 12.2 <0.01
BOD5 (mg/L) 18 35.2A 16.9 12 44.9
A 37.1 22 6.45
B 9.91 <0.01
Inorganic carbon
(mg/L) 21 109
A 45.6 25 103
A 52 39 46.9
B 18.1 <0.01
Total organic carbon
(mg/L) 21 20.9 29.2 25 27.7 37.3 39 15.5 13.8 0.21
Total carbon (mg/L) 21 124A 26.4 25 129
A 41 39 61.3
B 17.1 <0.01
Carbonate alkalinity
(meq/L) 13 0.82
B 0.14 13 1.23
A 0.61 11 0.35
C 0.17 <0.01
Total alkalinity
(meq/L) 24 9.12
A 1.11 25 8.71
A 3.25 39 3.72
B 0.91 <0.01
N-NH4+(mg/L)
b 24 2.95
A 3.08 25 36.6
A 90.3 39 0.43
B 1.68 <0.01
N-NO2- (mg/L)
b 24 0.02
0.02 25 0.07
0.11 39 0.04 0.08 0.64
N-NO3- (mg/L)
b 21 4.91
A 4.6 21 5.65
A 7.76 34 3.03
B 3.55 <0.01
P-PO43-
(mg/L) b 24 1.64
A 0.95 25 0.60
B 0.74 39 0.03
C 0.11 <0.01
SO42-
(meq/L) b 24 9.28
C 5.83 23 69.3
A 80.9 39 22.7
B 8.31 <0.01
Cl- (meq/L) 24 17.3
B 8.68 25 38.1
A 62.7 37 3.35
B 2.33 <0.01
Ca2+
(meq/L) 9 9.94B 2.38 12 11.2
B 3.39 18 14.7
A 3.72 <0.01
Na+ (meq/L) 9 12.8
AB 8.56 12 23.9
A 36.0 18 2.16
B 0.69 0.02
Mg2+
(meq/L) 9 9.51B 4.86 12 102
A 153 18 13.8
B 7.46 0.02
K+ (meq/L) 9 0.42
B 0.19 12 2.09
A 1.50 18 0.07
B 0.04 <0.01
a Means sharing a superscript capital letter were not significantly different between wetlands.
b Factors transformed into logarithm for the ANOVA analysis.
Tesis doctoral – Ibone Anza Gómez
116
Table 2. Physicochemical parameters of interstitial water and sediment from three wetlands differing
in affection by wastewater (Navaseca the most and TDNP the least). The values are based on data
collected during 8 visits throughout one year.
Wetland
Navaseca Veguilla TDNP
Parameters N Meana SD N Mean
a SD N Mean
a SD P
Inorganic carbon (mg/L) 48 103B
59 38 134A
101 79 83.7B
56.5 0.02
Total organic carbon (mg/L) 48 77.9
78.2 38 72.2
49.2 79 72.4
49.8 0.86
Total carbon (mg/L) 48 181AB
94.7 38 204A 93.6 79 155
B 84.9 0.02
N-NH4+
(mg/L)b 48 7.71
A 10.5 37 6.64
AB 10.5 79 3.33
B 6.91 <0.01
N-NO2- (mg/L)
+ 48 0.02
0.02 38 0.03
0.05 78 0.02
0.02 0.94
N-NO3- (mg/L) 36 8.11
A 4.46 28 9.97
A 8.39 56 4.42
B 4.74 <0.01
P-PO43-
(mg/L) +
48 2.92A
3.08 38 2.59A
2.79 79 0.42B
0.58 <0.01
SO42-
(meq/L) 48 8.35C
4.39 36 80A
82.7 79 28.4B
14.2 <0.01
Cl- (meq/L)
+ 41 22.8
A 5.69 35 35.0
A 35.2 78 7.31
B 10.3 <0.01
Ca2+
(meq/L) 18 9.59C
2.12 18 17.23B
7.46 36 22.2A
9.22 <0.01
Na+ (meq/L) 18 21.6
B 6.73 18 40.2
A 35.9 36 4.43
C 6.58 <0.01
Mg2+
(meq/L) 18 13.0B
7.46 18 120A
166 36 25.5B
27.5 <0.01
K+ (meq/L) 18 0.46
B 0.20 18 2.45
A 1.72 36 0.14
B 0.16 <0.01
pH c 48 8.22
A 0.42 44 8.25
A 0.32 84 7.89
B 0.27 <0.01
Conductivity (µS/cm) bc
42 558B
323 38 2233A
2764 72 909B
818 <0.01
BOD5 (mg/g)c 33 14.4
A 10 28 11.5
AB 8.83 56 8.39
B 3.91 <0.01
Water content (%)c 47 31.1
A 37.9 44 15.2
B 12.1 83 15.9
B 9.61 <0.01
LOI (%)c 46 1.42
B 0.9 44 1.79
A 1.13 83 1.87
A 0.74 0.02
aMeans sharing a superscript capital letter were not significantly different between wetlands.
bFactors that have been transformed into logarithm for the ANOVA analysis.
cParameters of the sediment.
117
TABLE 3 Presence of three avian pathogens and C. botulinum type C/D in environmental samples taken from three wetlands differing in affection
by wastewater (Navaseca is the most and TDNP the least affected). An avian botulism outbreak occurred in Navaseca during the study period.
Avian pathogens
Wetland
Navaseca Veguilla TDNP
N + % N + % N + %
C. botulinum type C/D
Sediment 48 10 20.8* 42 8 19.0
* 84 2 2.4
Water 47 3 6.4* 38 0 0 79 0 0
Faeces 215 8 3.7* 192 1 0.5 248 0 0
Aquatic invertebratesa 26 2 7.7 26 0 0 51 0 0
Fliesa 42 2 4.5 20 0 0 72 0 0
C. perfringens type A
Sediment 18 14 77.8* 18 15 83.3
* 4 36 11.1
Water 17 8 47.0* 16 10 62.5
* 6 36 16.7
Faeces 83 75 90.4*†
76 47 61.8 110 56 59.9
E.coli (APEC)
Sediment 48 5 10.4* 42 2 4.76 84 1 3.8
Water 47 6 12.8 38 1 2.63 79 3 1.2
Faeces 205 73 35.6* 192 59 30.7
* 248 42 16.9
Salmonella spp.
Sediment 48 0 0 42 0 0 84 1 1.2
Water 47 1 2.1 38 0 0 79 0 0
Faeces 205 2 0.9 192 7 3.6* 248 1 0.4
aAquatic invertebrates and flies were grouped in pools
*Prevalence significantly higher than in TDNP (p<0.05)
†Prevalence significantly higher than in Veguilla (p<0.05)
Tesis doctoral – Ibone Anza Gómez
118
Table 4. Prevalence of three avian pathogens and C. botulinum type C/D in faeces of different bird
families collected in three wetlands year round.
Avian family
E. coli (APEC) C. perfringens
type A
Salmonella
spp
C. botulinum
type C/D
N + %a N + %
a N + % N + %
Anatidae 231
81 35B
104 73 70.2A
231 3 1.3 231 2 0.9
Rallidae 192 39 20.3C
50 35 70A
192 1 0.5 202 6 2.9
Laridae 57 10 17.5C
41 33 80.5A 57 2 3.5 57 0 0
Scolopacidae 101 18 17.8C
50 22 44B
101 1 1 101 0 0
Ciconiidae 21 13 61.9A
5 1 20B
21 2 9.5 21 0 0
Phoenicopteridae 10 2 20C
0 0 0 10 0 0 10 0 0
Ardeidae 18 6 33.3ABC
4 3 75AB
18 0 0 18 0 0
a Percentages sharing a superscript capital letter were not significantly different between bird families
3.3 Parameters associated with bacteria occurrence.
Regression models with ΔAICc<2 revealed an association between several
environmental factors and the presence of the studied bacteria in the wetlands (Table 5).
Taking into account just the significative values (p<0.05), APEC was less present in faeces
from TDNP. Moreover, the presence of APEC in faeces was higher from spring to autumn,
and it was more frequent in Ciconiidae faeces than in other bird families. The observed
prevalence of Salmonella spp. was also lower in bird faeces from TDNP. Furthermore, C.
perfringens was less frequent in water samples from TDNP, while in sediment samples it
was positively associated with SO42-
levels. In faeces, C. perfringens prevalence was lower
during the summer than in spring and it was more present in Navaseca than in TDNP. In
sediment samples C. botulinum was less frequent in TDNP. Also, it was positively
associated with chlorophyll a levels and negatively correlated with conductivity of surface
water (Table 5).
Capítulo 3
119
3.4 Physicochemical parameters associated with the botulism outbreak in Navaseca.
Before the onset of the outbreak, we observed a period of maintained high water
temperatures (28.5 ± 0.3 °C), associated with high levels of chlorophyll a concentrations
and high sediment BOD5. At the same time, we observed abrupt changes affecting several
environmental parameters that may have triggered the outbreak (Fig. 2). One of the first
changes observed was a decrease in water Eh, followed by the increase in concentration of
inorganic carbon in interstitial water. Then, the chlorophyll a concentration decreased
sharply along with the sulfate concentration in interstitial water and sediment BOD5 (Fig.
2). Coinciding with these changes, C. botulinum type C/D was first detected in sediments
and its occurrence in bird faeces experienced a peak; later, during the botulism outbreak, it
was also detected in surface water samples and Calliphoridae flies and, after the peak of the
outbreak, in aquatic snails, coleopteran larvae and Ephydridae flies (Fig. 3).
120
Table 5. Regression models of the presence of the four avian pathogens in different samples based on AICc. Models with differences of less than 2 AICc points
from the best (ΔAICc = 0) were considered to have the same empirical support.
Avian pathogen Sample Model
C. botulinum type C/D Sediment Zone [TDNP (-3.43)] + season + water conductivity (-0.001) + chlorophyll a (+1.13) + PO4
3- (-1.02)
Faeces Zone + season
C. perfringens type A
Sediment Zone + inorganic carbon (-0.03) + organic carbon (+0.04) + LOI (-2.70) + pH(+9.56 )+ SO42-
(+0.21) + NH4+ (+2.58) + PO4
3-
(-1.58)
Water Zone [TDNP (-3.01)]+ season + conductivity (-5*10-3
) + temperature (+0.19) + chlorophyll a (-1.13) + turbidity (+1.34) + pH
(+0.90)
Faeces Zone [Navaseca (+1.48) + TDNP (-0.96)] + season [summer (-1.26)]
E.coli (APEC)
Sediment Zone + inorganic carbon (-0.02) + organic carbon (+0.001) + LOI (-1.3)
Water Zone [TDNP (-1.94)] + temperature (-0.18) + chlorophyll a (-0.81)
Faeces Zone [TDNP (-1.28)] + season [autumn (+1.37) + spring (+1.16) + summer (+0.82)] + bird family[Ciconiidae (+0.93) + Laridae
(-1.07) + Scolopacidae (-0.79) + Rallidae (-0.69)]
Salmonella spp. Faeces Zone [TDNP (-2.23)]
In bold are factors and variables that have a significative effect (p<0. 05) and in ( ) are the average estimates of the effects.
Full model for C. botulinum type C/D and APEC in sediment: zone + season + water temperature +water conductivity + water redox + log water chlorophyll a + log interstitial water PO43-+
interstitial water SO42-+ interstitial inorganic carbon +interstitial organic carbon + sediment pH+ sediment LOI. Reference zone is Navaseca.
Full model for APEC in water: zone + season + water temperature + water conductivity +water redox + log water chlorophyll a + water dissolved oxygen. Reference zone is Navaseca.
Full model for C.perfringens in sediment: zone +season+ log interstitial water NH4++log interstitial water PO4
3- + interstitial water Cl-+ interstitial water SO42- + interstitial water Mg2+ + interstitial
inorganic carbon +interstitial organic carbon + sediment pH+ sediment LOI.
Full model C. perfringens in water: zone + season+ water temperature + water conductivity +water redox + water pH + log water chlorophyll α +log water turbidity. Reference zone is Navaseca and
reference season spring.
Full model for faeces: zone (wetland) + season + bird type. Reference zone is Veguilla, reference season is winter and reference bird type is anatidae.
Capítulo 3
121
Fig. 2. Changes in environmental parameters in Navaseca lake that could have favored the avian
botulism outbreak in summer 2010. The arrows indicate the beginning and the ending of the
botulism outbreak, presented as mean +/- standard error of data from 6 sampling points.
Tesis doctoral – Ibone Anza Gómez
122
Fig. 3. Presence of C. botulinum type C/D in different environmental samples collected in
Navaseca lake during 8 sampling visits. The arrows indicate the beginning and the ending of the
botulism outbreak.
4. Discussion
The spill of treated wastewater has produced changes in the studied wetlands
that can facilitate the onset of avian botulism outbreaks. These changes included
eutrophication (i.e. Navaseca and Veguilla) due to the regular input of nutrients which
led to the development of anaerobic environments that favoured the presence of C.
botulinum type C/D. Moreover, the wetlands receiving treated wastewater showed
higher prevalences of avian pathogenic bacteria (i.e., APEC and C. perfringens type A)
that can kill a small number of birds and therefore provide carcasses which are an
Capítulo 3
123
optimum substrate for the initial growth of C. botulinum prior to an outbreak. In
addition, these eutrophic wetlands have high phytoplankton and zooplankton
productivity from spring to autumn that attract a great amount of waterbirds, which
increases spatial aggregation and the risk of epidemics (Murray and Hamilton, 2010;
Cardoni et al., 2011). The result of this has been a higher frequency of botulism
outbreaks in Navaseca (4 summer outbreaks in the last 5 years) and Veguilla (5
recorded outbreaks since 1978) than in TDNP (only one large outbreak in 1999 and
another smaller in an exhibition pond in 2007) (Vidal et al., 2009; Vidal et al., 2013).
Wastewater discharges in wetlands modify their hydroperiod, soil pH and Eh,
nutrient load and plant communities (Cooke et al., 1990; Mason, 2002; Foulquier et al.,
2013; Sánchez, 2013). In our study area, we have observed higher turbidity, chlorophyll
a, total and volatile solids, BOD5, total carbon, NH4+
and PO43-
concentrations and
lower water Eh in the wetlands with an input of treated wastewater. The issue is how
these changes can increase the risk of botulism outbreaks. Our results suggest that high
water temperatures (especially during the summer) and eutrophication in Navaseca lake
caused an overgrowth of phytoplankton before the outbreak, as revealed by high
concentrations of chlorophyll a recorded in June and early July. Later, we observed an
overgrowth of floating duckweed (Lemna minor), which covered the surface of the lake
during the seconds half of July. The lack of light and resources resulting of this
overgrowth may have caused the death of the phytoplankton, as indicated the sharp
decreases of Eh and chlorophyll a. Moreover, the death phytoplankton could sink into
the sediments and the resulting organic matter may have encouraged the overgrowth of
microorganisms depleting the oxygen, as reported elsewhere (Díaz and Rosenberg,
2008). Further supporting evidence for this conjecture are the high inorganic carbon
concentration and the decrease of the SO42-
concentration recorded in interstitial water
Tesis doctoral – Ibone Anza Gómez
124
between July and August which may have been a consequence of the metabolism of
microorganisms (i.e. methanogenesis) and the activity of anaerobic sulfate-reducing
bacteria (Baird, 1999; Jouanneau et al., 2014). Also, the sharp decrease on the BOD5
levels reflected that microorganisms had consumed organic matter with the consequent
oxygen depletion. This anoxic environment could be suitable for the growth of C.
botulinum type C/D, which was first detected in the sediments of Navaseca in July
coinciding with the cited changes. Later, C. botulinum was also detected in water and in
necrophagous invertebrates (i.e. Calliphoridae flies and beetle larvae), probably due to
its ability to grow in other compartments such as carcasses. Moreover, we found a
significant association between sampling sites with high concentrations of chlorophyll a
and the presence of C. botulinum type C/D in the sediments, which may indicate that
this pathogen prevails better in eutrophicated sites. Other authors have also observed
links between botulism and changes in environmental characteristics of wetlands that
can be due to eutrophication. Murphy et al. (2000) found that a switch in the water Eh
in Whitewater Lake (Canada) might have been a significant factor in the development
of C. botulinum type C in its sediments. Rocke et al. (1999) found that increasing
temperature and biomass may influence the initial phase of botulism outbreaks, and that
these were more frequent in wetlands with lower Eh. More recently, Lan Chun et al.
(2013) found that the macrophytic green alga Cladophora provides habitat for C.
botulinum type E and that its accumulation in near shore waters coincided with high
incidence of avian botulism in the shoreline.
The proliferation of C. botulinum type C/D in sediments can increase the
chances of birds ingesting spores either directly from the sediments (Beyer et al., 2008)
or along with detritivorous aquatic invertebrates, such as snails. In our study, this is
supported by the increase in the detection of C. botulinum type C/D in bird faeces
Capítulo 3
125
before the occurrence of the outbreak in July. After the death of any of these carrier
birds, their carcasses may become substrate for further proliferation and toxinogenesis
of C. botulinum type C/D prior to an outbreak, which would later propagate by the
carcass-maggot cycle (Wobeser, 1997). The presence of avian pathogens in wetlands
can facilitate this process by causing sudden mortalities of waterbirds and may be one
of the reasons that explain the regular botulism outbreaks that occur in wastewater lakes
where the prevalence of pathogens is higher. Bird mortalities have already been
described as the major initiating factor of outbreaks in Eyebrow Lake, Canada (Soos
and Wobeser, 2006). In our study, APEC and C. perfringens type A, both capable of
producing bird mortalities (Ankerberg, 1984; Benskin et al., 2009; Díaz-Sánchez et al.,
2013), were significantly more frequent in sediment and bird faeces from the two
wetlands that receive effluents from wastewater treatment plants (i.e. Navaseca and
Veguilla). In addition, C. perfringens type A is a good indicator of sewage discharges
(Skanavis and Yanko, 2001; Mason, 2002), so the high prevalence observed indicates
the presence of poorly treated wastewater in Navaseca and Veguilla which probably
contains other pathogens not included in this study, like Campylobacter spp.,
Aeromonas spp., or Pseudomonas spp. (Al-Bahry et al., 2009; Benskin et al., 2009). As
an example, E. coli and Proteus mirabilis were isolated from the heart of a white-
headed duck collected during the outbreak in Navaseca. Also, in a recent bird mortality
that occurred in another lake receiving wastewater, Pseudomonas aeruginosa was
isolated from the heart of a coot (Fulica atra) (own unpublished data, IREC). As further
evidence, a discharge of wastewater in the Salada lagoon (south of Spain) was
associated with a waterbird mortality due to Pasteurella anatipestifer (Gómez, 1987).
Finally, C. botulinum type C/D was also more frequent in the sediments
collected from Navaseca and Veguilla, which was probably related to the higher
Tesis doctoral – Ibone Anza Gómez
126
frequency of outbreaks in these wetlands (Vidal et al, 2009; Vidal et al, 2013). In this
sense, Wobeser et al. (1987) found a strong association between a prior history of
botulism in a wetland and the proportion of soil samples containing C. botulinum type
C. Our regression analysis showed that the most important factor explaining the
presence of the avian pathogens was the zone (wetland), more than the physicochemical
parameters, the season, or the type of bird sampled. It is probable that other variables
not studied here, such as bird aggregation, the amount of wastewater entering the
wetlands or the water retention time had an effect on the prevalence of pathogens.
