Effects of Flavonoids on Rumen Fermentation Activity, Methane ...

Hindawi Publishing CorporationBioMed Research InternationalVolume 2013 Article ID 349129 8 pageshttpdxdoiorg1011552013349129

Research ArticleEffects of Flavonoids on Rumen Fermentation Activity MethaneProduction and Microbial Population

Ehsan Oskoueian12 Norhani Abdullah13 and Armin Oskoueian14

1 Institute of Tropical Agriculture Universiti Putra Malaysia 43400 Serdang Selangor Malaysia2 Agriculture Biotechnology Research Institute of Iran (ABRII) East and North-East Branch PO Box 91735844 Mashhad Iran3Department of Biochemistry Faculty of Biotechnology and Biomolecular Sciences Universiti Putra Malaysia43400 Serdang Selangor Malaysia

4 Ferdowsi University of Mashhad International Branch PO Box 917794888 Mashhad Iran

Correspondence should be addressed to Norhani Abdullah norhanibiotechgmailcom

Received 14 April 2013 Revised 12 August 2013 Accepted 26 August 2013

Academic Editor Nico Boon

Copyright copy 2013 Ehsan Oskoueian et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

This research was carried out to evaluate the effects of flavone myricetin naringin catechin rutin quercetin and kaempferol atthe concentration of 45 of the substrate (dry matter basis) on the rumen microbial activity in vitro Mixture of guinea grass andconcentrate (60 40) was used as the substrateThe results showed that all the flavonoids except naringin and quercetin significantly(119875 lt 005) decreased the dry matter degradability The gas production significantly (119875 lt 005) decreased by flavone myricetinand kaempferol whereas naringin rutin and quercetin significantly (119875 lt 005) increased the gas production The flavonoidssuppressed methane production significantly (119875 lt 005) The total VFA concentration significantly (119875 lt 005) decreased in thepresence of flavone myricetin and kaempferol All flavonoids except naringin and quercetin significantly (119875 lt 005) reducedthe carboxymethyl cellulase filter paperase xylanase and 120573-glucosidase activities purine content and the efficiency of microbialprotein synthesis Flavone myricetin catechin rutin and kaempferol significantly (119875 lt 005) reduced the population of rumenmicrobes Total populations of protozoa and methanogens were significantly (119875 lt 005) suppressed by naringin and quercetinTheresults of this research demonstrated that naringin and quercetin at the concentration of 45 of the substrate (dry matter basis)were potential metabolites to suppress methane production without any negative effects on rumen microbial fermentation

1 Introduction

The highly diverse methanogenic community present in therumen have been implicated in global warming and attemptsto manipulate rumen microbial fermentation towards reduc-ing the methane production through application of feedadditives remain a high priority [1] For the past decadesseveral additives such as ionophores and probiotics havebeen introduced to the ruminant production industry [2]The ionophores such asmonensin lasalocid and laidlomycinsignificantly suppressed the methane production in rumi-nants [3] However concerns including antibiotic resistanceand detectable residual levels of these compounds in animalproducts limit the utilization of these additives [4] In thecase of probiotics the commonly used microorganisms for

ruminants are yeast and Aspergillus oryzae These microbesincrease butyrate or propionate acids concentration reduceprotozoa numbers and promote acetogenesis which resultedin lower methane production [5] However the use of probi-otics to inhibit methane production in ruminants is limiteddue to the cost hence appropriate strategies are requiredfor the large-scale production of probiotics with economicaloperating expenditure [6]

Recently natural plant products which are often inex-pensive and environmentally safe have been introduced inmethane mitigation strategies They could be superior feedadditives to replace the ionophores andprobiotics for control-ling methanogenesis [7] These compounds are not only ableto suppress the methane production but also possess broadrange of favorable effects on animal health For instance

2 BioMed Research International

their major affects on gastrointestinal tract include improve-ment in digestibility feed efficiency protection of dietaryproteins from rumenmicrobial degradation maintaining thegut microflora balance gastric or liver damage preventionreduction in gastrointestinal spasms diarrhea constipationbloat acidosis and controlling gut pathogens [8]

Furthermore their main effects on respiratory and car-diovascular system in animals include emollient antitussiveexpectorant hypotensive cardioprotective and vascular-stabilizing properties [9] They also possess antihyperlipi-demic hypocholesterolaemic and diuretic properties Thesecompounds are capable of reducing fear depression andanxiety and showed to have antipyretic and analgaesic effectsThe enhancements in immune function reproductive organsfertility wool growth and ectoparasites elimination have alsobeen reported [8 10]

Among plant secondary metabolites flavonoids havegained importance because of their wide range of biolog-ical activities and in particular antimicrobial propertiesFlavonoids are classified under polyphenolic compounds asthey possess A and C rings of benzo-1-pyran-4-quinoneand a B ring [11] These natural compounds are believedto have direct effects against methanogens [12] and to bean alternative agent to suppress methane production andimprove animal health and productivity

