Eosinophil viability is increased by acidic pH in a cAMP- and GPR65-dependent manner

PHAGOCYTES, GRANULOCYTES, AND MYELOPOIESIS

Eosinophil viability is increased by acidic pH in a cAMP- and GPR65-dependentmannerLeah C. Kottyan,1,2 Ann R. Collier,1 Khanh H. Cao,1 Kathryn A. Niese,1 Megan Hedgebeth,1 Caius G. Radu,3,4

Owen N. Witte,5,6 Gurjit K. Khurana Hershey,1,2 Marc E. Rothenberg,1,2 and Nives Zimmermann1,2

1Cincinnati Children’s Hospital Medical Center, OH; 2Immunobiology Graduate Program, University of Cincinnati College of Medicine, OH; and 3Crump Institutefor Molecular Imaging, 4Department of Molecular and Medical Pharmacology, David Geffen School of Medicine, 5Department of Microbiology, Immunology, andMolecular Genetics, and 6Howard Hughes Medical Institute, University of California, Los Angeles

The microenvironment of the lung in asthmaisacidic,yet theeffectofacidityon inflamma-tory cells has not been well established. Wenow demonstrate that acidity inhibits eosin-ophil apoptosis and increases cellular viabil-ity in a dose-dependent manner betweenpH 7.5 and 6.0. Notably, acidity induced eo-sinophil cyclic adenosine 5�-monophos-

phate (cAMP) production and enhanced cel-lular viability in an adenylate cyclase–dependent manner. Furthermore, we identifyG protein-coupled receptor 65 (GPR65) asthe chief acid-sensing receptor expressedby eosinophils, as GPR65-deficient eosino-phils were resistant to acid-induced eosino-phil cAMP production and enhanced viabil-

ity. Notably, GPR65�/� mice had attenuatedairway eosinophilia and increased apopto-sis in 2 distinct models of allergic airwaydisease. We conclude that eosinophil viabil-ity is increased in acidic microenvironmentsin a cAMP- and GPR65-dependent manner.(Blood. 2009;114:2774-2782)

Introduction

Asthma is a chronic lung disease characterized by episodes of inflamma-tion and narrowing of the airways in response to diverse stimuli.1 Overthe past 2 decades, the incidence of asthma has increased worldwide andis now one of the chief diagnoses responsible for pediatric hospitaliza-tion. Extracellular acidosis is commonly observed in inflammatorydiseases such as asthma. Several studies have shown that the pH ofexhaled breath condensate (EBC) in patients with acute asthma issignificantly lower than that of normal subjects. The pH of EBC ismildly alkaline in control persons (7.65 � 0.20), reaching 5.23 plus orminus 0.21 during asthma exacerbations.2 Furthermore, the EBC pH ofpediatric and adult patients with chronic asthma is also significantlydecreased compared with healthy people and correlates with asthmaseverity.3,4 Whereas EBC is not a direct measurement of airway liningfluid, airway acidification in asthma is supported by alternative ap-proaches, including direct measurements of bronchial secretions.2

Although EBC pH is not an asthma-specific biomarker, early clinicalstudies have suggested that acidification contributes to the diseaseprocess as inhalation of buffers that increase airway pH alleviatesasthma symptoms.5

G protein-coupled receptor 65 (GPR65), also known as T-celldeath-associated gene 8, belongs to a group of acid-sensing receptors inthe G2A G protein–coupled receptor (GPCR) family.6-8 This groupincludes G2A, GPR65, ovarian cancer GPCR1 (OGR1), and GPR4.Some members of the G2A family, including GPR65, have been shownto be proton sensors in lymphocytes. Acid-sensing capacity is mediatedby proton transfer to histidines in the first extracellular loop of GPR65,presumably causing a conformational change in GPR65 that activatesG�s. This acid-sensing activity has been demonstrated by measuringintracellular cyclic adenosine 5�-monophosphate (cAMP) in GPR65-deficient lymphocytes incubated at several proton concentrations.7

To better understand the functional implications of acidicmicroenvironments on eosinophils, hallmark cells of asthmaticinflammation,9 we assessed the function of eosinophils exposed toacid. Recent studies in patients with asthma and experimentalmodels of asthma suggest that eosinophils have a causative role inasthma under certain conditions.10-13 Eosinophils may affect thepathophysiologic processes of asthma through an array of mecha-nisms, including immunomodulation, inducing tissue damage anddysfunction by releasing toxic granule proteins, and effects onnerves leading to bronchoconstriction.9

Importantly, we found that both human and murine eosinophilsrespond to protons with increasing cellular viability and decreasing earlyapoptosis. We demonstrate that eosinophils respond to increased acidityby increasing intracellular cAMP production; furthermore, the activityof adenylate cyclase is required for acidity-enhanced eosinophil viabil-ity. We identified an acid-sensing receptor GPR65 that has increasedexpression in asthmatic inflammation and is expressed on eosinophils.Importantly, we demonstrate that the acidic pH-induced increase ineosinophil cAMP and viability is dependent upon GPR65. Finally, weshow that GPR65�/� mice have attenuated airway eosinophilia in2 distinct models of allergic asthma, and this is associated with increasedapoptosis in GPR65�/� compared with wild-type allergen-elicitedairway eosinophils.

Methods

Mice

Male and female 8- to 12-week-old, CD2–interleukin 5 (IL-5) transgenic(Tg) mice (BALB/c)14 were housed under specific pathogen-free conditions

Submitted May 7, 2009; accepted July 14, 2009. Prepublished online as BloodFirst Edition paper, July 29, 2009; DOI 10.1182/blood-2009-05-220681.

Some of the data in this study were presented in abstract form at the 2007 annualmeeting of the American Academy of Asthma, Allergy, and Immunology, San Diego,CA, February 26, 2007, the 2009 annual meeting of the American Academy ofAsthma, Allergy, and Immunology, Washington, DC, March 17, 2009, and the 2007International Eosinophil meeting, Snowbird, UT, July 20, 2007

The online version of this article contains a data supplement.

The publication costs of this article were defrayed in part by page chargepayment. Therefore, and solely to indicate this fact, this article is herebymarked ‘‘advertisement’’ in accordance with 18 USC section 1734.

© 2009 by The American Society of Hematology

2774 BLOOD, 24 SEPTEMBER 2009 � VOLUME 114, NUMBER 13

For personal use only.on March 24, 2016. by guest www.bloodjournal.orgFrom

and used as a source of eosinophils, as previously reported.15 CD2–IL-5transgenic mice were crossed with GPR65�/� BALB/c mice16 as a source ofGPR65-deficient eosinophils. BALB/c and GPR65�/� mice were used forallergen challenge experiments. All animal studies were reviewed andapproved by the Cincinnati Children’s Hospital Medical Center Institu-tional Animal Care and Use Committee.