The proximity of landfills to wetlands may suppose an additional risk for the
appearance of outbreaks because opportunistic birds feeding urban waste, such as gulls
or storks, may spread pathogens such as Salmonella spp., Campylobacter spp. or C.
botulinum from landfills where they feed (Ortiz and Smith, 1994; Benskin et al., 2009;
Ramos et al., 2010) to wetlands where they roost. Accordingly, we observed the major
prevalence of Salmonella spp. in bird faeces (mainly in gulls and storks) of Veguilla,
which can be related with the high prevalence of Salmonella spp. detected in gull faeces
in a nearby landfill (30%). The higher prevalence of APEC observed in Ciconiidae
(white storks) faeces also supports this statement.
5. Conclusions
Inefficiently treated effluents from wastewater treatment plants represent a risk
for the conservation of wetland ecosystems. During the dry season, these wetlands still
maintain water with high phytoplankton and zooplankton productivity thus attracting a
great amount of waterbirds, including endangered species such as the white-headed
duck. The eutrophication and high loads of avian pathogens that are found in these
Capítulo 3
127
wetlands may increase the risk of botulism outbreaks which, in this situation of
aggregation, can have a severe impact on waterbird populations due to the high
mortality rates produced in short periods of time (Rocke, 2006; Work et al., 2010).
Waterbirds attracted by these eutrophic wetlands may be exposed to diverse pathogens,
urban or industrial pollutants with unknown effects for them (Markman et al., 2008;
Murray and Hamilton, 2010). Improvements on water-treatment plants and the
elimination of “by-pass” systems that directly pour wastewater on wetlands are urgent
measures to guarantee the conservation of waterbirds.
Acknowledgments
We thank Miguel Carles-Tolrá for helping with the identification of the fly
families. We also thank Jordi Feliu, Alicia B. Gómez and Adelaida Chicampol for their
assistance in the field work, and David Sánchez for his help with the interpretation of
the results. This study was supported by the Spanish Ministry of Environment (grants
OAPN 035/2009). I. Anza was supported by a JAE PRE grant from Spanish Council of
Research (CSIC); Dr. D. Vidal was supported with a JAE DOC contract from the CSIC;
S. Díaz-Sánchez held a PhD research grant funded by the Junta de Comunidades de
Castilla–La Mancha (JCCM) (AG07). Dr. S. Sánchez acknowledges the Consejería de
Educación y Ciencia de la Junta de Comunidades de Castilla–La Mancha and Fondo
Social Europeo for his research fellowship (09/02-C).
References
Al-Bahry, S.N., Mahmoud, I.Y., Al-Belushi, K.I.A., Elshafie, A.E., Al-Harthy, A.,
Bakheit, C.K. 2009. Coastal sewage discharge and its impact on fish with
Tesis doctoral – Ibone Anza Gómez
128
reference to antibiotic resistant enteric bacteria and enteric pathogens as bio-
indicators of pollution. Chemosphere 77, 1534–1539.
Álvarez-Cobelas, M., Cirujano, S., Sánchez-Carrillo, S. 2001. Hydrological and
botanical man-made changes in the Spanish wetland of Las Tablas de Daimiel.
Biologial Conservation 97, 89-98.
Álvarez-Cobelas, M., Cirujano, S. 1996. Las Tablas de Daimiel. Ecología acuática y
sociedad. Organismo Autónomo Parques Nacionales, Ministerio de Medio
Ambiente, Madrid, Spain.
Ankerberg, CWJr. 1984. Pelican deaths in the vicinity of a sewage lift station a
bacteriological investigation. Microbios Letters 101, 33-42.
Anza, I., Skarin, H., Vidal, D., Lindberg, A., Båverud, V., Mateo, R. 2014. The same
clade of Clostridium botulinum strains is causing avian botulism in southern and
northern Europe. Anaerobe 26, 20-23.
APHA. 1998. Standard methods for the examination of water and waste water, 20th
ed.
Published jointly by American Public Health Association, American Water
Works Association, and Water Environment Federation, Washington DC.
Baird, C. 1999. Environmental chemistry, 2nd
ed. W. H. Freeman & Company,
Basingstoke, UK.
Barton, K. 2011. MuMIn: Multi-model inference. R package version 1.6.1.
http://cran.r_proyect.org/package=MuMIn
Benskin, C.M., Wilson, K., Jones, K., Hartley, I.R. 2009. Bacterial pathogens in wild
birds: a review of the frequency and effects of infection. Biological Reviews 84,
349-373.
Capítulo 3
129
Beyer, W.N., Perry, M.C., Osenton, P.C. 2008. Sediment ingestion rates in waterfowl
(Anatidae) and their use in environmental risk assessment. Integrated
Environmental Assessment and Management 4, 246-251.
Burnham, K.P., Anderson, D.R. 2002. Model selection and multimodel inference: a
practical information-theoretic approach, 2nd
ed. Springer-Verlag, New York,
NY
Cardoni, D.A., Isacch, J.P., Fanjul, M.E., Escapa, M., Iribarne, O.O. 2011. Relationship
between anthropogenic sewage discharge, marsh structure and bird assemblages
in an SW Atlantic saltmarsh. Marine Environmental Research 71, 122-130.
Cooke, J.G., Cooper, A.B., Clunie, N.M.U. 1990. Changes in the water, soil, and
vegetation of a wetland after a decade of receiving a sewage effluent. New
Zealand Journal of Ecology 14, 37-47.
de Caluwe, H., van Logtestijn, R. 1998. Method Manual – Landscape Ecology – Utrecht
University.
Díaz, R.J., Rosenberg, R. 2008. Spreading dead zones and consequences for marine
ecosystems. Science 321: 926.
Díaz-Sánchez, S., López, A., Gamino, V., Sánchez, S., Ewers, C., Höfle, U. 2013. A
colibacillosis outbreak in farmed red-legged partridges (Alectoris rufa) Avian
Diseases 57, 143-146.
Florín, M., Montes, C. 1999. Functional analysis and restoration of Mediterranean
lagunas in the Mancha Húmeda Biosphere Reserve (Central Spain). Aquatic
Conservation 9, 97-109.
Fornés, J., Rodríguez, J.A., Hernández, N., Llamas, M.R. 2000. Possible solutions to
avoid conflicts between water resources development and wetland conservation
Tesis doctoral – Ibone Anza Gómez
130
in the "La Mancha Húmeda" Biosphere Reserve (Spain) Physics and Chemitry
of the Earth part B: Hydrology, Oceans and Atmosphere 25, 623-627.
Foulquier, A., Volat, B., Neyra, M., Bornette, G., Montuelle, B. 2013. Long-term
impact of hydrological regime on structure and functions of microbial
communities in riverine wetland sediments. FEMS Microbiology Ecology 85,
211-26.
Golterman, H.L., de Graaf Bierbrauwer-Würtz, I.M. 1992. Colorimetric determination
of sulphate in freshwater with a chromate reagent. Hydrobiologia 228, 111–115.
Gómez, J.M. 1987. Mortandad de aves en la Laguna Salada: incidencia en la población
de malvasías. Oxyura 1, 15-20.
[ISO] International Organization for Standardization. 2002. ISO6579:2002.
Microbiology of food and animal feeding stuffs: Horizontal method for the
detection of Salmonella sp. Geneva, Switzerland: ISO.
Johnson, T.J., Wannemuehler, Y., Johnson, S.J., Stell, A.L., Doetkott, C., Johnson, J.R.,
Kim, K.S., Spanjaard, L., Nolan, L.K. 2008. Comparison of extraintestinal
pathogenic Escherichia coli strains from human and avian sources reveals a
mixed subset representing potential zoonotic pathogens. Applied and
Environmental Microbioloy 74, 7043–7050.
Jouanneaua, S., Recoulesb, L., Duranda, M.J., Boukabacheb, A., Picotb, V., Primaultc,
Y., Lakeld, A., Sengeline, M., Barillonf, B., Thouanda, G. 2014. Methods for
assessing biochemical oxygen demand (BOD): a review. Water Research 49, 62-
82.
Lan Chun, C., Ochsner, U., Byappanahalli, M.N., Whitman, R.L., Tepp, W.H., Lin, G.,
Johnson, E.A., Peller, J., Sadowsky, M.J. 2013. Association of toxin-producing
Capítulo 3
131
Clostridium botulinum with the macroalga Cladophora in the Great Lakes.
Environmental Science and Technology 47, 2587-2594.
León-Quinto, T., De la Vega, A., Lozano, A., Pastor, S. 2004. Summer mortality of
waterbirds in a Mediterranean wetland. Waterbirds 27, 46-53.
Markman, S., Leitner, S., Catchpole, C., Barnsley, S., Müller, C.T., Pascoe, D.,
Buchanan, K.L. 2008. Pollutants increase song complexity and the volume of the
brain area HVC in a songbird. PLoS ONE 3, e1674.
doi:10.1371/journal.pone.0001674.
Martínez-Santos, P., De Stefano, L., Llamas, M.R., Martínez-Alfaro, P.E. 2008.
Wetland restoration in the Mancha occidental aquifer. Spain: A critical
perspective on water, agricultural, and environmental policies. Restoration
Ecology 16, 511-521.
Mason, C.F. 2002. Biology of freshwater pollution, 4th
ed. Pearson Education Limited,
Harlow, UK.
Murphy, T., Lawson, A., Nalewajko, C., Murkin, H., Ross, L., Oguma, K., McIntyre, T.
2000. Algal toxins—Initiators of avian botulism? Environmental Toxicology 15,
558-67.
Murray, C.G., Hamilton, A.J. 2010. Perspectives on wastewater treatment wetlands and
waterbird conservation. Journal of Applied Ecology 47, 976–985.
Navarro, V., García, B., Sánchez, D., Asensio, L. 2011. An evaluation of the application
of treated sewage effluents in Las Tablas de Daimiel National Park. Central
Spain. Journal of Hydrology 401, 53-64.
Nol, P., Rocke, T.E., Gross, K., Yuill, T.M. 2004. Prevalence of neurotoxic Clostridium
botulinum type C in the gastrointestinal tracts of tilapia (Oreochromis
mossambicus) in the Salton Sea. Journal of Wildlife Diseases 40, 414–419.
Tesis doctoral – Ibone Anza Gómez
132
Okafor, N. 2011. Pollution of aquatic systems: Pollution through eutrophication, fecal
materials, and oil spills. In Environmental Microbiology of Aquatic and Waste
Systems, Springer, Netherlands. p 151-183
Ortiz, N.E., Smith, G.R. 1994. Landfill sites, botulism and gulls. Epidemiological
Infection 112, 385–391.
Ramos, R., Cerdà-Cuéllar, M., Ramírez, F., Jover, L., Ruiz, X. 2010. Influence of refuse
sites on the prevalence of Campylobacter spp. and Salmonella serovars in
seagulls. Applied and Environmental Microbiology 76, 3052–3056.
Rocke, T.E., Euliss, N.H. Jr., Samuel, M.D. 1999. Environmental characteristics
associated with the occurrence of avian botulism in wetlands of a Northern
California refuge. Journal of Wildlife Management 63, 358-368.
Rocke, T.E., Samuel, M.D. 1999. Water and sediment characteristics associated with
avian botulism outbreaks in wetlands. Journal of Wildlife Management 63,
1249-1260.
Rocke, T.E. 2006. The global importance of avian botulism. In Boere GC, Galbraith
CA, Stroud DA (eds), Waterbirds around the world. The Stationery Office,
Edinburgh, UK. p 422-426
Sánchez, D. 2013. Ph.D. thesis. University of Castilla la Mancha, Ciudad Real, Spain
Sánchez-Hernández, L., Cifuentes, A., Jiménez, B., Mateo, R., González, R. 2008.
Detection of Clostridium botulinum neurotoxin coding genes: analysis of PCR
products by real time versus capillary gel electrophoresis methods. European
Food Research and Technology 227, 495–502.
Skanavis, C., Yanko, W.A. 2001. Clostridium perfringens as a potential indicator for
the presence of sewage solids in marine sediments. Marine Pollution Bulletin 42,
31-35.
Capítulo 3
133
Soos, C., Wobeser, G. 2006. Identification of primary substrate in the initiation of avian
botulism outbreaks. Journal of Wildlife Management 70, 43-53.
van Asten, A.J., van der Wiel, C.W., Nikolaou, G., Houwers, D.J., Gröne, A. 2009. A
multiplex PCR for toxin typing of Clostridium perfringens isolates. Veterinary
Microbiology 136, 411-412.
Vidal, D., Anza, I., Taggart, M.A., Pérez-Ramírez, E., Crespo, E., Höfle, U., Mateo, R.
2013. Environmental factors influencing the prevalence of Clostridium
botulinum type C in non-permanent Mediterranean wetlands. Applied and
Environmental Microbiology 79, 4264-4271.
Vidal, D., Taggart, M.A., Badiola, I., Mateo, R. 2011. Real-time polymerase chain
reaction for the detection of toxigenic Clostridium botulinum type C1 in
waterbirds and sediment samples: comparison with other PCR techniques.
Journal of Veterinary Diagnostic Investigation 23, 942–946.
Vidal, D., Taggart, M.A., Höfle, U., González, R., Cifuentes, A., Sánchez-Hernández,
L., Barcenilla, J., Jiménez, B., Green, A.J., Mateo, R. 2009. Análisis del riesgo
de intoxicación por botulismo en malvasía cabeciblanca y otras especies de aves
acuáticas en las Tablas de Daimiel y humedales cercanos [Risk analysis of
botulism poisoning in whiteheaded duck and other species of waterfowl in the
Tablas of Daimiel and nearby wetlands]. In: Proyectos de Investigación en
Parques Nacionales: 2005–2008. Ramírez, L., Asensio, B. (eds). Ministerio de
Medio Ambiente, Madrid, Spain. p 229–247
Wobeser, G., Marsden, S., MacFarlane, R.J. 1987. Occurrence of toxigenic Clostridium
botulinum type C in the soil of wetland in Saskatchewan. Journal of Wildlife
Diseases 23, 67-76.
Tesis doctoral – Ibone Anza Gómez
134
Wobeser, G. 1997. Avian botulism – another perspective. Journal of Wildlife Diseases
33, 181–186.
Work, T.M., Klavitter, J.L., Reynolds, M.H., Blehert, D. 2010. Avian botulism: a case
study in translocated endangered Laysan ducks (Anas laysanensis) on Midway
Atoll. Journal of Wildlife Diseases 46, 499–506.
Woudstra, C., Skarin, H., Anniballi, F., Fenicia, L., Bano, L., Drigo, I., Koene, M.,
Bäyon-Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012.
Neurotoxin gene profiling of Clostridium botulinum types C and D native to
different countries within Europe. Applied and Environmental Microbiology 78,
3120-3127.
135
CAPÍTULO 4
Nueva perspectiva en la epidemiología de los brotes de
botulismo aviar: las moscas necrófacas como vectores de C.
botulinum tipo C/D
Moscas calífora (verde) y común sobre el cadaver de una garceta. Fotografía de Rafael Mateo
Anza, I.,
Vidal, D., Mateo, R. 2014. New insight in the epidemiology of avian botulism
outbreaks: necrophagous flies as vectors of Clostridium botulinum type C/D.
Environmental and Microbiology Reports (ahead of print) doi: 10.1111/1758-
2229.12197.
Tesis doctoral – Ibone Anza Gómez
136
Nueva perspectiva en la epidemiología de los brotes de botulismo aviar: las moscas
necrófacas como vectores de C. botulinum tipo C/D.
RESUMEN
Los brotes de botulismo aviar se propagan por el ciclo de ”larva de mosca-cadáver”, por
el cual, Clostridium botulinum y las moscas necrófagas interactúan para asegurar su
reproducción en una relación mutualista donde las larvas de mosca portadoras de
esporas/toxina son la pieza clave. En este estudio investigamos la hipotesis de que las
moscas adultas puedan también tener un papel significativo en los brotes de botulismo
llevando microorganismos de C. botulinum entre cadáveres. Para comprobarlo,
relizamos un experimento de campo en el que pusimos cadáveres de aves libres de C.
botulinum tipo C/D en recipientes sólo accesibles a invertebrados voladores en
humedales con brote de botulismo y en zonas control. Además, realizamos
experimentos laboratoriales para evaluar si las moscas necrófagas (calíforas) pueden
transportar C. botulinum tipo C/D y por cuanto tiempo. Como resultado, el 27.5% de los
cadáveres previamente negativos colocados en humedales con brote desarrollaron larvas
portadoras del clostridio. Además, en el laboratorio, las moscas calíforas fueron capaces
de transferir C. botulinum entre dos puntos y lo excretaron hasta 24 h después de
alimentarse de él. Nuestros resultados confirman que que las moscas necrófagas juegan
un papel en la propagación de los brotes de botulismo con implicaciones en su
epidemiología.
Capítulo 4
137
New insight in the epidemiology of avian botulism outbreaks: necrophagous flies as
vectors of Clostridium botulinum type C/D
ABSTRACT
Avian botulism outbreaks spread through the “bird carcass-maggot” cycle, in which
Clostridium botulinum and blowflies interact to ensure their reproduction in a
mutualistic relationship where neurotoxin/spore-bearing maggot is one of the keystones.
Here, we investigated the hypothesis that adult blowflies may also play a significant
role in botulism outbreaks by carrying C. botulinum cells between carcasses. We carried
out a field experiment placing bird carcasses free of C. botulinum type C/D in
containers only accessible to necrophagous flying insects in wetlands where avian
botulism outbreaks were occurring and in control sites. Additionally, we performed
laboratory trials to evaluate if blowflies may carry C. botulinum type C/D and for how
long. Maggots bearing C. botulinum type C/D developed in 27.5% of carcasses placed
in wetlands during botulism outbreaks. Calliphoridae flies in laboratory trials were able
to transfer C. botulinum between two points and excreted it in their spots for up to 24 h
after an infective feeding. Our results confirm that adult necrophagous flies play a role
in the spreading of botulism outbreaks which have implications in the epidemiology of
this disease.
Tesis doctoral – Ibone Anza Gómez
138
1. Introduction
Avian botulism is an intoxication caused by the botulinum neurotoxin (BoNT),
which causes a severe flaccid paralysis of the muscles and death in birds and mammals
(Rocke and Bollinger, 2008; Defilippo et al., 2013). This neurotoxin is secreted by
Clostridium botulinum, a strictly anaerobic and spore-forming Gram positive bacterium.
Several types of BoNT serotypes exist; type C/D is the most common in avian botulism
outbreaks in Europe (Woudstra et al., 2012; Anza et al., 2014a). In a global basis,
botulism is one of the most important diseases for waterbirds (Rocke, 2006), and it is an
emerging serious disease in poultry (Lindberg et al., 2010). Birds get intoxicated after
ingesting the toxin along with their prey (invertebrates or fishes), and it has also been
suggested that spores may germinate in their digestive tract producing a toxico-infection
(Rocke, 2006; Lindberg et al., 2010).