The plant flavonoids are generally present in the gly-cosides form with the aglycone linked to a variable sugarmoiety by a 120573-glycosidic bond mainly in position 3 of theC ring [11 13] The presence of sugar moiety reduces thebioactivity of flavonoid thus the removal of sugarmoiety notonly enhances the functional properties of flavonoid but alsoimproves the bioavailability in the gastrointestinal tract Arecent study by Berger et al [13] showed that rumenmicrobesenhanced the bioavailability of flavonoid rutin (quercetin-3-O-rutinoside) by degradation of glycosidic linkage Thisdegradation resulted in libration of quercetin Further thequercetin and itsmethylated (isorhamnetin tamarixetin) anddehydroxylated (kaempferol) derivatives were detected inplasma of nonlactating cows Similarly a recent study byGohlke et al [14] compared the bioavailability of quercetinin the aglycone and glucorhamnoside forms through duode-nal administration in German Holstein cows Their resultsshowed higher intestinal bioavailability of quercetin in theaglycone form as compared to the glucorhamnoside form

Plant extracts rich in flavonoids have gained importancein improving animal production Tedesco et al [15] reportedthe increase in milk yield and lactation performance indairy cows upon 25 d administration of sylimarin (10 gd)which mainly consist of flavonolignans Likewise Balcellset al [16] showed that plant extract containing flavonoidsat the concentration of 300mgkgDM was able to decreasethe incidence of acidosis and enhance the animal growthperformance in cattle receiving high-concentrate diet Thisphenomenon was attributed to the decrease in the titersof Streptococcus bovis and Selenomonas ruminantium andincrease in the numbers of lactate-consuming microorgan-isms such asMegasphaera elsdenii

Currently various flavonoids-rich feed additives to sup-press the methane production are available in the market

However these products mainly contain plant crude extractsand it is rather difficult to correlate the response of rumenmicrobes to the flavonoids The presence of other compo-nents such as glycosides phenolics terpenoids alkaloidsessential oils and organic acids in the plant extracts mayinfluence the results Furthermore the information on theeffect of flavonoids in the pure form on rumen microbialactivity is still lacking [13 14 16]

Taking all these considerations into account this researchhypothesised that the flavonoids depending on their typesare capable of modulating the rumen fermentation activityin varying degrees Hence in order to test this hypothesisin vitro gas production technique was applied to evaluatethe effect of different types of flavonoids in the pure formson rumen microbial fermentation methane productionenzyme activity microbial protein synthesis and microbialpopulation

2 Material and Methods

21 Flavonoids The flavonoids (purity ge 98) consistingof flavone myricetin naringin catechin rutin quercetinand kaempferol were purchased from Sigma (St Louis MOUSA)

22 In Vitro Rumen Fermentation The in vitro gas produc-tion technique has been considered as an acceptable methodto evaluate the effect of phytochemicals on rumen microbialfermentation [17] Two male cows fitted with rumen fistulawere maintained on a diet consisting of 60 guinea grassand 40 commercial cow pellet (FFM Berhad Malaysia)which contained corn grain palm kernel cake soybeanmealrice bran palm kernel oil limestone salt and vitamin-mineral premix The proximate chemical composition of thediet (gkgDM) was 146 crude protein 485 neutral detergentfiber 369 crude lipid 839 ash and metabolizable energy1004MJKgDMThedietwas offered twice daily and animalshad free access to drinking water The animals were used asrumen fluid donors

Two hundred milligram of feed consisting of dry guineagrass and concentrate at 60 40 ratio was used as the substratefor the in vitro fermentation The incubation medium wasprepared as described by Menke and Steingass [18] and30mL was dispensed anaerobically into each 100mL syringeEach flavonoid was dissolved in ethanol and the concentra-tion of 45 (ww) of the substrate on drymatter basis (9mg)was included in each syringeThe final ethanol concentrationof each syringe was 05 (vv) The control consisted of sub-strate with 05 (vv) ethanol The syringes were incubatedat 39∘C for 24 h In vitro gas production (GP) was measuredat 2 4 8 12 and 24 h A total of nine syringes for eachtreatment were usedThe content of three syringes were usedfor dry matter degradability (DMD) pH and fermentationparameters and another three formicrobial protein synthesisand the remaining three syringes were used for quantificationof rumen microbial population and enzyme activity assaysThis experiment was performed in three separate runs Thevolatile fatty acids (VFAs) which include acetic isobutyricbutyric propionic valeric isovaleric and caproic acids were

BioMed Research International 3

determined by gas chromatography (Agilent 6890 A) whichwas equipped with a capillary column packed with 10(wv) PEG 600 on Shimalate TPA 6080 [19] After 24 hincubation methane production was measured by injecting1mL of the headspace gas from each of the syringes intoa gas chromatograph (Agilent 5890 Series Gas Chromato-graph Wilmington DE USA) equipped with FID detectorSeparation was achieved using an HP-Plot Q column (30mtimes 053mm times 40m) (Agilent Technologies WilmingtonDE USA) with nitrogen (999 purity Domnick-Huntergenerator Domnick-Hunter Leicester UK) as the carriergas at the flow rate of 35mLmin An isothermal oventemperature of 50∘C was used in the separation Calibrationwas completed using standard methane prepared by ScottySpecialtyGases (Supelco Bellefonte PAUSA)The ammonianitrogen content was determined by the Kjeldahl procedure[20] Cumulative gas production data were fitted to themodel of Oslashrskov and McDonald [21] and the values of a(the gas production from the immediately soluble fraction)b (the gas production from the insoluble fraction) 119886 + 119887(potential extent of gas production) and c (gas productionrate constant for the insoluble fraction b) were estimatedusing the nonlinear regression (NLIN) procedure of SAS[22] All animal management and sampling procedures wereapproved by the Universiti Putra Malaysia Animal Care andUse Committee [23]