Human eosinophil purification

Eosinophils were purified from healthy or mildly atopic volunteers bynegative immunomagnetic selection, as reported,17 and approved by theCincinnati Children’s Hospital Medical Center Institutional Review Board,with informed consent obtained in accordance with the Declaration ofHelsinki. Briefly, granulocytes were isolated from heparin-anticoagulatedwhole blood by dextran sedimentation, Percoll centrifugation, and hypo-tonic lysis of red blood cells. Cells were resuspended in Hanks buffered saltsolution (Life Technologies) with 2% fetal calf serum and incubated with0.75 �L/106 cells of anti-CD16–conjugated microbeads (magnetic acti-vated cell sorting [MACS]; Miltenyi Biotec) for 30 minutes at 4°C. The cellsuspension was then applied onto a CS MACS column, and negativepopulations were collected through a magnetic field. The isolates routinelycontained more than 95% eosinophils with viability of more than 95% asassessed by trypan blue exclusion.

Murine eosinophils

Eosinophils were obtained from spleen cells derived from CD2–IL-5transgenic mice, in which approximately 30% to 50% of the cells areeosinophils. Both the ammonium chloride and hypotonic methods of redblood cell lysis were used with similar results. Eosinophils were purified(80%-85% purity) from the spleen by immunomagnetic negative selectionusing anti-Thy1.2 and anti-CD19 using the MACS system (MiltenyiBiotec), as previously described.15 The results from 2A were also confirmedon murine eosinophils purified to more than 95% using polarized light tosort the eosinophils by flow cytometry, as described previously.18 Purifiedeosinophils were used for measurement of cAMP, whereas unpurifiedspleen cells were used for viability assays.

Assessment of viability

For acidic exposure, RPMI with 10% fetal bovine serum was prepared byusing 30 mM biologic buffer (either HEPES [N-2-hydroxyethylpiperazine-N�-2-ethanesulfonic acid], 2-[N-morpholino]ethanesulfonic acid (MES),acetate, or citrate for pH ranges 8.5-7.0, 6.5-5.5, 5.0-4.5, and 4.0,respectively). After the media was adjusted to the appropriate pH, NaCl wasadded to maintain osmolarity at 330 mOsM. For mouse studies, IL-5 Tgspleen cells (5-10 � 105 cells) were incubated in 1 mL buffered media for 3to 7 hours at 37°C with 5% CO2. After 5 hours of incubation, the pHincreased by 0.25 plus or minus 0.08 at pH 7.5 and 0.2 plus or minus 0.1 atpH 6. In some experiments, cells were first stained with anti–C-C chemo-kine receptor (CCR)3 or anti–Siglec-F to identify eosinophils. For humanstudies, purified eosinophils were incubated for 18 to 24 hours. Apoptosisand viability were determined using annexin V–allophycocyanin and7-aminoactinomycin D (7AAD), according to the manufacturer’s instruc-tions (BD Biosciences). Viability was defined as annexin V–negative,7AAD-negative. Early apoptosis was defined as annexin V–positive, 7AAD-negative. Briefly, cells were washed and resuspended in annexin V–bindingbuffer and stained with annexin V–allophycocyanin and 7AAD. Sampleswere then incubated at room temperature for 15 minutes. Cells wereanalyzed immediately on the FACSCalibur.

Experimental asthma induction

Allergic lung disease was established by 2 mouse models, ovalbumin(OVA) and Aspergillus fumigatus, as described.19,20 Briefly, the OVA modelinvolved 2 intraperitoneal sensitizations of OVA with alum, followed by2 intranasal challenges with either OVA or saline. The Aspergillus modelinvolved 9 intranasal challenges with Aspergillus extract. After the micewere killed, bronchoalveolar lavage (BAL) differential cell counts wereperformed, as previously described.20

Preparation of RNA and microarray hybridization

Microarray data are derived from dataset published previously.19,20 Briefly,whole lung RNA from saline and allergen (OVA and A fumigatus)–challenged mice was hybridized to Affymetrix gene arrays. Data analysiswas described previously.19,20

Northern blot

RNA was extracted from the lungs of allergen-challenged mice. The cDNAprobes, generated from commercially available vectors (Image Consortiumobtained from ATCC), were confirmed by sequencing radiolabeled with 32P,and hybridized using standard conditions.19,20

Human RNA samples

Nasal brushing samples were obtained from children with stable asthma,children undergoing an asthma exacerbation, and nonatopic children withasthma, as described previously.21

RT-PCR

Gene-specific primers (designed by using Beacon Designer software[Applied Dynamics International]) were chosen to span at least 1 intron inthe genomic sequence to enable the mRNA-derived product to be distin-guished from any possible contaminating genomic product. The sequencesof primers for GPR65 are forward, CGGAAGAAACATGGAAGGAA andreverse, TTGGCTAAAGGGGTCAACTG. Before cDNA synthesis (usingSuperScript II, RNase H�; Invitrogen), 1 to 2 �g of each RNA sample waspretreated with DNase I (Invitrogen). Reverse transcription–polymerasechain reaction (RT-PCR) analysis was conducted with the iCycler (Bio-Rad) by using the iQ SYBR Green Supermix Taq polymerase mix(Bio-Rad). The amount of double-stranded DNA product, indicated bySYBR Green fluorescence, was measured at the end of each extensioncycle. The relative mRNA levels of each target gene were normalized to thehousekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (forward,TGGAAATCCCATCACCATCT; reverse, GTCTTCTGGGTGGCAGTGAT).

Measurement of cAMP in eosinophils

Human eosinophils isolated from peripheral blood and murine eosinophilspurified from the spleen by immunomagnetic negative selection were usedto assess cAMP levels. Cells were incubated in buffered media and 0.5 mM3-isobutyl-1-methylxanthine (IBMX). After a 30-minute incubation, cellswere lysed for cAMP quantification using enzyme-linked immunosorbentassay (ELISA; Amersham Biosciences). For data in Figure 2E, humaneosinophils were incubated without treatment, or with IBMX or adenylatecyclase inhibitor for 10 minutes.

Bone marrow eosinophil CFU analysis and eosinophil bloodlevels

Eosinophil colony-forming unit (CFU) analysis was performed, as de-scribed previously.22 A sample of peripheral blood was added directly toDiscombe solution, and the eosinophils were counted with ahemocytometer.23

ELISA measurements

Protein levels were measured in eosinophil lysates, BAL fluid (BALF), andlung homogenates using ELISA kits specific for IL-5, IL-13, and eotaxin-2(R&D Systems). The sensitivity of the ELISAs were as follows: 31.25 pg/mL, 250 pg/mL, and 15.6 pg/mL for IL-5, IL-13, and eotaxin-2, respec-tively. OVA-specific immunoglobulin G1 was measured, as previouslydescribed.24

Chemotaxis

Chemotactic responses were determined by chemotaxis through a Trans-well plate, as previously described.25 Eosinophils (1.5 � 106) in bufferedsaline (HEPES or 2-[N-morpholino]ethanesulfonic acid for pH 7.5 and 6.0,

ACID ENHANCES EOSINOPHIL VIABILITY THROUGH GPR65 2775BLOOD, 24 SEPTEMBER 2009 � VOLUME 114, NUMBER 13

For personal use only.on March 24, 2016. by guest www.bloodjournal.orgFrom

respectively; osmolarity was adjusted to equal value in all conditions) with0.5% bovine serum albumin (low endotoxin; Sigma-Aldrich) were placedin the upper chamber, and the chemoattractant (eotaxin-2 at various doses inbuffered saline with 0.5% bovine serum albumin) was placed in the lowerchamber. Chemotaxis was allowed to proceed for 1 hour (before changes inviability occur) at pH 7.5 and 6.0; both top and bottom chambers wereadjusted to the same pH.