Outbreaks in waterbirds occur mostly between summer and autumn, when high
temperatures along with increasing biomass and anaerobic conditions in wetlands
allows the growth of C. botulinum in the environment (Rocke and Bollinger, 2008;
Anza et al., 2014b). In wetlands from south-central Spain, outbreaks occur almost every
year and usually last one to two months between June and October. Mortality rate vary
between years and locations, and it has been positively correlated with temperature
(Vidal et al., 2013). These outbreaks propagate and become self-perpetuating by a
process known as the carcass-maggot cycle of avian botulism, during which toxin-
loaded maggots amplify the number of intoxicated birds: first, a bird with C. botulinum
in its digestive tract dies and its carcass provides an anaerobic and protein-rich
environment where the microorganism grows and produces toxin; simultaneously,
maggots develop in the carcass accumulating the toxin (which does not affect
Capítulo 4
139
invertebrates) and finally, healthy birds eat the toxin-loaded maggots, die and generate
new substrate for the growth of C. botulinum and toxinogenesis. This cycle continues
until conditions become unsuitable (i.e. decreasing temperatures, carcass removal, bird
disaggregation) for bacteria and/or larval growth (Wobeser, 1997; Soos and Wobeser,
2006). Percentages of carcasses that develop toxic maggots during botulism outbreaks
vary between studies from 85–90% (Duncan and Jensen, 1976) to 12-74% (Soos and
Wobeser, 2006). Environmental factors, such as temperatures and fly activity, may
contribute to this variance. Although the highest concentrations of toxin have been
described in carcass-maggots, other types of invertebrates, especially scavenger snails
and beetles, may also carry spores and toxin, and serve as secondary sources of
bacterium and/or its toxin for birds (Duncan and Jensen, 1976; Vidal et al., 2013; Anza
et al., 2014b). Avian botulism outbreaks are difficult to prevent because C. botulinum
spores are ubiquitous in wetlands, and environmental conditions that lead to spore
germination and toxin production are diverse, unclear and complex to manage (Rocke
and Bollinger, 2008). This is why outbreaks control relies on prompt detection and
removal of bird carcasses, so as to stop the carcass-maggot cycle (Evelsizer et al.,
2010b).
Flies are mechanical vectors of a variety of diseases and play an important role
in spreading them. For example, Turrell and Knudson (1987) demonstrated that stable
flies can mechanically carry Bacillus anthracis from anthrax-infected guinea pigs to
healthy ones, and Cohen et al. (1991) observed that the control of flies in a military base
decreased the incidence of shigellosis by 85%. Different pathogens, such as B.
anthracis, Escherichia coli, Salmonella spp. or Staphylococcus spp., have been isolated
from flies external surfaces and their spots (vomits and feces) (Nazni et al., 2005;
Fasanella et al., 2010; Lindsay et al., 2012). Clostridium botulinum type C or C/D cells
Tesis doctoral – Ibone Anza Gómez
140
and toxin have already been detected in adult Calliphoridae flies and Dermestidae
beetles caught near bird carcasses during botulism outbreaks (Duncan and Jensen 1976;
Vidal et al., 2013). Blow and flesh flies (families Calliphoridae and Sarcophagidae)
feed and oviposit on carrion (Norris, 1965) and the role of their maggots in the
spreading of botulism outbreaks by the carcass-maggot cycle is well documented
(Hubálek and Halouzka, 1991), but to our knowledge there are no studies focused on
the potential role of adult flies as vectors of C. botulinum type C/D during the
propagation of avian botulism outbreaks. Flies feed and lay eggs over different bird
carcasses, so we hypothesize that, during this process, they may transfer C. botulinum
cells and increase the number of carcasses with toxin loaded maggots, therefore
spreading the outbreaks. Moreover, we propose that this relationship between
necrophagous flies and C. botulinum may be studied as a mutualism, because both
species ensure the substrate for their reproduction (bird carcasses) with their interaction.
We tested this hypothesis by placing carcasses free of C. botulinum type C/D in
containers only accessible to flying insects in wetlands where an outbreak was taking
place, so as to determine if the flies trapped in them and the maggots born from their
eggs carried the pathogen. We also performed laboratory experiments to determine
under controlled conditions if Calliphoridae flies can transport viable C. botulinum type
C/D cells and for how long can eliminate them in their spots.
Capítulo 4
141
2. Material and methods
2.1 Field experiment: transport of C. botulinum type C/D between carcasses by
necrophagous insects
The study was carried out in different wetlands and urban areas of the province
of Ciudad Real, in south central Spain, for two consecutive years, 2012 and 2013.
Eighty three bird carcasses free of C. botulinum type C/D inserted in containers only
accessible to flying necrophagous invertebrates (Fig. 1A) were hung on vegetation 150-
200 cm above the ground until maggots infestation was observed (between 5 and 14
days). Fifty four were set in botulism endemic wetlands (43 during outbreak periods and
11 two months before an outbreak) and 29 in control sites (Table 1). Maggots developed
in 78 carcasses and were analyzed in pools of 3 to 8 individuals from each carcass for
the presence of C. botulinum type C/D by real time PCR after culture enrichment
(Sánchez-Hernandez et al., 2008; Vidal et al., 2011). This assay amplifies genes
encoding both, type C and type C/D mosaic toxins, but as in the study area type C/D is
predominant we assumed that we were detecting the mosaic type (Vidal et al., 2013;
Anza et al., 2014). Eighty one individual necrophagous flies (43 from outbreak and 38
from control and pre-outbreak sites) and 55 beetles (37 from outbreak and 18 from
control and pre-outbreak sites) randomly selected from 79 containers were analyzed
with the same PCR assay (Table 1).
Tesis doctoral – Ibone Anza Gómez
142
Fig. 1. A. Design of the carrion-fly traps used in the field experiment consisting of a 5 l water
plastic bottle with two holes in the bottom that allowed the pass of carrion flies attracted by the
odor of a bird carcass used as bait and where maggots develop. B. Design of the odor-baited fly
traps used for capturing flies for the laboratory experiments: a. holes, b. pork liver on an agar
plate base, c. opaque plastic pot, d. funnel, e. plastic bag, f. string.
2.2 Laboratory experiments
2.2.1 Transport of C. botulinum by Calliphoridae flies
Sixty Calliphoridae flies captured in urban sites with odor-baited traps (Fig. 1B)
were maintained inside two plastic framed cages (30 flies each) of 50 × 50 cm covered
on all sides by mosquito net (Fig. 2). In one cage, 20 sterile cotton-wool swabs
(CLASSIQSwabsTM
Copan) saturated in a solution of cooked meat broth and glucose
(BD BBL cooked meat medium with glucose, BD) were pierced in one of the walls, and
another 10 swabs saturated in the same solution but containing 25 spores/µl of C.
botulinum type C/D were pierced in the opposite wall. The C. botulinum type C/D strain
used was isolated from the gastric content of a black-headed gull (Chroicocephalus
Capítulo 4
143
ridibundus) collected in the summer of 2005 in the province of Ciudad Real (internal
reference IREC-B136) and confirmed as C. botulinum type C/D by PCR (Vidal et al.,
2013). The second cage was placed beside and used as control with 20 swabs saturated
in the same solution of cooked meat broth pierced between two opposite walls. After 48
h flies were frozen so as to kill them. All flies and swabs were analyzed with the same
real-time PCR protocol used for the field experiment (Sánchez-Hernandez et al., 2008;
Vidal et al., 2011).
Fig. 2. Design of the cage used for the C. botulinum transport experiment. Twenty sterile
cotton-wool swabs saturated in a solution of cooked meat broth and glucose were placed in one
wall and 10 swabs saturated in the same solution but containing 25 spores/µl of C. botulinum
type C/D were placed in the opposite wall.
2.2.2 Time of excretion of C. botulinum type C/D by Calliphoridae flies
Twelve Calliphoridae flies were captured in urban sites with odour-baited traps
(Fig. 1A), and their spots were tested by real-time PCR to confirm that they were
negative to the pathogen. Then, they were placed in individual Petri dishes and fed with
Tesis doctoral – Ibone Anza Gómez
144
a solution of cooked meat broth and glucose containing 25 spores/µl of the same strain
of C. botulinum type C/D used in the previous experiment (Fig. 3). After, they were
transferred to new sterile Petri dishes at 3, 6, 9, 12, 24 and 27 h, and the spots (vomitus
and faeces) that remained in the dishes were collected with sterile cotton swabs and
tested by real-time PCR (same assay as in previous experiments) for the presence of C.
botulinum type C/D. In 7 occasions, there were no spots in the Petri dishes, so the swabs
were passed over their surface.
Fig. 3. Calliphoridae fly feeding on a C. botulinum type C/D infective swab prior to excretion
experiment. Fly spots can be observed on the surface of the Petri dish.
3. Results and discussion
3.1 Transport of C. botulinum type C/D between carcasses by necrophagous insects in
the field
Based on the Fisher´s test, there were significant differences (P<0.01) in the
frequency of detection of C. botulinum type C/D in maggots (27.5%) and in adult flies
Capítulo 4
145
(18.6%) collected in outbreak sites compared with the frequency observed in control
and pre-outbreak sites where the pathogen was absent (Table 1). The highest prevalence
was detected on Sarcophagidae flies (27%), followed by Calliphoridae flies (19%),
Muscidae flies (9%) and Dermestidae beetles (8.1%), although there were no significant
differences between families (Table 2). In many wetlands, botulism is an endemic
disease (birds intoxicate at a low rate) with periodic epidemics (birds intoxicate at a
greater rate) when large outbreaks occur. The most critical factor for the spreading of
large avian botulism outbreaks is the density of carcasses that contain C. botulinum
spores which will germinate and produce toxin (Rocke and Bollinger, 2008; Evelsizer et
al., 2010a). In this sense, Wobeser (1997) stated that the secondary poisoning is the
major factor causing large outbreaks and proposed that these occur when the average
number of birds dying of secondary poisoning attributable to a single carcass is >1. This
further depends on four factors: “the probability of carcasses developing maggots”, “the
probability of maggots accumulating toxin”, “the contact rate between susceptible birds
and toxic material” and “the proportion of contacts resulting in intoxication and death”
(Soos and Wobeser, 2006). The first factor largely depends on the activity of blowflies,
and the second factor may also be influenced by flies because, as we have shown, they
may act as vectors of C. botulinum type C/D cells and contribute to colonize with it up
to 27.5% of previously uncontaminated carcasses. Taking into account that the presence
of C. botulinum type C/D in the environment in the study area is generally low (6% in
sediment samples, Vidal et al., 2013), the contribution of flies to the spreading of the
outbreaks can be substantial. In this sense, Reed and Rocke (1992) found high levels of
toxin in 16% of maggots developing on previously healthy euthanized bird carcasses
and in 10% of maggots developing on botulism-intoxicated bird carcasses placed in
adjacent pools; they suggested that the euthanized bird carcasses were already infected
Tesis doctoral – Ibone Anza Gómez
146
with spores, but another feasible hypothesis is that flying necrophagous invertebrates
transported them, as observed here. Further support to our findings is that several
studies have shown that adult flies are vectors of a variety of pathogens (Nazni et al.,
2005; Fasanella et al., 2010; Lindsay et al., 2012). The absence of the pathogen in our
controls ruled out that cross contamination occurred from our traps themselves.
3.2 Transport of C. botulinum type C/D by Calliphoridae flies under controlled
conditions
After 48 h, 3 of the 20 (15%) previously sterile cotton swabs and 1 of the 30
flies (3.3%) from the experimental cage tested positive to C. botulinum type C/D by real
time PCR, while all the samples from the control cage, swabs and flies, were negative.
This experiment performed under controlled conditions definitely shows that
Calliphoridae flies can transport C. botulinum cells and supports the field findings.
147
Table 1. Samples collected during the field experiment and analyzed for the presence of C.botulinum type C/D.
Site status Site1 Date
Carcasses
(parasitized/total)
Positive maggot pools/total no
of parasitized carcasses (%)2
Positive flies/total no
of flies (%)3
Positive beetles/total no
of beetles (%)3
Control Urban area Jul-Aug 2012 3/5 0/3 0/0 0/0
Urban area Sep 2013 10/10 0/10 0/0 0/5
Tablas Daimiel Jun-Jul 2013 14/14 0/14 0/19 0/9
All 27/29 0/27 0/19 0/14
Pre-outbreak Navaseca May 2013 11/11 0/11 0/19 0/4
Control + pre-outbreak 38/40 0/38 0/38 0/18
Outbreak Navaseca Jul-Aug 2012 22/24 4/22 (18.2) 4/27 (14.8) 1/8 (12.5)
Navaseca Aug 2013 10/10 3/10 (30) 1/8 (12.5) 0/11
Pozuelo Jul-Aug 2013 8/9 4/8 (50) 3/8 (37.5) 2/18 (11.1)
All 40/43 11/40 (27.5)*+
8/43 (18.6)+ 3/37 (8.1)
1 Tablas Daimiel, Navaseca and Pozuelo are wetland areas.
2 Pool of maggots contain 3 to 8 individuals.
3 Flies and beetles were analyzed individually, they can proceed from the same trap.
*Prevalence during “outbreak” significantly higher than in its correspondent “control” samples (P< 0.01).
+ Prevalence during “outbreak” significantly higher than in its correspondent “control + pre-outbreak” samples (P< 0.01).
Tesis doctoral – Ibone Anza Gómez
148
Table 2. Presence of C. botulinum type C/D in individuals of different families of necrophagous
flies and beetles in sites where an avian botulism outbreak was taking place and in sites with no
outbreak.
Non outbreak sites Outbreak sites
Family of fly
or beetle
No. of
individuals
No. of
positive
individuals
% positive
individuals*
No. of
individuals
No. of
positive
individuals
% positive
individuals
*
Calliphoridae 13 0 0 21 4 19
Muscidae 14 0 0 11 1 9.1
Sarcophagidae 11 0 0 11 3 27
Dermestidae 18 0 0 37 3 8.1
*Percentages of detection of C. botulinum type C/D were not significantly different between families or
sites
3.3 Excretion of C. botulinum type C/D by Calliphoridae flies
Eleven of the 12 flies excreted C. botulinum type C/D at least once between 3 and
24 hours post-infective feeding. After 3 hours, C. botulinum could be detected in the
spots of 7 of the 12 flies (58%) and this number decreased every 3 h; after 24 h, the
pathogen was only detected in the spots of one fly (8%), and after 27 h it was absent
(Fig.4). These results demonstrate that flies can excrete C. botulinum type C/D cells
during the following 24 h after a single infective exposure. Moreover, C. botulinum was
absent from the surface of the 7 Petri dishes where the exposed flies landed but did not
deposit spots, which suggests that flies transmit the pathogen fecal-orally rather than by
direct contamination with spores present on their body surfaces. These results are in
agreement with Fasanella et al. (2010) who recovered anthrax organisms from fly spots
mainly 2 to 12 h after an infective feeding, with a peak at 10 h, but no longer than 24 h.
Calliphoridae flies can live up to 5 weeks so they can act as vectors for a substantial
period of time. In addition, some species usually move up to 6 km and sometimes up to
Capítulo 4
149
32 km (Cragg and Hobart, 1955; Braack and De Vos, 1990), so its role as mechanical
vectors of C. botulinum type C/D spores should not be underestimated.
Fig.4. Percentage of flies (N=12) that excreted C. botulinum type C/D after an infective feeding.
4. Perspectives
These results highlight the importance of prompt removal and proper disposal, by
burying or burning, of bird carcasses so as to avoid the propagation of the outbreaks by
flies. Studies about the efficiency of fly-control to prevent the spreading of botulism
outbreaks would be necessary to determine the real importance of flies in the
epidemiology of the outbreaks. For example, it has been demonstrated that fly-control
can reduce the incidence of human diseases, such as shigellosis, by 40-85% (Cohen et al,
1991; Farag et al, 2013) and the prevalence of Campylobacter spp.–positive poultry
Tesis doctoral – Ibone Anza Gómez
150
flocks by 77% (Bahrndorff et al, 2013). New experiments are needed for understanding
the real epidemiological potential of Calliphoridae as it would be crucial to know if flies
only act as mechanical vectors of C. botulinum spores or if they are also bioenhancers of
transmission following spore germination and replication in their intestinal tract as it has
been demonstrated for other pathogens (Fasanella et al., 2010). Finally, from the
ecological point of view, it is interesting to point out that the relationship between C.
botulinum type C/D and blowflies has characteristics of a mutualism because both
organisms take advantage of it (Landry, 2012; Herre et al., 1999). Carrion in nature is an
unexpected, ephemeral and patchy nutrient-rich resource for a variety of living
organisms. These ephemeral patches support high levels of diversity where direct and
indirect interactions occur between vertebrates, insect species and microbes that compete
for the same resource (Barton et al., 2013). In this framework, C. botulinum type C/D is a
poor competitor and its growth is limited by other bacteria in sediments (Sandler et al.,
1998), so in turn, it produces a lethal toxin that kills vertebrates generating carcasses
where it multiplies more easily. Meanwhile, maggots also grow in those carcasses,
accumulate the botulinum toxin -without suffering its effects- and carry the toxin and C.
botulinum cells to new healthy birds, spreading the outbreaks and creating new organic
resources for both, C. botulinum and flies. Moreover, flies can act as vectors of C.
botulinum type C/D cells, thus increasing the probabilities of toxin production in the
carcasses where they lay eggs. Without flies, the chances for C. botulinum type C/D to
kill/colonize new birds (via maggots) or carcasses (via flies) in nature would be reduced
or non-existent and, maybe, some fly phenotypes are dependent upon this relationship.
Capítulo 4
151
Acknowledgments
We thank the cooperation of staff from the Tablas of Daimiel National Park and
of the environmental agents from Castilla-La Mancha (JCCM). We also thank Miguel
Carles-Tolrá for helping with the identification of the fly families. This study was
supported by the Spanish Ministry of Environment (grants OAPN 099/2003 and OAPN
035/2009). Ibone Anza was supported by a JAE PRE grant from CSIC.
References
Anza, I., Skarin, H., Vidal, D., Lindberg, A., Båverud, V., Mateo, R. 2014a. The same
clade of Clostridium botulinum strains is causing avian botulism in southern and
northern Europe. Anaerobe 26, 20-23.
Anza, I., Vidal, D., Laguna, C., Díaz-Sánchez, S., Sánchez, S., Chicote, A., Florín, M.,
Mateo, R. 2014b. Eutrophication and bacterial pathogens as risk factors for avian
botulism outbreaks in wetlands receiving effluents from urban wastewater
treatment plants. Applied and Environmental Microbiology 80, 4251-4259.
Bahrndorff, S., Rangstrup-Christensen, L., Nordentoft, S., Hald, B. 2013. Foodborne
Disease Prevention and Broiler Chickens with Reduced Campylobacter Infection.
Emerging Infectious Diseases 19, 425-430.
Barton, P.S., Cunningham, S.A., Lindenmayer, D.B., Manning, A.D. 2013. The role of
carrion in maintaining biodiversity and ecological processes in terrestrial
ecosystems. Oecologia 171, 761-772.
Braack, L.E., De Vos, V. 1990. Feeding habits and flight range of blow-flies
(Chrysomyia spp.) in relation to anthrax transmission in the Kruger National Park,
South Africa. Onderstepoort Journal of Veterinary Research 57, 141-142.
Tesis doctoral – Ibone Anza Gómez
152
Cohen, D., Green, M., Block, C., Slepon, R., Ambar, R., Wasserman, S.S., Levine, M.M.