23 Rumen Microbial Enzyme Activity In order to extractthe microbial enzyme the whole content of each syringeafter 24 h incubation was transferred to a 50mL centrifugetube andmixed with 5mL carbon tetrachloride and lysozymesolution (04 g100mL phosphate buffer 01M and pH 68)and further incubated at 40∘C for 3 h followed by 60 ssonication at 4∘C using a sonicator (Vibra Cell sonicatorSonics and Materials Danbury CT USA) The sonicatedsamples were centrifuged at 24000timesg for 20min at 4∘C andthe clear supernatant was used for the estimation of enzymeactivities [24]

The enzymes studied were filter paperase (FPase) car-boxymethylcellulase (CMCase) 120573-glucosidase and xylanaseas described by Saad et al [25] Filterpaper carboxymethyl-cellulose 120588-nitrophenyl-120573-D-glucopyranoside and xylanwere used as substrates to determine the FPase CMCase120573-glucosidase and xylanase activities respectively Filterpa-perase CMCase and xylanase activities were determinedby measuring the production of reducing sugar usingdinitrosalicylic acid (DNSA) [26] 120573-glucosidase activitywas measured by the amount of 120588-nitrophenol releasedfrom the 120588-nitrophenyl-120573-D-glucopyranoside (PNPG) Eachenzyme assay was carried out in triplicate Protein con-tent of supernatant was determined according to Bradford[27] The specific activity of each enzyme (CMCase FPasexylanase or 120573-glucosidase) was expressed as 120583mol of prod-uct (glucosexylose4-nitrophenol) releasedminmg proteinunder the assay conditions

24 Rumen Microbial Protein Synthesis Microbial proteinsynthesis was determined according to the method described

by Makkar and Becker [28] using purines as a markerAfter 24 h fermentation the content of each syringe wascentrifuged at 20000timesg for 30min and the supernatantwas discarded The pellet was washed with distilled waterfollowed by centrifugation (20000timesg for 30min)The pelletconsisting of undigested substrate and microbial mass waslyophilized Aliquot of 25mL of perchloric acid (06M) wasadded to 100mg of each lyophilized sample and the mixturewas incubated in a water bath at 90ndash95∘C for 1 h The pH ofsolutionwas adjusted between 66 and 69 using concentratedKOH (8M) and the solution was centrifuged at 3000timesgfor 15min to remove the precipitate Then the supernatantwas filtered through 045120583m filter The adenine and guaninecontents were quantitatively measured in the supernatant byhigh-performance liquid chromatography (HPLC) equippedwith a reverse phase C18 LiChrospher 100 250 times 4mm IDand 5 120583m pore size column (Agilent Technologies Wald-bronn Germany) Absorbance was monitored at 254 nm andguanine and adenine peaks appeared at about 83 and 111minrespectively Allopurinol was used as the internal standardwhich appeared at about 166minThe efficiency of microbialprotein synthesis (EMPS) was calculated by dividing the totalpurines by total gas or total volatile fatty acids (VFAs)

25 Rumen Microbial Population Analysis At the end of theincubation 1mL of rumen fluid containing digesta was usedfor DNA extraction using QIAamp DNA Stool Mini Kit(QIAGEN) The primer sets used in this study are shownin Table 1 The 16S rRNA of bacteria and 18S rRNA ofprotozoa and fungi were amplified by PCR using primers forgeneral bacteria general fungi total protozoa Ruminococcusflavefaciens Fibrobacter succinogenes Ruminococcus albusand total methanogens The PCR products were cloned inpCR21-TOPO TA cloning vector (Invitrogen Carlsbad CAUSA) and transformed into chemically competent E coliTOP10 cells (Invitrogen) The plasmids were extracted andsequenced using capillary electrophoresis on an AppliedBiosystems 3730xl DNA Analyzer (Applied Biosystems Fos-ter City CA USA)The sequences were checked for chimericrDNA using Bellerophon [29] and were compared to thoseavailable in the GenBank using the Basic Local AlignmentSearch Tool [30]The plasmid carrying the sequence that wasge99 similar to the previously published sequence of thetarget microorganism was used for real-time PCR amplifi-cation and standard curve construction The concentrationand purity of the plasmid for each group of microorganismswas determined using Nanodrop (NanoDrop TechnologiesWilmington DE USA) and the number of copies wasdetermined using the following formula [31]

Amount of DNA (120583gmL) times 6022 times 1023

Length (bp) times 109 times 650 (1)

Real-time PCR assays were conducted on a BioRad CFX96 real-time PCR thermocycler (Bio-Rad Hercules USA)using iQ SYBR Green Supermix (Bio-Rad Laboratories IncHercules CA USA) Data from the real-time PCR reactions

4 BioMed Research International

Table 1 PCR primer sets used in this studylowast

Microorganism Forward Reverse Amplicon size (bp) ReferenceGeneral bacteria cggcaacgagcgcaaccc ccattgtagcacgtgtgtagcc 130 [45]General fungi gaggaagtaaaagtcgtaacaaggtttc caaattcacaaagggtaggatgatt 120 [45]Total protozoa gctttcgwtggtagtgtatt cttgccctcyaatcgtwct 223 [46]Total methanogens cgwagggaagctgttaagt taccgtcgtccactcctt 343 [47]Ruminococcus albus ccctaaaagcagtcttagttcg cctccttgcggttagaaca 175 [48]Ruminococcus flavefaciens cgaacggagataatttgagtttacttagg cggtctctgtatgttatgaggtattacc 132 [45]Fibrobacter succinogenes gttcggaattactgggcgtaaa cgcctgcccctgaactatc 121 [45]lowastPrimer sequence (51015840 rarr 31015840)