Actin polymerization

Agonist-induced actin polymerization was assessed using nitrobenzoxadia-zole-phallacidin (Molecular Probes). For experiments measuring pH-induced actin polymerization, eosinophils were resuspended in pH-bufferedsaline and sampled at 0 to 120 seconds. For eotaxin-2–elicited actinpolymerization, eosinophils were resuspended at 2.5 � 106 cells/mL inpH-buffered saline and stimulated with eotaxin-2 (10 nM) for indicatedamounts of time. After stimulation, cells were fixed in 3.7% formaldehydefor 60 minutes. Lysophosphatidylcholine (100 mg/mL; Sigma-Aldrich) and3.3 � 10�7 M nitrobenzoxadiazole-phallacidin were added to the cells andincubated for 1 hour in the dark. Cells were analyzed on a FACSCaliburwith a linear fluorescence channel (FL1) in which the fluorescence isproportional to F-actin content. Relative F-actin content is expressed as theratio of the mean channel fluorescence between chemokine- and mediaalone–stimulated cells.

Statistical analysis

Within experiments, analysis of variance with appropriate posttest (forexperiments with more than 2 groups) and Student t test (for experiments

with 2 groups) were used to assess statistical significance. Paired t testswere used to assess significance over multiple experiments.

Results

Exposure to acidity increases eosinophil viability anddecreases eosinophil apoptosis

To examine the effects of acidity on eosinophils, we incubatedmurine eosinophils in media buffered to various pH. The viabilitydyes annexin V and 7AAD were used to assess eosinophil viabilityand apoptosis by measuring the percentage of cells in eachquadrant and the number of cells at the end of the incubation.Viable cells were defined as annexin V–negative, 7AAD-negative.Early apoptotic cells were defined as annexin V–positive, 7AAD-negative. Mouse eosinophils incubated in acidic pH were found tohave increased viability and decreased apoptosis (Figure 1A-B).Specifically, at pH 6, there were 2.0- plus or minus 0.4-fold moreviable eosinophils and 1.75- plus or minus 0.5-fold fewer eosino-phils in early apoptosis compared with eosinophils incubated atpH 7.5 (average � SD; n � 13 experiments, paired t test, P � .008and P � .009, respectively). Furthermore, increased viability anddecreased early apoptosis with decreased pH occurred in a time-and dose-dependent manner (Figure 1C). When examined over a7-hour time course, there were no significant differences in

Figure 1. Eosinophils have decreased early apoptosisand increased viability in acidic pH. Murine (A-C) andhuman eosinophils (D-F) were incubated in media bufferedto various pH. Viability analysis shows that incubation ofmurine eosinophils in acidic media for 4 hours affects num-ber of viable eosinophils (A) and number of early apoptoticmurine eosinophils (B). Viability analysis of murine eosino-phils over a 7-hour time course shows that incubation ofmurine eosinophils in acidic media affects percentage ofviable eosinophils (C). Representative flow cytometric anal-ysis of human eosinophils incubated at various pH for24 hours (D) with quantification showing average percent-age of viable eosinophils with SD (E). Human eosinophilswere incubated in media buffered to pH 7.5 and 6.0 in thepresence of indicated doses of IL-5 for 18 hours (F). Resultsshow the average � SD of triplicate incubations. *P � .05.Representative experiment (of 11 and 3) is shown formurine and human eosinophils, respectively.

2776 KOTTYAN et al BLOOD, 24 SEPTEMBER 2009 � VOLUME 114, NUMBER 13

For personal use only.on March 24, 2016. by guest www.bloodjournal.orgFrom

viability at 3 hours, whereas at 5 hours eosinophils were moreviable at pH 6.0 compared with pH 7.5; at 7 hours, the pH-inducedeffect on eosinophil viability was significantly increased comparedwith 5 hours (Figure 1C). This pH-induced effect on eosinophilviability was also dose-dependent in human peripheral bloodeosinophils incubated for 24 hours (Figure 1D-E). Mild acidity hasan additive effect on IL-5–induced increased viability of humaneosinophils (Figure 1F). In summary, both human and murineeosinophils respond to increased acidity (decreased pH) withincreased viability and decreased apoptosis.

To show that the effects of acid on eosinophils are specific toviability, we assessed other pH-induced effects, including actinpolymerization and chemotaxis toward the eosinophil chemoat-tractant eotaxin-2. There were no significant differences in actinpolymerization in response to acidic exposure, eotaxin-2–induced actin polymerization in media of different pH, orchemoattraction toward eotaxin-2 in media of different pH(supplemental Figure 1, available on the Blood website; see theSupplemental Materials link at the top of the online article; anddata not shown).

Acidic pH increases intracellular cAMP production, which is acritical signaling molecule for eosinophil viability

We hypothesized that the effects of exposure of eosinophils toacidic microenvironments would involve intracellular signalingevents. Indeed, we found that purified murine eosinophils re-sponded to increasing exposure to acid with a significant up-regulation of cAMP production in a pH-dependent manner topH 5.5 (Figure 2A). Similar to murine eosinophils, human eosino-

phils responded to increased acidity with a dose-dependent in-crease in cAMP production (Figure 2B).

Previous studies have shown a role for cAMP in increasinghuman eosinophil viability.26-30 We hypothesized that murineeosinophils would also respond to agents that increased cAMP withincreased viability. To test this hypothesis, we exposed spleen-derived eosinophils to IBMX, a phosphodiesterase inhibitor;dibutyryl cAMP, a cell-permeable cAMP analog; and forskolin, anactivator of adenylate cyclase. Dibutyryl cAMP and forskolinincreased eosinophil viability (data not shown; consistent withMachida et al31). A dose-dependent increase in viability withincreased IBMX exposure was found at both pH 7.5 and 6.0;however, a corresponding dose-dependent decrease in viabilitywith an increasing dose of adenylate cyclase inhibitor SQ2254032

was found only at pH 6.0 (Figure 2C). Treatment with adenylatecyclase inhibitor at pH 6.0 decreased the eosinophil viability to thelevel observed at pH 7.5. To further understand the mechanism ofincreased viability in acidic pH, human eosinophils were exposedto various doses of phosphodiesterase inhibitor, IBMX, andadenylate cyclase inhibitor, SQ22540,32 at pH 7.5 and 6.0. IBMXincreased viability in a dose-dependent manner at both pH 7.5 and6.0. The adenylate cyclase inhibitor decreased eosinophil viabilityin a dose-dependent manner at pH 6.0, but not pH 7.5 (Figure 2D),thus demonstrating that acid-induced increased viability is depen-dent on cAMP. When eosinophil viability was assessed as afunction of intracellular cAMP, we found a strong association (R2

of 0.78, P � .001; Figure 2E). In summary, acidic pH leads tocAMP accumulation in eosinophils, and this is required for acidicpH-enhanced eosinophil viability.