1991. Reduction of transmission of shigellosis by control of houseflies (Musca
domestica). Lancet 337, 993–997.
Cragg, J.B., Hobart, J. 1955. A study of a field population of the blowflies Lucilia caesar
(L.) and L. sericata (MG.). Annals of Applied Biology 43, 645-663.
Defilippo, F., Luppi, A., Maioli, G., Marzi, D., Fontana, M.C., Paoli, F., Bonilauri, P.,
Dottori, M., Merialdi, G. 2013. Outbreak of type C botulism in birds and
mammals in the Emilia Romagna region, northern Italy. Journal of Wildlife
Diseases 49, 1042-1046.
Duncan, R.M., Jensen, W.L. 1976. A relationship between avian carcasses and living
invertebrates in the epizootiology of avian botulism. Journal of Wildlife Diseases
12, 116–126.
Evelsizer, D.D., Bollinger, T.K., Dufour, K.W., Clark, R.G. 2010a. Survival of radio-
marked mallards in relation to management of avian botulism. Journal of Wildlife
Diseases 46, 864–877.
Evelsizer, D.D., Clark, R.G., Bollinger, T.K. 2010b. Relationships between local carcass
density and risk of mortality in molting mallards during avian botulism outbreaks.
Journal of Wildlife Diseases 46, 507-513.
Farag, T.H., Faruque, A.S., Wu, Y., Das, S.K., Hossain, A., Ahmed, S., Ahmed, D.,
Nasrin, D., Kotloff, K.L., Panchilangam, S., Nataro, J.P., Cohen, D., Blackwelder,
W.C., Levine, M.M. 2013. Housefly population density correlates with shigellosis
among children in Mirzapur, Bangladesh: a time series analysis. PLoS Negl Trop
Dis 7, e2280. doi:10.1371/journal.pntd.0002280.
Capítulo 4
153
Fasanella, A., Scasciamacchia, S., Garofolo, G., Giangaspero, A., Tarsitano, E., Adone,
R. 2010. Evaluation of the house fly Musca domestica as a mechanical vector for
an anthrax. PLoS ONE 5: e12219. doi:10.1371/journal.pone.0012219.
Herre, E.A., Knowlton, N., Mueller, U.G., Rehner, S.A. 1999. The evolution of
mutualisms: exploring the paths between conflict and cooperation. Trends in
Ecology and Evolution 14, 49-53.
Hubálek, Z., Halouzka, J. 1991. Persistence of Clostridium botulinum type C toxin in
blow fly (Calliphoridae) larvae as a possible cause of avian botulism in spring.
Journal of Wildlife Diseases 27, 81–85.
Landry, C. 2012. Mighty mutualisms: The nature of plant-pollinator interactions. Nature
Education Knowledge 3, 37.
Lindberg, A., Skarin, H., Knutsson, R., Blomqvist, G., Båverud, V. 2010. Real-time PCR
for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering a
chimeric C/D sequence-application on outbreaks of botulism in poultry.
Veterinary Microbiology 146, 118-123.
Lindsay, S.W., Lindsay, T.C., Duprez, J., Hall, M.J.R., Kwambana, B.A., Jawara, M.,
Nurudeen, I.U., Sallah, N., Wyatt, N., D’Alessandro, U., Pinder, M., Antonio., M.
2012. Chrysomya putoria, a putative vector of diarrheal diseases. PLoS Neglected
Tropical Diseases 6, e1895. doi:10.1371/journal.pntd.0001895.
Nazni, W.A., Seleena, B., Lee, H.L., Jeffery, J.T., Rogayah, T.A., Sofian, M.A. 2005.
Bacteria fauna from the house fly, Musca domestica (L.). Tropical Biomedicine
22, 225-231.
Norris, K.R. 1965. The bionomics of blow flies. Annual Review of Entomology 10, 47–
68.
Tesis doctoral – Ibone Anza Gómez
154
Reed, T.M., Rocke, T.E. 1992. The role of avian carcasses in botulism epizootics.
Wildlife Society Bulletin 20, 175-182.
Rocke, T.E., Bollinger, T.K. 2008. Avian botulism. In Infectious diseases of wild birds.
Thomas, N.J., Hunter, D.B., Atkinson, C.T. (eds). Blackwell Publishing
Professional, Ames, Iowa, USA. p 377-416.
Rocke, T. E. 2006. The global importance of avian botulism. In Waterbirds around the
world. Boere, G.C., Galbraith, C.A., Stroud, D.A. (eds). The Stationery Office,
Edinburgh, UK. p 422-426.
Sandler, R.J., Rocke, T.E., Yuill, T.M. 1998. The inhibition of Clostridium botulinum
type C by other bacteria in wetland sediments. Journal of Wildlife Diseases 34,
830-833.
Sánchez-Hernández, L., Cifuentes, A., Jiménez, B., Mateo, R., González, R. 2008.
Detection of Clostridium botulinum neurotoxin coding genes: analysis of PCR
products by real time versus capillary gel electrophoresis methods. European Food
Research and Technology 227, 495–502.
Soos, C., Wobeser, G. 2006. Identification of primary substrate in the initiation of avian
botulism outbreaks. Journal of Wildlife Management 70, 43–53.
Turell, M.J., Knudson, G.B. 1987. Mechanical transmission of Bacillus anthracis by
stable flies (Stomoxys calcitrans) and mosquitoes (Aedes aegypti and Aedes
taeniorhynchus). Infection and Immunity 55, 1859–1861.
Vidal, D., Taggart, M.A., Badiola, I., Mateo, R. 2011. Real-time polymerase chain
reaction for the detection of toxigenic Clostridium botulinum type C1 in waterbird
and sediment samples: comparison with other PCR techniques. Journal of
Veterinary Diagnostic Investigation 23, 942–946.
Capítulo 4
155
Vidal, D., Anza, I., Taggart, M.A., Pérez-Ramírez, E., Crespo, E., Hofle, U., Mateo, R.
2013. Environmental factors influencing the prevalence of Clostridium botulinum
type C in non-permanent Mediterranean wetlands. Applied and Environental
Microbiology 79, 4264-4271.
Wobeser, G. 1997. Avian botulism – another perspective. Journal of Wildlife Diseases
33, 181–186.
Woudstra, C., Skarin, H., Anniballi, F., Fenicia, L., Bano, L., Drigo, I., Koene, M.,
Bäyon-Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012. Neurotoxin
gene profiling of Clostridium botulinum types C and D native to different
countries within Europe. Applied and Environmental Microbiology 78, 3120-
3127.
156
CAPÍTULO 5
Diferencias en la susceptibilidad al botulismo y en la excreción
de C. botulinum tipo C/D entre especies de aves acuáticas
Fototrampeo en la laguna de Pozuelo de Calatrava, Ciudad Real. Fotografía de Ibone Anza
Anza, I., Vidal, D., Feliu, J., Crespo, E., Mateo, R. In preparation. Differences in
susceptibility to avian botulism and C. botulinum type C/D excretion between waterbird
species.
Capítulo 5
157
Diferencias en la susceptibilidad al botulismo y en la excreción de C. botulinum tipo
C/D entre especies de aves acuáticas
RESUMEN
El botulismo aviar mata miles de aves acuáticas todos los años incluyendo especies en
peligro. Las aves que portan y mueren con C. botulinum tipo C/D en su tracto
gastrointestinal son un factor clave para el inicio y propagación de los brotes. En este
estudio, estimamos la susceptibilidad al botulismo de 11 especies de aves acuáticas
comunes en humedales mediterráneos, analizando el número de aves muertas o enfermas
de cada especie en función del censo de individuos en riesgo en diferentes momentos
durante el periodo de brote. Además, analizamos la presencia de C. botulinum tipo C/D
en hisopos cloacales, muestras de heces e invertebrados acuáticos recogidos durante
periodos con brote y sin brote. Encontramos diferencias en la susceptibilidad al botulismo
entre especies, probablemente relacionados con el tipo de alimentación, y posiblemente
resistencia innata. También el uso temporal del humedal afectó al número de aves
muertas de ciertas especies. La presencia de la especie invasora de caracol acuático,
Physella acuta, podría ser un importante conductor en la epidemiología de los brotes, ya
que un alto porcentaje de ellos (30%) portan el patógeno durante los brotes. La excreción
de C. botulinum por aves acuáticas parece estar relacionado con la prevalencia del
patógeno en el medio y la fisiología digestiva de cada especie. Así, nuestros resultados
muestran que especies herbívoras como las fochas (Fulica atra) y los ánades frisos (Anas
strepera) pueden tener un papel más importante en la dispersión del botulismo porque
mantienen y excretan el patógeno durante más tiempo. La globalmente amenazada
malvasía cabeciblanca (Oxyura leucocephala) mostró una tasa de mortalidad durante los
Tesis doctoral – Ibone Anza Gómez
158
brotes estudiados de entre el 7 y el 17% del número máximo de animales censados, lo que
hace del botulismo un factor de riesgo importante para la conservación de la especie.
Capítulo 5
159
Differences in susceptibility to avian botulism and C. botulinum type C/D excretion
between waterbird species.
ABSTRACT
Avian botulism kills thousands of waterbirds every year including endangered species.
Birds that carry and die with C. botulinum type C/D in their gastrointestinal tract are a
key factor for initiating and spreading these outbreaks. We estimated the susceptibility to
botulism of 11 common waterbird species in Mediterranean wetlands by analyzing the
number of death and sick birds of each species in relation to the number of life
individuals counted. Additionally, we analyzed the presence of C. botulinum type C/D in
waterbird cloacal swabs, fecal samples and aquatic invertebrates collected during
outbreak and non-outbreak periods. We found differences among species in their
susceptibility to botulism, probably related with feeding habits and, possibly, genetic
resilience. Also the temporal wetland use patterns influenced the number of dead birds of
certain species. The invasive water snails, as Physella acuta, may be an important driver
in the botulism epidemiology, because 30% of samples tested positive to the BoNT gene
during outbreaks. The excretion of C. botulinum by waterbirds seemed to be related with
the prevalence of the pathogen in the environment and the digestive physiology of the
species. Our results show the possibility that some herbivorous waterbirds like coots
(Fulica atra) and gadwalls (Anas strepera) may have a more significant role in the
dispersion of botulism than others, because they retain the pathogen for longer periods.
The globally endangered white-headed duck (Oxyura leucocephala) showed mortality
rates in the studied outbreaks of 7 and 17% of the maximum census, which highlights
botulism as an important risk factor for the conservation of the species.
Tesis doctoral – Ibone Anza Gómez
160
1. Introduction
Avian botulism is an intoxication characterized by a severe flaccid paralysis of the
muscles and final death by respiratory failure caused by the botulinum neurotoxins
(BoNT) produced by Clostridium botulinum (Rocke and Friend, 1999). Botulism
outbreaks in freshwater waterbirds are generally caused by C. botulinum type C (Rocke,
2006) though, in recent years, it has been shown that in Europe a more lethal mosaic type
C/D is widely spread (Woudstra et al., 2012; Anza et al., 2014a). In the Great Lakes of
North America, type E also causes botulism outbreaks in fish eating birds (Shutt et al.,
2014). Outbreaks mostly occur between summer and autumn, when high temperatures
allow the multiplication and toxigenesis of C. botulinum on bird carcasses. Then, an
exponential process known as “the carcass maggot-cycle” triggers the outbreak when
healthy birds feed on toxin (and bacteria)-loaded maggots from each carcass and die
(Reed and Rocke, 1992; Wobeser, 1997; Rocke, 2006). Factors such as pH between 7.5
and 9, low redox potential, increasing temperature, decreasing turbidity, low salinity,
eutrophication, high invertebrate density and bird abundance has also been associated
with botulism risk in wetlands (Rocke and Samuel, 1999; Murray and Hamilton, 2010;
Anza et al., 2014b). Mortality varies between years and places, from hundreds to
thousands of birds may die in a single outbreak (Friend et al., 2001; Vidal et al., 2013).
Botulism stands as one of major diseases of waterbirds because it causes high
losses, affects a broad spectrum of species, occurs annually and seems to be increasing its
geographic area (Friend et al., 2001). Populations of species that are numerous and
geographically widespread may cope with sporadic and sudden high losses (i.e. mallard
Anas platyrhynchos or coots Fulica atra), while populations of endangered or local
Capítulo 5
161
species are more vulnerable and a single botulism outbreak may have catastrophic
consequences for their viability (Rocke, 2006). For example, in 1996 botulism killed
almost 15-20% of the western metapopulation of American white pelican (Pelecanus
erythrorhynchos) (Rocke et al., 2005). Later on, it killed a relevant number of individuals
of two critically endangered species, the black-faced spoonbill (Platalea minor) in
Taiwan and the Laysan duck (Anas laysanensis) in Hawaii (Chou, 2008; Work et al.,
2010). Botulism has also been linked with the local extintion of the breeding population
of great black-backed gulls (Larus marinus) in eastern Lake Ontario (Shutt et al., 2014)
and with declines in the population of pintail ducks (Anas acuta) in the United States
(Friend et al., 2001). In Spain, two threatened species such as the white-headed duck
(Oxyura leucocephala) and the ferruginous duck (Aythya nyroca) regularly die during
botulism outbreaks (Vidal et al., 2013). In addition, white-headed duck in the study area
usually breeds in highly eutrophic wetlands receiving the effluent of wastewater
treatment plants, where the risk of botulism outbreaks has been found to be elevated
(Vidal et al., 2013; Anza et al., 2014b).
Susceptibility to botulism intoxication differs between bird species and only
vultures seem to be resistant (Rocke and Friend, 1999). Foraging behavior is probably a
significant factor influencing this susceptibility, because dabbling waterfowl and
shorebird species that feed near the surface seem to be more prone to intoxication than
diving ducks or probers (Rocke and Friend, 1999; Adams et al., 2003; Vidal et al., 2013).
However, the susceptibility to botulism of multiple waterbird species has never been
quantitatively evaluated taking into account the census of individuals at risk during the
outbreaks.
Host-pathogen relationships are determinant to understand the ecology of
diseases. In the case of botulism, the role of carrier birds is unclear, as it is not known for
Tesis doctoral – Ibone Anza Gómez
162
how long a bird may maintain spores/cells in its gastrointestinal track or whether the
disease is always an intoxication, or if toxicoinfection could exist when the toxin is
produced in the gastrointestinal track. For instance, Reed and Rocke (1992) reported that
21 of 40 healthy mallards (Anas platyrhynchos) from wetlands where botulism outbreaks
have occurred carried C. botulinum spores in their intestinal tract. We also suggested that
waterbirds can spread this bacterium with their feces (Anza et al, 2014b). In fact, the
similarity of the same strains of C. botulinum type C/D in both extremes of the Palearctic
migratory flyway (Sweden and Spain) may respond to this role of waterbirds as carriers
of this bacterium (Anza et al., 2014a).
With this study, we aim to (1) estimate differences in the susceptibility to
botulism of the most common waterbirds inhabiting wetlands of Central Spain, including
the globally endangered white-headed duck, (2) to find sources of the bacterium (aquatic
invertebrates) that could explain differences in the susceptibility of the waterbirds species
related to diet, and (3) to investigate the role of healthy and intoxicated birds as dispersers
of C. botulinum type C/D through fecal excretion.
2. Material and methods
2.1 Study area
The study area consisted of four wetlands in Castilla-La Mancha, a flat region
situated in the Central Spanish Plateau mostly devoted to agriculture. Tablas de Daimiel
is a National Park (TDNP), a Special Protection Area for Birds and it is included in the
Ramsar List. It protects the remaining 1,675 ha of a floodplain wetland that 50 years ago
comprised 6,000 ha. Navaseca lake (24.3 ha) is located in the vicinity of TDNP (about
6.5 km) and close to the town of Daimiel. This wetland was seasonal in the past, but now
Capítulo 5
163
it is permanently flooded and highly eutrophic, because it receives the effluent of a
wastewater treatment plant. Prado lake (50.5 ha) close to the town of Pozuelo de
Calatrava is a temporary, endorheic, saline wetland included in the Ramsar List. It also
receives inputs of treated wastewater, so the quality of its water is often deteriorated.
Finally, Calderon lake (49.8 ha) near the town of Moral de Calatrava is also a temporary
and endorheic wetland. All these wetlands are winter refuge and/or breeding site of a
variety of waterbird species including endangered species such as the crested coot (Fulica
cristata), white-headed duck, ferrugineous duck or marbled teal (Marmaronetta
angustirostris). Avian botulism is endemic in the region, where outbreaks have been
attributed to the mosaic C. botulinum type C/D (Vidal et al., 2013; Anza et al., 2014a).
The climate in this area is cold-temperate continental, with a pronounced dry season and
annual rainfall of around 400 to 500 mm. All the wetlands studied are between 603 and
670 m above sea level.
2.2 Counts of living and dead waterbirds
Waterbird counts of live adults and subadults of different species were made just
after sunrise by using binoculars and a telescope at selected points along the shore of
Navaseca lake during outbreak periods. In 2011, five counts were made between July and
August with intervals of around 15 days. In 2012, nine counts were made between the
second half of June and August at weekly intervals (except one missing count at the end
of July). During these periods, one person surveyed the shore of Navaseca every morning
(except weekends), and collected dead and sick birds. Once a week, the survey was also
made by boat to collect dead birds from several small islands located in the center of the
lake. After identifying the species, dead birds were buried in the surrounding fields by
Tesis doctoral – Ibone Anza Gómez
164
Daimiel town council staff, and sick birds were sent to the provincial wildlife
rehabilitation center that belongs to the regional government (Joint of Commonalities of
Castilla-La Mancha, JCCM).
2.3 Sampling of aquatic invertebrates
During outbreak periods, aquatic invertebrates and fishes were sampled in
Navaseca, Prado and Calderon lakes in 2011, and water snails were also sampled in
Navaseca in August 2012. Aquatic invertebrates were captured from the water with a 0.5
mm-mesh-size sieve and aquatic snails were collected with forceps. They were kept alive
in sterile plastic containers until analysis in the following 24 h. In the laboratory, they
were identified and pooled according, at least, to the taxonomic family. Samples of
invertebrates and fishes included specimens of non-biting midge’s larvae (Chironomidae,
n=15), water boatmen (Corixidae, n=24), back swimmers (Notonectidae, n=4),
crustaceans (Ostracoda, Copepoda and Cladocera; n=15), freshwater snails (Physidae,
n=53), beetle larvae (Coleoptera, n=5), mayfly larvae (Ephemeroptera, n=3), soldier fly
larvae (Stratiomyidae, n=2) and mosquito fish (Gambussia affinis, n=8).
2.4 Sampling of waterbird feces and live bird cloacal swabs
Waterbird fecal samples were collected during outbreak and non-outbreak periods
(Table 1). Fecal sampling during outbreak periods was performed in 2011 between late
July and October in Navaseca (n of sampling visits (ns) = 4), Pozuelo (ns = 1) and Moral
lakes (ns = 1). Fecal sampling during non-outbreak periods was performed in 2011
between June and early July in Navaseca (ns = 3) and between August and October in
TDNP (ns = 3); and in 2012, between January and April in Navaseca (ns = 5) and in
Capítulo 5
165
Tablas de Daimiel National Park (ns = 1). In each sampling, around 30 waterbird (ducks,
rails, shorebirds and gulls) fecal samples were collected with sterile swabs and kept at 4
ºC in plastic bags with zip closure until processing during the next 24 h.
Waterbirds bait trapping was done at Navaseca lake once per season in 2012,
using funnel traps on the shore of the lake, were groups of moorhens usually feed. In
previous studies, monitoring of faeces showed the presence of C. botulinum in 2.9% of
droppings of rails, including moorhens (Gallinula chloropus), which suggested that
healthy birds of this species could be carriers of the bacteria (Anza et al., 2014b). Traps
were baited with grain and checked every hour. Captured birds were removed and held in
bags before ringing and sample collection. Birds were marked with a metal ring,
weighed, and tarsus, beak and wing length measured. Age (juvenile or adult) was
determined using plumage criteria (Baker, 1993). A cloacal sample was taken with a
sterile swab and kept in a sterile transport container (APTACA, Copan) until analysis.
After sampling, the birds were released. Cloacal swab samples were also taken from
recaptured birds. A total of 89 moorhens, 1 water rail (Rallus aquaticus) and 1 mallard
were captured in the funnels; from these, 46 individuals were adults, 38 sub-adults and 7
chicks. Nineteen moorhens were recaptured once, two were recaptured twice and one was
recaptured three times. As a reference sample, between March and April 2012, 19
moorhens, 1 coot and 11 mallards were trapped and sampled in Ebro Delta (NE Spain),
where botulism outbreaks are uncommon.
2.5 Fecal excretion of C. botulinum by botulism affected birds
In 2012, botulism intoxicated waterbirds collected during two botulism outbreaks
from Navaseca and Pozuelo lakes were monitored to study the chronology of fecal
Tesis doctoral – Ibone Anza Gómez
166
excretion of C. botulinum type C/D after admission at the regional wildlife rehabilitation
center. Upon admission, birds were marked with color plastic bands and a cloacal sample
was taken with a sterile swab that was kept in a transport container (APTACA, Copan).
The following five days, birds were maintained in nursing pens and received
support treatment consisting on antibiotic therapy (Marbocyl 2%, Vetoquinol), vitamin
complex (Duphafrarl Multi, Pfizer), intravenous fluids (Ringer-lactate) and tube feeding.
During this period another two cloacal swabs were taken on days 3 and 5. After this time,
if birds were recovered they were taken to a bigger enclosure before being released.
During this period, cloacal swabs were taken when birds needed to be handled and before
they were released. The intended sampling scheme was to collect cloacal samples at two
days intervals; however, due to the different times of recovery of each bird and to avoid
interfering with the center´s staff work, the sampling scheme was variable. To confirm
botulism, blood samples from four waterbirds (three from Navaseca and one from
Pozuelo) admitted to the center in a critical condition were collected from the jugular
vein following euthanasia and the sera was tested for botulinum toxin C by the mouse
bioassay neutralization test (CDC, 1998).
2.6 Camara trapping of waterbirds near carcasses in wetlands
To see if waterbirds feed on or around carcasses, camera traps were installed
pointing to bird carcasses located in the shore of Navaseca and Pozuleo lakes during
outbreak periods. In Navaseca, the camera was installed in an island during 4 days in
August 2012. In Pozuelo the camera was installed during 6 days in September 2013 in 3
different locations: 2 days in the surrounding shore, 2 days in one island and 2 days in
another island.
Capítulo 5
167
2.7 C. botulinum type C/D detection
Cloacal swabs, bird faeces and aquatic invertebrates were processed for detection
of C. botulinum type C/D as previously described by Vidal et al. (2011). Briefly, samples
were cultured in 9 ml of commercial cooked meat broth supplemented with vitamin K1,
glucose and hemine (BD BBL Cooked meat medium with glucose, hemin and vitamin K)
using an anaerobe container system (BD GasPakTM 129 EZ) over a period of 3 days at
37 °C. DNA was extracted by boiling the pellet obtained from 1 ml of the culture broth in
300 µl of distilled water. The solution obtained after centrifugation was used as PCR
template. Real time PCR was performed according to Sánchez-Hernández et al. (2008)
for the detection of the genes encoding both type C and type C/D mosaic toxins.
2.8 Statistical analysis
The differences in the susceptibility to botulism between species were studied
with the data of the recorded mortality relative to the census in the previous days (1-2
weeks) in the same wetland. The relative susceptibility of each species was estimated
from the relationship between number of dead birds and census data. This model was
calculated with a General Linear Model procedure with a negative binomial distribution
of counts to avoid over dispersion of data and including date as a covariate. Census date
was expressed as the number of days since the 1st of June. Count of dead/sick birds
recorded between censuses was used as dependent variable, the count of living
individuals recorded in each census, julian day and quadratic julian day of census as
covariables and the year as fixed factor. Then, the standardized residuals of the model
were plotted for each species to obtain the distance of their observed mortality values
from the expected values. Only the most abundant species were considered, i.e. Anatidae
Tesis doctoral – Ibone Anza Gómez
168
(5 species): mallard (Anas platyrhynchos), gadwall (Anas strepera), northern shoveler
(Anas clypeata), European pochard (Aythya ferina), and white-headed duck (Oxyura
leucocephala); Rallidae (2 species): moorhen (Gallinula chloropus) and coot (Fulica
atra); black-necked grebe (Podiceps nigricolli), black-winged stilt (Himantopus
himantopus), black-headed gull (Chroicocephalus ridibundus), and flamingo
(Phoenicopterus roseus). This approach was preferred over a comparison of prevalence
or incidence, because these two parameters would be more biased in case of low live bird
counts. Mortality was also calculated as percentage of death/sick individuals of each
species over the maximum number of individuals of the species recorded in the lagoon.
Fisher exact probability test was used to compare the frequency of detection of C.
botulinum type C/D in bird feces samples collected during outbreak and non-outbreak
periods. It was also used to compare the frequency of the pathogen in cloacal swabs of
different bird species at the wildlife rehabilitation center. Significance for the statistical
analyses was set at P < 0.05. The analyses were performed with IBM SPSS Statistics
19.0.0.
3. Results
3.1 Susceptibility of avian species to botulism
During the census performed in Navaseca lake between 2011 and 2012, 17,574
observations (times that a species is counted) of the 11 selected species were made. The
most common species were coot (4,936 observations), flamingo (2,137), northern
shoveler (2,021), white headed-duck (1,826), black-necked-grebe (1,541), mallard
(1,328), and moorhen (1,183), but differences in the abundance of some species (i.e.
black-headed gull, coot and shoveler) were observed between 2011 and 2012 (Fig. 1A).
Capítulo 5
169
During the same period, 646 dead or sick birds were collected, 357 in 2011 and 289 in
2012 (Fig. 1B).
0 50 100 150 200 250 300 350 400 450 500
Mallard
Shoveler
Gadwall
White-headed duck
Pochard
Coot
Moorhen
Black-winged stilt
Black-headed gull
Black-necked grebe
Flamingo2011
2012
0 20 40 60 80 100 120 140
Others
Mallard
Shoveler
Gadwall
White-headed duck
Pochard
Coot
Moorhen
Black-winged stilt
Black-headed gull
Black-necked grebe
Flamingo2011
2012
Fig. 1. A. Mean number of waterbirds observed (observations) in Navaseca lake during botulism
outbreaks from June to August in 2011 (5 census) and 2012 (9 census). B. Number of dead/sick
waterbirds collected in 2011 and 2012 in Navaseca lake during botulism outbreaks.
In 2011, the first waterbird carcasses were observed in the third week of July and the
number of dead birds increased until mid-August, the last dead birds were collected at the
beginning of October. In 2012, the first dead birds appeared in mid-June and the number
of dead or sick birds reached a peak at the end of June, then it decreased until the end of
August (Fig. 2).
B
A
Tesis doctoral – Ibone Anza Gómez
170
Fig. 2. Number of birds counted (black line) during the census of 2011 and 2012 in Navaseca lake
and the number of death/sick birds collected weekly (in bars) during the botulism outbreaks.
The numbers of affected birds from certain species varied between years:
shovelers, gadwalls, white-headed ducks, moorhens and black-winged stilts were more
affected in 2011, while mallards, gulls, grebes and coots were more affected in 2012 (Fig.
1B). Regarding to the percentage of death/sick birds in relation to the maximum number
of birds counted each year (% in 2011-2012) the most affected birds were: the gadwall
(89-24%), black-winged stilt (85-2%), coot (53-17%), black-headed gull (43-9%),
mallards (11.6-24.7%), pochard (17-11%) and white-headed duck (17-7%). GLM
analysis showed a significant relationship between the number of living birds and the
Capítulo 5
171
number of sick/dead birds for each species at each “between-census” period (Wald’s χ2=
41.34; P<0.001), between the number of dead birds and the julian day of census (Wald’s
χ2= 5.31; P=0.02) and quadratic julian day of census (Wald’s χ
2= 3.94; P=0.05) and that
in 2011 the number of affected birds was significantly higher than in 2012 (Wald’s
χ2=22.46; P<0.001). The plot of the standardized residuals revealed that mallards, coots,
gulls and gadwalls were the most susceptible species to botulism intoxication, while
flamingos and grebes the less susceptible (Fig. 3).
Fig. 3. Susceptibility of different waterbird species to botulism intoxication based on standardized
residuals from GLM, presented as mean ± 95% confidence interval.
Model: Number dead birds = living birds + julian day + julian day2 + year
Tesis doctoral – Ibone Anza Gómez
172
3.2 Detection of C. botulinum type C/D in potential prey of white-headed duck and other
waterbird species
C. botulinum BoNT-C/D gene was detected in 16 out of 53 (30%) samples of
freshwater snails (Physella acuta) and in two out of two soldier fly larvae
(Stratiomyidae). None of the other samples of aquatic invertebrates or fishes yielded C.
botulinum BoNT-C/D genes (Table 1).
Table 1. Aquatic invertebrates collected in Navaseca during botulism outbreaks tested for the
BoNT C/D gene.
Type of invertebrate BoNT-C/D gene positive/total
no of samples analyzed (%)
Snails 16/53 (30)
Beetles 0/5
Water boatmen 0/24
Back swimmer 0/4
Crustacea 0/15
Mayfly 0/3
Soldier fly larvae 2/2 (100)
Fishes 0/8
Chironomids 0/15
Total 18/129
3.3 Excretion of C. botulinum type C/D by free-living birds
None of the 117 cloacal swabs from healthy birds captured in the funnel traps in
Navaseca lake yielded BoNT-C/D genes (Table 2), and neither did the 31 cloacal swabs
from the waterbirds captured in Ebro Delta. During non-outbreak periods 0.8% (N=365)
of waterbird faeces samples yielded BoNT-C/D genes, while during outbreak periods
16.3% (N=153) of faecal samples yielded it; being this difference significant (Fisher
Capítulo 5
173
exact test, P<0.0001; Table 2). Regarding to the excretion by type of bird, 23% of rail
fecal samples, 16% of shorebirds samples and 9% of ducks samples yielded BoNT-C/D
genes when collected during botulism outbreaks; these percentages where not statistically
different. Out of outbreak periods, 1.4% of fecal samples of rails and 1.9% of shorebirds
yielded the gene, while duck samples were negative.
As for the sick birds admitted to wildlife rehabilitation center with botulism signs,
69 individuals from nine species where sampled, 32 of them were finally released and 37
died during the recovery process. Twenty-six (37.7%) of the birds excreted C. botulinum
BoNT-C/D genes at some time during the period at the wildlife rehabilitation center. The
excretion decreased with the time at the center, from 30% BoNT-C/D gene positive
cloacal swabs the day 1 to 0% the day 7; though two individuals, a coot and a gadwall,
excreted it again after the 7th
day, just before being released. Ducks (Anatidae) and rails
(Rallidae) excreted the BoNT-C/D genes more often (P <0.05) and for longer time than
gulls (Laridae) (Fig. 4; Table S1 in supplemental material).
3.4 Camera trapping
The cameras took pictures of different species of shorebirds [common snipes
(Gallinago gallinago), green sandpipers (Tringa ochropus), little ringed plover
(Charadrius dubius), northern lapwings (Vanellus vanellus)], moorhens and mallards
feeding near the carcasses. The camera located in the surrounding shore of Pozuelo lake
took a picture of a fox (Vulpes vulpes) picking up one of the carcasses (Fig. S1)
Tesis doctoral – Ibone Anza Gómez
174
Table 2. Comparison of the prevalence of BoNT-C/D gene in healthy waterbird cloacal swabs and
in feacal samples collected during botulism outbreak and non-outbreak periods.
Wetland status Season Wetland Positive/total (%)
Cloacal swabs Bird faeces
Non-outbreak Early summer 2011 Navaseca - 1/83 (1.2)
Summer 2011 Tablas - 1/62 (1.6)
Autumn 2011 Tablas - 0/34
Winter 2012 Navaseca 0/44 1/106 (0.9)
Spring 2012 Navaseca 0/34 1/56 (1.8)
Tablas - 0/24
Autumn 2012 Navaseca 0/28 -
Total 0/106 4/365 (0.8)
Outbreak Summer 2011 Navaseca - 20/96 (20.8)
Pozuelo - 2/24 (8.3)
Early autumn 2011 Navaseca - 2/27 (7.4)
Autumn 2011 Moral - 0/28
Summer 2012 Navaseca 0/9 1/6 (16.6)
Total 0/9 25/153 (16.3)*
*Prevalence during “outbreak “significantly higher than during “non-outbreak” (Fisher exact test, p<
0.0001).
Fig. 4. Excretion of C. botulinum BoNT-C/D gene by different families of sick waterbirds during
the recovery process at a wildlife rehabilitation centre after a botulism outbreak.
Capítulo 5
175
4. Discussion
In this study, we have observed that susceptibility of different species of
waterbirds to botulism intoxication varied, i.e. mallards and coots were more susceptible
than flamingos and grebes; this was probably influenced by feeding behavior and
temporal wetland use patterns, but some genetic resilience could not be discarded.
Moreover, C. botulinum type C/D toxin genes could be detected in waterbird faeces year
round, at a very low frequency out of outbreak periods and at a markedly higher
frequency during outbreak periods, which shows that waterbirds may harbor C. botulinum
type C/D in their gastrointestinal tract and may act as dispersers of the pathogen between
wetlands. In addition, if these carrier birds die, their carcasses may become substrate for
the growth of C. botulinum and contribute to the start and spreading of the outbreaks; but
do all waterbird species contribute equally to the epidemiology and dispersal of botulism?
Based on the GLM analysis, the most susceptible species in our study were
mallards, followed by coots, black-headed gulls and gadwalls, and the less were
flamingos and grebes; the rest of species seemed to be similarly affected. Accordingly,
the most affected waterbirds during avian botulism outbreaks reported in previous studies
in Spain were mallards, coots, common teals (Anas crecca), black-headed gulls and
shovelers (Contreras de Vera et al., 1987; Vidal et al., 2013); though neither of these
studies took into account the number of healthy individuals of each species at risk of
botulism intoxication. Interestingly, in a previous study carried out in our same study area
which included 13 botulism outbreaks and around 20,000 death waterbird, only 8
individuals of the white-headed duck (“endangered” in the IUCN Red List of Threatened
Species; BirdLife International, 2012) were reported (Vidal et al., 2013), which may have
led to think that this species is not sensitive to botulism. By contrast, in the present study,
Tesis doctoral – Ibone Anza Gómez
176
just during two outbreaks, a total of 43 dead white-headed ducks were collected, which
represented the 7 and the 17% of the maximum census in Navaseca lagoon during 2011
and 2012 respectively. This difference is probably due to the increase in the population of
this species in the last decades in Castilla-La Mancha and it confirms that botulism may
affect the recovery of this species, which is particularly relevant because white-headed
ducks are attracted by wastewater wetlands (Hadad and Moyal, 2007), such as Navaseca,
where the risk of botulism outbreaks is high (Anza et al., 2014b).
Differences in feeding habits may explain variations in susceptibility to botulism
(Rocke, 2006). This fact also indicates that the BoNT toxin concentrates in specific
compartments (i.e. invertebrates) of the wetlands. For example, in a study performed in a
Canadian prairie lake, surface feeder shorebirds seemed more prone to ingest botulinum
toxin than probers (Adams et al., 2003), and based on a literature review and over 2,000
diagnostic records at the USGS National Wildlife Health Center, dabbling ducks are
among the species at greater risk of botulism (Rocke, 2006). Accordingly, in our study,
diving ducks (white-headed duck and pochards) seemed to be less affected than dabbling
ducks and surface feeders (gadwall, mallard and coots). The feeding habits of the
majority of waterbirds are not accurately known and they probably change with the
seasons and the type of prey available in each wetland, which makes it very difficult to
identify possible sources of toxin for each species. Mallards and gulls, which were
between the most susceptible species in this study, are omnivorous and opportunistic
species (Cramps, 1998) and may ingest the botulinum toxin from a variety of sources, as
for example maggots from carcasses which are known to be a major source of toxin
(Duncan and Jensen, 1976; Rocke and Friend, 1999). Coots and gadwalls, also between
the most susceptible species, are mainly herbivorous (Cramps, 1998); so one source of
toxin for them may be freshwater snails which are frequently observed on plants and on
Capítulo 5
177
carcasses (personal observation). In this study 30% (N= 53) of freshwater snails (Physella
acuta) collected during outbreaks yielded BoNT-C/D genes; this snail eats detritus where
it may acquire C. botulinum and its toxin. Previous studies also reported an association
between water snails and carcasses and detected BoNT-C toxin in their tissues (Duncan
and Jensen, 1976). Interestingly, Physella acuta is a globally invasive species of
gasteropod originated in North America (Albrecht et al., 2009) and is characterized by a
high reproductive rate, high passive dispersal capacities and high tolerance to polluted
water (Bernot et al., 2005). Previous studies have linked invasive species with the
(re)emergence of avian botulism type E in several locations of the Great Lakes of North
America where the invasion of dreissenid mussels (Dreissena bugensis and Dreissena
polymorpha) and round gobies (Neogobius melanostomus) presumably have produced
habitat transformations and the development of anoxic conditions that favored C.
botulinum (Getchell and Bowser, 2006). It is possible that the invasive freshwater snails
also facilitate avian botulism outbreaks by serving as an important source of toxin for
waterbirds due to their abundance and their necrophagous habits. Further research about
toxin concentration in water snails is needed to determine their epidemiologic
importance. On their part, flamingos and black-necked grebes probably do not include
preys that harbor the botulinum toxin in their diets. Flamingos primarily feed on artemias
(Artemia spp.) or alternatively prey chironomid larvae (Deville et al., 2013) and black-
necked grebes actively prey on artemias and other invertebrates such as corixids (Varo et
al., 2011); we have analyzed a relevant number of samples of chironomids, corixids and
crustaceans and they did not yield BoNT C/D genes, including specimens captured during
outbreak periods (Anza et al., 2014b). Alternatively, as flamingos and grebes are
genetically closely related (Hackett et al., 2008), there is the possibility that these species
are more resistant to the toxin, as is the case of vultures (Rocke and Friend, 1999). With
Tesis doctoral – Ibone Anza Gómez
178
the images taken with the camera traps, we can confirm that some waterbirds could get
intoxicated while feeding near carcasses, which are the major source of toxin, and also
we point out that scavengers, such as foxes, may clean up a great proportion of the
carcasses in the surrounding area of the wetlands helping to the control of the outbreaks.