Table 2 Effects of flavonoids on dry matter degradability total gas methane and gas production parameters

Items Treatments SEMCtrl F M N C R Q K

Dry matter degradability () 879a 813b 821b 861a 820b 815b 856a 832b 12Total gas (mL24 h) 361c 281d 306d 478a 369c 409b 430b 348c 094CH4 (mLgDM) 86a 57cd 49d 63c 79ab 72b 62c 53d 029(119886 + 119887) (mL) 411c 324d 342d 567a 437c 487b 554a 403c 163119888 (hminus1) 008ab 009a 009a 005b 009a 006b 006b 009a 0007Ctrl control F flavone M myricetin N naringin C catechin R rutin Q quercetin and K kaempferol119886 119887 119888 and 119886 + 119887 are calculated from the exponential equation 119901 = 119886 + 119887(1 minus 119890119888119905)(119886 + 119887) = potential extent of gas production 119888 = gas production rate constant for the insoluble fraction (119887)Means within the same row with different superscripts are significantly different (119875 lt 005)

were analyzed using CFX manager software version 3 (Bio-Rad Laboratories) All real-time PCR amplifications wereperformed in triplicate

26 Statistical Analyses The data were analysed using thegeneral linear models (GLM) procedure of SAS [22] ina completely randomized design (CRD) and means werecompared with Duncanrsquos multiple range test Means wereconsidered significantly different at 119875 lt 005

3 Results and Discussion

The effects of flavonoids at the concentration of 45 (ww)of the substrate on rumen dry matter (DM) degradabilitytotal gas and methane gas production kinetics are shownin Table 2 The in vitro DM degradability of control groupwas 879 and all flavonoids except naringin and quercetinreduced this value significantly (119875 lt 005) to the range of813 to 832 The total gas production of the control was361mL (Table 2) and this value was significantly (119875 lt 005)decreased to 281 and 306mLwhen the flavone andmyricetinwere added respectively On the other hand naringin rutinand quercetin increased the gas production significantly (119875 lt005) to 478 409 and 430mL respectively

The control treatment showed the production of86mLgDM methane and inclusion of flavone myricetinnaringin rutin quercetin and kaempferol significantly(119875 lt 005) decreased the values to 57 49 63 72 62and 53mLgDM respectively The inhibitory activities offlavonoids used in this experiment towards methanogenesis

can be categorized in descending order as follows myricetinge kaempferol ge flavone gt quercetin ge naringin gt rutin gecatechin The suppression of methane production observedin this study was in accordance with the result of Tavendaleet al [32] who demonstrated the potential of flavonolto decrease methane production in Methanobrevibacterruminantium culture Besides Patra et al [24] have alsoindicated that plant extract containing flavonoids coulddecrease the methane production Generally the decreasein the dry matter degradability total gas and methaneproduction upon addition of flavonoids could be attributedto the antimicrobial action of flavonoids [33 34]

The potential extent of gas production indicated bythe a + b values is in accordance with the results in gasproduction during fermentation As observed these valueswere significantly (119875 lt 005) higher in treatments withnaringin rutin and quercetin and lower in treatments withflavone and myricetin (Table 2) The gas production rateconstants for the insoluble fraction (b) are presented as cvalues in Table 2 The c value for the control was 008and addition of naringin rutin and quercetin reduced thissignificantly (119875 lt 005)The increase in the gas production ofa + b led to the decrease in the c value as previously describedby Oslashrskov and McDonald [21]

The addition of flavonoids did not affect the pH andammonia nitrogen significantly as shown in Table 3The totalVFA concentration of control group was 473mM but theaddition of flavone myricetin and kaempferol significantly(119875 lt 005) reduced the total VFA concentration to 413 391and 423mM respectively The decrease in total VFAs valuesimplied the antimicrobial action of flavonoids However in

BioMed Research International 5

Table 3 Effects of flavonoids on pH ammonia and volatile fatty acids

Items Treatments SEMCtrl F M N C R Q K

pH 68 68 68 68 68 68 68 68 001Ammonia N (mg100mL) 365 376 375 362 362 362 374 356 057Total VFA (mM) 473a 413b 391c 470a 471a 467a 465a 423b 058Acetic acid (molar ) 580a 526b 533b 602a 587a 601a 605a 536b 171Propionic acid (molar ) 195a 162b 169b 178ab 190a 175ab 176ab 166b 075Butyric acid (molar ) 138b 174a 181a 151b 155b 153b 151b 177a 066C2 C3 ratiob 30b 32ab 31ab 34a 31ab 34a 34a 32ab 020Ctrl control F flavone M myricetin N naringin C catechin R rutin Q quercetin and K kaempferolC2 C3 acetate propionate ratioMeans within the same row with different superscripts are significantly different (119875 lt 005)

Table 4 Effects of flavonoids on the specific activity of enzymes in buffered rumen fluid