Figure 2. Acidic pH increases intracellular cAMP, which is a critical signaling molecule in eosinophil viability. Eosinophils were isolated from mouse spleen or humanperipheral blood; eosinophils were incubated in media of over a pH range (A-B) for 30 minutes in the presence of IBMX, and accumulated intracellular cAMP was measured viaan ELISA from eosinophil lysates. n � 3 mice per group. Results shown as the mean intracellular cAMP � SD. Representative experiments (of 3) are shown. Murineeosinophils were incubated in IBMX (a phosphodiesterase inhibitor) or an adenylate cyclase inhibitor (C) for 4 hours. Human eosinophils were exposed to variousconcentrations of adenylate cyclase inhibitor SQ22536 and IBMX at pH 7.5 and pH 6.0 for 24 hours. Human eosinophil viability was assessed (D), and intracellular cAMP wasmeasured from the lysates of a sample of each well (taken at 10-minute time point); (E) demonstrates human eosinophil viability as a function of intracellular cAMP. Viabilityanalysis was performed using annexin V and 7AAD. Results show the average � SD (of triplicate incubations). *P � .05.

ACID ENHANCES EOSINOPHIL VIABILITY THROUGH GPR65 2777BLOOD, 24 SEPTEMBER 2009 � VOLUME 114, NUMBER 13

For personal use only.on March 24, 2016. by guest www.bloodjournal.orgFrom

GPR65 is a proton-sensing GPCR that has increasedexpression in models of asthmatic inflammation

The mechanism of pH recognition by inflammatory cells remainslargely unclear. We have previously defined a group of “asthmasignature genes” based on transcript expression profile analysis oflung tissue derived from 2 independent murine models of allergen-induced experimental asthma that both have a major eosinophiliccomponent.19,20 This analysis revealed that an acid-sensing recep-tor gpr65 is among the genes whose expression is up-regulated inthe lung by the induction of experimental allergic asthma (Figure3). This was specific for GPR65 as other related receptors (G2Aand endothelial differentiation gene [EDG]-1, -3, -5, -6, and -8) didnot exhibit increased expression in mouse models of asthma (datanot shown). The expression results for GPR65 were confirmed byNorthern blot analysis. In contrast to control saline-challengedmice that had no detectable levels of GPR65 mRNA, GPR65mRNA expression was significantly increased by allergen chal-lenge (Figure 3B-C). To assess relevance to human disease, wemeasured expression of GPR65 in nasal brushings of patients withstable and acute asthma and control patients.21 GPR65 mRNAexpression was increased by 4.1- plus or minus 3-fold in patientswith acute asthma compared with controls (P � .02). In samplesfrom patients with stable asthma, there was a trend towardincreased GPR65 mRNA expression (2.6- � 2-fold, P � .08; Fig-ure 3D). In summary, GPR65 expression is increased in multiplemurine models of allergic asthma and in human populations duringacute asthma exacerbations.

GPR65 is expressed by eosinophils

We hypothesized that GPR65 was expressed by eosinophils. To addressthis, we examined GPR65 gene-targeted mice that contain the GPR65exon 2 replaced with a construct encoding promoterless IRES–enhanced green fluorescent protein (EGFP) sequences, thus allowing forGPR65 promoter activity to be assessed by EGFP expression.7 Notably,our data demonstrate strong GPR65 promoter activity in murineeosinophils (Figure 4). As a control, peripheral blood T cells, B cells,

Figure 3. GPR65 has increased expression in allergicairway inflammation. (A-C) Lung RNA from allergen-treatedmice was analyzed by microarray analysis (A) and Northernblot (B-C) for expression of GPR65. Ethidium bromide (E Br)is shown as a loading control. (D) Quantitative RT-PCRanalysis of GPR65 expression from pediatric patients. *P � .05compared with saline in panelAand control subjects in panel D.

Figure 4. Eosinophils express significant GPR65 promoter activity. GPR65/

and GPR65�/� (GFP knockin) peripheral blood was assessed for median GFPexpression in the FL1 channel using flow cytometry. Cell types were defined asfollows: T cells (CD3), B cells (CD19), neutrophils (CCR3�Gr-1hi), and eosinophils(CCR3Gr-1lo). Quantification of a representative experiment is shown in panel A(n � 3 mice per genotype). (B) Histograms demonstrating GFP expression indifferent cell populations are shown. Results show the median FL1 � SD. *P � .05.Representative experiment (of 4) is shown. (C) PCR analysis of GPR65 expression incDNA made from human eosinophils and PBMC from 2 individual donors. �RTindicates negative control without reverse transcriptase.

2778 KOTTYAN et al BLOOD, 24 SEPTEMBER 2009 � VOLUME 114, NUMBER 13

For personal use only.on March 24, 2016. by guest www.bloodjournal.orgFrom

and neutrophils also expressed GPR65, as measured by the difference inmedian FL1 intensity between GPR65/ and GPR65�/� cells (Figure4). In mouse spleen and blood cells, the EGFP expression was 2.4 plusor minus 0.8 times higher in eosinophils than in T cells (average of5 experiments). In mouse bone marrow, we detected EGFP expressionin CD3, CD19, Gr1hi, and Siglec-F cells, but not Ter119 cells(supplemental Figure 2). Similarly, in human eosinophils (96% pure),RT-PCR analysis demonstrated expression of GPR65 mRNA (Figure4C); this is consistent with microarray data in the public domain33 (GeneExpression Omnibus [GEO] accession number GDS1775). In sum-mary, these data demonstrate substantial expression of GPR65 byeosinophils.

GPR65 is an eosinophil pH sensor

We tested the hypothesis that GPR65 was an eosinophil pH sensor.We first compared the response of GPR65/ and GPR65�/�

murine eosinophils to increasing acid concentrations: importantly,the up-regulation of cAMP production in eosinophils in response toincreased acid was ablated in GPR65�/� eosinophils (Figure 5A).GPR65/ and GPR65�/� eosinophils have equivalent viability at a30-minute time point across the pH range (data not shown). As acontrol, GPR65/ and GPR65�/� eosinophils up-regulated cAMPproduction in response to forskolin, an activator of adenylatecyclase at comparable levels (Figure 5B), showing that GPR65�/�

eosinophils do not have a global defect in cAMP production. Thus,GPR65 is a nonredundant acid-sensing receptor on eosinophils thatcontrols cAMP production.

GPR65 regulates eosinophil survival in vitro

To test the role of GPR65 in acidic pH-induced eosinophil viability,we assessed the viability of eosinophils from GPR65 wild-type and

GPR65-deficient mice at pH 7.5 and 6.0. Whereas wild-typeeosinophils had 1.8- plus or minus 0.4-fold increased numbers ofviable eosinophils at pH 6.0 compared with eosinophils at pH 7.5(n � 8 experiments; average � SD), GPR65�/� eosinophils had35% plus or minus 30% decrease in the numbers of viableeosinophils incubated at pH 6.0 compared with pH 7.5 (n � 8experiments; average � SD; Figure 5C). Thus, the acid-inducedincrease in eosinophil viability was not observed in GPR65-deficient cells.