A bigger sampling effort with the camara trap would give further information about how
different waterbirds get intoxicated.
Another factor which influenced the number of dead birds of certain species due
to botulism was the temporal wetland use patterns, as it may be the case of shovelers and
black-winged stilts. In 2011, large flocks of shovelers arrived to Navaseca at the end of
summer coinciding with the peak of mortality and resulting in a high proportion of dead
shovelers. Meanwhile, in 2012, the peak of mortality occurred at the end of June when
they had not arrived to the wetland, so the proportion of dead shovelers was smaller. This
pattern explain the lower than expected susceptibility we recorded for this species, which
is a dabbling duck frequently reported between botulism bird losses (Vidal et al., 2013).
In the case of black-winged stilt, in 2012 the majority of individuals were count in
August when the peak of mortality had passed. This pattern explains the lower mortality
recorded in 2012 than in 2011 in spite of the higher number of individuals counted.
Similarly, Rocke et al. (2005) suggested that brown pelicans (Pelecanus occidentalis)
were more affected by botulism than white pelicans in the Salton Sea because they
arrived earlier in the season.
Very little has been published about excretion of C. botulinum by waterbirds. Our
results indicate that it is a reflection of the abundance of the bacteria in environment
because prevalence in feces (0.8% out of outbreak periods and 16.3% during outbreaks)
was similar to the reported prevalence in sediments (0-2.4% out of outbreak periods and
30% during outbreak periods; Anza et al., 2014b). In Austria, Zechmeinster et al. (2005)
Capítulo 5
179
reported BoNT-C gene in around 80% of waterbird fecal samples, which coincided with
the percentage of sediment positive samples. We did not find C. botulinum in cloacal
swabs of healthy birds indicating that they do not usually excrete it and that this
bacterium does not form part of the normal microbiota of waterbirds, though we cannot
discard that they harbored it in their caecum in small quantities undetectable with a
cloacal swab. Similarly, Hardy and Kaldhusdal (2013) did not find C. botulinum type
C/D in caecum samples from 100 healthy broiler flocks and concluded that botulism is a
sporadic and exogenously acquired event in broiler farms without history of botulism.
Supporting this hypotesis, Vidal et al. (2009) analyzed 24 caecum samples from mallard
hunted in Delta del Ebro where outbreaks are uncommon and all of them resulted
negative. Nevertheless, our findings suggest that C. botulinum passes through the
intestinal tract of healthy waterbirds after ingesting it along with sediment or food items,
and therefore waterbirds may disperse the pathogen, especially during outbreak periods
when the abundance of the microorganism in the environment is higher. Green et al.
(2002) stated that ducks, shorebirds and other waterbirds have great potential as
dispersers of aquatic organisms and that different bird species can have very different
roles in dispersal of specific aquatic organisms. Maximum retention time of propagules of
freshwater invertebrates and algae ingested by waterbirds may reach 24 hours
(Charalambidou and Santamaría, 2002) Moreover, Viana et al. (2013), by means of
mechanistic models, showed that up to 3.5% of estimated waterbirds seed dispersal
distances were longer than 100 km. If these data is applied to C. botulinum, waterbirds
may probably disperse it between distant wetlands. In this sense, the PFGE
characterization of C. botulinum type C/D strains isolated from botulism intoxicated bird
samples collected in Sweden and Spain showed that they were genetically very similar
(Anza et al., 2014a; Skarin et al., 2010), which supports the hypothesis that waterbirds
Tesis doctoral – Ibone Anza Gómez
180
may have spread C. botulinum type C/D during their migratory routes across Europe
(Woudstra et al., 2012).
The results obtained at the wildlife rehabilitation center showed that up to 37.7%
of sick birds may excrete C. botulinum type C/D and that, even under antibacterial
treatment, a few birds (6%) still excreted C. botulinum after the seventh day when they
were already recovered. Moreover, ducks and rails excreted C. botulinum type C/D more
often than gulls probably due to differences in the morphology of the digestive system. In
particular, the functionality of the caecum influences the retention time because it is
blind-ended and retains contents for longer periods of time (Clench and Mathias, 1992).
Moreover, anaerobic microbiota is predominant in this organ (Clench and Mathias,
1995), where C. botulinum has already been detected (Reed and Rocke, 1992; Vidal et
al., 2011). Ducks and rails have larger caecums than gulls and, in general, herbivores and
omnivores have larger caecums than piscivores and granivores (Clench and Mathias,
1995). In fact, in this study and a previous one, we found that the majority of positive
fecal samples belonged to rails (Anza et al., 2014b). This finding suggests that the
waterbird species with larger caecum may harbor and disperse the pathogen for longer
periods thus having a more important role in the dispersal of avian botulism.
The persistence of C. botulinum in the digestive tract indicates that it may remain
for some time as part of the intestinal microbiota, but further confirmation of this would
be necessary, because one may then expect to find cases of toxiinfectious botulism in
wild waterbirds (as described in foals and children and suggested for broilers [Dohms et
al., 1882; Midura, 1996; Swerczek et al., 1980]) if C. botulinum could replicate and
produce BoNt in the caecum of birds.
Capítulo 5
181
5. Conclusions
Susceptibility to botulism intoxication is different for each waterbird species and
it depends on feeding behavior and temporal wetland use patterns but also some
interspecies genetic component may exist. This implies that concentrations of highly
susceptible species during high-risk botulism periods may increase the likelihood of an
outbreak and the mortality rate. In this study, the threatened white-headed duck was not
between the most susceptible species, but botulism killed around the 7 and 17% of the
individuals inhabiting the studied lagoon, so this disease should be consider in future
conservation programs. Between the sources of intoxication for some waterbird species,
the invasive water snail Physella acuta may be particularly important as it is very
abundant in some wetlands and frequently harbor C. botulinum. Finally, even though C.
botulinum does not seem to form part of the normal microbiota of healthy waterbirds,
they may excrete and disperse it between wetlands after ingesting it from the
environment; but not all the species have the same potential as dispersers, species with
larger caecum, such as gadwalls and coots, may maintain and excrete it for longer
periods.
Acknowledgments
We thank Raúl, Alejandro del Moral and personal from Tablas de Daimiel
National Park for helping with the identification and collection of sick and dead
waterbirds. We also thank Juan Andrés for his assistance at the wildlife rehabilitation
center. This study was supported by the Spanish Ministry of Environment (grants OAPN
035/2009). I. Anza was supported by a JAE PRE grant from the Spanish Council of
Research (CSIC).
Tesis doctoral – Ibone Anza Gómez
182
References
Adams, S.G., Conly, F.M., Gratto-Trevor, C.L., Cash, K.J., Bollinger, T. 2003. Shorebird
use and mortality at a large Canadian prairie lake impacted by botulism.
Waterbirds 26, 13-25.
Albrecht, C., Kroll, O., Moreno, E., Wilke, T. 2009. Invasion of ancient Lake Titicaca by
the globally invasive Physa acuta (Gastropoda: Pulmonata: Hygrophila).
Biological Invasions 11, 1821–1826.
Anza, I., Skarin, H., Vidal, D., Lindberg, A., Båverud, V., Mateo, R. 2014a. The same
clade of Clostridium botulinum strains is causing avian botulism in southern and
northern Europe. Anaerobe 26, 20-23.
Anza, I., Vidal, D., Laguna, C., Díaz-Sánchez, S., Sánchez, S., Chicote, A., Florín, M.,
Mateo, R. 2014b. Eutrophication and bacterial pathogens as risk factors for avian
botulism outbreaks in wetlands receiving effluents from urban wastewater
treatment plants. Applied and Environmental Microbiology 15, 4251-4259.
Baker, K. (Ed.). 1993. Identification guide to European non-passerines. British Trust for
Ornithology, London.
Bernot, R.J., Kennedy, E.E., Lamberti, G.A. 2005. Effects of ionic liquids on the
survival, movement, and feeding behavior of the freshwater snail Physa acuta.
Environmental Chemical Toxicology 24, 1759–1765.
BirdLife International 2012. Oxyura leucocephala. En: IUCN 2014. IUCN Red List of
Threatened Species. Version 2014.1. <www.iucnredlist.org>. Descargado el 3 de
Julio 2014.
Centers for Disease Control and Prevention (CDC): Botulism in the United States, 1899-
1996. 1998. Handbook for Epidemiologists, Clinicians, and Laboratory Workers,
Capítulo 5
183
Atlanta, G.A. Centers for Disease Control and Prevention.
http://www.cdc.gov/ncidod/dbmd/diseaseinfo/files/botulism.PDF
Charalambidou, I., Santamaría, L. 2002. Waterbirds as endozoochorous dispersers of
aquatic organisms: a review of experimental evidence. Acta Oecologica 23, 165–
176.
Chou, S.J., Shieh, Y.C., Yu, C.Y. 2008. Hematologic and biochemistry values for black-
faced spoonbills (Platalea minor) with and recovering from botulism. Journal of
Wildlife Disease 3, 781-784.
Clench, M.H., Mathias, J.R. 1992. Intestinal transit: how can it be delayed long enough
for birds to act as long-distance dispersal agents? Auk 109, 933–936.
Clench, M.H., Mathias, J.R. 1995. The avian cecum: a review. Wilson Bulletin 107, 93–
121.
Contreras de Vera, A., León-Vizcaíno, L., Carranza, J., Hermoso de Mendoza, M.,
Garrido, F. 1987. Botulismo aviar en zonas húmedas de la campiña de Sevilla y
Córdoba. Medicina Veterinaria 4, 173–179.
Cramp, S. 1998. The complete birds of the Western Palearctic on CD-ROM. Oxford
University Press, Oxford.
Deville, A.S., Grémillet, D., Gauthier-Clerc, M., Guillemain, M., Von Houwald, F.,
Gardelli, B., Béchet, A. 2013. Non-linear feeding functional responses in the
Greater Flamingo (Phoenicopterus roseus) predict immediate negative impact of
wetland degradation on this flagship species. Ecology and Evolution 3, 1413–
1425.
Dohms, J.E., Allen, P.H., Rosenberger, J.K. 1982. Cases of type C botulism in broiler
chickens. Avian Diseases 26, 204-210.
Tesis doctoral – Ibone Anza Gómez
184
Dover, N., Barash, J.R., Hill, K.K., Xie, G., Arnon, S.S. 2014. Molecular characterization
of a novel botulinum neurotoxin type H gene. Journal of Infectious Diseases 209,
192–202.
Duncan, R.M., Jensen, W.L. 1976. A relationship between avian carcasses and living
invertebrates in the epizootiology of avian botulism. Journal of Wildlife Diseases
12, 116–126.
Friend, M., McLean, R.G., Dein, F.J. 2001. Disease emergence in birds: challenges for
the twenty-first century. The Auk 118, 290-303.
Getchell, R.G., Bowser, P.R. 2006. Ecology of type E botulism within dreissenid mussel
beds. Aquatic Invaders 17, 1-8.
Green, A.J, Figuerola, J., Sánchez, M.I. 2002. Implications of waterbird ecology for the
dispersal of aquatic organisms. Acta Oecologica 23, 177–189.
Hackett, S.J., Kimball, R.T., Reddy, S., Bowie, R.C.K., Braun, E.L., Braun, M.J.,
Chojnowski, J.L., Cox, W.A., Han, K.L., Harshman, J., Huddleston, C.J., Marks,
B.D., Miglia, K.J., Moore, W.S., Sheldon, F.H., Steadman, D.W., Witt, C.C.,
Yuri, Y. 2008. A phylogenomic study of birds reveals their evolutionary history.
Science 320, 1763-1768.
Hadad, E., Moyal, C. 2007. Preference of the White-headed duck Oxyura leucocephala
for wastewater reservoirs in the Judean Plain, Israel. Sandgrouse 29, 70-78.
Hardy, S.P., Kaldhusdal, M. 2013. Type C and C/D toxigenic Clostridium botulinum is
not normally present in the intestine of healthy broilers. Veterinary Microbiology
30, 466-468.
Midura, T.F. 1996. Update: infant botulism. Clinical Microbiology Reviews 9, 119-125.
Murray, C.G., Hamilton, A.J. 2010. Perspectives on wastewater treatment wetlands and
waterbird conservation. Journal of Applied Ecology 47, 976–985.
Capítulo 5
185
Reed, T.M., Rocke, T.E. 1992. The role of avian carcasses in botulism epizootics.
Wildlife Society Bulletin 20, 175-182.
Rocke, T.E., Friend, M. 1999. Avian botulism. In Friend, M., Franson, J.D. (eds), Field
manual of wildlife disease. General procedures and diseases of birds, USGS
National Wildlife Health Center, Washington, USA. p 271-281
Rocke, T.E., Samuel, M.D. 1999. Water and sediment characteristics associated with
avian botulism outbreaks in wetlands. Journal of Wildlife Management 63, 1249-
1260.
Rocke, T.E., Converse, K., Meteyer, C., Mclean, R.G. 2005. The impact of disease in the
American white pelican in North America. Waterbirds 28 (Special Publication 1),
87-94.
Rocke, T.E. 2006. The global importance of avian botulism. In Boere, G.C., Galbraith,
C.A., Stroud, D.A. (eds), Waterbirds around the world, The Stationery Office,
Edinburgh, UK. p 422-426.
Sánchez-Hernández, L., Cifuentes, A., Jiménez, B., Mateo, R., González, R. 2008.
Detection of Clostridium botulinum neurotoxin coding genes: analysis of PCR
products by real time versus capillary gel electrophoresis methods. European Food
Research and Technology 227, 495–502.
Shutt, J.L., Andrews, D.W., Weseloh, D.V.C., Moore, D.J., Hebert, C.E., Campbell,
G.D., Williams, K. 2014. The importance of island surveys in documenting
disease-related mortality and botulism E in Great Lakes colonial waterbirds.
Journal of Great Lakes Research 40, 58–63.
Skarin, H., Lindberg, A., Blomqvist, G., Aspán, A., Båverud, V. 2010. Molecular
characterization and comparison of Clostridium botulinum type C avian strains.
Avian Pathology 39, 511-518.
Tesis doctoral – Ibone Anza Gómez
186
Swerczek, T.W. 1980. Experimentally induced toxicoinfectious botulism in horses and
foals. American Journal of Veterinary Research 41, 348-350.
Varo, N., Green, A.J., Sánchez, M.I., Ramos, C., Gómez, J., Amat, J.A. 2011.
Behavioural and population responses to changing availability of Artemia prey by
moulting black-necked grebes, Podiceps nigricollis. Hydrobiologia 664, 163–171.
Viana, D. S., Santamaría, L., Michot, T.C., Figuerola, J. 2013. Allomeric scaling of long-
distance seed dispersal by migratory birds. The American Naturalist 181, 649-662.
Vidal, D., Taggart, M.A., Höfle, U., González, R., Cifuentes, A., Sánchez-Hernández, L.,
Barcenilla, J., Jiménez, B., Green, A.J., Mateo, R. 2009. Análisis del riesgo de
intoxicación por botulismo en malvasía cabeciblanca y otras especies de aves
acuáticas en las Tablas de Daimiel y humedales cercanos. En: L. Ramírez & B.
Asensio (Eds.) Proyectos de Investigación en Parques Nacionales 2005-2008.
Organismo Autónomo Parques Nacionales, Ministerio de Medio Ambiente,
Madrid. p. 229-247.
Vidal, D., Anza, I., Taggart, M.A., Pérez-Ramírez, E., Crespo, E., Hofle, U., Mateo, R.
2013. Environmental factors influencing the prevalence of Clostridium botulinum
type C in non-permanent Mediterranean wetlands. Applied and Environmental
Microbiology 79, 4264-4271.
Vidal, D., Taggart, M.A., Badiola, I., Mateo, R. 2011. Real-time polymerase chain
reaction for the detection of toxigenic Clostridium botulinum type C1 in waterbird
and sediment samples: comparison with other PCR techniques. Journal of
Veterinary Diagnostic Investigation 23, 942–946.
Wobeser, G. 1997. Avian botulism – another perspective. Journal of Wildlife Diseases
33, 181–186.
Capítulo 5
187
Work, T.M., Klavitter, J.L., Reynolds, M.H., Blehert, D. 2010. Avian botulism: a case
study in translocated endangered Laysan ducks (Anas laysanensis) on Midway
Atoll. Journal of Wildlife Diseases 46, 499–506.
Woudstra, C., Skarin, H., Anniballi, F., Fenicia, L., Bano, L., Drigo, I., Koene, M.,
Bäyon-Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012. Neurotoxin
gene profiling of Clostridium botulinum types C and D native to different
countries within Europe. Applied and Environmental Microbiology 78, 3120-
3127.
Zechmeister, T.C., Kirschner, A.K, Fuchsberger, M., Gruber, S.G., Suess, B.,
Rosengarten, R., Pittner, F., Mach, R.L., Herzig, A., Farnleitner, A.H. 2005.
Prevalence of botulinum neurotoxin C1 and its corresponding gene in
environmental samples from low and high risk avian botulism areas. ALTEX 22,
185–195.
188
Supplemental material
Table S1. Excretion of C. botulinum BoNT type C/D gene by different species of sick waterbirds during the recovery process at a wildlife rehabilitation centre
after a botulism outbreak
Family Species Positive/total (%)
Cloacal swabs (time of excretion) *
Individuals* 1 day 3 day 5 day 7 day >7 day†
Anatidae Anas platyrhynchos 7/11 (63.6) 7/11 (63.6) 3/6 (50) 0/1 0/1 0/8
Anas strepera 4/9 (44.4) 3/9 (33.3) 1/4 (25) 1/2 0/1 1/5 (20)
Aythya ferina 2/3 (66.7) 1/3 (33.3) 0/2 0/1 0/1 0/1
Oxyura leucocephala 1/5 (20) 1/5 (20) 0/1 1/1 - -
Total 14/28 (50)A 12/28 (43.3)
A 4/13 (30.7) 2/5 (20) 0/3 1/14 (7.1)
Rallidae Fulica atra 8/19 (42.1) 4/19 (21) 5/17 (29.4) 3/11 (27.2) 0/9 1/12 (8.3)
Gallinula chloropus 1/2 (50) 1/2 (50) - - - -
Total 9/21 (42.8)A 5/21 (23.8)
A 5/17 (29.4) 3/11 (27.2) 0/9 1/12 (8.3)
Laridae Chroicocephalus ridibundus 1/18 (5.5) 1/18 (5.5) 0/9 0/7 0/8 0/4
Larus fuscus 1/1 (100) 1/1 (100) - - - -
Total 2/19 (10.5)B 2/19 (10.5)
B 0/9 0/7 0/8 0/4
Podicipedidae Podiceps nigricollis 1/1 (100) 1/1 (100) 0/1 - - -
Total 1/1 (100)AB
1/1 (100)AB
0/1 - - -
Total 26/69 (37.7) 20/69 (30) 9/40 (22.5) 5/23 (21.7) 0/20 2/30 (6.7)
*Percentages of the presence of C. botulinum were significantly different between bird families with a different superscript capital letter.
†One mallard, 1 gull and 2 coots have been sampled 2 times and another coot 3. The total number of birds sampled is 24.
Capítulo 5
189
Fig. 1S. Different species of waterbirds feeding around carcasses and a fox picking up a carcass.
Tesis doctoral – Ibone Anza Gómez
190
DISCUSIÓN GENERAL
El botulismo aviar causa mortalidades masivas de aves acuáticas en todos los
continentes menos en la Antártida, pero ha sido mayoritariamente estudiado en
Norteamérica y Europa. Los brotes ocurren principalmente en humedales de agua dulce
durante el verano, aunque también se han descrito en zonas costeras afectando a
gaviotas (Rocke, 2006; Neimanis et al., 2007). Esta enfermedad afecta a un gran
número de especies de aves acuáticas, incluyendo algunas en peligro de extinción, para
las cuales un solo brote podría tener consecuencias nefastas si sus individuos estuviesen
concentrados en unos pocos humedales (Chou et al., 2008; Work et al., 2010). También
se ha sugerido que el botulismo puede estar entre las causas del declive de algunas
especies como el ánade rabudo (Anas penelope) en Estados Unidos, el cual ha sufrido
miles de bajas debidas a esta enfermedad (Friend et al., 2001).
En España, se registran brotes de botulismo aviar casi anualmente desde los años
70 (León-Vizcaíno et al., 1979), tanto en el norte como en el sur del país. En los
humedales manchegos, donde se enmarca esta tesis, es una enfermedad endémica que
produce brotes casi todos los veranos y otoños, incluyendo algunos especialmente
severos como los ocurridos en varias lagunas situadas en el norte de Ciudad Real en
1978, con alrededor de 6.000 aves afectadas, y en Las Tablas de Daimiel en 1999, con
alrededor de 11.000. Con los estudios de esta tesis queremos ampliar los conocimientos
sobre esta enfermedad que afecta cada año a uno de los principales recursos naturales de
la provincia, las aves acuáticas.
Discusión general
191
1. El agente causante de los brotes
En un principio los brotes de botulismo aviar en España se atribuían a C.
botuinum tipo C (León-Vizcaíno et al., 1979), pero posteriormente se descubrió que en
Europa estaba más extendido el mosaico C/D (Woudstra et al., 2012). Este mosaico es
más letal para las aves y con los medios convencionales como el bioensayo y PCR no
específicas es difícil de diferenciar del tipo C (Takeda et al., 2005). Por ello
investigamos si el mosaico C/D también se distribuía en España (capítulos 1 y 2). Así,
durante una estancia en el Instituto Nacional de Vaterinaria de Suecia (SVA en
Uppsala), aislamos varias cepas de C. botulinum procedentes de cadáveres de aves
muertas por botulismo en tres humedales manchegos, las caracterizamos por PCR y las
pulsotipamos por electroforesis en gel de campo pulsante (EGCP). Las diferentes cepas
resultaron ser tipo C/D y al compararlas genéticamente con cepas suecas, resultaron ser
muy similares o iguales, lo que apoya la hipótesis de una expansión clónica del mosaico
C/D por Europa, probablemente transportada por aves acuáticas. También observamos
que las cepas eran compartidas entre aves domésticas y salvajes. De todas formas, la
técnica EGCP puede no ser suficientemente discriminante, como se ha demostrado para
C. botulinum tipo A (Raphael et al., 2014), y se deberían hacer estudios con técnicas
más finas para ver hasta qué punto las cepas de C. botulinum tipo C/D en Europa son
clónicas y si se podrían diferenciar con vistas a futuros estudios epidemiológicos. En el
capítulo 2 mediante técnicas de PCR convencional (Takeda et al., 2005) analizamos un
mayor número de muestras de tejidos de aves y ambientales recogidas durante brotes de
botulismo en humedales manchegos y volvemos a confirmar que C. botulinum tipo C/D
es el causante de los brotes en nuestro país, o al menos en la provincia de Ciudad Real.
La presencia de este mosaico ya había sido “intuida” en los trabajos realizados en los 80
Tesis doctoral – Ibone Anza Gómez
192
en lagunas andaluzas, donde se describe cierta acción de la antitoxina D (además de la
C) en los test de neutralización realizados para caracterizar la toxina botulínica en suero
de aves enfermas (Contreras de Vera et al., 1987). Así concluimos que en España, como
en muchas otras regiones de Europa, el agente causante del botulismo aviar es
Clostridium botulinum tipo C/D.
2. Historial de brotes en La Mancha Húmeda (Ciudad Real y Cuenca)
y las aves afectadas
El primer paso para comprender las causas del botulismo aviar en la región fue
recopilar información sobre el historial de brotes en La Mancha Húmeda (humedales
situados entre Ciudad Real y Cuenca) y buscar factores ambientales que los causen
(capítulo 2). Para ello, la Junta de Comunidades de Castilla la Mancha nos facilitó
información sobre los brotes acontecidos entre 1978 y 2008. En ese periodo se
produjeron 13 brotes de botulismo (Fig. 1) que afectaron a más de 20.000 aves de más
de 50 especies (ver material suplementario del capítulo 2).
1978
Varias lagunas entre Alcázar-Pedro Muñoz
1998
Alcázar-Pedro MuñozRetama-Manjavacas
1999
Tablas de Daimiel
2002
Alcázar
2004
Jabalón
2005
Jabalón
Vicario
2008
Alcázar
Navaseca
2006
Alcázar
Pedro Muñoz
2007
Tablas de Daimiel
Fig. 1. Cronología de brotes de botulismo en La Mancha-Húmeda entre 1978 y 2008. Alcázar,
Pedro Muñoz, Retama-Manjavacas y Navaseca son lagunas que reciben aguas residuales de
estaciones depuradoras.
Discusión general
193
Probablemente el número estimado de aves muertas es mayor porque muchos
brotes de botulismo pasan desapercibidos o no se registran y, además, los trabajos de
recogida de cadáveres no son eficientes al 100%, por ejemplo, Cliplef y Wobeser (1993)
estimaron que durante sólo se recoge una tercera parte de los cadáveres aunque dicha
eficiencia puede variar con las características y dimensiones de cada humedal. Entre las
especies más afectadas en el periodo de estudio estuvieron los ánades azulones,
seguidos de las fochas comunes, ánades frisos, cucharas comunes, cercetas y gaviotas
reidoras. Estas especies también han sido descritas en otros trabajos como muy
afectadas por el botulismo pero, dado que en ninguno de estos estudios se realizaron
censos, no está claro si el gran número de pérdidas es debido a su abundancia o a que
realmente son más susceptibles a la intoxicación. Por ello, en el capítulo 5, hicimos una
estima de la susceptibilidad de las especies de aves acuáticas más comunes en la
provincia recopilando datos de mortalidad en función del número de aves censadas y
momento del brote. Coincidiendo con los datos del primer estudio, encontramos que los
ánades azulones (Anas platyrhynchos), fochas (Fulica atra), frisos (Anas strepera) y
gaviotas (Chroicocephalus ridibundus), son más susceptibles que otras aves
filogenéticamente más distantes de anátidas y rállidos como los zampullines
cuellinegros (Podiceps nigricollis) y flamencos (Phoenicopterus roseus). Estas
diferencias en susceptibilidad parecen estar muy asociadas al tipo de alimentación. Aves
que se alimentan en superficie y/u omnívoras son más susceptibles que las buceadoras
y/o especialistas, probablemente porque las probabilidades de ingerir larvas de mosca
tóxicas son mayores. De hecho, con las imágenes obtenidas con las cámaras trampas
observamos como varias especies de limícolas se alimentaban en la superficie alrededor
de los cadáveres. Estas diferencias en susceptibilidad asociadas a alimentación también
nos indican que la toxina botulínica se encuentra en compartimentos determinados en
Tesis doctoral – Ibone Anza Gómez
194
los humedales (i.e. invertebrados acuáticos) y que no está libre en el agua. Otros autores
también han observado que aves generalistas y/o que se alimentan en superficie sufren
un mayor número de bajas por botulismo (Rocke, 2006; Adams et al, 2003; Shutt et al,
2014). Además, observamos que la malvasía cabeciblanca (Oxyura leucocephala),
especie en peligro de extinción, es susceptible a la enfermedad. Esto debe ser tomado en
cuenta en programas de conservación considerando la afinidad de esta especie por
humedales de aguas residuales, en los que como posteriormente veremos, el riesgo de
botulismo es elevado. Este estudio sobre susceptibilidad se realizó en un único humedal
por lo que para obtener resultados extrapolables a otras zonas, se debería ampliar en
más humedales. Con este tipo de datos de mortalidad, se podría llegar a conocer el
impacto del botulismo sobre ciertas especies y priorizar medidas de conservación
destinadas a evitar brotes en el caso de especies muy sensibles.
3. Factores ambientales relacionados con los brotes y el problema de
las aguas residuales
De los factores ambientales estudiados en el capítulo 2 (temperaturas mínimas,
máximas y medias, número de días con temperatura mayor de 25 ºC, lluvia media y
humedad media), sólo encontramos relación entre la mortalidad durante los brotes y la
temperatura media en julio. Además, se observó que la mayoría de los brotes se daban
en humedales que reciben aguas residuales (Fig. 1), muy abundantes en La Mancha, e
incluso se dio un brote fuera de temporada estival, entre septiembre y diciembre, tras
unas fuertes lluvias que sobrecargaron la depuradora de Navaseca con la consiguiente
entrada de agua muy contaminada en el humedal a través de un dispositivo de by-pass.
Discusión general
195
Las aguas residuales, aunque no existen estudios previos que lo confirmen, están
descritas como un factor de riesgo para la aparición de botulismo ya que aportan
muchos nutrientes que eutrofizan el agua, y materia orgánica que pueden consumir el
oxígeno del fondo del humedal, produciendo condiciones adecuadas para la
proliferación de microorganismos anaerobios como C. botulinum (Rocke y Friend,
1999; Murray y Hamilton, 2010). Además, después del brote producido en Navaseca
tras las fuertes lluvias, nosotros especulamos que junto con las aguas residuales, entran
en el humedal enterobacterias que pueden producir mortalidades entre las aves acuáticas
y desencadenar los brotes de botulismo, los cuales se propagarán por el ciclo “larva de
mosca-cadáver” (Rocke, 2006). Dado que en Castilla-La Mancha existen muchos
humedales abastecidos con aguas residuales e incluso se ha propuesto solventar los
periodos de sequía en Las Tablas de Daimiel utilizando este tipo de aguas depuradas, en
el capítulo 3 nos propusimos realizar una monitorización anual comparando dos
humedales que reciben agua de depuradoras (La Veguilla y Navaseca) y un control (Las
Tablas) para buscar diferencias que demuestren asociaciones entre las aguas residuales
y los brotes de botulismo. En primer lugar, encontramos que en los humedales con
aguas residuales, la carga de enterobacterias potencialmente patógenas para las aves
como Escherichia coli patógena para las aves (APEC) y Clostridium perfringens tipo A
es significativamente mayor que en Las Tablas, lo que apoya la hipótesis de que en
estos humedales las mortalidades por otras enfermedades puedan ser más frecuentes y
por lo tanto desencadenen brotes de botulismo. Además, en la laguna de Navaseca,
donde se produjo un brote durante el estudio, la temperatura del agua y la concentración
de clorofila (signo de eutrofización) fueron mayores, y el potencial redox menor que en
los otros humedales, factores previamente asociados con el riesgo de brotes de
botulismo (Rocke y Samuel, 1999; Murphy et al., 2000; Pérez-Fuentetaja et al., 2011).
Tesis doctoral – Ibone Anza Gómez
196
También en esta laguna, detectamos cambios bruscos en parámetros ambientales
provocados por la eutrofización de las aguas previos al brote que indicaron la
producción de condiciones anaeróbicas en sedimentos y que coincidieron con el
aumento en la detección de C. botulinum tipo C/D en ellos. Estos cambios fueron la
bajada de la clorofila, sulfatos, potencial redox, y DBO5 y la subida en carbono
inorgánico. A estas diferencias entre humedales y cambios en parámetros ambientales se
añade que la presencia de C. botulinum tipo C/D fue mayor en los humedales
abastecidos con aguas residuales tratadas que en Las Tablas, pudiendo ser debido al
mayor número de brotes registrados en estos o a las mejores condiciones que se dan en
sus sedimentos para el establecimiento de la bacteria. Por último, el vertido de aguas
altera la hipersalinidad propia de muchos humedales manchegos, especialmente los de
la zona de Alcázar, y como vimos en el capitulo 2 y se ha demostrado en otros estudios
(Segner et al., 1971; Webb et al., 2007), la salinidad o la concentración de cloruros
podría ser un factor limitante para el crecimiento de C. botulinum. Con todo esto, en el
capitulo 3 demostramos como las aguas residuales deficientemente tratadas que se
vierten en los humedales manchegos son un factor de riesgo para la aparición de brotes.
Este problema se agrava porque en épocas de sequía, que pueden ir en aumento con el
cambio climático, estos humedales sostienen altas concentraciones de aves acuáticas,
momento en que un brote puede tener consecuencias nefastas. Por ello se deben mejorar
los sistemas de las estaciones depuradoras de aguas residuales (EDAR), muchas de ellas
obsoletas, y eliminar los sistemas by-pass que permiten que aguas casi sin tratar entren
en los humedales cuando estas EDAR se sobrecargan. También debería plantearse
verter las aguas depuradas en humedales construidos y respetar los naturales, ya que
estos tienen unas condiciones naturales (i.e. salinidad) y ciclos hidrológicos
Discusión general
197
característicos que se ven alterados con el vertido de este tipo de aguas (Cooke et al.,
1990; Florín y Montes, 1999).
4. Las moscas como vectores de C. botulinum tipo C/D
Se han dedicado muchos estudios al ciclo “larva de mosca-cadáver”, por el cual
las aves se intoxican al ingerir larvas tóxicas desarrolladas sobre cadáveres en los que se
ha producido toxina botulínica y posteriormente mueren generando más sustrato para la
producción de toxina, haciendo que los brotes se expandan de manera semejante a una
enfermedad infecciosa (Wobeser, 1997; Rocke y Friend, 1999; Rocke, 2006). Sin
embargo, no se ha dedicado mucha atención al posible papel de moscas adultas como
vectores de C. botulinum y propagadoras de brotes. Nosotros, en nuestros primeros
estudios detectamos moscas calíforas, capturadas cerca de cadáveres, positivas a C.
botulinum tipo C/D (capitulo 2). Anteriormente, Duncan y Jensen (1976) habían
descrito moscas, también capturadas cerca de cadáveres, portadoras de la toxina
botulínica tipo C. Las moscas son vector de un gran número de enfermedades (Cohen et
al., 1991; Nazni et al., 2005; Lindsay et al., 2012), por lo que también lo podrían ser
para el botulismo. En el monitoreo realizado en el capitulo 3, tras capturar moscas no
asociadas a cadáveres a lo largo de un año en tres humedales diferente, solo detectamos
2 pooles de moscas positivas a C. botulinum capturadas durante y justo después de un
brote en la laguna de Navaseca, lo que sugería que normalmente no portan C. botulinum
pero que sí pueden hacerlo. Por ello, en el capítulo 4, nos centramos en esta hipótesis y
realizamos un mayor esfuerzo de muestreo durante momentos de brote, que junto con
experimentos laboratoriales, nos permitieron confirmar que las moscas, sobre todo
sarcófagas y calíforas, pueden transportar C. botulinum y excretarlo al menos durante 12
Tesis doctoral – Ibone Anza Gómez
198
horas. Además, confirmamos que las moscas y otros invertebrados necrófagos (i.e.
escarabajos de la familia Dermestidae) son capaces de llevar un número suficiente de
microorganismos de C. botulinum a cadáveres previamente “libres” del patógeno para
que se produzcan sobre ellos larvas positivas al patógeno, ayudando así a la propagación
de los brotes. En este estudio, un 27% de cadáveres de aves previamente negativos a C.
botulinum tipo C/D colocados en humedales con brote y solamente accesible a
invertebrados voladores (moscas y escarabajos necrófagos), desarrollaron larvas
positivas a C. botulinum tipo C/D. Dadas las bajas prevalencias generales del patógeno
que se observan en el ambiente (6% en sedimentos; 3,7% en heces; capítulos 2 y 3), el
papel de las moscas como propagadoras de brotes puede ser importante. Para llegar a
conclusiones más concretas, serían necesarios estudios en los que se pudiesen comparar
brotes de botulismo en presencia de moscas y sin moscas, para ver hasta qué punto estas
tienen un papel en la propagación, y también sería interesante comprobar si C.
botulinum puede multiplicarse en el tracto gastrointestinal de las moscas, como se ha
demostrados para Bacillus anthracis (Fasanella et al., 2010), con lo que además
tendrían un papel magnificador. Otro aspecto interesante desde el punto de vista
ecológico, es que la relación entre C. botulinum tipo C/D y las moscas podría ser
estudiada como un mutualismo, dado que ambos organismos obtienen beneficios de su
interacción. Por último, este estudio pone de manifiesto una vez más la importancia de
la rápida recogida y eliminación (enterrados o incinerados) de los cadáveres de aves en
humedales con el fin de evitar la propagación de los brotes.
Discusión general
199
5. Las aves acuáticas como portadoras de C. botulinum tipo C/D
Otra de las preguntas que nos planteamos en esta tesis es si las aves acuáticas
portan C.botulinum tipo C/D en su tracto gastrointestinal, lo que facilitaría que
mortalidades producidas por otras causas, como enterobacterias (más comunes en
humedales con aguas residuales), desencadenasen brotes de botulismo. Además, nos
planteamos que en algunos casos se puedan dar toxiinfecciones en aves silvestres y no
solo intoxicaciones. Para ello, durante el monitoreo de los tres humedales (Navaseca,
Veguilla y Tablas) a lo largo de un año (capítulo 3) recogimos heces para ver si las aves
excretaban C. botulinum tipo C/D y en qué momentos. Como resultado, observamos una
baja prevalencia del patógeno en heces recogidas en Alcázar (0,5%) y Navaseca (3%),
humedales donde los brotes son más habituales. Además, en Navaseca se dio un pico en
la prevalencia justo antes de que se detectasen las primeras aves muertas por botulismo,
indicando que éstas estaban ingiriendo la bacteria de algún lugar que nosotros no
habíamos detectado, como podrían ser sedimentos o cadáveres. Estos datos confirman
que las aves portan el clostridio, y que haciéndolo antes de los brotes podrían
desencadenarlos con su muerte debida a cualquier otra causa. Zechmeister et al, (2005)
también detectó la presencia de C. botulinum tipo C en el 80% de heces de aves
acuáticas procedentes de zonas con brotes y Reed y Rocke (1992) lo detectaron en 21 de
40 muestras de ciegos de aves procedentes de zonas donde los brotes son frecuentes.
Posteriormente, en el capítulo 5, nos centramos en el estudio de la excreción de
C. botulinum tipo C/D por aves sanas y enfermas. En este estudio observamos que las
prevalencias en heces son mucho más altas durante los brotes (16%), que fuera de estos
(1%), lo que coincide con muestras de hisopos cloacales tomados a pollas de agua
(Gallinula chloropus) sanas (0%) y a aves enfermas de botulismo llevadas a un centro
Tesis doctoral – Ibone Anza Gómez
200
de recuperación (40%). Esto indica que la excreción de C. botulinum tipo C/D es un
reflejo de la presencia de la bacteria en el ambiente o una toxiinfección y descartamos
que sea parte de la microbiota normal de las aves. Hardy y Kaldhusdal (2013)
analizaron muestras de ciego de pollos procedentes de 100 granjas sin historia de
botulismo y también llegaron a esta conclusión puesto que todas las muestras fueron
negativas, mientras que sí se detectó C. botulinum tipo C/D en muestras ambientales de
granjas con historia de botulismo. Por otro lado, tras tomar hisopos seriados a aves
enfermas en un centro de recuperación, vimos que la mayoría excretaban la bacteria
entre el primer y el séptimo día de ingreso, excepto dos aves, una focha y un ánade
friso, que la excretaron más tiempo, los días 14 y 11 respectivamente, una vez
recuperados. Estos datos podrían indicar que C. botulinum tipo C/D se mantiene durante
algún tiempo en las aves y que probablemente se reproduzca en el ciego, causando una
toxiinfección. De hecho, Miyazaki y Sakaguchi (1978) demostraron que las aves
enfermaban de botulismo tras la ingestión de esporas, pero si se les ligaba el ciego no lo
hacían. Esto se apoya en que aves con ciegos más desarrollados, como ánades y fochas,
excretaron más tiempo que las gaviotas reidoras (Chroicocephalus ridibundus) las
cuales tienen ciegos menos desarrollados. Por ello, la presencia de C. botulinum tipo
C/D en heces e hisopos cloacales confirma que las aves, en ciertos momentos, pueden
portarlo y que mortalidades por otras causas, como enterobacterias (frecuentes en aguas
residuales) o por propia toxiinfección, pueden desencadenar los brotes, ya que los
cadáveres son el sustrato perfecto para el crecimiento inicial del clostridio. Por último,
cabe destacar que las aves pueden actuar como vehículo de C. botulinum y transportarlo
entre humedales lo que podría ser una causa de la amplia distribución del mosaico C/D
por Europa (Woudstra et al., 2012) como sugerimos en el capítulo 1.
Discusión general
201
6. Invertebrados acuáticos como fuente alternativa de intoxicación
Para que las aves se intoxiquen la toxina debe ser vehiculada hasta ellas en su
alimento, porque como se deduce de las diferentes susceptibilidades de las aves al
botulismo en el capítulo 5, la toxina no está libre en el ambiente. El estudio de Duncan
y Jensen (1976) demuestra que un gran número de invertebrados capturados a menos de
30 cm de cadáveres muertos por botulismo portan la toxina y entre estos los que más la
concentran, en concentraciones relevantes para la epidemiología de los brotes, son las
larvas de moscas, seguidas de coleópteros necrófagos y caracoles acuáticos. Otros
invertebrados positivos a la toxina fueron coríxidos, notonéctidos, anfípodos,
ostrácodos, larvas de quironómidos, larvas de ditiscos y ninfas de efemerópteros, todos
ellos en concentraciones muy bajas, probablemente insuficientes para matar a un ave.
Nosotros en un primer momento, capitulo 2, muestreamos algunos
invertebrados acuáticos capturados cerca de cadáveres durante los brotes y encontramos
positividad en muestras de coríxidos y quironómidos. Pérez-Fuentetaja et al. (2011)
también encuentran varias especies de invertebrados bénticos portadoras de C.
botulinum tipo E y las propone como vehículos del clostridio hacia las aves desde el
sedimento. En el capítulo 3, muestreamos un gran número de invertebrados acuáticos a
lo largo de un año, independientes y asociados a cadáveres, y sólo encontramos
positividad en caracolas acuáticas que identificamos como Physella acuta y en larvas de
coleópteros, ambas especies con hábitos necrófagos. Posteriormente, en el capítulo 5,
donde hacemos un muestreo más intensivo de invertebrados durante los brotes
confirmamos de nuevo que los caracoles acuáticos, Physella acuta, portan C. botulinum
tipo C/D en una alta frecuencia (30% de las muestras analizadas) con lo que pueden ser
una fuente alternativa de toxina después de las larvas de mosca. Además, Physella acuta
Tesis doctoral – Ibone Anza Gómez
202
es una especie invasora con gran tolerancia a la contaminación y un alto índice de
reproducción (Bernot et al., 2005; Albrecht et al., 2009), lo que aumenta su importancia
como fuente de intoxicación en humedales que reciben aguas residuales donde, al
menos en Navaseca, en ciertos momentos se observan un gran número de individuos de
esta especie, muchos de ellos sobre cadáveres. En estudios futuros, para determinar su
importancia real en la epidemiología de los brotes, se debería confirmar si portan
también la toxina y en qué concentración. Por último, tras observar gran abundancia de
Physella acuta durante los picos de mortalidad en los brotes de Navaseca, podría ser
interesante buscar relaciones entre la abundancia de este invertebrado y los índices de
mortalidad por botulismo.
7. Síntesis
En los humedales de La Mancha Húmeda el botulismo aviar es una enfermedad
muy frecuente. En concreto, en Ciudad Real y humedales colindantes de Cuenca se han
registrado 13 brotes entre 1978 y 2008 más al menos otros 9 brotes registrados entre
2010 y 2013. De los datos obtenidos, hemos visto que el índice de mortalidad está
relacionado con las altas temperaturas en el mes de julio y la frecuencia de los brotes
con el aporte de aguas residuales a los humedales. Además, la presencia de C.
botulinum tipo C/D en sedimentos parece estar limitada por la salinidad intrínseca de
alguno de estos humedales y favorecida por el aumento de materia orgánica. También
hemos observado que las moscas adultas y los caracoles acuáticos pueden jugar un
papel importante en la propagación de los brotes. En la figura 2 mostramos un esquema
de los posibles mecanismos implicados en la aparición y propagación de los brotes de
botulismo en humedales manchegos estudiados en esta tesis.
Discusión general
203
Mortalidad
Capítulo 1 y 2
Eh Sulfato Carbono inorgánico
C. botulinum en el medio
Proliferación de Lemna
Temperatura Eutrofización Aguas residuales
Enteropatógenos
Mortalidad
A
B
C
D
Heces
Invertebradosacuáticos
Aves acuáticas
Larvas de mosca
Muerte de fitoplancton
Transporte a otroshumedales
Materia orgánica
DBO5
Anaerobiosis
Cl-
C. botulinum tipo C/D: 13 brotes entre 1978 y 2008 con más de 20.000 aves muertas de 50 especies diferentes
Capítulo 3
Capítulo 1
Capítulo 4
Capítulo 5
E
Invertebrados
acuáticos
Fig. 2. Esquema del funcionamiento de los brotes en humedales manchegos que reciben aguas residuales
según los datos obtenidos en esta tesis; A: Las altas temperaturas, junto con la gran cantidad de nutrientes
y materia orgánica que entran en humedales con las aguas residuales provocan el crecimiento de
fitoplancton y Lemna spp que tapan la luz y acaban con los recursos provocando la muerte del primero.
La gran cantidad de materia orgánica que se acumula provoca la caída del potencial redox en agua y la
producción de condiciones anaerobias en sedimentos como se observa por la caída de los sulfatos (signo
de proliferación de bacterias reductoras de sulfatos) aumento del carbono inorgánico (consecuencia del
metabolismo bacteriano) y caída de la demanda biológica de oxígeno una vez consumida la materia
orgánica a cambio de oxígeno. Estas condiciones anaeróbicas permiten la proliferación de C. botulinum
en el sedimento; B: Las aves e invertebrados acuáticos ingieren esporas y/o toxina del medio; C: La
muerte de aves portadoras de C. botulinum por otras causas (como enterobacterias muy abundantes en
humedales con aguas residuales), por intoxicación o por toxiinfección, genera cadáveres que son el
sustrato más adecuado para el crecimiento del patógeno y producción de altas concentraciones de toxina,
que se acumula en las larvas de mosca y otros invertebrados acuáticos de hábitos necrófagos; D:
Comienza el ciclo “larva de mosca-cadáver”. Las moscas adultas también ayudan a la propagación de la
bacteria entre cadáveres; E: Tras ingerir esporas del medio, las aves portan C. botulinum en su tracto
gastrointestinal, lo excretan y lo transportan entre humedales.
Tesis doctoral – Ibone Anza Gómez
204
Referencias
Adams, S.G., Conly, F.M., Gratto-Trevor, C.L., Cash, K.J., Bollinger, T. 2003.
Shorebird use and mortality at a large Canadian prairie lake impacted by
botulism. Waterbirds 26, 13-25.
Albrecht, C., Kroll, O., Moreno, E., Wilke, T. 2009. Invasion of ancient Lake Titicaca
by the globally invasive Physa acuta (Gastropoda: Pulmonata: Hygrophila).
Biological Invasions 11, 1821–1826.
Bernot, R.J., Kennedy, E.E., Lamberti, G.A. 2005. Effects of ionic liquids on the
survival, movement, and feeding behavior of the freshwater snail Physa acuta.
Environmental Chemical Toxicology 24, 1759–1765.
Chou, S.J., Shieh, Y.C., Yu, C.Y. 2008. Hematologic and biochemistry values for
black-faced spoonbills (Platalea minor) with and recovering from botulism.
Journal of Wildlife Disease 3, 781-784.
Cliplef, D.J., Wobeser, G. 1993. Observations on waterfowl carcasses during a botulism
epizootic. Journal of Wildlife Diseases 29, 8-14.
Cohen, D., Green, M., Block, C., Slepon, R., Ambar, R., Wasserman, S.S., Levine,
M.M. 1991. Reduction of transmission of shigellosis by control of houseflies
(Musca domestica). Lancet 337, 993–997.
Contreras de Vera, A., León, L., Carranza, J., Hermoso de Medoza, M., Garrido, F.
1987. Botulismo aviar en zonas húmedas de la campiña de Sevilla y Córdoba.
Medicina Veterinaria 4, 173-180.
Cooke, J.G., Cooper, A.B., Clunie, N.M.U. 1990. Changes in the water, soil, and
vegetation of a wetland after a decade of receiving a sewage effluent. New
Zealand Journal of Ecology 14, 37-47.
Discusión general
205
Duncan, R.M., Jensen, W.L. 1976. A relationship between avian carcasses and living
invertebrates in the epizootiology of avian botulism. Journal of Wildlife
Diseases 12, 116–126.
Fasanella, A., Scasciamacchia, S., Garofolo, G., Giangaspero, A., Tarsitano, E., Adone,
R. 2010. Evaluation of the house fly Musca domestica as a mechanical vector for
an anthrax. PLoS ONE 5, e12219. doi:10.1371/journal.pone.0012219.
Florín, M., Montes, C. 1999. Functional analysis and restoration of Mediterranean
lagunas in the Mancha Húmeda Biosphere Reserve (Central Spain). Aquatic
Conservation 9, 97-109.
Friend, M., McLean, R.G., Dein, F.J. 2001. Disease emergence in birds: challenges for
the twenty-first century. The Auk 118, 290-303.
Hardy, S.P., Kaldhusdal, M. 2013. Type C and C/D toxigenic Clostridium botulinum is
not normally present in the intestine of healthy broilers. Veterinary
Microbiology 30, 466-468.
León-Vizcaíno, L., Miranda, A., Carranza, J., Perea, A. 1979. Intoxicación botulínica en
aves acuáticas silvestres en la marisma del Guadalquivir (Coto Doñana). Acta
Vertebrata 6, 120-123.
Lindsay, S.W., Lindsay, T.C., Duprez, J., Hall, M.J.R., Kwambana, B.A., Jawara, M.,
Nurudeen, I.U., Sallah, N., Wyatt, N, D'Alessandro, U., Pinder, M., Antonio, M.
2012. Chrysomya putoria, a putative vector of diarrheal diseases. PLoS
Neglected Tropical Diseases 6, e1895. doi:10.1371/journal.pntd.0001895.
Miyazaki, S., Sakaguchi, G. 1978. Experimental botulism in chickens: the cecum as the
site of production and absorption of botulinum toxin. Japanese Journal of
Medical Science and Biology 31, 1-15.
Tesis doctoral – Ibone Anza Gómez
206
Murphy, T., Lawson, A., Nalewajko, C., Murkin, H., Ross, L., Oguma, K., McIntyre, T.
2000. Algal toxins – Initiators of avian botulism? Environmental Toxicology
15, 558-567.
Murray, C.G., Hamilton, A.J. 2010. Perspectives on wastewater treatment wetlands and
waterbird conservation. Journal of Applied Ecology 47, 976–985.
Nazni, W.A., Seleena, B., Lee, H.L., Jeffery, J.T., Rogayah, T.A., Sofian, M.A. 2005.
Bacteria fauna from the house fly, Musca domestica (L.). Tropical Biomedicine
22, 225-231.
Neimanis, A., Gavier-Widén, D., Leighton, F., Bollinger, T., Rocke, T., Mörner, T.
2007. An outbreak of type C botulism in herring gulls (Larus argentatus) in
southeastern Sweden. Journal of Wildlife Diseases 43, 327-736.
Pérez-Fuentetaja, A., Clapsadl, M.D., Getchell, R.G., Bowser, P.R., Lee, W.T. 2011.
Clostridium botulinum type E in Lake Erie: inter-annual differences and role of
benthic invertebrates. Journal of the Great Lakes Research 37, 238–244.
Raphael, B.H., Shirey, T.B., Lúquez, C., Maslanka, S.E. 2014. Distinguishing highly-
related outbreak-associated Clostridium botulinum type A(B) strains. BMC
Microbiology 14, 192-199.
Reed, T.M., Rocke, T.E. 1992. The role of avian carcasses in botulism epizootics.
Wildlife Society Bulletin 20, 175-182.
Rocke, T.E., Friend, M. 1999. Avian botulism. In Friend, M., Franson, J.D. (eds), Field
manual of wildlife disease. General procedures and diseases of birds, USGS
National Wildlife Health Center, Washington, USA. p 271-281
Rocke, T.E., Samuel, M.D. 1999. Water and sediment characteristics associated with
avian botulism outbreaks in wetlands. Journal of Wildlife Management 63,
1249-1260.
Discusión general
207
Rocke, T.E. 2006. The global importance of avian botulism. In Boere, G.C., Galbraith,
C.A., Stroud, D.A. (eds), Waterbirds around the world, The Stationery Office,
Edinburgh, UK. p 422-426.
Segner, W.P., Schmidt, C.F., Boltz, J.K. 1971. Enrichment, isolation, and cultural
characteristics of marine strains of Clostridium botulinum type C. Applied
Microbiology 22, 1017–1024.
Shutt, J.L., Andrews, D.W., Weseloh, D.V.C., Moore, D.J., Hebert, C.E., Campbell,
G.D., Williams, K. 2014. The importance of island surveys in documenting
disease-related mortality and botulism E in Great Lakes colonial waterbirds.
Journal of Great Lakes Research 40, 58–63.
Takeda, M., Tsukamoto, K., Kohda, T., Matsui, M., Mukamoto, M., Kozaki, S. 2005.
Characterization of the neurotoxin produced by isolates associated with avian
botulism. Avian Diseases 49, 376-381.
Vidal, D., Anza, I., Taggart, M.A., Pérez-Ramírez, E., Crespo, E., Hofle, U., Mateo, R.
2013. Environmental factors influencing the prevalence of Clostridium
botulinum type C in non-permanent Mediterranean wetlands. Applied and
Environmental Microbiology 79, 4264-4271.
Webb, M.D., Pin, C., Peck, M.W., Stringer, S.C. 2007. Historical and contemporary
NaCl concentrations affect the duration and distribution of lag times from
individual spores of nonproteolytic Clostridium botulinum. Applied and
Environmental Microbiology 73, 2118-2127.
Wobeser, G. 1997. Avian botulism – another perspective. Journal of Wildlife Diseases
33, 181–186.
Tesis doctoral – Ibone Anza Gómez
208
Work, T.M., Klavitter, J.L., Reynolds, M.H., Blehert, D. 2010. Avian botulism: a case
study in translocated endangered Laysan ducks (Anas laysanensis) on Midway
Atoll. Journal of Wildlife Diseases 46, 499–506.
Woudstra, C., Skarin, H., Anniballi, F., Fenicia, L., Bano, L., Drigo, I., Koene, M.,
Bäyon-Auboyer, M.H., Buffereau, J.P., De Medici, D., Fach, P. 2012.
Neurotoxin gene profiling of Clostridium botulinum types C and D native to
different countries within Europe. Applied and Environmental Microbiology 78,
3120-3127.
Zechmeister, T.C., Kirschner, A.K, Fuchsberger, M., Gruber, S.G., Suess, B.,
Rosengarten, R., Pittner, F., Mach, R.L., Herzig, A., Farnleitner, A.H. 2005.
Prevalence of botulinum neurotoxin C1 and its corresponding gene in
environmental samples from low and high risk avian botulism areas. ALTEX 22,
185–195.
Conclusiones
209
CONCLUSIONES
1. El botulismo aviar en los humedales manchegos, y quizás en el resto de España,
está producido principalmente por el mosaico Clostridium botulinum tipo C/D
como ocurre en otros países europeos.
2. Usando la técnica de Electroforesis en Gel de Campo Pulsante (EGCP) se ha
comprobado que las aves salvajes y domésticas comparten cepas de C.
botulinum tipo C/D. Las cepas de este mosaico son genéticamente muy similares
en territorios distantes como España y Suecia, por lo que podrían haber sido
transportadas por aves acuáticas en su ruta migratoria.
3. La temperatura media durante el mes de julio superior a 26 ºC incrementa la
mortalidad asociada a brotes de botulismo aviar, por lo que durante veranos
especialmente calurosos debería aumentarse la vigilancia y retirada de cadáveres
en humedales para evitar o minimizar los brotes de botulismo.
4. El vertido de aguas residuales insuficientemente tratadas en humedales produce
la eutrofización de sus aguas. En verano, debido a las altas temperaturas, se
produce el sobrecrecimiento y muerte del fitoplancton que finalmente
desencadena la producción de condiciones anaerobias en los sedimentos y
permite la proliferación de C. botulinum tipo C/D en ellos, lo que podría explicar
los brotes recurrentes en estos humedales.
5. En los humedales en los que se vierten aguas residuales insuficientemente
tratadas la prevalencia de bacterias patógenas para las aves es mucho mayor que
en los naturales. Estas bacterias pueden producir mortalidades entre las aves
acuáticas que después podrían desencadenar brotes de botulismo cuando las
condiciones ambientales fuesen favorables.
Tesis doctoral – Ibone Anza Gómez
210
6. Las moscas necrófagas pueden portar un número suficiente de células de C.
botulinum tipo C/D entre cadáveres para que el patógeno se multiplique en ellos
y así aumentar el número de larvas tóxicas y la propagación de los brotes. Esta
relación tiene características de un mutualismo, puesto que ambas especies
obtienen beneficios.
7. Las aves excretan C. botulinum tipo C/D en función de la prevalencia del
microorganismo en el ambiente y lo pueden portar entre humedales. La mayoría
de aves afectadas de botulismo ingresadas y tratadas en el centro de
recuperación deja de excretar el microorganismo antes del séptimo día.
8. Las aves que se alimentan en superficie y son generalistas, como los ánades
azulones, gaviotas reidoras, fochas y ánades frisos, son más sensibles a la
intoxicación por botulismo que aves especialistas, como zampullines y
flamencos. Algunos patos buceadores, como la globalmente amenazada
malvasía cabeciblanca también se encuentra entre las especies afectadas
frecuentemente por esta enfermedad.