Enzymes (120583molminmg protein) Treatments SEMCtrl F M N C R Q K

CMCase 045a 031bc 028c 043a 035b 034b 041ab 029c 005FPase 029a 015c 014c 028a 022b 023b 027a 014c 003Xylanase 082a 047b 041b 076a 052b 053b 075a 042b 011120573-Glucosidase 014a 007b 008b 015a 009b 009b 013a 008b 0006Ctrl control F flavone M myricetin N naringin C catechin R rutin Q quercetin and K kaempferolMeans within the same row with different superscripts are significantly different (119875 lt 005)

treatments with naringin catechin rutin and quercetin thetotal VFAs concentrations were comparable to the control Inthe case of catechin and rutin in spite of the decrease in DMdegradability the VFA concentration was not significantlysuppressed which indicated the possible utilization of theseflavonoids as fermentable substrates It has been reported byMcSweeney et al [35] that rutin naringin and quercitrinare readily degraded in the rumen and their derivatives areutilized by rumen microbes Smith et al [36] reported themicrobial degradation of flavonoids in the rumen whichoccurred through cleavage of theirC rings resulting in pheno-lic acids and nonaromatic fermentation productsThus thesebyproducts could play a role as an alternative carbon sourcefor rumen microbial activities

The molar percentage of acetic acid and propionic acidwere significantly (119875 lt 005) reduced in treatmentswith flavone myricetin and kaempferol with concomitantincrease in butyric acid when compared to the control Onthe other hand molar percentages of acetic propionic andbutyric acids in treatments with naringin catechin rutinand quercetin were comparable to the control In line withthis result Lowry and Kennedy [37] and McSweeney andMackie [38] have reported the increase in concentration ofacetic and butyric acids upon fermentation of rutin naringinand quercetin by rumen microbes The increase in acetic topropionic (C2 C3) ratio reflects an increase in acetic acid andslight decrease in propionic acid concentrations

It is interesting to note that CMCase FPase xylanaseand 120573-glucosidase activities in treatments with naringin andquercetin were comparable to the control (Table 4) whereasother flavonoids reduced these activities significantly (119875 lt

005)The results showed that the specific activity of xylanasein buffered rumen fluid was higher than that of the CMCaseand FPase Xylanase is a measure of hemicellulase activitywhile CMCase and FPase indicate cellulolytic activity Thelevels of enzyme activities were in accordance with thepercentage of DM degradability

The decrease in CMCase FPase xylanase and 120573-glucosidase specific activities of fermenting rumen fluid inthe presence of flavone myricetin and kaempferol could berelated to the higher antimicrobial action of these compoundsor their derivatives produced during fermentation Theenzyme activities of rumen microbes treated with naringinand quercetin are in accordance with the results in DMdegradability and end products of fermentation The effectsof naringin and quercetin on rumen fermentation in thisresearch are similar to that of methanolic extract of garlicreported by Kamra et al [39] The garlic methanolic extractreduced the methane production without impairing theruminal enzyme activity and in vitro DM degradability

According to Lowry and Kennedy [37] quercetin aphenolic aglycone although insoluble in water can berapidly degraded by rumenmicrobes and enhance the rumenmicrobial activity Lowry and Kennedy have also observedan inhibition of rumen microbial activity in the presenceof catechin despite of its close structural relationship toquercetinThese observations are comparable with the resultsobtained in this experiment showing the positive effects ofquercetin and negative effects of catechin on rumenmicrobialactivities

The adenine guanine and purine content of controlgroup were 21 14 and 36 120583moL respectively (Table 5) The

6 BioMed Research International

Table 5 Effects of flavonoids on purine content and efficiency of rumen microbial protein synthesis

Treatments SEMCtrl F M N C R Q K

Adenine (120583mol) 21a 13c 13c 22a 14bc 15bc 20a 13c 007Guanine (120583mol) 14a 09b 10b 14a 10b 10b 13a 09b 007Purines (120583mol) 36a 22c 23c 37a 24bc 26bc 34a 22c 014Efficiency of microbial protein synthesis (EMPS)120583mol purinemL gas 010a 007b 007b 008ab 006b 006b 008ab 006b 001120583mol purinemmol total VFA 008a 005b 006b 008a 005b 005b 008a 005b 001

Ctrl control F flavone M myricetin N naringin C catechin R rutin Q quercetin and K kaempferolMeans within the same row with different superscripts are significantly different (119875 lt 005)

Table 6 The slope of the standard curve and real-time PCRamplification efficiency

Microorganisms Slope EfficiencyGeneral bacteria minus332 1001General fungi minus343 956Total protozoa minus332 1025Total methanogens minus333 1011Fibrobacter succinogenes minus331 1028Ruminococcus albus minus330 1009Ruminococcus flavefaciens minus333 998

Table 7 Effect of flavonoids on different rumen microbial popula-tion

Items Treatments SEMCtrl F M N C R Q K

General bacteria times 1014 copiesmL of rumen fluid65a 37b 35b 54a 53a 49ab 53a 34b 122

General fungi times 105 copiesmL of rumen fluid37a 21b 21b 32a 26ab 29ab 34a 23b 036

Total protozoa times 106 copiesmL of rumen fluid38a 11c 19b 19b 21b 26ab 23b 15bc 031

Total methanogens times 107 copiesmL of rumen fluid17a 10b 07b 06b 11ab 13a 09b 11ab 022

Fibrobacter succinogenes times 106 copiesmL of rumen fluid35a 14c 16bc 32a 27ab 25b 31a 14c 026

Ruminococcus albus times 105 copiesmL of rumen fluid24a 15bc 18b 23a 20ab 18b 24a 15bc 018

Ruminococcus flavefaciens times 105 copiesmL of rumen fluid51a 37b 32bc 52a 42b 43ab 49a 31c 028