GPR65 nonredundantly regulates eosinophil survival in vivo

We hypothesized that GPR65 would affect eosinophil viability inmurine models of asthma. Previously sensitized mice were eutha-nized 24 hours after the second allergen challenge, and differentialcell counts were determined by staining cytocentrifuge prepara-tions of the BALF (representative experiment in Figure 6A).

Figure 6. GPR65 is a critical regulator of BAL eosinophilia and viability inmurine asthma model. Sensitized GPR65/ and GPR65�/� were challenged withintranasal OVA or saline. The differential cell counts were performed by stainingcytocentrifuge preparations of the BALF (A). n � 4-6 mice per group. Flow cytometry–based viability analysis of eosinophils and mononuclear cells in representative in vivoexperiment using annexin V/7AAD (B) and anti-active caspase-3 (C). n � 4-6 miceper group. Results are shown as the mean � SD. Representative experiments (of3-5) are shown.

Figure 5. GPR65 regulates eosinophil cAMP production and viability. Eosinophilswere isolated from the spleens of GPR65/ or GPR65�/� mice; eosinophils wereincubated in media of various acidity (A) or forskolin at pH 7.0 (B) for 30 minutes in thepresence of IBMX, and accumulated intracellular cAMP was measured via an ELISA fromeosinophil lysates. n � 3 mice per group. Results shown as the mean intracellularcAMP � SD. Representative experiments (of 3) are shown. Viability analysis of GPR65/

and GPR65�/� eosinophils after a 5-hour ex vivo incubation at pH 7.5 and 6.0 (C). Resultsare representative of 3 time-course and 8 5-hour incubation experiments. Results areshown as the mean � SD of triplicate incubations.

ACID ENHANCES EOSINOPHIL VIABILITY THROUGH GPR65 2779BLOOD, 24 SEPTEMBER 2009 � VOLUME 114, NUMBER 13

For personal use only.on March 24, 2016. by guest www.bloodjournal.orgFrom

GPR65-deficient mice had 76% plus or minus 12% attenuation ofairway eosinophilia compared with normal controls (n � 8 experi-ments; P � .01-.001). Based on CCR3 and Siglec-F costaining,there was 82% plus or minus 8% attenuation of eosinophilia inGPR65-deficient mice compared with wild-type mice (data notshown; n � 3 experiments). In comparison, other cell types in theBALF of allergen-challenged mice were not reproducibly affectedby GPR65 expression (Figure 6A). Furthermore, we assessed theairway eosinophilia after 9 intranasal challenges with theallergenA fumigatus and found a statistically significant decrease inairway eosinophilia in the absence of GPR65. Specifically, inthe A fumigatus model, we found attenuated airway eosino-philia (representative experiment, 8.8 � 104 � 1.8 � 104 and3.0 � 104 � 1.2 � 104 BAL eosinophils in GPR65/ andGPR65�/�, respectively; average of 3 experiments, 2.5 � 0.5-folddecrease in BAL eosinophilia P � .05-.01). Taken together, thesedata demonstrate an in vivo effect of GPR65 in regulatingallergen-induced eosinophilia.

As a control, GPR65-deficient mice have normal levels ofCFU-eosinophil (GPR65/, 7 � 5 and GPR65�/�, 5 � 4 CFU-eosinophil colonies/105 low-density bone marrow cells). We foundcomparable levels of peripheral blood eosinophils in GPR65wild-type and deficient animals (GPR65/, 2.1 � 0.4 � 105 eosin-ophils/mL, and GPR65�/�, 2.2 � 0.1 � 105 eosinophils/mL). Fur-thermore, GPR65�/� and GPR65/ IL-5 Tg mice had comparablelevels of peripheral blood eosinophilia (GPR65/, 42 � 6 � 105

eosinophils/mL, and GPR65�/�, 48 � 1 � 105 eosinophils/mL).Together, these data suggest that eosinophils develop and egressinto the circulation normally in GPR65�/� mice.

The attenuated BALF eosinophilia in the allergen-challengedGPR65�/� mice could have been due to insufficient recruitment inthe airway. In vitro analysis demonstrated normal chemotacticresponses of GPR65�/� eosinophils (supplemental Figure 1).Furthermore, levels of Th2 cytokines (IL-5 and IL-13) in lungtissue, and the eosinophil chemokine eotaxin-2 in BALF were notaltered in allergen-challenged GPR65-deficient mice (supplemen-tal Figure 3). In addition, GPR65�/� mice were appropriately andsystemically sensitized to the allergen, as determined by the levelsof OVA-specific immunoglobulin G1 in plasma (data not shown).The lack of defects in sensitization or cytokine production suggeststhat the concerted action of other cell types, for example, lympho-cytes, was normal and that the defect was intrinsic to eosinophils.

Based on decreased numbers of airway eosinophils with normallevels of eosinophilic chemotactic agents, we hypothesized thatGPR65 functions to maintain eosinophil viability. Eosinophilsderived from the BALF of GPR65-deficient mice were signifi-cantly less viable, as assessed by 7AAD and annexin V staining(GPR65/, 78% � 9% viable; GPR65�/�, 53% � 8% viable;P � .001; Figure 6B). Specifically, the majority of GPR65/

eosinophils were annexin V�/7AAD�, whereas 3 plus or minus 0.1times more GPR65�/� than GPR65/ eosinophils were annexin V/7AAD� (average of 3 experiments). As a control, mononuclearcells in the BALF of GPR65/ and GPR65�/� did not differ inviability, further suggesting that in allergic inflammation GPR65-deficient mice have a specific defect in eosinophils (90% � 2% and87% � 2% mononuclear cell viability in GPR65/ and GPR65�/�,respectively). We also found a defect in BAL eosinophil viabilityfollowing the Aspergillus model in GPR65�/� compared withGPR65/ mice (representative experiment: 67% � 8% and55% � 9% of BALF eosinophils that were viable in GPR65/ andGPR65�/� mice, respectively; average � SD of 3 experiments,

12% � 4% decrease in viability in GPR65�/� compared withGPR65/ BAL eosinophils). To identify changes in caspase-3activity in the BALF eosinophils, we used flow cytometry tomeasure the percentage of eosinophils with caspase-3 activation inthe BALF of OVA-challenged GPR65/ and GPR65�/� mice.There was a significant increase in active caspase-3 in theGPR65�/� BALF eosinophils compared with the GPR65/ BALFeosinophils: 38% plus or minus 6% and 61% plus or minus 6% ofBAL eosinophils had activated caspase-3 in GPR65/ andGPR65�/�, respectively (Figure 6C). In summary, GPR65 regu-lates viability of allergen-elicited BALF eosinophils, most likelythrough a caspase-dependent mechanism.

Discussion

Acidity of the airways in asthma has been demonstrated in multiplestudies and is in trials as a noninvasive biomarker with clinicalutility to diagnose and/or guide treatment of asthma (reviewed inHunt34). However, the effect of airway acidity on inflammatorycells that accumulate in asthma is an understudied area of research.Prior studies have mainly concentrated on neutrophils, demonstrat-ing that their functional responses (eg, chemokinesis and survival)are enhanced in acidic pH.35-37 Similarly, lymphocyte motility isactivated by acidic pH.38 Dendritic cell activation as well as uptakeof antigen are also increased with mild acidosis.39 In macrophages,a recently published study highlights the role of GPR65, calledT-cell death–associated gene 8 in their study, in mediating acid-induced inhibition of cytokine production, for example, tumornecrosis factor-�, in response to endotoxin.40 In this study, weestablish that acidic pH enhances the viability of eosinophils in amanner dependent upon adenylate cyclase activity and cAMPproduction.

Recently, a novel hypothesis has been proposed that protonsmay act as intercellular signal transmitters. For instance, a recentpublication demonstrated that protons are released from cells in aregulated way and that adjacent cells have proton receptors;together, this leads to a physiologic response, namely musclecontraction in Caenorhabditis elegans.41 Extracellular acidosismay affect cells by multiple mechanisms, including the following:(1) affecting cell surface receptors (such as the acid-sensing familyof GPCRs), leading to intracellular signal transduction; (2) activat-ing acid-sensing ion channels (such as the neuronal subgroup ofepithelial sodium [Na] channels), leading to acid-evoked cur-rents42; or (3) indirectly by affecting the action of other ligands (eg,chemokines,43 growth factors whose activity may be pH-dependent) or by affecting intracellular pH. For instance, inosteoclasts, ovarian cancer GPCR1 (OGR1) is a crucial protonsensor that regulates survival.44 In this study, we provide evidencethat the effect of extracellular acidosis on eosinophils involvesGPR65, a novel cell surface proton-sensing GPCR, and theintracellular second messenger cAMP, at least in part. We demon-strate the importance of this pathway in vivo on eosinophil viabilityand accumulation in models of allergic airway inflammation.

cAMP accumulation has been shown to induce eosinophilsurvival. Treatment of eosinophils with the adenylate cyclaseactivator forskolin, �2 adrenergic agonists, or other stimulators ofG�s-coupled GPCRs, or phosphodiesterase inhibitors, leads toincreased cAMP and enhanced eosinophil survival.26-31 As a sidenote, whereas the commonly used phosphodiesterase inhibitor,theophylline, leads to eosinophil cell death, this effect is indepen-dent of cAMP.29 However, cAMP has been associated with

2780 KOTTYAN et al BLOOD, 24 SEPTEMBER 2009 � VOLUME 114, NUMBER 13

For personal use only.on March 24, 2016. by guest www.bloodjournal.orgFrom

inducing cell death in other cell types,45,46 thus demonstratingeosinophil specificity of this effect. Furthermore, the effect ofpH-induced regulation of cAMP on eosinophil viability waspreviously unknown.

We further demonstrate the importance of a novel acid-sensingreceptor, GPR65, in regulating eosinophil viability in response toacidic pH in vitro and allergen challenge in vivo. We first identifiedGPR65 as an allergen-induced gene19,20 (Figure 3). GPR65 waspreviously shown to control acidic pH-induced cAMP accumula-tion in lymphocytes.7 Second, we show that GPR65 is expressed oneosinophils at a higher level than other hematopoietic cells. This isconsistent with microarray data in the public domain showing thehighest level of GPR65 on human eosinophils, followed byneutrophils and basophils, and lymphocytes33 (GEO accessionnumber GDS1775). Unfortunately, we were unable to obtainGPR65-specific staining with commercially available antibodies(clones sc-9702 and sc9705 from Santa Cruz Biotechnology).Furthermore, we show that GPR65 regulates acidic pH-inducedcAMP accumulation in eosinophils, as well as acid pH-enhancedeosinophil viability. Consistent with the in vitro observations, ourin vivo studies demonstrate that GPR65 critically regulates airwayeosinophilia in a murine model of allergic airway inflammation. Weprovide evidence that the mechanism of GPR65’s regulation ismediated by regulation of eosinophil viability. Eosinophil apopto-sis has been hypothesized to regulate the maintenance and clear-ance of eosinophils during allergic airway inflammation. Factorsthat affect the balance of antiapoptotic and proapoptotic proteins ineosinophils in the microenvironment of allergic airway inflamma-tion are not well understood. The clearance of dead eosinophilsfrom the airways of allergen-challenged mice is rapid and mostlikely meditated by macrophage and epithelial cell phagocytosis.The difference in viability seen in our study may explain theattenuation of eosinophilia, as once eosinophils begin the deathpathway, surrounding cells quickly phagocytose them. This issupported by our finding that GPR65�/� mice have a 3-foldincrease in early apoptotic cells (annexin V/7AAD�), but nochange in late apoptotic/necrotic cells (annexin V/7AAD; seeFigure 6B), suggesting that late apoptotic cells are phagocytosedand removed. There have been descriptions of apoptotic eosino-phils in the airways going through secondary necrosis.47 Althoughwe demonstrate that GPR65-deficient eosinophils have decreasedsurvival in the BALF of allergen-challenged mice, future studieswill directly address whether phagocytosis or secondary necrosis isresponsible for the observed decreased BALF eosinophilia. It alsoremains possible that GPR65-deficient eosinophils undergo activa-tion-induced death in the lung parenchyma and can thus not betransported into the alveolar space, which has been suggested as aclearance mechanism for apoptotic eosinophils.47 Finally, our invivo studies in allergen-challenged mice do not directly test the roleof acidic pH in eosinophil viability and accumulation. Ourpreliminary analysis demonstrates that the airway pH is indeedacidic in the OVA model of allergic airway inflammation.48

Future studies will focus on the in vivo effect of acidic pH oneosinophil viability, effect of acidic pH on other eosinophilfunctions (respiratory burst, degranulation), as well as any conse-quences on asthma outcomes.

Previous studies have shown expression of GPR65 in multiplehematopoietic cells. Similarly, we compare the expression of

GPR65 (inferred from GFP expression in GPR65�/� mice) ineosinophils, neutrophils, and T and B lymphocytes. Whereas thelevel was highest in eosinophils, other cells also express GPR65.However, our in vivo experiments demonstrate eosinophil-selective effects in that eosinophils are the only cell type consis-tently decreased in the BALF of allergen-challenged GPR65�/�

mice. There are several potential explanations for this finding.First, as we demonstrate that the GPR65 level is higher ineosinophils compared with other hematopoietic cells, eosinophilsmay be more sensitive to GPR65 than other cell types. Similarly,GPR65 function may be nonredundant in eosinophils, whereasother related receptors may compensate in other cell types.Alternatively, cAMP may have different functions in different celltypes that may stem from cross-talk with other pathways ordifferential levels of cAMP at baseline in individual cell types.45,46

For instance, the level of cAMP in regulatory T cells is greater than10-fold higher than in CD4 effector T cells.45 Future studies willspecifically address the cell selectivity of the GPR65 effect.However, our study clearly demonstrates that, despite its originalname (T-cell death-associated gene 8) and early studies in T cells,49,50

GPR65 is expressed in eosinophils and it functions in a survival-promoting fashion.

In summary, our results have established the following: (1) acidicpH regulates eosinophil survival; (2) intracellular cAMP is acrucial regulator of acid-enhanced eosinophil survival; (3) GPR65is expressed and functions as an acid-sensing receptor on eosino-phils; and (4) GPR65 regulates allergen-induced airway eosinophilia.

Acknowledgments

We thank Drs David Hildeman, Kimberly Risma, and UmasundariSivaprasad for advice and critical input regarding this study; DrsChristopher Karp, Fred Finkelman, and Simon Hogan for criticalreview of this manuscript; and Mark Ericksen and Drs YoshiyukiYamada and Jesus Guajardo for technical help.

This work was supported in part by a Cincinnati Children’sHospital Medical Center Trustee grant to N.Z. and NationalInstitutes of Health grant R21A1079251 to N.Z. We acknowledgean American Academy of Allergy, Asthma, and ImmunologyStrategic Training in Allergy Research (ST*AR) award (to L.C.K.).L.C.K. is a Philanthropic Educational Organization (PEO) scholar.O.N.W. is an Investigator of the Howard Hughes Medical Institute.

Authorship

Contribution: L.C.K., A.R.C., K.H.C., K.A.N., M.H., and G.K.H.performed research; L.C.K., A.R.C., G.K.H., M.E.R., and N.Z.analyzed and interpreted data; C.G.R. and O.N.W. contributed vitalnew reagents (GPR65-deficient mice); and L.C.K., M.E.R., andN.Z. wrote the manuscript.

Conflict-of-interest disclosure: M.E.R. and N.Z. received re-search funding from Merck related to GPR65. The remainingauthors declare no competing financial interests.

Correspondence: Nives Zimmermann, Division of Allergyand Immunology, Cincinnati Children’s Hospital, 3333 BurnetAve, ML 7028, Cincinnati, OH 45229-3039; e-mail: [email protected].

ACID ENHANCES EOSINOPHIL VIABILITY THROUGH GPR65 2781BLOOD, 24 SEPTEMBER 2009 � VOLUME 114, NUMBER 13

For personal use only.on March 24, 2016. by guest www.bloodjournal.orgFrom

References

1. Busse WW, Lemanske RF Jr. Asthma. N EnglJ Med. 2001;344:350-362.

2. Hunt J, Fang K, Malik R, et al. Endogenous air-way acidification: implications for asthma patho-physiology. Am J Respir Crit Care Med. 2000;161:694-699.

3. Carpagnano GE, Barnes PJ, Francis J, Wilson N,Bush A, Kharitonov SA. Breath condensate pH inchildren with cystic fibrosis and asthma: a newnoninvasive marker of airway inflammation?Chest. 2004;125:2005-2010.

4. Kostikas K, Papatheodorou G, Ganas K,Psathakis K, Panagou P, Loukides S. pH in ex-pired breath condensate of patients with inflam-matory airway diseases. Am J Respir Crit CareMed. 2002;165:1364-1370.

5. Ahmed T, Ali JM, al-Sharif AF. Effect of alkalinebulization on bronchoconstriction in acutebronchial asthma. Respir Med. 1993;87:235-236.

6. Ishii S, Kihara Y, Shimizu T. Identification of T celldeath-associated gene 8 (TDAG8) as a novelacid sensing G-protein coupled receptor. J Bio-chem. 2005;280:9083-9087.

7. Radu CG, Nijagal A, McLaughlin J, Wang L, WitteON. Differential proton sensitivity of related Gprotein-coupled receptors T cell death-associatedgene 8 and G2A expressed in immune cells. ProcNatl Acad Sci U S A. 2005;102:1632-1637.

8. Wang J, Kon J, Mogi C, et al. TDAG8 is a proton-sensing and psychosine-sensitive G-protein-coupled receptor. J Biol Chem. 2004;279:45626-45633.

9. Rothenberg M, Hogan S. The eosinophil. AnnuRev Immunol. 2006;24:147-174.

10. Lee JJ, Dimina D, Macias MP, et al. Defining alink with asthma in mice congenitally deficient ineosinophils. Science. 2004;305:1773-1776.

11. Haldar P, Brightling CE, Hargadon B, et al. Me-polizumab and exacerbations of refractory eosin-ophilic asthma. N Engl J Med. 2009;360:973-984.

12. Humbles AA, Lloyd CM, McMillan SJ, et al. A criti-cal role for eosinophils in allergic airways remod-eling. Science. 2004;305:1776-1779.

13. Nair P, Pizzichini M, Kjarsagaard M, et al. Mepoli-zumab for prednisone-dependent asthma withsputum eosinophilia. N Engl J Med. 2009;360:985-993.

14. Dent LA, Strath M, Mellor AL, Sanderson CJ. Eo-sinophilia in transgenic mice expressing interleu-kin 5. J Exp Med. 1990;172:1425-1431.

15. Rothenberg ME, Luster AD, Leder P. Murineeotaxin: an eosinophil chemoattractant induciblein endothelial cells and in interleukin 4-inducedtumor suppression. Proc Natl Acad Sci U S A.1995;92:8960-8964.

16. Radu C, Cheng D, Nijagal A, et al. Normal im-mune development and glucocorticoid-inducedthymocyte apoptosis in mice deficient for the T-cell death-associated gene 8 receptor. Mol CellBiol. 2006;26:668-677.

17. Zimmermann N, Conkright JJ, Rothenberg ME.CC chemokine receptor-3 undergoes prolongedligand-induced internalization. J Biol Chem. 1999;274:12611-12618.

18. Mould AW, Ramsay AJ, Matthaei KI, Young IG,Rothenberg ME, Foster PS. The effect of IL-5 andeotaxin expression in the lung on eosinophil traf-

ficking and degranulation and the induction ofbronchial hyperreactivity. J Immunol. 2000;164:2142-2150.

19. Zimmermann N, King NE, Laporte J, et al. Dis-section of experimental asthma with DNA mi-croarray analysis identifies arginase in asthmapathogenesis. J Clin Invest. 2003;111:1863-1874.

20. Zimmermann N, Mishra A, King NE, et al. Tran-script signatures in experimental asthma: identifi-cation of STAT6-dependent and -independentpathways. J Immunol. 2004;172:1815-1824.

21. Guajardo JR, Schleifer KW, Daines MO, et al.Altered gene expression profiles in nasal territoryepithelium reflect stable versus acute childhoodasthma. J Allergy Clin Immunol. 2005;115:243-251.

22. Yamada Y, Rothenberg ME, Lee AW, et al. TheFIP1L1-PDGFRa fusion gene cooperates withIL-5 to induce murine hypereosinophilic syn-drome (HES)/chronic eosinophilic leukemia(CEL)-like disease. Blood. 2006;107:4071-4079.

23. Brandt EB, Rothenberg ME. Eosinophil levels inmice are significantly higher in small blood ves-sels than in large blood vessels. J Allergy ClinImmunol. 2001;108:142-143.

24. Brandt EB, Strait RT, Hershko D, et al. Mast cellsare required for experimental oral allergen-induced diarrhea. J Clin Invest. 2003;112:1666-1677.

25. Zimmermann N, Hogan SP, Mishra A, et al. Mu-rine eotaxin-2: a constitutive eosinophil chemo-kine induced by allergen challenge and IL-4 over-expression. J Immunol. 2000;165:5839-5846.

26. Chang HS, Jeon KW, Kim KH, Chung IY, ParkCS. Role of cAMP-dependent pathway in eosino-phil apoptosis and survival. Cell Immunol. 2000;203:29-38.

27. Hallsworth MP, Giembycz MA, Barnes PJ, LeeTH. Cyclic AMP-elevating agents prolong or in-hibit eosinophil survival depending on prior expo-sure to GM-CSF. Br J Pharmacol. 1996;117:79-86.

28. Peacock CD, Misso NL, Watkins DN, ThompsonPJ. PGE 2 and dibutyryl cyclic adenosine mono-phosphate prolong eosinophil survival in vitro. JAllergy Clin Immunol. 1999;104:153-162.

29. Yasui K, Hu B, Nakazawa T, Agematsu K,Komiyama A. Theophylline accelerates humangranulocyte apoptosis not via phosphodiesteraseinhibition. J Clin Invest. 1997;100:1677-1684.

30. Momose T, Okubo Y, Horie S, Suzuki J, Isobe M,Sekiguchi M. Effects of intracellular cyclic AMPmodulators on human eosinophil survival, de-granulation and CD11b expression. Int Arch Al-lergy Immunol. 1998;117:138-145.

31. Machida K, Inoue H, Matsumoto K, et al. Activa-tion of PI3K-Akt pathway mediates antiapoptoticeffects of �-adrenergic agonist in airway eosino-phils. Am J Physiol. 2005;288:L860-L867.

32. Sturm EM, Schratl P, Schuligoi R, et al. Prosta-glandin E2 inhibits eosinophil trafficking throughE-prostanoid 2 receptors. J Immunol. 2008;181:7273-7283.

33. Jeffrey KL, Brummer T, Rolph MS, et al. Positiveregulation of immune cell function and inflamma-tory responses by phosphatase PAC-1. J Immu-nol. 2006;7:274-283.

34. Hunt J. Exhaled breath condensate: an overview.Immunol Allergy Clin North Am. 2007;27:587-596.

35. Dziezanowski MA, DeStefano MJ, Rabinovitch M.Effect of antitubulins on spontaneous and chemo-tactic migration of neutrophils under agarose.J Cell Sci. 1980;42:379-388.

36. Zigmond SH, Hargrove RL. Orientation of PMN ina pH gradient: acid-induced release of a chemo-tactic factor. J Immunol. 1981;126:478-481.

37. Trevani AS, Andonegui G, Giordano M, et al. Ex-tracellular acidification induces human neutrophilactivation. J Immunol. 1999;162:4849-4857.

38. Ratner S. Motility of IL-2-stimulated lymphocytesin neutral and acidified extracellular matrix. CellImmunol. 1992;139:399-410.

39. Vermeulen M, Giordano M, Trevani AS, et al. Aci-dosis improves uptake of antigens and MHCclass I-restricted presentation by dendritic cells.J Immunol. 2004;172:3196-3204.

40. Mogi C, Tobo M, Tomura H, et al. Involvement ofproton-sensing TDAG8 in extracellular acidifica-tion-induced inhibition of proinflammatory cyto-kine production in peritoneal macrophages. J Im-munol. 2009;182:3243-3251.

41. Beg AA, Ernstrom GG, Nix P, Davis MW,Jorgensen EM. Protons act as a transmitter formuscle contraction in C. elegans. Cell. 2008;132:149-160.

42. Wemmie JA, Price MP, Welsh MJ. Acid-sensingion channels: advances, questions and therapeu-tic opportunities. Trends Neurosci. 2006;29:578-586.

43. Dairaghi DJ, Oldham ER, Bacon KB, SchallTJ. Chemokine receptor CCR3 function is highlydependent on local pH and ionic strength. J BiolChem. 1997;272:28206-28209.

44. Pereverzev A, Komarova SV, Korcok J, et al. Ex-tracellular acidification enhances osteoclast sur-vival through an NFAT-independent, protein ki-nase C-dependent pathway. Bone. 2008;42:150-161.

45. Bopp T, Becker C, Klein M, et al. Cyclic adeno-sine monophosphate is a key component of regu-latory T cell-mediated suppression. J Exp Med.2007;204:1303-1310.

46. Robison G, Butcher R, Sutherland E. Cyclic AMP.Annu Rev Biochem. 1968;37:149-174.

47. Uller L, Persson G, Kallstrom L, Erjefalt J. Lungtissue eosinophils may be cleared through lumi-nal entry rather than apoptosis: effects of steroidtreatment. Am J Respir Crit Care Med. 2001;164:1948-1956.

48. Kottyan LC, Hedgebeth MH, Niese KA, et al. Eo-sinophils respond to acidic environments withcAMP production, decreased apoptosis, and adecrease in the expression of pro-apoptotic Bcl-2family members. J Allergy Clin Immunol. 2009;123:S251.

49. Choi JW, Lee SY, Choi Y. Identification of a puta-tive G protein-coupled receptor induced duringactivation-induced apoptosis of T cells. Cell Im-munol. 1996;168:78-84.

50. Tosa N, Murakami M, Jia WY, et al. Critical func-tion of T cell death-associated gene 8 inglucocorticoid-induced thymocyte apoptosis. IntImmunol. 2003;15:741-749.

2782 KOTTYAN et al BLOOD, 24 SEPTEMBER 2009 � VOLUME 114, NUMBER 13

For personal use only.on March 24, 2016. by guest www.bloodjournal.orgFrom

online July 29, 2009 originally publisheddoi:10.1182/blood-2009-05-220681

2009 114: 2774-2782  

Owen N. Witte, Gurjit K. Khurana Hershey, Marc E. Rothenberg and Nives ZimmermannLeah C. Kottyan, Ann R. Collier, Khanh H. Cao, Kathryn A. Niese, Megan Hedgebeth, Caius G. Radu, GPR65-dependent mannerEosinophil viability is increased by acidic pH in a cAMP- and 

http://www.bloodjournal.org/content/114/13/2774.full.htmlUpdated information and services can be found at:

(544 articles)Phagocytes, Granulocytes, and Myelopoiesis    (5372 articles)Immunobiology   

Articles on similar topics can be found in the following Blood collections

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://www.bloodjournal.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

  Copyright 2011 by The American Society of Hematology; all rights reserved.of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society

For personal use only.on March 24, 2016. by guest www.bloodjournal.orgFrom