Ctrl control F flavone M myricetin N naringin C catechin R rutin Qquercetin and K kaempferolMeans within the same row with different superscripts are significantlydifferent (119875 lt 005)

addition of naringin and quercetin did not affect these valuessignificantly whereas the adenine guanine and purine con-tent were significantly (119875 lt 005) decreased upon additionof flavone myricetin catechin rutin and kaempferol Theestimated EMPS values of control were 010 120583moLpurinemLgas and 008 120583moLpurinemmoL total VFA and these values

did not show significant difference when compared to bothnaringin and quercetin treated samples However flavonemyricetin catechin rutin and kaempferol significantly (119875 lt005) decreased the EMPS when compared to the controlSimilarly these parameters supported the results obtainedin DM degradability total gas production total VFAs andenzyme activities of naringin- and quercetin-treated samples

Broudiscou et al [40] reported that the A millefoliumA chamissonis and L angustifolia leaves extracts which con-tained flavonoids increased without changes or decreased theEMPS respectively The variations in the results may relateto the type and concentration of the flavonoids present inthe plant extract In case of high concentration of flavonoidsthe EMPSmay decrease as observed in this study Flavonoidsused in this study were capable of modulating the EMPShowever the appropriate levels to increase the EMPS need tobe investigated

The precision of rumen microbial quantification usingreal-time PCR is revealed by the slope of standard curve andthe PCR amplification efficiency values (Table 6) The slopeand amplification efficiency obtained in this research rangedfrom minus330 to minus343 and from 956 to 1028 respectivelyZhang and Fang [41] recommended the reliable standardcurve in practice to have slope between minus30 and minus39corresponding to PCR efficiencies of 80ndash115 Thus all thevalues for the slope andPCRamplification efficiency obtainedin this study were in the acceptable range

The quantity of the rumen microbes affected byflavonoids is presented in Table 7 As observed with otherparameters the addition of naringin and quercetin had nosignificant effects on the population of general bacteriageneral fungi Fibrobacter succinogenes Ruminococcusalbus and Ruminococcus flavefaciens when compared tothe control While these flavonoids significantly (119875 lt 005)suppressed the population of total protozoa and totalmethanogens The addition of flavone myricetin catechinrutin and kaempferol significantly (119875 lt 005) reduced thepopulation of almost all of the rumen microorganisms Thereduction ofmethane producingmicroorganisms is reflectiveof the decrease in methane production as shown in Table 2It has been suggested that the flavonoids directly [1] orthrough new derivatives produced upon biotransformationor degradation [42] affect the rumen microbial activity Theeffects of naringin and quercetin towards rumen microbes

BioMed Research International 7

are desirable and they should be considered as alternativecompounds to manipulate the rumen microbes towardsmaintaining the cellulolytic bacteria with lower protozoa andmethanogens population

The flavonoids generally act against microorganismsthrough inhibition of cytoplasmic membrane function inhi-bition of bacterial cell wall synthesis or inhibition ofnucleic acid synthesis [34] In addition the antimicrobialpotential of flavonoids is dependent on the number andthe position of hydroxyl groups and presence of aliphaticand glycosyl groups in their structures For instance theactive flavonoids against Methicillin-resistant Staphylococcusaureus are hydroxyl group at position 5 of flavones andflavanones [43] Moreover Mirzoeva et al [44] reported theantibacterial action of quercetin and naringin against E colithrough disruption of proton motive force and inhibition ofbacterial motility To date no much information is availableon the mechanism of action of flavonoids against rumenmicrobes The results obtained in this study indicated thatflavone myricetin and kaempferol markedly reduced rumenmicrobial fermentation activity while catechin and rutinshowed minimal effect In contrast naringin and quercetinmaintained rumen microbial fermentation activity with sig-nificant reduction in methane production

4 Conclusions

The naringin and quercetin at the concentration of 45(ww) of the substrate (on dry matter basis) suppressedmethane production and decreased rumen protozoa andmethanogens population The DM degradability and otherfermentation parameters were not affected by these fla-vanoids Future studies on feeding ruminant with plants richin quercetin and naringin may allow the development ofa natural and acceptable technique to manipulate rumenfermentation towards lower methane production

Conflict of Interests

The authors declare no financial or proprietary interests inany materials or methods reported in this paper

Authorsrsquo Contribution

All authors are involved in the work presented in this paper

Acknowledgment

The facilities provided by the Institute of Bioscience and theInstitute of Tropical Agriculture Universiti Putra Malaysiaare gratefully acknowledged

References

[1] A K Patra and J Saxena ldquoA new perspective on the use of plantsecondarymetabolites to inhibitmethanogenesis in the rumenrdquoPhytochemistry vol 71 no 11-12 pp 1198ndash1222 2010

[2] I Karakurt G Aydin and K Aydiner ldquoSources and mitigationof methane emissions by sectors a critical reviewrdquo RenewableEnergy vol 39 no 1 pp 40ndash48 2012

[3] C H Ponce D R Smith M E Branine M E Hubbert andM L Galyean ldquoEffects of type of ionophore and carrier on invitro ruminal dry matter disappearance gas production andfermentation end products of a concentrate substraterdquo AnimalFeed Science and Technology vol 171 no 2-4 pp 223ndash229 2012

[4] D J Nisbet T R Callaway T S Edrington R C Andersonand N Krueger ldquoEffects of the dicarboxylic acids malateand fumarate on E coli O157H7 and Salmonella entericatyphimuriumpopulations in pure culture and inmixed ruminalmicroorganism fermentationsrdquo Current Microbiology vol 58no 5 pp 488ndash492 2009

[5] M F Iqbal Y Cheng W Zhu and B Zeshan ldquoMitigation ofruminant methane production current strategies constraintsand future optionsrdquoWorld Journal of Microbiology and Biotech-nology vol 24 no 12 pp 2747ndash2755 2008

[6] N J Nusbaum ldquoDairy livestock methane remediation andglobal warmingrdquo Journal of Community Health vol 35 no 5pp 500ndash502 2010

[7] D N KamraM Pawar and B Singh ldquoEffect of plant secondarymetabolites on rumen methanogens and methane emissionsby ruminantsrdquo in Dietary Phytochemicals and Microbes A KPatra Ed pp 351ndash370 Springer AmsterdamThe Netherlands2012

[8] Z Durmic and D Blache ldquoBioactive plants and plant productseffects on animal function health and welfarerdquo Animal FeedScience and Technology vol 176 no 1ndash4 pp 150ndash162 2012

[9] L J McGaw and J N Eloff ldquoEthnoveterinary use of southernAfrican plants and scientific evaluation of their medicinalpropertiesrdquo Journal of Ethnopharmacology vol 119 no 3 pp559ndash574 2008

[10] S Rochfort A J Parker and F R Dunshea ldquoPlant bioactivesfor ruminant health and productivityrdquo Phytochemistry vol 69no 2 pp 299ndash322 2008

[11] A Crozier I B Jaganath and M N Clifford ldquoPhenolspolyphenols and Tannins an overviewrdquo in Plant SecondaryMetabolites A Crozier M N Clifford and H Ashihara Edspp 1ndash24 Blackwell Publishing Oxford UK 2007

[12] R Bodas N Prieto R Garcia-Gonzalez S Andres F JGiraldez and S Lopez ldquoManipulation of rumen fermentationand methane production with plant secondary metabolitesrdquoAnimal Feed Science and Technology vol 176 no 1ndash4 pp 78ndash93 2012

[13] L M Berger S Wein R Blank C C Metges and S WolfframldquoBioavailability of the flavonol quercetin in cows after intraru-minal application of quercetin aglycone and rutinrdquo Journal ofDairy Science vol 95 no 9 pp 5047ndash5055 2012

[14] A Gohlke C J Ingelmann G Nurnberg A Starke S Wolf-fram and C C Metges ldquoBioavailability of quercetin from itsaglycone and its glucorhamnoside rutin in lactating dairy cowsafter intraduodenal administrationrdquo Journal of Dairy Sciencevol 96 no 4 pp 2303ndash2313 2013

[15] D Tedesco A Tava S Galletti et al ldquoEffects of silymarin anatural hepatoprotector in periparturient dairy cowsrdquo Journalof Dairy Science vol 87 no 7 pp 2239ndash2247 2004

[16] J Balcells A Aris A Serrano A R Seradj J Crespo and MDevant ldquoEffects of an extract of plant flavonoids (Bioflavex)on rumen fermentation and performance in heifers fed high-concentrate dietsrdquo Journal of Animal Science vol 90 no 13 pp4975ndash4984 2012

8 BioMed Research International

[17] H P S Makkar ldquoIn vitro gas methods for evaluation offeeds containing phytochemicalsrdquo Animal Feed Science andTechnology vol 123-124 pp 291ndash302 2005

[18] K HMenke andH Steingass ldquoEstimation of the energetic feedvalue obtained from chemical analysis and in vitro gas produc-tion using rumen fluidrdquoAnimal Research and Development vol28 pp 7ndash55 1988

[19] E Oskoueian N AbdullahW Z Saad A ROmarM B Putehand YW Ho ldquoAnti-nutritional metabolites and effect of treatedJatropha curcas kernel meal on rumen fermentation in vitrordquoJournal of Animal and Veterinary Advances vol 10 no 2 pp214ndash220 2011

[20] AOAC Official Methods of Analysis pp 64ndash87 Associationof Official Analytical Chemists Washington DC USA 15thedition 1990

[21] E Oslashrskov and I McDonald ldquoThe estimation of protein degrad-ability in the rumen from incubation measurements weightedaccording to rate of passagerdquoThe Journal of Agricultural Sciencevol 92 no 2 pp 499ndash503 1979

[22] SAS Institute Inc SAS userrsquos guide Statistics SAS for WindowsRelease 9 1 3 SAS Institute Inc Cary NC USA 2003

[23] Universiti Putra Malaysia Animal Care and Use CommitteeReference No UPMFPVPS3 2 1 551AUP-R32 SerdangSelangor Malaysia 2008

[24] A K Patra D N Kamra and N Agarwal ldquoEffect of plantextracts on in vitro methanogenesis enzyme activities andfermentation of feed in rumen liquor of buffalordquo Animal FeedScience and Technology vol 128 no 3-4 pp 276ndash291 2006

[25] W Z Saad N Abdullah A R Alimon and YW Ho ldquoEffects ofphenolic monomers on the enzymes activities and volatile fattyacids production of Neocallimastix frontalis B9rdquo Anaerobe vol14 no 2 pp 118ndash122 2008

[26] G L Miller ldquoUse of dinitrosalicylic acid reagent for determina-tion of reducing sugarrdquo Analytical Chemistry vol 31 no 3 pp426ndash428 1959

[27] M M Bradford ldquoA rapid and sensitive method for the quanti-tation of microgram quantities of protein utilizing the principleof protein dye bindingrdquoAnalytical Biochemistry vol 72 no 1-2pp 248ndash254 1976

[28] H P S Makkar and K Becker ldquoPurine quantification in digestafrom ruminants by spectrophotometric and HPLC methodsrdquoBritish Journal of Nutrition vol 81 no 2 pp 107ndash112 1999

[29] T Huber G Faulkner and P Hugenholtz ldquoBellerophon aprogram to detect chimeric sequences in multiple sequencealignmentsrdquo Bioinformatics vol 20 no 14 pp 2317ndash2319 2004

[30] S F Altschul T L Madden A A Schaffer et al ldquoGappedBLAST and PSI-BLAST a new generation of protein databasesearch programsrdquo Nucleic Acids Research vol 25 no 17 pp3389ndash3402 1997

[31] M Li G B Penner E Hernandez-Sanabria M Oba and L LGuan ldquoEffects of sampling location and time and host animalon assessment of bacterial diversity and fermentation parame-ters in the bovine rumenrdquo Journal of Applied Microbiology vol107 no 6 pp 1924ndash1934 2009

[32] M H Tavendale L P Meagher D Pacheco N Walker G TAttwood and S Sivakumaran ldquoMethane production from invitro rumen incubations with Lotus pedunculatus andMedicagosativa and effects of extractable condensed tannin fractions onmethanogenesisrdquo Animal Feed Science and Technology vol 123-124 pp 403ndash419 2005

[33] T P T Cushnie and A J Lamb ldquoRecent advances in under-standing the antibacterial properties of flavonoidsrdquo Interna-tional Journal of Antimicrobial Agents vol 38 no 2 pp 99ndash1072011

[34] T P T Cushnie and A J Lamb ldquoAntimicrobial activity offlavonoidsrdquo International Journal of Antimicrobial Agents vol26 no 5 pp 343ndash356 2005

[35] C S McSweeney B Palmer D M McNeill and D O KrauseldquoMicrobial interactions with tannins nutritional consequencesfor ruminantsrdquo Animal Feed Science and Technology vol 91 no1-2 pp 83ndash93 2001

[36] A H Smith E Zoetendal and R I Mackie ldquoBacterialmechanisms to overcome inhibitory effects of dietary tanninsrdquoMicrobial Ecology vol 50 no 2 pp 197ndash205 2005

[37] J Lowry and P Kennedy ldquoFermentation of flavonols by rumenorganismsrdquo Proceeding of Australian Society of Animal Produc-tion vol 21 p 366 1996

[38] C McSweeney and R Mackie ldquoGastrointestinal detoxificationand digestive disorders in ruminant animalsrdquo in Gastrointesti-nal Microbiology R Mackie and B White Eds pp 583ndash634Springer New York NY USA 1997

[39] D N Kamra N Agarwal and L C Chaudhary ldquoInhibitionof ruminal methanogenesis by tropical plants containing sec-ondary compoundsrdquo International Congress Series vol 1293 pp156ndash163 2006

[40] L Broudiscou Y Papon and A F Broudiscou ldquoEffects of dryplant extracts on feed degradation and the production of rumenmicrobial biomass in a dual outflow fermenterrdquo Animal FeedScience and Technology vol 101 no 1ndash4 pp 183ndash189 2002

[41] T Zhang and H H P Fang ldquoApplications of real-time poly-merase chain reaction for quantification of microorganisms inenvironmental samplesrdquo Applied Microbiology and Biotechnol-ogy vol 70 no 3 pp 281ndash289 2006

[42] A L Simons M Renouf S Hendrich and P A MurphyldquoHuman gut microbial degradation of flavonoids structure-function relationshipsrdquo Journal of Agricultural and Food Chem-istry vol 53 no 10 pp 4258ndash4263 2005

[43] L E Alcaraz S E Blanco O N Puig F Tomas and F HFerretti ldquoAntibacterial activity of flavonoids againstmethicillin-resistant Staphylococcus aureus strainsrdquo Journal of TheoreticalBiology vol 205 no 2 pp 231ndash240 2000

[44] O K Mirzoeva R N Grishanin and P C Calder ldquoAntimi-crobial action of propolis and some of its components t heeffects on growthmembrane potential andmotility of bacteriardquoMicrobiological Research vol 152 no 3 pp 239ndash246 1997

[45] S E Denman and C S McSweeney ldquoDevelopment of a real-time PCR assay formonitoring anaerobic fungal and cellulolyticbacterial populations within the rumenrdquo FEMS MicrobiologyEcology vol 58 no 3 pp 572ndash582 2006

[46] J T Sylvester S K R Karnati Z Yu M Morrison and J LFirkins ldquoDevelopment of an assay to quantify rumen ciliateprotozoal biomass in cows using real-time PCRrdquo Journal ofNutrition vol 134 no 12 pp 3378ndash3384 2004

[47] Y Yu C Lee J Kim and S Hwang ldquoGroup-specific primer andprobe sets to detect methanogenic communities using quanti-tative real-time polymerase chain reactionrdquo Biotechnology andBioengineering vol 89 no 6 pp 670ndash679 2005

[48] S Koike and Y Kobayashi ldquoDevelopment and use of competi-tive PCR assays for the rumen cellulolytic bacteria Fibrobactersuccinogenes Ruminococcus albus and Ruminococcus flavefa-ciensrdquo FEMS Microbiology Letters vol 204 no 2 pp 361ndash3662001

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology