Research Article Duplex TaqMan Hydrolysis Probe-Based Molecular Assay for Simultaneous Detection and Differentiation of Burkholderia pseudomallei and Leptospira spp. DNA Mohammad Ridhuan Mohd Ali , 1,2 Lee Lih Huey, 2 Phiaw Chong Foo , 3,4 Yuan Xin Goay , 5,6 Asmaliza S. Ismail, 7 Khairul Mohd Fadzli Mustaffa, 6 Ismail Aziah, 6 Phua Kia Kien , 6 Azian Harun , 2,8 Nabilah Ismail , 2,8 and Chan Yean Yean 2,8 1 Bacteriology Unit, Infectious Disease Research Centre, Institute for Medical Research, Ministry of Health Malaysia, National Institutes of Health Complex, Bandar Setia Alam, 40170 Shah Alam, Selangor, Malaysia 2 Department of Medical Microbiology & Parasitology, School of Medical Sciences, Universiti Sains Malaysia, Health Campus, 16150 Kubang Kerian, Kelantan, Malaysia 3 Acarology Unit, Infectious Disease Research Centre, Institute for Medical Research, Ministry of Health Malaysia, National Institutes of Health Complex, Bandar Setia Alam, 40170 Shah Alam, Selangor, Malaysia 4 School of Health Sciences, Universiti Sains Malaysia, Health Campus, 16150 Kubang Kerian, Kelantan, Malaysia 5 INTI International College Penang, Lebuh Bukit Jambul, Bukit Jambul, 11900 Bayan Lepas, Pulau Pinang, Malaysia 6 Institute for Research in Molecular Medicine, Universiti Sains Malaysia, Health Campus, 16150 Kubang Kerian, Kelantan, Malaysia 7 Research Policy & Planning Division, National Institutes of Health, Ministry of Health Malaysia, Bandar Setia Alam, 40170 Shah Alam, Selangor, Malaysia 8 Hospital Universiti Sains Malaysia, Health Campus, 16150 Kubang Kerian, Kelantan, Malaysia Correspondence should be addressed to Mohammad Ridhuan Mohd Ali; [email protected] and Chan Yean Yean; [email protected] Received 25 February 2019; Revised 29 May 2019; Accepted 30 May 2019; Published 2 July 2019 Academic Editor: Francesca Mancianti Copyright © 2019 Mohammad Ridhuan Mohd Ali et al. is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Melioidosis and leptospirosis, caused by two different bacteria, Burkholderia pseudomallei and Leptospira spp., are potentially fatal infections that share a very similar spectrum of clinical features and cause significant mortality and morbidity in humans and livestock. Early detection is important for better clinical consequences. To our knowledge, there is no diagnostic tool available to simultaneously detect and differentiate melioidosis and leptospirosis in humans and animals. In this study, we described a duplex TaqMan probe-based qPCR for the detection of B. pseudomallei and Leptospira spp. DNA. e performance of the assay was evalu- ated on 20 B. pseudomallei isolates, 23 Leptospira strains, and 39 other microorganisms, as well as two sets of serially diluted reference strains. e duplex qPCR assay was able to detect 0.02 pg (∼ 4 copies) Leptospira spp. DNA and 0.2 pg (∼ 25.6 copies) B. pseudomallei DNA. No undesired amplification was observed in other microorganisms. In conclusion, the duplex qPCR assay was sensitive and specific for the detection of B. pseudomallei & Leptospira spp. DNA and is suitable for further analytical and clinical evaluation. 1. Introduction Burkholderia pseudomallei and Leptospira are two impor- tant infectious agents for melioidosis and leptospirosis, respectively [1–3]. e Gram-negative B. pseudomallei is recognized as CDC Tier 1 select agent and a Category B Priority Pathogen by the National Institute of Allergy and Infectious Diseases (NIAID), in addition to lep- tospirosis, which has been added to the Emerging Infec- tious Diseases category (https://www.niaid.nih.gov/research/ emerging-infectious-diseases-pathogens). Both organisms are normally found in the soil and freshwater environment [4, 5]. Hindawi BioMed Research International Volume 2019, Article ID 9451791, 6 pages https://doi.org/10.1155/2019/9451791
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Research ArticleDuplex TaqMan Hydrolysis Probe-Based MolecularAssay for Simultaneous Detection and Differentiation ofBurkholderia pseudomallei and Leptospira spp DNA
Mohammad RidhuanMohd Ali 12 Lee Lih Huey2 Phiaw Chong Foo 34
Yuan Xin Goay 56 Asmaliza S Ismail7 Khairul Mohd Fadzli Mustaffa6 Ismail Aziah6
Phua Kia Kien 6 Azian Harun 28 Nabilah Ismail 28 and Chan Yean Yean 28
1Bacteriology Unit Infectious Disease Research Centre Institute for Medical Research Ministry of Health MalaysiaNational Institutes of Health Complex Bandar Setia Alam 40170 Shah Alam Selangor Malaysia2Department of Medical Microbiology amp Parasitology School of Medical Sciences Universiti Sains Malaysia Health Campus16150 Kubang Kerian Kelantan Malaysia3Acarology Unit Infectious Disease Research Centre Institute for Medical Research Ministry of Health MalaysiaNational Institutes of Health Complex Bandar Setia Alam 40170 Shah Alam Selangor Malaysia4School of Health Sciences Universiti Sains Malaysia Health Campus 16150 Kubang Kerian Kelantan Malaysia5INTI International College Penang Lebuh Bukit Jambul Bukit Jambul 11900 Bayan Lepas Pulau Pinang Malaysia6Institute for Research in Molecular Medicine Universiti Sains Malaysia Health Campus 16150 Kubang Kerian Kelantan Malaysia7Research Policy amp Planning Division National Institutes of Health Ministry of Health Malaysia Bandar Setia Alam40170 Shah Alam Selangor Malaysia8Hospital Universiti Sains Malaysia Health Campus 16150 Kubang Kerian Kelantan Malaysia
Correspondence should be addressed to Mohammad Ridhuan Mohd Ali ridhuanaligmailcomand Chan Yean Yean yeancynyahoocom
Received 25 February 2019 Revised 29 May 2019 Accepted 30 May 2019 Published 2 July 2019
Academic Editor Francesca Mancianti
Copyright copy 2019 Mohammad Ridhuan Mohd Ali et al This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited
Melioidosis and leptospirosis caused by two different bacteria Burkholderia pseudomallei and Leptospira spp are potentially fatalinfections that share a very similar spectrum of clinical features and cause significant mortality and morbidity in humans andlivestock Early detection is important for better clinical consequences To our knowledge there is no diagnostic tool available tosimultaneously detect and differentiate melioidosis and leptospirosis in humans and animals In this study we described a duplexTaqMan probe-based qPCR for the detection of B pseudomallei and Leptospira spp DNAThe performance of the assay was evalu-ated on 20B pseudomallei isolates 23 Leptospira strains and 39 othermicroorganisms aswell as two sets of serially diluted referencestrainsThe duplex qPCR assaywas able to detect 002 pg (sim 4 copies) Leptospira spp DNA and 02 pg (sim 256 copies)B pseudomalleiDNA No undesired amplification was observed in other microorganisms In conclusion the duplex qPCR assay was sensitive andspecific for the detection of B pseudomallei amp Leptospira spp DNA and is suitable for further analytical and clinical evaluation
1 Introduction
Burkholderia pseudomallei and Leptospira are two impor-tant infectious agents for melioidosis and leptospirosisrespectively [1ndash3] The Gram-negative B pseudomallei isrecognized as CDC Tier 1 select agent and a Category
B Priority Pathogen by the National Institute of Allergyand Infectious Diseases (NIAID) in addition to lep-tospirosis which has been added to the Emerging Infec-tious Diseases category (httpswwwniaidnihgovresearchemerging-infectious-diseases-pathogens) Both organisms arenormally found in the soil and freshwater environment [4 5]
HindawiBioMed Research InternationalVolume 2019 Article ID 9451791 6 pageshttpsdoiorg10115520199451791
2 BioMed Research International
In addition to their ubiquitous habitats these organismsroutinely infect animals such as cattle sheep and horsesCertain animal classes such as rats may asymptomaticallycarry Leptospira It is generally accepted that animals areresponsible for shedding and maintenance of Leptospira andB pseudomallei in the environments through their urinesand faeces [5ndash7] Human cases are usually associated withinteractions with the contaminated environments [6 8]To date increasing cases of melioidosis and leptospirosishave been reported worldwide especially in the tropical andsubtropical regions [1 6]
Infections by B pseudomallei and Leptospira portray avery similar spectrum of nonspecific clinical presentationsincluding fever headache myalgia and pneumonia [4 8]In animals B pseudomallei infections cause pneumoniawith lung abscesses anorexia and encephalitis [9] Mean-while animal leptospirosis is characterized by abortionjaundice and infertility [10] Several factors such as bacterialload underlying medical conditions and serotypes increasehosts susceptibility to melioidosis and leptospirosis [1 11ndash13] Furthermore the risk of dual infection is apparent asseveral incidences of melioidosis-leptospirosis coinfectionswere reported previously [14 15] It is possible thatmany casesmay be underdiagnosed when only one between the two testsis considered or available [16]
Early detection ofmelioidosis and leptospirosis could sig-nificantly increase the chances of survival and reduce poten-tial economic loss [17] Current gold standard for detecting Bpseudomallei is by the culturemethodwhich requires 2-7 daysto grow [18] Meanwhile leptospiral antibody titer is detectedby the microscopic agglutination test (MAT) that usuallyrequires paired sera and is less useful during acute infection[5] As both diagnostic methods are time-consuming amore rapid laboratory assay is urgently needed To dateseveral molecular assays have been described for detection ofindividual B pseudomallei and Leptospira from the clinicalspecimens [5 18] However to our knowledge none ofthe reported assays is able to simultaneously detect anddistinguish B pseudomallei and Leptospira within the samereaction tube In this study we developed a duplex qPCR thatcan detectB pseudomallei and LeptospiraDNAand evaluatedthe assay on selected clinical and environmental isolates
2 Materials and Methods
21 Microorganism Strains and Growth Conditions A totalof 20 B pseudomallei strains 23 Leptospira strains and 39other microorganisms isolated from human clinical samplesand ATCC strains were used in this study (Table 1) Thesemicroorganisms were provided by the Department of Medi-cal Microbiology amp Parasitology School of Medical SciencesUniversiti Sains Malaysia Makmal Kesihatan Awam KotaBharu Universiti Putra Malaysia and Institute for MedicalResearch The bacteria were cultured aerobically in nutrientbroth overnight at 37∘C on a rotating platform of 180 rpmMeanwhile Leptospira strains were maintained in EMJHmedia incubated at 30∘C on rotating platform of 40 rpmovernight Entamoeba histolytica DNA was obtained directlyfrom School of Health Sciences Universiti Sains Malaysia
22 Isolation of Genomic DNA DNA was extracted frompure bacterial culture usingNucleoSpinTissueDNAExtrac-tion kit (MACHEREY-NAGEL GmbHamp Co KG Germany)The extraction procedure was carried out according to themanufacturer instructions with a minor modification on thefinal elution step in which the column was incubated atroom temperature for 10 minutes prior to centrifugation at11 000 times g Total DNA was quantified using the EppendorfBioPhotometer (Eppendorf Scientific Inc New York UnitedStates) and stored at -20∘C until use
23 Duplex Real-Time PCR Parameters The PCR reactionwas prepared in a total volume of 20 120583L containing 10 120583L 2timesSsoAdvanced Universal Probes Supermix 1 120583L PCR gradedistilled water 02 120583Mprimers 01 120583Mprobes and 8 120583LDNAtemplate Sequences of oligonucleotides used are listed inTable 2The oligonucleotides were designed for amplificationof the orf2 region of B pseudomallei type III secretion system(T3SS) and the rrs gene of Leptospira
Amplifications were conducted using Biorad CFX96Touch Real-Time PCR Detection System Thermal cyclingcondition included an initial denaturation at 95∘C for5 minutes followed by 50 cycles of 95∘C for 30 seconds and613∘C for 30 seconds Baseline threshold for the postamplifi-cation analysis was set at 50 (for B pseudomallei) and 25 (forLeptospira) Any Cq value le40 is considered positive All theamplification in this study was carried out in triplicate unlessspecified otherwise
24 Analytical Sensitivity and Specificity The analytical sen-sitivity of the assay was carried out using extracted B pseudo-mallei and L interrogans gDNA diluted 10-fold ranging from10 nguL to 1 fguL Two microliters of each diluted gDNAwere used in the duplex qPCR Amount of bacterial DNA ineach reaction was calculated based on a formula previouslydescribed by Aghamollaei et al (2015) [21] Meanwhilethe assay analytical specificity was determined using 2 120583Lextracted DNA from other organisms (non-LeptospiraDNAsand non-B pseudomallei) as listed in Table 1 DNA wereextracted using NucleoSpin Tissue extraction kit
3 Results and Discussions
Despite the availability of several TaqMan hydrolysis probe-based assays for the detection of either Leptospira spp or Bpseudomallei none of the reported assays are able to simul-taneously detect both organisms within the same reaction[18 22] Availability of such diagnostic tool that is able todetect and differentiate B pseudomallei or Leptospira spp iscrucial as both infections portray similar clinical features andyet require different clinical management In this study aduplex qPCR for detection of B pseudomallei and Leptospiraspp DNA was evaluated As shown in Table 3 the developedqPCR was able to amplify 002 pg (sim 4 copies) Leptospiraspp DNA and 02 pg (sim 256 copies) B pseudomallei DNArespectively The sensitivity of the duplex assay for detectionofLeptospiraDNA is comparable to other reported leptospiralprobe-based assays that detected between 1 and 20 DNA
BioMed Research International 3
Table 1 List of organism used for analytical specificity test
Organism Source No tested (119899) Results in duplex qPCRAspergillus fumigatus USM Malaysia 1 NegativeBacillus subtilis USM Malaysia 1 NegativeBurkholderia cepacia USM Malaysia 6 NegativeBurkholderia pseudomallei USM Malaysia 20 PositiveBurkholderia thailandensis USM Malaysia 1 NegativeCampylobacter jejuni USM Malaysia 1 NegativeCandida albicans USM Malaysia 1 NegativeCitrobacter freundii USM Malaysia 1 NegativeEntamoeba histolytica UNAM Mexico 1 NegativeEnterococcus faecalis USM Malaysia 1 NegativeKlebsiella pneumoniae USM Malaysia 1 NegativeLeptospira biflexa serovar Patoc IMR Malaysia 1 PositiveLeptospira biflexa serovar Patoc UPM Malaysia 1 PositiveLeptospira borgpetersenii Celledoni IMR Malaysia 1 PositiveLeptospira borgpetersenii serovar Ballum UPM Malaysia 1 PositiveLeptospira fainei serovar Hurtsbridge IMR Malaysia 1 PositiveLeptospira fainei serovar Hurtsbridge UPM Malaysia 1 PositiveLeptospira interrogans serovar Australis UPM Malaysia 1 PositiveLeptospira interrogans serovar Autumnalis IMR Malaysia 1 PositiveLeptospira interrogans serovar Bataviae IMR Malaysia 1 PositiveLeptospira interrogans serovar Bataviae UPM Malaysia 1 PositiveLeptospira interrogans serovar Canicola UPM Malaysia 1 PositiveLeptospira interrogans serovar Copenhageni IMR Malaysia 1 PositiveLeptospira interrogans serovar Hebdomadis UPM Malaysia 1 PositiveLeptospira interrogans serovar Icterohaemorrhagiae RGA UPM Malaysia 1 PositiveLeptospira interrogans serovar Javanica IMR Malaysia 1 PositiveLeptospira interrogans serovar Pomona IMR Malaysia 1 PositiveLeptospira interrogans serovar Pomona UPM Malaysia 1 PositiveLeptospira interrogans serovar Pyrogenes IMR Malaysia 1 PositiveLeptospira interrogans serovar Pyrogenes UPM Malaysia 1 PositiveLeptospira interrogans serovar Tarassovi IMR Malaysia 1 PositiveLeptospira licerasiae serovar Varillal IMR Malaysia 1 PositiveLeptospira meyeri serovar Semaranga IMR Malaysia 1 PositiveLeptospira wolffii IMR Malaysia 1 PositivePlasmodium falciparum MKA Kota Bharu 5 NegativePlasmodium knowlesi MKA Kota Bharu 5 NegativePlasmodium vivax MKA Kota Bharu 5 NegativeProteus mirabilis USM Malaysia 1 NegativeProteus vulgaris USM Malaysia 1 NegativeSalmonella Paratyphi A (ATCC 9150) ATCC USA 1 NegativeSalmonella Paratyphi B (ATCC BAA 1250) ATCC USA 1 NegativeSalmonella Paratyphi C (ATCC 9068) ATCC USA 1 NegativeSalmonella Typhi (ATCC 7251) ATCC USA 1 NegativeSalmonella Typhimurium (ATCC 14028) ATCC USA 1 NegativeStaphylococcus aureus USM Malaysia 1 NegativeStaphylococcus saprophyticus USM Malaysia 1 Negative
4 BioMed Research International
Table 2 List of primers and probes used in this study
Target Type Sequence (51015840 997888rarr31015840) Source
Leptospira sppForward primer ACTGAGACACGGTCCATACT
[19]Reverse primer TAGTTAGCYGGTGCTTTAGGYAProbe FAM-ACGGGAGGCAGC-ZEN-AGTTAAGAATCTTGC-IBFQ
B pseudomalleiForward primer CCTGGGAGAGCGAGATGTT
[20]Reverse primer GCTGGATGAGAAGAAAGTCCProbe TexRed-CCACGCACGGCGGAGATTCT-IBRQ
Table 3 Analytical sensitivity of the duplex qPCR assays
Copies number Amount (pg) Duplex qPCR for B pseudomallei Copies number Amount (pg) Duplex qPCR for Leptospira sppMean Cq SD CV () Mean Cq SD CV ()
2560000 20000 1841 005 026 4000000 20000 193 017 086256000 2000 2175 031 143 400000 2000 2309 016 06725600 200 2534 012 046 40000 200 2723 004 0162560 20 2897 013 044 4000 20 3067 032 105256 2 328 014 044 400 2 3463 008 024256 02 3696 106 288 40 02 3634 05 137256 002 - - - 4 002 3859 149 3870256 0002 - - - 04 0002 - - -
Table 4 PCR efficiency and linearity of the duplex qPCR assays
Parameter TargetLeptospira spp B pseudomallei
Slope -32776 -37006Efficiency 1019 863Linearity R2 09837 09987
copies per reaction [23ndash25] Meanwhile for the B pseudo-mallei detection the sensitivity was slightly lower than thepreviously reported assays that amplified 5 and 10DNAcopiesper reaction [26ndash28] In comparison to the correspondingmonoplex assay the duplex assay had comparable sensitivityfor Leptospira but had a reduced sensitivity for B pseudo-mallei target (02 pg in duplex versus 002 pg in monoplex)Reduced performance of multiplex assay as compared to themonoplex assay has been observed in othermolecular studieswhich are associated with primers competition primer crosshybridization and template mispriming [29 30] Whentested on other microorganisms no cross amplification wasobserved (Table 1) The orf2 region is selected because itis only present in B pseudomallei [31] Meanwhile for theleptospiral target the rrs gene is used because the gene ispresent in multiple copies per Leptospira genome [32] Asthe current panel included limited coverage of organismsfurther validation should include Burkholderia mallei andother Burkholderia cepacia complex (BCC)
As listed in Table 4 the duplex assay had an efficiencyof 1019 for the detection of Leptospira DNA comparableto the monoplex assay (1005) However for the detectionof B pseudomallei DNA the duplex assay had an efficiencyof 863 lower than the monoplex assay (959) Thesuboptimal efficiency may be attributed to the decreased
sensitivity of the assay on B pseudomallei target In an idealcondition PCR efficiency should be 90 and above [33]Further optimization is necessary in order to increase theassay efficiency especially for the B pseudomallei targetMeanwhile in terms of linearity the duplex assays (forLeptospira and B pseudomalleiDNAdetection) had R2 valuesof close to 1 Noticeably at low copy number the CV valuesranged between 28 and 38 (Table 3)
Overall the establishment of a duplex qPCR assay thatcan detect and differentiate B pseudomallei and Leptospiraspp may help the diagnosis of melioidosis and leptospiro-sis However prior to clinical evaluation further analyticalvalidation such as intra- and interassay variation a widerspectrum of microorganisms for specificity testing highernumber of replicates and optimization of assays are nec-essary In addition incorporation of internal amplificationcontrol should be considered because certain types of clinicalsamples such as whole blood and urine may cause PCRinhibition
Data Availability
The data used to support the findings of this study areavailable from the corresponding author upon request
Conflicts of Interest
The authors declare that there are no conflicts of interest
Acknowledgments
We would like to thank laboratory personnel at the Depart-ment of Medical Microbiology amp Parasitology Universiti
BioMed Research International 5
SainsMalaysiaMakmalKesihatanAwamKota BharuHospi-tal Raja Perempuan Zainab II Kota Bharu for the direct andindirect contribution The authors would also like to thankthe Director General of Health Malaysia for permission topublish this paper This study was funded by the ResearchUniversity Grant (1001PPSP812144) awarded to the lastauthor The first author received Yang di-Pertuan AgongScholarship (BYDPA) by the Public Service Department(JPA) Malaysia
Supplementary Materials
The standard curves of the duplex qPCR assays for thedetection of B pseudomallei DNA and Leptospira spp DNAare illustrated in Figure S1 in Supplementary Material(Supplementary Materials)
References
[1] F Costa J E Hagan J Calcagno et al ldquoGlobal morbidity andmortality of leptospirosis a systematic reviewrdquo PLOS NeglectedTropical Diseases vol 9 no 9 article e0003898 2015
[2] D Limmathurotsakul N Golding D A B Dance et alldquoPredicted global distribution of Burkholderia pseudomalleiand burden of melioidosisrdquo Nature Microbiology vol 1 no 1Article ID 15008 2016
[3] W J Wiersinga H S Virk A G Torres et al ldquoMelioidosisrdquoNature Reviews Disease Primers vol 4 no 1 Article ID 171072018
[4] R P Samy B G Stiles G Sethi and L H K Lim ldquoMelioidosisclinical impact and public health threat in the tropicsrdquo PLOSNeglected Tropical Diseases vol 11 no 5 Article ID e00047382017
[5] M Picardeau ldquoDiagnosis and epidemiology of leptospirosisrdquoMedecine et Maladies Infectieuses vol 43 no 1 pp 1ndash9 2013
[6] E A Kelser ldquoMelioidosis a greater threat than previouslysuspectedrdquoMicrobes and Infection vol 18 no 11 pp 661ndash6682016
[7] H Neubauer L D Sprague M Joseph et al ldquoDevelopment andclinical evaluation of a pcr assay targeting the metalloproteasegene (mprA) of B pseudomalleirdquo Zoonoses and Public Healthvol 54 no 1 pp 44ndash50 2007
[8] DAHaake andPN Levett ldquoLeptospirosis in humansrdquoCurrentTopics in Microbiology and Immunology vol 387 pp 65ndash972015
[9] T Kasantikul A Sommanustweechai K Polsrila et al ldquoRet-rospective study on fatal melioidosis in captive zoo animals inThailandrdquo Transboundary and Emerging Diseases vol 63 no 5pp e389ndashe394 2016
[10] S Vidal K Kegler G Greub et al ldquoNeglected zoonotic agentsin cattle abortion tackling the difficult to grow bacteriardquo BMCVeterinary Research vol 13 no 1 p 373 2017
[11] B Garba A R Bahaman S K Bejo Z Zakaria A R Mutaliband F Bande ldquoMajor epidemiological factors associated withleptospirosis in Malaysiardquo Acta Tropica vol 178 pp 242ndash2472018
[12] K Suwannarong P Singhasivanon and R S Chapman ldquoRiskfactors for severe leptospirosis of Khon Kaen Province a case-control studyrdquo Journal of Health Research vol 28 no 1 pp 59ndash64 2014
[13] Y Suputtamongkol W Chaowagul P Chetchotisakd et alldquoRisk factors for melioidosis and bacteremic melioidosisrdquo Clin-ical Infectious Diseases vol 29 no 2 pp 408ndash413 1999
[14] M R Mohd Ali A W Mohamad Safiee P Thangarajah etal ldquoMolecular detection of leptospirosis and melioidosis co-infection a case reportrdquo Journal of Infection and Public Healthvol 10 no 6 pp 894ndash896 2017
[15] M Sapian M T Khairi S H How et al ldquoOutbreak ofmelioidosis and leptospirosis co-infection following a rescueoperationrdquo Medical Journal of Malaysia vol 67 no 3 pp 293ndash297 2012
[16] A N Rafizah B Aziah Y Azwany et al ldquoLeptospirosis inNortheasternMalaysia misdiagnosed or coinfectionrdquo Interna-tional Journal of Collaborative Research on Internal Medicine ampPublic Health vol 4 pp 1419ndash1427 2012
[17] D Limmathurotsakul and S J Peacock ldquoMelioidosis a clinicaloverviewrdquo British Medical Bulletin vol 99 no 1 pp 125ndash1392011
[18] S K Lau S Sridhar C-C Ho et al ldquoLaboratory diagnosis ofmelioidosis past present and futurerdquo Experimental Biology andMedicine vol 240 no 6 pp 742ndash751 2015
[19] M R Mohd Ali A W Mohd Safee N H Ismail et alldquoDevelopment and validation of pan- Leptospira Taqman qPCRfor the detection of Leptospira spp in clinical specimensrdquoMolecular and Cellular Probes vol 38 pp 1ndash6 2018
[20] M R Mohd Ali P C Foo M Hassan et al ldquoDevelopmentand validation of TaqMan real-time PCR for the detection ofBurkholderia pseudomallei isolates from Malaysiardquo TropicalBiomedicine 36 In press
[21] H Aghamollaei M M Moghaddam H Kooshki M HeiatR Mirnejad and N S Barzi ldquoDetection of Pseudomonasaeruginosa by a triplex polymerase chain reaction assay basedon lasIR and gyrB genesrdquo Journal of Infection and Public Healthvol 8 no 4 pp 314ndash322 2015
[22] J J Waggoner and B A Pinsky ldquoMolecular diagnostics forhuman leptospirosisrdquo Current Opinion in Infectious Diseasesvol 29 no 5 pp 440ndash445 2016
[23] R A Stoddard J E Gee P P Wilkins K McCaustlandand A R Hoffmaster ldquoDetection of pathogenic Leptospiraspp through TaqMan polymerase chain reaction targeting theLipL32 generdquo Diagnostic Microbiology and Infectious Diseasevol 64 no 3 pp 247ndash255 2009
[24] S Villumsen R Pedersen M B Borre P Ahrens J S Jensenand K A Krogfelt ldquoNovel TaqMan PCR for detection ofLeptospira species in urine and blood pit-falls of in silicovalidationrdquo Journal of Microbiological Methods vol 91 no 1 pp184ndash190 2012
[25] I N Riediger R A Stoddard G S Ribeiro et al ldquoRapidactionable diagnosis of urban epidemic leptospirosis using apathogenic Leptospira lipL32-based real-time PCR assayrdquo PLOSNeglected Tropical Diseases vol 11 no 9 Article ID e00059402017
[26] M Kaestli L J Richardson R E Colman et al ldquoComparisonof TaqMan PCR assays for detection of the melioidosis agentBurkholderia pseudomallei in clinical specimensrdquo Journal ofClinical Microbiology vol 50 no 6 pp 2059ndash2062 2012
[27] R T Novak M B Glass J E Gee et al ldquoDevelopmentand evaluation of a real-time PCR assay targeting the typeIII secretion system of Burkholderia pseudomalleirdquo Journal ofClinical Microbiology vol 44 no 1 pp 85ndash90 2006
[28] B Zhang D J Wear H Kim P Weina A Stojadinovic andM Izadjoo ldquoDevelopment of hydrolysis probe-based real-time
6 BioMed Research International
PCR for Identification of virulent gene targets of Burkholderiapseudomallei and B mallei mdasha retrospective study on archivalcases of service members with melioidosis and glandersrdquoMilitary Medicine vol 177 no 2 pp 216ndash221 2012
[29] M S Hamilton M Otto A Nickell D Abel Y Ballam andR Schremmer ldquoHigh frequency of competitive inhibition inthe Roche Cobas AMPLICOR multiplex PCR for Chlamydiatrachomatis and Neisseria gonorrhoeaerdquo Journal of ClinicalMicrobiology vol 40 no 11 pp 4393-4393 2002
[30] M N Nikiforova W A LaFramboise and Y E NikiforovldquoChapter 4 - amplification-based methodsrdquo in Clinical Genom-ics pp 57ndash67 2015
[31] L Rainbow C A Hart and C Winstanley ldquoDistribution oftype III secretion gene clusters in Burkholderia pseudomalleiB thailandensis and B malleirdquo Journal of Medical Microbiologyvol 51 no 5 pp 374ndash384 2002
[32] A L T O Nascimento S Verjovski-AlmeidaM A van Sluys etal ldquoGenome features of Leptospira interrogans serovar Copen-hagenirdquo Brazilian Journal of Medical and Biological Researchvol 37 no 4 pp 459ndash478 2004
[33] D Svec A Tichopad V Novosadova M W Pfaffl and MKubista ldquoHow good is a PCR efficiency estimate recommen-dations for precise and robust qPCR efficiency assessmentsrdquoBiomolecularDetection andQuantification vol 3 pp 9ndash16 2015
Stem Cells International
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
MEDIATORSINFLAMMATION
of
EndocrinologyInternational Journal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Disease Markers
Hindawiwwwhindawicom Volume 2018
BioMed Research International
OncologyJournal of
Hindawiwwwhindawicom Volume 2013
Hindawiwwwhindawicom Volume 2018
Oxidative Medicine and Cellular Longevity
Hindawiwwwhindawicom Volume 2018
PPAR Research
Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom
The Scientific World Journal
Volume 2018
Immunology ResearchHindawiwwwhindawicom Volume 2018
Journal of
ObesityJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Computational and Mathematical Methods in Medicine
Hindawiwwwhindawicom Volume 2018
Behavioural Neurology
OphthalmologyJournal of
Hindawiwwwhindawicom Volume 2018
Diabetes ResearchJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Research and TreatmentAIDS
Hindawiwwwhindawicom Volume 2018
Gastroenterology Research and Practice
Hindawiwwwhindawicom Volume 2018
Parkinsonrsquos Disease
Evidence-Based Complementary andAlternative Medicine
Volume 2018Hindawiwwwhindawicom
Submit your manuscripts atwwwhindawicom
2 BioMed Research International
In addition to their ubiquitous habitats these organismsroutinely infect animals such as cattle sheep and horsesCertain animal classes such as rats may asymptomaticallycarry Leptospira It is generally accepted that animals areresponsible for shedding and maintenance of Leptospira andB pseudomallei in the environments through their urinesand faeces [5ndash7] Human cases are usually associated withinteractions with the contaminated environments [6 8]To date increasing cases of melioidosis and leptospirosishave been reported worldwide especially in the tropical andsubtropical regions [1 6]
Infections by B pseudomallei and Leptospira portray avery similar spectrum of nonspecific clinical presentationsincluding fever headache myalgia and pneumonia [4 8]In animals B pseudomallei infections cause pneumoniawith lung abscesses anorexia and encephalitis [9] Mean-while animal leptospirosis is characterized by abortionjaundice and infertility [10] Several factors such as bacterialload underlying medical conditions and serotypes increasehosts susceptibility to melioidosis and leptospirosis [1 11ndash13] Furthermore the risk of dual infection is apparent asseveral incidences of melioidosis-leptospirosis coinfectionswere reported previously [14 15] It is possible thatmany casesmay be underdiagnosed when only one between the two testsis considered or available [16]
Early detection ofmelioidosis and leptospirosis could sig-nificantly increase the chances of survival and reduce poten-tial economic loss [17] Current gold standard for detecting Bpseudomallei is by the culturemethodwhich requires 2-7 daysto grow [18] Meanwhile leptospiral antibody titer is detectedby the microscopic agglutination test (MAT) that usuallyrequires paired sera and is less useful during acute infection[5] As both diagnostic methods are time-consuming amore rapid laboratory assay is urgently needed To dateseveral molecular assays have been described for detection ofindividual B pseudomallei and Leptospira from the clinicalspecimens [5 18] However to our knowledge none ofthe reported assays is able to simultaneously detect anddistinguish B pseudomallei and Leptospira within the samereaction tube In this study we developed a duplex qPCR thatcan detectB pseudomallei and LeptospiraDNAand evaluatedthe assay on selected clinical and environmental isolates
2 Materials and Methods
21 Microorganism Strains and Growth Conditions A totalof 20 B pseudomallei strains 23 Leptospira strains and 39other microorganisms isolated from human clinical samplesand ATCC strains were used in this study (Table 1) Thesemicroorganisms were provided by the Department of Medi-cal Microbiology amp Parasitology School of Medical SciencesUniversiti Sains Malaysia Makmal Kesihatan Awam KotaBharu Universiti Putra Malaysia and Institute for MedicalResearch The bacteria were cultured aerobically in nutrientbroth overnight at 37∘C on a rotating platform of 180 rpmMeanwhile Leptospira strains were maintained in EMJHmedia incubated at 30∘C on rotating platform of 40 rpmovernight Entamoeba histolytica DNA was obtained directlyfrom School of Health Sciences Universiti Sains Malaysia
22 Isolation of Genomic DNA DNA was extracted frompure bacterial culture usingNucleoSpinTissueDNAExtrac-tion kit (MACHEREY-NAGEL GmbHamp Co KG Germany)The extraction procedure was carried out according to themanufacturer instructions with a minor modification on thefinal elution step in which the column was incubated atroom temperature for 10 minutes prior to centrifugation at11 000 times g Total DNA was quantified using the EppendorfBioPhotometer (Eppendorf Scientific Inc New York UnitedStates) and stored at -20∘C until use
23 Duplex Real-Time PCR Parameters The PCR reactionwas prepared in a total volume of 20 120583L containing 10 120583L 2timesSsoAdvanced Universal Probes Supermix 1 120583L PCR gradedistilled water 02 120583Mprimers 01 120583Mprobes and 8 120583LDNAtemplate Sequences of oligonucleotides used are listed inTable 2The oligonucleotides were designed for amplificationof the orf2 region of B pseudomallei type III secretion system(T3SS) and the rrs gene of Leptospira
Amplifications were conducted using Biorad CFX96Touch Real-Time PCR Detection System Thermal cyclingcondition included an initial denaturation at 95∘C for5 minutes followed by 50 cycles of 95∘C for 30 seconds and613∘C for 30 seconds Baseline threshold for the postamplifi-cation analysis was set at 50 (for B pseudomallei) and 25 (forLeptospira) Any Cq value le40 is considered positive All theamplification in this study was carried out in triplicate unlessspecified otherwise
24 Analytical Sensitivity and Specificity The analytical sen-sitivity of the assay was carried out using extracted B pseudo-mallei and L interrogans gDNA diluted 10-fold ranging from10 nguL to 1 fguL Two microliters of each diluted gDNAwere used in the duplex qPCR Amount of bacterial DNA ineach reaction was calculated based on a formula previouslydescribed by Aghamollaei et al (2015) [21] Meanwhilethe assay analytical specificity was determined using 2 120583Lextracted DNA from other organisms (non-LeptospiraDNAsand non-B pseudomallei) as listed in Table 1 DNA wereextracted using NucleoSpin Tissue extraction kit
3 Results and Discussions
Despite the availability of several TaqMan hydrolysis probe-based assays for the detection of either Leptospira spp or Bpseudomallei none of the reported assays are able to simul-taneously detect both organisms within the same reaction[18 22] Availability of such diagnostic tool that is able todetect and differentiate B pseudomallei or Leptospira spp iscrucial as both infections portray similar clinical features andyet require different clinical management In this study aduplex qPCR for detection of B pseudomallei and Leptospiraspp DNA was evaluated As shown in Table 3 the developedqPCR was able to amplify 002 pg (sim 4 copies) Leptospiraspp DNA and 02 pg (sim 256 copies) B pseudomallei DNArespectively The sensitivity of the duplex assay for detectionofLeptospiraDNA is comparable to other reported leptospiralprobe-based assays that detected between 1 and 20 DNA
BioMed Research International 3
Table 1 List of organism used for analytical specificity test
Organism Source No tested (119899) Results in duplex qPCRAspergillus fumigatus USM Malaysia 1 NegativeBacillus subtilis USM Malaysia 1 NegativeBurkholderia cepacia USM Malaysia 6 NegativeBurkholderia pseudomallei USM Malaysia 20 PositiveBurkholderia thailandensis USM Malaysia 1 NegativeCampylobacter jejuni USM Malaysia 1 NegativeCandida albicans USM Malaysia 1 NegativeCitrobacter freundii USM Malaysia 1 NegativeEntamoeba histolytica UNAM Mexico 1 NegativeEnterococcus faecalis USM Malaysia 1 NegativeKlebsiella pneumoniae USM Malaysia 1 NegativeLeptospira biflexa serovar Patoc IMR Malaysia 1 PositiveLeptospira biflexa serovar Patoc UPM Malaysia 1 PositiveLeptospira borgpetersenii Celledoni IMR Malaysia 1 PositiveLeptospira borgpetersenii serovar Ballum UPM Malaysia 1 PositiveLeptospira fainei serovar Hurtsbridge IMR Malaysia 1 PositiveLeptospira fainei serovar Hurtsbridge UPM Malaysia 1 PositiveLeptospira interrogans serovar Australis UPM Malaysia 1 PositiveLeptospira interrogans serovar Autumnalis IMR Malaysia 1 PositiveLeptospira interrogans serovar Bataviae IMR Malaysia 1 PositiveLeptospira interrogans serovar Bataviae UPM Malaysia 1 PositiveLeptospira interrogans serovar Canicola UPM Malaysia 1 PositiveLeptospira interrogans serovar Copenhageni IMR Malaysia 1 PositiveLeptospira interrogans serovar Hebdomadis UPM Malaysia 1 PositiveLeptospira interrogans serovar Icterohaemorrhagiae RGA UPM Malaysia 1 PositiveLeptospira interrogans serovar Javanica IMR Malaysia 1 PositiveLeptospira interrogans serovar Pomona IMR Malaysia 1 PositiveLeptospira interrogans serovar Pomona UPM Malaysia 1 PositiveLeptospira interrogans serovar Pyrogenes IMR Malaysia 1 PositiveLeptospira interrogans serovar Pyrogenes UPM Malaysia 1 PositiveLeptospira interrogans serovar Tarassovi IMR Malaysia 1 PositiveLeptospira licerasiae serovar Varillal IMR Malaysia 1 PositiveLeptospira meyeri serovar Semaranga IMR Malaysia 1 PositiveLeptospira wolffii IMR Malaysia 1 PositivePlasmodium falciparum MKA Kota Bharu 5 NegativePlasmodium knowlesi MKA Kota Bharu 5 NegativePlasmodium vivax MKA Kota Bharu 5 NegativeProteus mirabilis USM Malaysia 1 NegativeProteus vulgaris USM Malaysia 1 NegativeSalmonella Paratyphi A (ATCC 9150) ATCC USA 1 NegativeSalmonella Paratyphi B (ATCC BAA 1250) ATCC USA 1 NegativeSalmonella Paratyphi C (ATCC 9068) ATCC USA 1 NegativeSalmonella Typhi (ATCC 7251) ATCC USA 1 NegativeSalmonella Typhimurium (ATCC 14028) ATCC USA 1 NegativeStaphylococcus aureus USM Malaysia 1 NegativeStaphylococcus saprophyticus USM Malaysia 1 Negative
4 BioMed Research International
Table 2 List of primers and probes used in this study
Target Type Sequence (51015840 997888rarr31015840) Source
Leptospira sppForward primer ACTGAGACACGGTCCATACT
[19]Reverse primer TAGTTAGCYGGTGCTTTAGGYAProbe FAM-ACGGGAGGCAGC-ZEN-AGTTAAGAATCTTGC-IBFQ
B pseudomalleiForward primer CCTGGGAGAGCGAGATGTT
[20]Reverse primer GCTGGATGAGAAGAAAGTCCProbe TexRed-CCACGCACGGCGGAGATTCT-IBRQ
Table 3 Analytical sensitivity of the duplex qPCR assays
Copies number Amount (pg) Duplex qPCR for B pseudomallei Copies number Amount (pg) Duplex qPCR for Leptospira sppMean Cq SD CV () Mean Cq SD CV ()
2560000 20000 1841 005 026 4000000 20000 193 017 086256000 2000 2175 031 143 400000 2000 2309 016 06725600 200 2534 012 046 40000 200 2723 004 0162560 20 2897 013 044 4000 20 3067 032 105256 2 328 014 044 400 2 3463 008 024256 02 3696 106 288 40 02 3634 05 137256 002 - - - 4 002 3859 149 3870256 0002 - - - 04 0002 - - -
Table 4 PCR efficiency and linearity of the duplex qPCR assays
Parameter TargetLeptospira spp B pseudomallei
Slope -32776 -37006Efficiency 1019 863Linearity R2 09837 09987
copies per reaction [23ndash25] Meanwhile for the B pseudo-mallei detection the sensitivity was slightly lower than thepreviously reported assays that amplified 5 and 10DNAcopiesper reaction [26ndash28] In comparison to the correspondingmonoplex assay the duplex assay had comparable sensitivityfor Leptospira but had a reduced sensitivity for B pseudo-mallei target (02 pg in duplex versus 002 pg in monoplex)Reduced performance of multiplex assay as compared to themonoplex assay has been observed in othermolecular studieswhich are associated with primers competition primer crosshybridization and template mispriming [29 30] Whentested on other microorganisms no cross amplification wasobserved (Table 1) The orf2 region is selected because itis only present in B pseudomallei [31] Meanwhile for theleptospiral target the rrs gene is used because the gene ispresent in multiple copies per Leptospira genome [32] Asthe current panel included limited coverage of organismsfurther validation should include Burkholderia mallei andother Burkholderia cepacia complex (BCC)
As listed in Table 4 the duplex assay had an efficiencyof 1019 for the detection of Leptospira DNA comparableto the monoplex assay (1005) However for the detectionof B pseudomallei DNA the duplex assay had an efficiencyof 863 lower than the monoplex assay (959) Thesuboptimal efficiency may be attributed to the decreased
sensitivity of the assay on B pseudomallei target In an idealcondition PCR efficiency should be 90 and above [33]Further optimization is necessary in order to increase theassay efficiency especially for the B pseudomallei targetMeanwhile in terms of linearity the duplex assays (forLeptospira and B pseudomalleiDNAdetection) had R2 valuesof close to 1 Noticeably at low copy number the CV valuesranged between 28 and 38 (Table 3)
Overall the establishment of a duplex qPCR assay thatcan detect and differentiate B pseudomallei and Leptospiraspp may help the diagnosis of melioidosis and leptospiro-sis However prior to clinical evaluation further analyticalvalidation such as intra- and interassay variation a widerspectrum of microorganisms for specificity testing highernumber of replicates and optimization of assays are nec-essary In addition incorporation of internal amplificationcontrol should be considered because certain types of clinicalsamples such as whole blood and urine may cause PCRinhibition
Data Availability
The data used to support the findings of this study areavailable from the corresponding author upon request
Conflicts of Interest
The authors declare that there are no conflicts of interest
Acknowledgments
We would like to thank laboratory personnel at the Depart-ment of Medical Microbiology amp Parasitology Universiti
BioMed Research International 5
SainsMalaysiaMakmalKesihatanAwamKota BharuHospi-tal Raja Perempuan Zainab II Kota Bharu for the direct andindirect contribution The authors would also like to thankthe Director General of Health Malaysia for permission topublish this paper This study was funded by the ResearchUniversity Grant (1001PPSP812144) awarded to the lastauthor The first author received Yang di-Pertuan AgongScholarship (BYDPA) by the Public Service Department(JPA) Malaysia
Supplementary Materials
The standard curves of the duplex qPCR assays for thedetection of B pseudomallei DNA and Leptospira spp DNAare illustrated in Figure S1 in Supplementary Material(Supplementary Materials)
References
[1] F Costa J E Hagan J Calcagno et al ldquoGlobal morbidity andmortality of leptospirosis a systematic reviewrdquo PLOS NeglectedTropical Diseases vol 9 no 9 article e0003898 2015
[2] D Limmathurotsakul N Golding D A B Dance et alldquoPredicted global distribution of Burkholderia pseudomalleiand burden of melioidosisrdquo Nature Microbiology vol 1 no 1Article ID 15008 2016
[3] W J Wiersinga H S Virk A G Torres et al ldquoMelioidosisrdquoNature Reviews Disease Primers vol 4 no 1 Article ID 171072018
[4] R P Samy B G Stiles G Sethi and L H K Lim ldquoMelioidosisclinical impact and public health threat in the tropicsrdquo PLOSNeglected Tropical Diseases vol 11 no 5 Article ID e00047382017
[5] M Picardeau ldquoDiagnosis and epidemiology of leptospirosisrdquoMedecine et Maladies Infectieuses vol 43 no 1 pp 1ndash9 2013
[6] E A Kelser ldquoMelioidosis a greater threat than previouslysuspectedrdquoMicrobes and Infection vol 18 no 11 pp 661ndash6682016
[7] H Neubauer L D Sprague M Joseph et al ldquoDevelopment andclinical evaluation of a pcr assay targeting the metalloproteasegene (mprA) of B pseudomalleirdquo Zoonoses and Public Healthvol 54 no 1 pp 44ndash50 2007
[8] DAHaake andPN Levett ldquoLeptospirosis in humansrdquoCurrentTopics in Microbiology and Immunology vol 387 pp 65ndash972015
[9] T Kasantikul A Sommanustweechai K Polsrila et al ldquoRet-rospective study on fatal melioidosis in captive zoo animals inThailandrdquo Transboundary and Emerging Diseases vol 63 no 5pp e389ndashe394 2016
[10] S Vidal K Kegler G Greub et al ldquoNeglected zoonotic agentsin cattle abortion tackling the difficult to grow bacteriardquo BMCVeterinary Research vol 13 no 1 p 373 2017
[11] B Garba A R Bahaman S K Bejo Z Zakaria A R Mutaliband F Bande ldquoMajor epidemiological factors associated withleptospirosis in Malaysiardquo Acta Tropica vol 178 pp 242ndash2472018
[12] K Suwannarong P Singhasivanon and R S Chapman ldquoRiskfactors for severe leptospirosis of Khon Kaen Province a case-control studyrdquo Journal of Health Research vol 28 no 1 pp 59ndash64 2014
[13] Y Suputtamongkol W Chaowagul P Chetchotisakd et alldquoRisk factors for melioidosis and bacteremic melioidosisrdquo Clin-ical Infectious Diseases vol 29 no 2 pp 408ndash413 1999
[14] M R Mohd Ali A W Mohamad Safiee P Thangarajah etal ldquoMolecular detection of leptospirosis and melioidosis co-infection a case reportrdquo Journal of Infection and Public Healthvol 10 no 6 pp 894ndash896 2017
[15] M Sapian M T Khairi S H How et al ldquoOutbreak ofmelioidosis and leptospirosis co-infection following a rescueoperationrdquo Medical Journal of Malaysia vol 67 no 3 pp 293ndash297 2012
[16] A N Rafizah B Aziah Y Azwany et al ldquoLeptospirosis inNortheasternMalaysia misdiagnosed or coinfectionrdquo Interna-tional Journal of Collaborative Research on Internal Medicine ampPublic Health vol 4 pp 1419ndash1427 2012
[17] D Limmathurotsakul and S J Peacock ldquoMelioidosis a clinicaloverviewrdquo British Medical Bulletin vol 99 no 1 pp 125ndash1392011
[18] S K Lau S Sridhar C-C Ho et al ldquoLaboratory diagnosis ofmelioidosis past present and futurerdquo Experimental Biology andMedicine vol 240 no 6 pp 742ndash751 2015
[19] M R Mohd Ali A W Mohd Safee N H Ismail et alldquoDevelopment and validation of pan- Leptospira Taqman qPCRfor the detection of Leptospira spp in clinical specimensrdquoMolecular and Cellular Probes vol 38 pp 1ndash6 2018
[20] M R Mohd Ali P C Foo M Hassan et al ldquoDevelopmentand validation of TaqMan real-time PCR for the detection ofBurkholderia pseudomallei isolates from Malaysiardquo TropicalBiomedicine 36 In press
[21] H Aghamollaei M M Moghaddam H Kooshki M HeiatR Mirnejad and N S Barzi ldquoDetection of Pseudomonasaeruginosa by a triplex polymerase chain reaction assay basedon lasIR and gyrB genesrdquo Journal of Infection and Public Healthvol 8 no 4 pp 314ndash322 2015
[22] J J Waggoner and B A Pinsky ldquoMolecular diagnostics forhuman leptospirosisrdquo Current Opinion in Infectious Diseasesvol 29 no 5 pp 440ndash445 2016
[23] R A Stoddard J E Gee P P Wilkins K McCaustlandand A R Hoffmaster ldquoDetection of pathogenic Leptospiraspp through TaqMan polymerase chain reaction targeting theLipL32 generdquo Diagnostic Microbiology and Infectious Diseasevol 64 no 3 pp 247ndash255 2009
[24] S Villumsen R Pedersen M B Borre P Ahrens J S Jensenand K A Krogfelt ldquoNovel TaqMan PCR for detection ofLeptospira species in urine and blood pit-falls of in silicovalidationrdquo Journal of Microbiological Methods vol 91 no 1 pp184ndash190 2012
[25] I N Riediger R A Stoddard G S Ribeiro et al ldquoRapidactionable diagnosis of urban epidemic leptospirosis using apathogenic Leptospira lipL32-based real-time PCR assayrdquo PLOSNeglected Tropical Diseases vol 11 no 9 Article ID e00059402017
[26] M Kaestli L J Richardson R E Colman et al ldquoComparisonof TaqMan PCR assays for detection of the melioidosis agentBurkholderia pseudomallei in clinical specimensrdquo Journal ofClinical Microbiology vol 50 no 6 pp 2059ndash2062 2012
[27] R T Novak M B Glass J E Gee et al ldquoDevelopmentand evaluation of a real-time PCR assay targeting the typeIII secretion system of Burkholderia pseudomalleirdquo Journal ofClinical Microbiology vol 44 no 1 pp 85ndash90 2006
[28] B Zhang D J Wear H Kim P Weina A Stojadinovic andM Izadjoo ldquoDevelopment of hydrolysis probe-based real-time
6 BioMed Research International
PCR for Identification of virulent gene targets of Burkholderiapseudomallei and B mallei mdasha retrospective study on archivalcases of service members with melioidosis and glandersrdquoMilitary Medicine vol 177 no 2 pp 216ndash221 2012
[29] M S Hamilton M Otto A Nickell D Abel Y Ballam andR Schremmer ldquoHigh frequency of competitive inhibition inthe Roche Cobas AMPLICOR multiplex PCR for Chlamydiatrachomatis and Neisseria gonorrhoeaerdquo Journal of ClinicalMicrobiology vol 40 no 11 pp 4393-4393 2002
[30] M N Nikiforova W A LaFramboise and Y E NikiforovldquoChapter 4 - amplification-based methodsrdquo in Clinical Genom-ics pp 57ndash67 2015
[31] L Rainbow C A Hart and C Winstanley ldquoDistribution oftype III secretion gene clusters in Burkholderia pseudomalleiB thailandensis and B malleirdquo Journal of Medical Microbiologyvol 51 no 5 pp 374ndash384 2002
[32] A L T O Nascimento S Verjovski-AlmeidaM A van Sluys etal ldquoGenome features of Leptospira interrogans serovar Copen-hagenirdquo Brazilian Journal of Medical and Biological Researchvol 37 no 4 pp 459ndash478 2004
[33] D Svec A Tichopad V Novosadova M W Pfaffl and MKubista ldquoHow good is a PCR efficiency estimate recommen-dations for precise and robust qPCR efficiency assessmentsrdquoBiomolecularDetection andQuantification vol 3 pp 9ndash16 2015
Stem Cells International
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
MEDIATORSINFLAMMATION
of
EndocrinologyInternational Journal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Disease Markers
Hindawiwwwhindawicom Volume 2018
BioMed Research International
OncologyJournal of
Hindawiwwwhindawicom Volume 2013
Hindawiwwwhindawicom Volume 2018
Oxidative Medicine and Cellular Longevity
Hindawiwwwhindawicom Volume 2018
PPAR Research
Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom
The Scientific World Journal
Volume 2018
Immunology ResearchHindawiwwwhindawicom Volume 2018
Journal of
ObesityJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Computational and Mathematical Methods in Medicine
Hindawiwwwhindawicom Volume 2018
Behavioural Neurology
OphthalmologyJournal of
Hindawiwwwhindawicom Volume 2018
Diabetes ResearchJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Research and TreatmentAIDS
Hindawiwwwhindawicom Volume 2018
Gastroenterology Research and Practice
Hindawiwwwhindawicom Volume 2018
Parkinsonrsquos Disease
Evidence-Based Complementary andAlternative Medicine
Volume 2018Hindawiwwwhindawicom
Submit your manuscripts atwwwhindawicom
BioMed Research International 3
Table 1 List of organism used for analytical specificity test
Organism Source No tested (119899) Results in duplex qPCRAspergillus fumigatus USM Malaysia 1 NegativeBacillus subtilis USM Malaysia 1 NegativeBurkholderia cepacia USM Malaysia 6 NegativeBurkholderia pseudomallei USM Malaysia 20 PositiveBurkholderia thailandensis USM Malaysia 1 NegativeCampylobacter jejuni USM Malaysia 1 NegativeCandida albicans USM Malaysia 1 NegativeCitrobacter freundii USM Malaysia 1 NegativeEntamoeba histolytica UNAM Mexico 1 NegativeEnterococcus faecalis USM Malaysia 1 NegativeKlebsiella pneumoniae USM Malaysia 1 NegativeLeptospira biflexa serovar Patoc IMR Malaysia 1 PositiveLeptospira biflexa serovar Patoc UPM Malaysia 1 PositiveLeptospira borgpetersenii Celledoni IMR Malaysia 1 PositiveLeptospira borgpetersenii serovar Ballum UPM Malaysia 1 PositiveLeptospira fainei serovar Hurtsbridge IMR Malaysia 1 PositiveLeptospira fainei serovar Hurtsbridge UPM Malaysia 1 PositiveLeptospira interrogans serovar Australis UPM Malaysia 1 PositiveLeptospira interrogans serovar Autumnalis IMR Malaysia 1 PositiveLeptospira interrogans serovar Bataviae IMR Malaysia 1 PositiveLeptospira interrogans serovar Bataviae UPM Malaysia 1 PositiveLeptospira interrogans serovar Canicola UPM Malaysia 1 PositiveLeptospira interrogans serovar Copenhageni IMR Malaysia 1 PositiveLeptospira interrogans serovar Hebdomadis UPM Malaysia 1 PositiveLeptospira interrogans serovar Icterohaemorrhagiae RGA UPM Malaysia 1 PositiveLeptospira interrogans serovar Javanica IMR Malaysia 1 PositiveLeptospira interrogans serovar Pomona IMR Malaysia 1 PositiveLeptospira interrogans serovar Pomona UPM Malaysia 1 PositiveLeptospira interrogans serovar Pyrogenes IMR Malaysia 1 PositiveLeptospira interrogans serovar Pyrogenes UPM Malaysia 1 PositiveLeptospira interrogans serovar Tarassovi IMR Malaysia 1 PositiveLeptospira licerasiae serovar Varillal IMR Malaysia 1 PositiveLeptospira meyeri serovar Semaranga IMR Malaysia 1 PositiveLeptospira wolffii IMR Malaysia 1 PositivePlasmodium falciparum MKA Kota Bharu 5 NegativePlasmodium knowlesi MKA Kota Bharu 5 NegativePlasmodium vivax MKA Kota Bharu 5 NegativeProteus mirabilis USM Malaysia 1 NegativeProteus vulgaris USM Malaysia 1 NegativeSalmonella Paratyphi A (ATCC 9150) ATCC USA 1 NegativeSalmonella Paratyphi B (ATCC BAA 1250) ATCC USA 1 NegativeSalmonella Paratyphi C (ATCC 9068) ATCC USA 1 NegativeSalmonella Typhi (ATCC 7251) ATCC USA 1 NegativeSalmonella Typhimurium (ATCC 14028) ATCC USA 1 NegativeStaphylococcus aureus USM Malaysia 1 NegativeStaphylococcus saprophyticus USM Malaysia 1 Negative
4 BioMed Research International
Table 2 List of primers and probes used in this study
Target Type Sequence (51015840 997888rarr31015840) Source
Leptospira sppForward primer ACTGAGACACGGTCCATACT
[19]Reverse primer TAGTTAGCYGGTGCTTTAGGYAProbe FAM-ACGGGAGGCAGC-ZEN-AGTTAAGAATCTTGC-IBFQ
B pseudomalleiForward primer CCTGGGAGAGCGAGATGTT
[20]Reverse primer GCTGGATGAGAAGAAAGTCCProbe TexRed-CCACGCACGGCGGAGATTCT-IBRQ
Table 3 Analytical sensitivity of the duplex qPCR assays
Copies number Amount (pg) Duplex qPCR for B pseudomallei Copies number Amount (pg) Duplex qPCR for Leptospira sppMean Cq SD CV () Mean Cq SD CV ()
2560000 20000 1841 005 026 4000000 20000 193 017 086256000 2000 2175 031 143 400000 2000 2309 016 06725600 200 2534 012 046 40000 200 2723 004 0162560 20 2897 013 044 4000 20 3067 032 105256 2 328 014 044 400 2 3463 008 024256 02 3696 106 288 40 02 3634 05 137256 002 - - - 4 002 3859 149 3870256 0002 - - - 04 0002 - - -
Table 4 PCR efficiency and linearity of the duplex qPCR assays
Parameter TargetLeptospira spp B pseudomallei
Slope -32776 -37006Efficiency 1019 863Linearity R2 09837 09987
copies per reaction [23ndash25] Meanwhile for the B pseudo-mallei detection the sensitivity was slightly lower than thepreviously reported assays that amplified 5 and 10DNAcopiesper reaction [26ndash28] In comparison to the correspondingmonoplex assay the duplex assay had comparable sensitivityfor Leptospira but had a reduced sensitivity for B pseudo-mallei target (02 pg in duplex versus 002 pg in monoplex)Reduced performance of multiplex assay as compared to themonoplex assay has been observed in othermolecular studieswhich are associated with primers competition primer crosshybridization and template mispriming [29 30] Whentested on other microorganisms no cross amplification wasobserved (Table 1) The orf2 region is selected because itis only present in B pseudomallei [31] Meanwhile for theleptospiral target the rrs gene is used because the gene ispresent in multiple copies per Leptospira genome [32] Asthe current panel included limited coverage of organismsfurther validation should include Burkholderia mallei andother Burkholderia cepacia complex (BCC)
As listed in Table 4 the duplex assay had an efficiencyof 1019 for the detection of Leptospira DNA comparableto the monoplex assay (1005) However for the detectionof B pseudomallei DNA the duplex assay had an efficiencyof 863 lower than the monoplex assay (959) Thesuboptimal efficiency may be attributed to the decreased
sensitivity of the assay on B pseudomallei target In an idealcondition PCR efficiency should be 90 and above [33]Further optimization is necessary in order to increase theassay efficiency especially for the B pseudomallei targetMeanwhile in terms of linearity the duplex assays (forLeptospira and B pseudomalleiDNAdetection) had R2 valuesof close to 1 Noticeably at low copy number the CV valuesranged between 28 and 38 (Table 3)
Overall the establishment of a duplex qPCR assay thatcan detect and differentiate B pseudomallei and Leptospiraspp may help the diagnosis of melioidosis and leptospiro-sis However prior to clinical evaluation further analyticalvalidation such as intra- and interassay variation a widerspectrum of microorganisms for specificity testing highernumber of replicates and optimization of assays are nec-essary In addition incorporation of internal amplificationcontrol should be considered because certain types of clinicalsamples such as whole blood and urine may cause PCRinhibition
Data Availability
The data used to support the findings of this study areavailable from the corresponding author upon request
Conflicts of Interest
The authors declare that there are no conflicts of interest
Acknowledgments
We would like to thank laboratory personnel at the Depart-ment of Medical Microbiology amp Parasitology Universiti
BioMed Research International 5
SainsMalaysiaMakmalKesihatanAwamKota BharuHospi-tal Raja Perempuan Zainab II Kota Bharu for the direct andindirect contribution The authors would also like to thankthe Director General of Health Malaysia for permission topublish this paper This study was funded by the ResearchUniversity Grant (1001PPSP812144) awarded to the lastauthor The first author received Yang di-Pertuan AgongScholarship (BYDPA) by the Public Service Department(JPA) Malaysia
Supplementary Materials
The standard curves of the duplex qPCR assays for thedetection of B pseudomallei DNA and Leptospira spp DNAare illustrated in Figure S1 in Supplementary Material(Supplementary Materials)
References
[1] F Costa J E Hagan J Calcagno et al ldquoGlobal morbidity andmortality of leptospirosis a systematic reviewrdquo PLOS NeglectedTropical Diseases vol 9 no 9 article e0003898 2015
[2] D Limmathurotsakul N Golding D A B Dance et alldquoPredicted global distribution of Burkholderia pseudomalleiand burden of melioidosisrdquo Nature Microbiology vol 1 no 1Article ID 15008 2016
[3] W J Wiersinga H S Virk A G Torres et al ldquoMelioidosisrdquoNature Reviews Disease Primers vol 4 no 1 Article ID 171072018
[4] R P Samy B G Stiles G Sethi and L H K Lim ldquoMelioidosisclinical impact and public health threat in the tropicsrdquo PLOSNeglected Tropical Diseases vol 11 no 5 Article ID e00047382017
[5] M Picardeau ldquoDiagnosis and epidemiology of leptospirosisrdquoMedecine et Maladies Infectieuses vol 43 no 1 pp 1ndash9 2013
[6] E A Kelser ldquoMelioidosis a greater threat than previouslysuspectedrdquoMicrobes and Infection vol 18 no 11 pp 661ndash6682016
[7] H Neubauer L D Sprague M Joseph et al ldquoDevelopment andclinical evaluation of a pcr assay targeting the metalloproteasegene (mprA) of B pseudomalleirdquo Zoonoses and Public Healthvol 54 no 1 pp 44ndash50 2007
[8] DAHaake andPN Levett ldquoLeptospirosis in humansrdquoCurrentTopics in Microbiology and Immunology vol 387 pp 65ndash972015
[9] T Kasantikul A Sommanustweechai K Polsrila et al ldquoRet-rospective study on fatal melioidosis in captive zoo animals inThailandrdquo Transboundary and Emerging Diseases vol 63 no 5pp e389ndashe394 2016
[10] S Vidal K Kegler G Greub et al ldquoNeglected zoonotic agentsin cattle abortion tackling the difficult to grow bacteriardquo BMCVeterinary Research vol 13 no 1 p 373 2017
[11] B Garba A R Bahaman S K Bejo Z Zakaria A R Mutaliband F Bande ldquoMajor epidemiological factors associated withleptospirosis in Malaysiardquo Acta Tropica vol 178 pp 242ndash2472018
[12] K Suwannarong P Singhasivanon and R S Chapman ldquoRiskfactors for severe leptospirosis of Khon Kaen Province a case-control studyrdquo Journal of Health Research vol 28 no 1 pp 59ndash64 2014
[13] Y Suputtamongkol W Chaowagul P Chetchotisakd et alldquoRisk factors for melioidosis and bacteremic melioidosisrdquo Clin-ical Infectious Diseases vol 29 no 2 pp 408ndash413 1999
[14] M R Mohd Ali A W Mohamad Safiee P Thangarajah etal ldquoMolecular detection of leptospirosis and melioidosis co-infection a case reportrdquo Journal of Infection and Public Healthvol 10 no 6 pp 894ndash896 2017
[15] M Sapian M T Khairi S H How et al ldquoOutbreak ofmelioidosis and leptospirosis co-infection following a rescueoperationrdquo Medical Journal of Malaysia vol 67 no 3 pp 293ndash297 2012
[16] A N Rafizah B Aziah Y Azwany et al ldquoLeptospirosis inNortheasternMalaysia misdiagnosed or coinfectionrdquo Interna-tional Journal of Collaborative Research on Internal Medicine ampPublic Health vol 4 pp 1419ndash1427 2012
[17] D Limmathurotsakul and S J Peacock ldquoMelioidosis a clinicaloverviewrdquo British Medical Bulletin vol 99 no 1 pp 125ndash1392011
[18] S K Lau S Sridhar C-C Ho et al ldquoLaboratory diagnosis ofmelioidosis past present and futurerdquo Experimental Biology andMedicine vol 240 no 6 pp 742ndash751 2015
[19] M R Mohd Ali A W Mohd Safee N H Ismail et alldquoDevelopment and validation of pan- Leptospira Taqman qPCRfor the detection of Leptospira spp in clinical specimensrdquoMolecular and Cellular Probes vol 38 pp 1ndash6 2018
[20] M R Mohd Ali P C Foo M Hassan et al ldquoDevelopmentand validation of TaqMan real-time PCR for the detection ofBurkholderia pseudomallei isolates from Malaysiardquo TropicalBiomedicine 36 In press
[21] H Aghamollaei M M Moghaddam H Kooshki M HeiatR Mirnejad and N S Barzi ldquoDetection of Pseudomonasaeruginosa by a triplex polymerase chain reaction assay basedon lasIR and gyrB genesrdquo Journal of Infection and Public Healthvol 8 no 4 pp 314ndash322 2015
[22] J J Waggoner and B A Pinsky ldquoMolecular diagnostics forhuman leptospirosisrdquo Current Opinion in Infectious Diseasesvol 29 no 5 pp 440ndash445 2016
[23] R A Stoddard J E Gee P P Wilkins K McCaustlandand A R Hoffmaster ldquoDetection of pathogenic Leptospiraspp through TaqMan polymerase chain reaction targeting theLipL32 generdquo Diagnostic Microbiology and Infectious Diseasevol 64 no 3 pp 247ndash255 2009
[24] S Villumsen R Pedersen M B Borre P Ahrens J S Jensenand K A Krogfelt ldquoNovel TaqMan PCR for detection ofLeptospira species in urine and blood pit-falls of in silicovalidationrdquo Journal of Microbiological Methods vol 91 no 1 pp184ndash190 2012
[25] I N Riediger R A Stoddard G S Ribeiro et al ldquoRapidactionable diagnosis of urban epidemic leptospirosis using apathogenic Leptospira lipL32-based real-time PCR assayrdquo PLOSNeglected Tropical Diseases vol 11 no 9 Article ID e00059402017
[26] M Kaestli L J Richardson R E Colman et al ldquoComparisonof TaqMan PCR assays for detection of the melioidosis agentBurkholderia pseudomallei in clinical specimensrdquo Journal ofClinical Microbiology vol 50 no 6 pp 2059ndash2062 2012
[27] R T Novak M B Glass J E Gee et al ldquoDevelopmentand evaluation of a real-time PCR assay targeting the typeIII secretion system of Burkholderia pseudomalleirdquo Journal ofClinical Microbiology vol 44 no 1 pp 85ndash90 2006
[28] B Zhang D J Wear H Kim P Weina A Stojadinovic andM Izadjoo ldquoDevelopment of hydrolysis probe-based real-time
6 BioMed Research International
PCR for Identification of virulent gene targets of Burkholderiapseudomallei and B mallei mdasha retrospective study on archivalcases of service members with melioidosis and glandersrdquoMilitary Medicine vol 177 no 2 pp 216ndash221 2012
[29] M S Hamilton M Otto A Nickell D Abel Y Ballam andR Schremmer ldquoHigh frequency of competitive inhibition inthe Roche Cobas AMPLICOR multiplex PCR for Chlamydiatrachomatis and Neisseria gonorrhoeaerdquo Journal of ClinicalMicrobiology vol 40 no 11 pp 4393-4393 2002
[30] M N Nikiforova W A LaFramboise and Y E NikiforovldquoChapter 4 - amplification-based methodsrdquo in Clinical Genom-ics pp 57ndash67 2015
[31] L Rainbow C A Hart and C Winstanley ldquoDistribution oftype III secretion gene clusters in Burkholderia pseudomalleiB thailandensis and B malleirdquo Journal of Medical Microbiologyvol 51 no 5 pp 374ndash384 2002
[32] A L T O Nascimento S Verjovski-AlmeidaM A van Sluys etal ldquoGenome features of Leptospira interrogans serovar Copen-hagenirdquo Brazilian Journal of Medical and Biological Researchvol 37 no 4 pp 459ndash478 2004
[33] D Svec A Tichopad V Novosadova M W Pfaffl and MKubista ldquoHow good is a PCR efficiency estimate recommen-dations for precise and robust qPCR efficiency assessmentsrdquoBiomolecularDetection andQuantification vol 3 pp 9ndash16 2015
Stem Cells International
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
MEDIATORSINFLAMMATION
of
EndocrinologyInternational Journal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Disease Markers
Hindawiwwwhindawicom Volume 2018
BioMed Research International
OncologyJournal of
Hindawiwwwhindawicom Volume 2013
Hindawiwwwhindawicom Volume 2018
Oxidative Medicine and Cellular Longevity
Hindawiwwwhindawicom Volume 2018
PPAR Research
Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom
The Scientific World Journal
Volume 2018
Immunology ResearchHindawiwwwhindawicom Volume 2018
Journal of
ObesityJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Computational and Mathematical Methods in Medicine
Hindawiwwwhindawicom Volume 2018
Behavioural Neurology
OphthalmologyJournal of
Hindawiwwwhindawicom Volume 2018
Diabetes ResearchJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Research and TreatmentAIDS
Hindawiwwwhindawicom Volume 2018
Gastroenterology Research and Practice
Hindawiwwwhindawicom Volume 2018
Parkinsonrsquos Disease
Evidence-Based Complementary andAlternative Medicine
Volume 2018Hindawiwwwhindawicom
Submit your manuscripts atwwwhindawicom
4 BioMed Research International
Table 2 List of primers and probes used in this study
Target Type Sequence (51015840 997888rarr31015840) Source
Leptospira sppForward primer ACTGAGACACGGTCCATACT
[19]Reverse primer TAGTTAGCYGGTGCTTTAGGYAProbe FAM-ACGGGAGGCAGC-ZEN-AGTTAAGAATCTTGC-IBFQ
B pseudomalleiForward primer CCTGGGAGAGCGAGATGTT
[20]Reverse primer GCTGGATGAGAAGAAAGTCCProbe TexRed-CCACGCACGGCGGAGATTCT-IBRQ
Table 3 Analytical sensitivity of the duplex qPCR assays
Copies number Amount (pg) Duplex qPCR for B pseudomallei Copies number Amount (pg) Duplex qPCR for Leptospira sppMean Cq SD CV () Mean Cq SD CV ()
2560000 20000 1841 005 026 4000000 20000 193 017 086256000 2000 2175 031 143 400000 2000 2309 016 06725600 200 2534 012 046 40000 200 2723 004 0162560 20 2897 013 044 4000 20 3067 032 105256 2 328 014 044 400 2 3463 008 024256 02 3696 106 288 40 02 3634 05 137256 002 - - - 4 002 3859 149 3870256 0002 - - - 04 0002 - - -
Table 4 PCR efficiency and linearity of the duplex qPCR assays
Parameter TargetLeptospira spp B pseudomallei
Slope -32776 -37006Efficiency 1019 863Linearity R2 09837 09987
copies per reaction [23ndash25] Meanwhile for the B pseudo-mallei detection the sensitivity was slightly lower than thepreviously reported assays that amplified 5 and 10DNAcopiesper reaction [26ndash28] In comparison to the correspondingmonoplex assay the duplex assay had comparable sensitivityfor Leptospira but had a reduced sensitivity for B pseudo-mallei target (02 pg in duplex versus 002 pg in monoplex)Reduced performance of multiplex assay as compared to themonoplex assay has been observed in othermolecular studieswhich are associated with primers competition primer crosshybridization and template mispriming [29 30] Whentested on other microorganisms no cross amplification wasobserved (Table 1) The orf2 region is selected because itis only present in B pseudomallei [31] Meanwhile for theleptospiral target the rrs gene is used because the gene ispresent in multiple copies per Leptospira genome [32] Asthe current panel included limited coverage of organismsfurther validation should include Burkholderia mallei andother Burkholderia cepacia complex (BCC)
As listed in Table 4 the duplex assay had an efficiencyof 1019 for the detection of Leptospira DNA comparableto the monoplex assay (1005) However for the detectionof B pseudomallei DNA the duplex assay had an efficiencyof 863 lower than the monoplex assay (959) Thesuboptimal efficiency may be attributed to the decreased
sensitivity of the assay on B pseudomallei target In an idealcondition PCR efficiency should be 90 and above [33]Further optimization is necessary in order to increase theassay efficiency especially for the B pseudomallei targetMeanwhile in terms of linearity the duplex assays (forLeptospira and B pseudomalleiDNAdetection) had R2 valuesof close to 1 Noticeably at low copy number the CV valuesranged between 28 and 38 (Table 3)
Overall the establishment of a duplex qPCR assay thatcan detect and differentiate B pseudomallei and Leptospiraspp may help the diagnosis of melioidosis and leptospiro-sis However prior to clinical evaluation further analyticalvalidation such as intra- and interassay variation a widerspectrum of microorganisms for specificity testing highernumber of replicates and optimization of assays are nec-essary In addition incorporation of internal amplificationcontrol should be considered because certain types of clinicalsamples such as whole blood and urine may cause PCRinhibition
Data Availability
The data used to support the findings of this study areavailable from the corresponding author upon request
Conflicts of Interest
The authors declare that there are no conflicts of interest
Acknowledgments
We would like to thank laboratory personnel at the Depart-ment of Medical Microbiology amp Parasitology Universiti
BioMed Research International 5
SainsMalaysiaMakmalKesihatanAwamKota BharuHospi-tal Raja Perempuan Zainab II Kota Bharu for the direct andindirect contribution The authors would also like to thankthe Director General of Health Malaysia for permission topublish this paper This study was funded by the ResearchUniversity Grant (1001PPSP812144) awarded to the lastauthor The first author received Yang di-Pertuan AgongScholarship (BYDPA) by the Public Service Department(JPA) Malaysia
Supplementary Materials
The standard curves of the duplex qPCR assays for thedetection of B pseudomallei DNA and Leptospira spp DNAare illustrated in Figure S1 in Supplementary Material(Supplementary Materials)
References
[1] F Costa J E Hagan J Calcagno et al ldquoGlobal morbidity andmortality of leptospirosis a systematic reviewrdquo PLOS NeglectedTropical Diseases vol 9 no 9 article e0003898 2015
[2] D Limmathurotsakul N Golding D A B Dance et alldquoPredicted global distribution of Burkholderia pseudomalleiand burden of melioidosisrdquo Nature Microbiology vol 1 no 1Article ID 15008 2016
[3] W J Wiersinga H S Virk A G Torres et al ldquoMelioidosisrdquoNature Reviews Disease Primers vol 4 no 1 Article ID 171072018
[4] R P Samy B G Stiles G Sethi and L H K Lim ldquoMelioidosisclinical impact and public health threat in the tropicsrdquo PLOSNeglected Tropical Diseases vol 11 no 5 Article ID e00047382017
[5] M Picardeau ldquoDiagnosis and epidemiology of leptospirosisrdquoMedecine et Maladies Infectieuses vol 43 no 1 pp 1ndash9 2013
[6] E A Kelser ldquoMelioidosis a greater threat than previouslysuspectedrdquoMicrobes and Infection vol 18 no 11 pp 661ndash6682016
[7] H Neubauer L D Sprague M Joseph et al ldquoDevelopment andclinical evaluation of a pcr assay targeting the metalloproteasegene (mprA) of B pseudomalleirdquo Zoonoses and Public Healthvol 54 no 1 pp 44ndash50 2007
[8] DAHaake andPN Levett ldquoLeptospirosis in humansrdquoCurrentTopics in Microbiology and Immunology vol 387 pp 65ndash972015
[9] T Kasantikul A Sommanustweechai K Polsrila et al ldquoRet-rospective study on fatal melioidosis in captive zoo animals inThailandrdquo Transboundary and Emerging Diseases vol 63 no 5pp e389ndashe394 2016
[10] S Vidal K Kegler G Greub et al ldquoNeglected zoonotic agentsin cattle abortion tackling the difficult to grow bacteriardquo BMCVeterinary Research vol 13 no 1 p 373 2017
[11] B Garba A R Bahaman S K Bejo Z Zakaria A R Mutaliband F Bande ldquoMajor epidemiological factors associated withleptospirosis in Malaysiardquo Acta Tropica vol 178 pp 242ndash2472018
[12] K Suwannarong P Singhasivanon and R S Chapman ldquoRiskfactors for severe leptospirosis of Khon Kaen Province a case-control studyrdquo Journal of Health Research vol 28 no 1 pp 59ndash64 2014
[13] Y Suputtamongkol W Chaowagul P Chetchotisakd et alldquoRisk factors for melioidosis and bacteremic melioidosisrdquo Clin-ical Infectious Diseases vol 29 no 2 pp 408ndash413 1999
[14] M R Mohd Ali A W Mohamad Safiee P Thangarajah etal ldquoMolecular detection of leptospirosis and melioidosis co-infection a case reportrdquo Journal of Infection and Public Healthvol 10 no 6 pp 894ndash896 2017
[15] M Sapian M T Khairi S H How et al ldquoOutbreak ofmelioidosis and leptospirosis co-infection following a rescueoperationrdquo Medical Journal of Malaysia vol 67 no 3 pp 293ndash297 2012
[16] A N Rafizah B Aziah Y Azwany et al ldquoLeptospirosis inNortheasternMalaysia misdiagnosed or coinfectionrdquo Interna-tional Journal of Collaborative Research on Internal Medicine ampPublic Health vol 4 pp 1419ndash1427 2012
[17] D Limmathurotsakul and S J Peacock ldquoMelioidosis a clinicaloverviewrdquo British Medical Bulletin vol 99 no 1 pp 125ndash1392011
[18] S K Lau S Sridhar C-C Ho et al ldquoLaboratory diagnosis ofmelioidosis past present and futurerdquo Experimental Biology andMedicine vol 240 no 6 pp 742ndash751 2015
[19] M R Mohd Ali A W Mohd Safee N H Ismail et alldquoDevelopment and validation of pan- Leptospira Taqman qPCRfor the detection of Leptospira spp in clinical specimensrdquoMolecular and Cellular Probes vol 38 pp 1ndash6 2018
[20] M R Mohd Ali P C Foo M Hassan et al ldquoDevelopmentand validation of TaqMan real-time PCR for the detection ofBurkholderia pseudomallei isolates from Malaysiardquo TropicalBiomedicine 36 In press
[21] H Aghamollaei M M Moghaddam H Kooshki M HeiatR Mirnejad and N S Barzi ldquoDetection of Pseudomonasaeruginosa by a triplex polymerase chain reaction assay basedon lasIR and gyrB genesrdquo Journal of Infection and Public Healthvol 8 no 4 pp 314ndash322 2015
[22] J J Waggoner and B A Pinsky ldquoMolecular diagnostics forhuman leptospirosisrdquo Current Opinion in Infectious Diseasesvol 29 no 5 pp 440ndash445 2016
[23] R A Stoddard J E Gee P P Wilkins K McCaustlandand A R Hoffmaster ldquoDetection of pathogenic Leptospiraspp through TaqMan polymerase chain reaction targeting theLipL32 generdquo Diagnostic Microbiology and Infectious Diseasevol 64 no 3 pp 247ndash255 2009
[24] S Villumsen R Pedersen M B Borre P Ahrens J S Jensenand K A Krogfelt ldquoNovel TaqMan PCR for detection ofLeptospira species in urine and blood pit-falls of in silicovalidationrdquo Journal of Microbiological Methods vol 91 no 1 pp184ndash190 2012
[25] I N Riediger R A Stoddard G S Ribeiro et al ldquoRapidactionable diagnosis of urban epidemic leptospirosis using apathogenic Leptospira lipL32-based real-time PCR assayrdquo PLOSNeglected Tropical Diseases vol 11 no 9 Article ID e00059402017
[26] M Kaestli L J Richardson R E Colman et al ldquoComparisonof TaqMan PCR assays for detection of the melioidosis agentBurkholderia pseudomallei in clinical specimensrdquo Journal ofClinical Microbiology vol 50 no 6 pp 2059ndash2062 2012
[27] R T Novak M B Glass J E Gee et al ldquoDevelopmentand evaluation of a real-time PCR assay targeting the typeIII secretion system of Burkholderia pseudomalleirdquo Journal ofClinical Microbiology vol 44 no 1 pp 85ndash90 2006
[28] B Zhang D J Wear H Kim P Weina A Stojadinovic andM Izadjoo ldquoDevelopment of hydrolysis probe-based real-time
6 BioMed Research International
PCR for Identification of virulent gene targets of Burkholderiapseudomallei and B mallei mdasha retrospective study on archivalcases of service members with melioidosis and glandersrdquoMilitary Medicine vol 177 no 2 pp 216ndash221 2012
[29] M S Hamilton M Otto A Nickell D Abel Y Ballam andR Schremmer ldquoHigh frequency of competitive inhibition inthe Roche Cobas AMPLICOR multiplex PCR for Chlamydiatrachomatis and Neisseria gonorrhoeaerdquo Journal of ClinicalMicrobiology vol 40 no 11 pp 4393-4393 2002
[30] M N Nikiforova W A LaFramboise and Y E NikiforovldquoChapter 4 - amplification-based methodsrdquo in Clinical Genom-ics pp 57ndash67 2015
[31] L Rainbow C A Hart and C Winstanley ldquoDistribution oftype III secretion gene clusters in Burkholderia pseudomalleiB thailandensis and B malleirdquo Journal of Medical Microbiologyvol 51 no 5 pp 374ndash384 2002
[32] A L T O Nascimento S Verjovski-AlmeidaM A van Sluys etal ldquoGenome features of Leptospira interrogans serovar Copen-hagenirdquo Brazilian Journal of Medical and Biological Researchvol 37 no 4 pp 459ndash478 2004
[33] D Svec A Tichopad V Novosadova M W Pfaffl and MKubista ldquoHow good is a PCR efficiency estimate recommen-dations for precise and robust qPCR efficiency assessmentsrdquoBiomolecularDetection andQuantification vol 3 pp 9ndash16 2015
Stem Cells International
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
MEDIATORSINFLAMMATION
of
EndocrinologyInternational Journal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Disease Markers
Hindawiwwwhindawicom Volume 2018
BioMed Research International
OncologyJournal of
Hindawiwwwhindawicom Volume 2013
Hindawiwwwhindawicom Volume 2018
Oxidative Medicine and Cellular Longevity
Hindawiwwwhindawicom Volume 2018
PPAR Research
Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom
The Scientific World Journal
Volume 2018
Immunology ResearchHindawiwwwhindawicom Volume 2018
Journal of
ObesityJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Computational and Mathematical Methods in Medicine
Hindawiwwwhindawicom Volume 2018
Behavioural Neurology
OphthalmologyJournal of
Hindawiwwwhindawicom Volume 2018
Diabetes ResearchJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Research and TreatmentAIDS
Hindawiwwwhindawicom Volume 2018
Gastroenterology Research and Practice
Hindawiwwwhindawicom Volume 2018
Parkinsonrsquos Disease
Evidence-Based Complementary andAlternative Medicine
Volume 2018Hindawiwwwhindawicom
Submit your manuscripts atwwwhindawicom
BioMed Research International 5
SainsMalaysiaMakmalKesihatanAwamKota BharuHospi-tal Raja Perempuan Zainab II Kota Bharu for the direct andindirect contribution The authors would also like to thankthe Director General of Health Malaysia for permission topublish this paper This study was funded by the ResearchUniversity Grant (1001PPSP812144) awarded to the lastauthor The first author received Yang di-Pertuan AgongScholarship (BYDPA) by the Public Service Department(JPA) Malaysia
Supplementary Materials
The standard curves of the duplex qPCR assays for thedetection of B pseudomallei DNA and Leptospira spp DNAare illustrated in Figure S1 in Supplementary Material(Supplementary Materials)
References
[1] F Costa J E Hagan J Calcagno et al ldquoGlobal morbidity andmortality of leptospirosis a systematic reviewrdquo PLOS NeglectedTropical Diseases vol 9 no 9 article e0003898 2015
[2] D Limmathurotsakul N Golding D A B Dance et alldquoPredicted global distribution of Burkholderia pseudomalleiand burden of melioidosisrdquo Nature Microbiology vol 1 no 1Article ID 15008 2016
[3] W J Wiersinga H S Virk A G Torres et al ldquoMelioidosisrdquoNature Reviews Disease Primers vol 4 no 1 Article ID 171072018
[4] R P Samy B G Stiles G Sethi and L H K Lim ldquoMelioidosisclinical impact and public health threat in the tropicsrdquo PLOSNeglected Tropical Diseases vol 11 no 5 Article ID e00047382017
[5] M Picardeau ldquoDiagnosis and epidemiology of leptospirosisrdquoMedecine et Maladies Infectieuses vol 43 no 1 pp 1ndash9 2013
[6] E A Kelser ldquoMelioidosis a greater threat than previouslysuspectedrdquoMicrobes and Infection vol 18 no 11 pp 661ndash6682016
[7] H Neubauer L D Sprague M Joseph et al ldquoDevelopment andclinical evaluation of a pcr assay targeting the metalloproteasegene (mprA) of B pseudomalleirdquo Zoonoses and Public Healthvol 54 no 1 pp 44ndash50 2007
[8] DAHaake andPN Levett ldquoLeptospirosis in humansrdquoCurrentTopics in Microbiology and Immunology vol 387 pp 65ndash972015
[9] T Kasantikul A Sommanustweechai K Polsrila et al ldquoRet-rospective study on fatal melioidosis in captive zoo animals inThailandrdquo Transboundary and Emerging Diseases vol 63 no 5pp e389ndashe394 2016
[10] S Vidal K Kegler G Greub et al ldquoNeglected zoonotic agentsin cattle abortion tackling the difficult to grow bacteriardquo BMCVeterinary Research vol 13 no 1 p 373 2017
[11] B Garba A R Bahaman S K Bejo Z Zakaria A R Mutaliband F Bande ldquoMajor epidemiological factors associated withleptospirosis in Malaysiardquo Acta Tropica vol 178 pp 242ndash2472018
[12] K Suwannarong P Singhasivanon and R S Chapman ldquoRiskfactors for severe leptospirosis of Khon Kaen Province a case-control studyrdquo Journal of Health Research vol 28 no 1 pp 59ndash64 2014
[13] Y Suputtamongkol W Chaowagul P Chetchotisakd et alldquoRisk factors for melioidosis and bacteremic melioidosisrdquo Clin-ical Infectious Diseases vol 29 no 2 pp 408ndash413 1999
[14] M R Mohd Ali A W Mohamad Safiee P Thangarajah etal ldquoMolecular detection of leptospirosis and melioidosis co-infection a case reportrdquo Journal of Infection and Public Healthvol 10 no 6 pp 894ndash896 2017
[15] M Sapian M T Khairi S H How et al ldquoOutbreak ofmelioidosis and leptospirosis co-infection following a rescueoperationrdquo Medical Journal of Malaysia vol 67 no 3 pp 293ndash297 2012
[16] A N Rafizah B Aziah Y Azwany et al ldquoLeptospirosis inNortheasternMalaysia misdiagnosed or coinfectionrdquo Interna-tional Journal of Collaborative Research on Internal Medicine ampPublic Health vol 4 pp 1419ndash1427 2012
[17] D Limmathurotsakul and S J Peacock ldquoMelioidosis a clinicaloverviewrdquo British Medical Bulletin vol 99 no 1 pp 125ndash1392011
[18] S K Lau S Sridhar C-C Ho et al ldquoLaboratory diagnosis ofmelioidosis past present and futurerdquo Experimental Biology andMedicine vol 240 no 6 pp 742ndash751 2015
[19] M R Mohd Ali A W Mohd Safee N H Ismail et alldquoDevelopment and validation of pan- Leptospira Taqman qPCRfor the detection of Leptospira spp in clinical specimensrdquoMolecular and Cellular Probes vol 38 pp 1ndash6 2018
[20] M R Mohd Ali P C Foo M Hassan et al ldquoDevelopmentand validation of TaqMan real-time PCR for the detection ofBurkholderia pseudomallei isolates from Malaysiardquo TropicalBiomedicine 36 In press
[21] H Aghamollaei M M Moghaddam H Kooshki M HeiatR Mirnejad and N S Barzi ldquoDetection of Pseudomonasaeruginosa by a triplex polymerase chain reaction assay basedon lasIR and gyrB genesrdquo Journal of Infection and Public Healthvol 8 no 4 pp 314ndash322 2015
[22] J J Waggoner and B A Pinsky ldquoMolecular diagnostics forhuman leptospirosisrdquo Current Opinion in Infectious Diseasesvol 29 no 5 pp 440ndash445 2016
[23] R A Stoddard J E Gee P P Wilkins K McCaustlandand A R Hoffmaster ldquoDetection of pathogenic Leptospiraspp through TaqMan polymerase chain reaction targeting theLipL32 generdquo Diagnostic Microbiology and Infectious Diseasevol 64 no 3 pp 247ndash255 2009
[24] S Villumsen R Pedersen M B Borre P Ahrens J S Jensenand K A Krogfelt ldquoNovel TaqMan PCR for detection ofLeptospira species in urine and blood pit-falls of in silicovalidationrdquo Journal of Microbiological Methods vol 91 no 1 pp184ndash190 2012
[25] I N Riediger R A Stoddard G S Ribeiro et al ldquoRapidactionable diagnosis of urban epidemic leptospirosis using apathogenic Leptospira lipL32-based real-time PCR assayrdquo PLOSNeglected Tropical Diseases vol 11 no 9 Article ID e00059402017
[26] M Kaestli L J Richardson R E Colman et al ldquoComparisonof TaqMan PCR assays for detection of the melioidosis agentBurkholderia pseudomallei in clinical specimensrdquo Journal ofClinical Microbiology vol 50 no 6 pp 2059ndash2062 2012
[27] R T Novak M B Glass J E Gee et al ldquoDevelopmentand evaluation of a real-time PCR assay targeting the typeIII secretion system of Burkholderia pseudomalleirdquo Journal ofClinical Microbiology vol 44 no 1 pp 85ndash90 2006
[28] B Zhang D J Wear H Kim P Weina A Stojadinovic andM Izadjoo ldquoDevelopment of hydrolysis probe-based real-time
6 BioMed Research International
PCR for Identification of virulent gene targets of Burkholderiapseudomallei and B mallei mdasha retrospective study on archivalcases of service members with melioidosis and glandersrdquoMilitary Medicine vol 177 no 2 pp 216ndash221 2012
[29] M S Hamilton M Otto A Nickell D Abel Y Ballam andR Schremmer ldquoHigh frequency of competitive inhibition inthe Roche Cobas AMPLICOR multiplex PCR for Chlamydiatrachomatis and Neisseria gonorrhoeaerdquo Journal of ClinicalMicrobiology vol 40 no 11 pp 4393-4393 2002
[30] M N Nikiforova W A LaFramboise and Y E NikiforovldquoChapter 4 - amplification-based methodsrdquo in Clinical Genom-ics pp 57ndash67 2015
[31] L Rainbow C A Hart and C Winstanley ldquoDistribution oftype III secretion gene clusters in Burkholderia pseudomalleiB thailandensis and B malleirdquo Journal of Medical Microbiologyvol 51 no 5 pp 374ndash384 2002
[32] A L T O Nascimento S Verjovski-AlmeidaM A van Sluys etal ldquoGenome features of Leptospira interrogans serovar Copen-hagenirdquo Brazilian Journal of Medical and Biological Researchvol 37 no 4 pp 459ndash478 2004
[33] D Svec A Tichopad V Novosadova M W Pfaffl and MKubista ldquoHow good is a PCR efficiency estimate recommen-dations for precise and robust qPCR efficiency assessmentsrdquoBiomolecularDetection andQuantification vol 3 pp 9ndash16 2015
Stem Cells International
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
MEDIATORSINFLAMMATION
of
EndocrinologyInternational Journal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Disease Markers
Hindawiwwwhindawicom Volume 2018
BioMed Research International
OncologyJournal of
Hindawiwwwhindawicom Volume 2013
Hindawiwwwhindawicom Volume 2018
Oxidative Medicine and Cellular Longevity
Hindawiwwwhindawicom Volume 2018
PPAR Research
Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom
The Scientific World Journal
Volume 2018
Immunology ResearchHindawiwwwhindawicom Volume 2018
Journal of
ObesityJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Computational and Mathematical Methods in Medicine
Hindawiwwwhindawicom Volume 2018
Behavioural Neurology
OphthalmologyJournal of
Hindawiwwwhindawicom Volume 2018
Diabetes ResearchJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Research and TreatmentAIDS
Hindawiwwwhindawicom Volume 2018
Gastroenterology Research and Practice
Hindawiwwwhindawicom Volume 2018
Parkinsonrsquos Disease
Evidence-Based Complementary andAlternative Medicine
Volume 2018Hindawiwwwhindawicom
Submit your manuscripts atwwwhindawicom
6 BioMed Research International
PCR for Identification of virulent gene targets of Burkholderiapseudomallei and B mallei mdasha retrospective study on archivalcases of service members with melioidosis and glandersrdquoMilitary Medicine vol 177 no 2 pp 216ndash221 2012
[29] M S Hamilton M Otto A Nickell D Abel Y Ballam andR Schremmer ldquoHigh frequency of competitive inhibition inthe Roche Cobas AMPLICOR multiplex PCR for Chlamydiatrachomatis and Neisseria gonorrhoeaerdquo Journal of ClinicalMicrobiology vol 40 no 11 pp 4393-4393 2002
[30] M N Nikiforova W A LaFramboise and Y E NikiforovldquoChapter 4 - amplification-based methodsrdquo in Clinical Genom-ics pp 57ndash67 2015
[31] L Rainbow C A Hart and C Winstanley ldquoDistribution oftype III secretion gene clusters in Burkholderia pseudomalleiB thailandensis and B malleirdquo Journal of Medical Microbiologyvol 51 no 5 pp 374ndash384 2002
[32] A L T O Nascimento S Verjovski-AlmeidaM A van Sluys etal ldquoGenome features of Leptospira interrogans serovar Copen-hagenirdquo Brazilian Journal of Medical and Biological Researchvol 37 no 4 pp 459ndash478 2004
[33] D Svec A Tichopad V Novosadova M W Pfaffl and MKubista ldquoHow good is a PCR efficiency estimate recommen-dations for precise and robust qPCR efficiency assessmentsrdquoBiomolecularDetection andQuantification vol 3 pp 9ndash16 2015
Stem Cells International
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
MEDIATORSINFLAMMATION
of
EndocrinologyInternational Journal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Disease Markers
Hindawiwwwhindawicom Volume 2018
BioMed Research International
OncologyJournal of
Hindawiwwwhindawicom Volume 2013
Hindawiwwwhindawicom Volume 2018
Oxidative Medicine and Cellular Longevity
Hindawiwwwhindawicom Volume 2018
PPAR Research
Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom
The Scientific World Journal
Volume 2018
Immunology ResearchHindawiwwwhindawicom Volume 2018
Journal of
ObesityJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Computational and Mathematical Methods in Medicine
Hindawiwwwhindawicom Volume 2018
Behavioural Neurology
OphthalmologyJournal of
Hindawiwwwhindawicom Volume 2018
Diabetes ResearchJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Research and TreatmentAIDS
Hindawiwwwhindawicom Volume 2018
Gastroenterology Research and Practice
Hindawiwwwhindawicom Volume 2018
Parkinsonrsquos Disease
Evidence-Based Complementary andAlternative Medicine
Volume 2018Hindawiwwwhindawicom
Submit your manuscripts atwwwhindawicom
Stem Cells International
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
MEDIATORSINFLAMMATION
of
EndocrinologyInternational Journal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Disease Markers
Hindawiwwwhindawicom Volume 2018
BioMed Research International
OncologyJournal of
Hindawiwwwhindawicom Volume 2013
Hindawiwwwhindawicom Volume 2018
Oxidative Medicine and Cellular Longevity
Hindawiwwwhindawicom Volume 2018
PPAR Research
Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom
The Scientific World Journal
Volume 2018
Immunology ResearchHindawiwwwhindawicom Volume 2018
Journal of
ObesityJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Computational and Mathematical Methods in Medicine
Hindawiwwwhindawicom Volume 2018
Behavioural Neurology
OphthalmologyJournal of
Hindawiwwwhindawicom Volume 2018
Diabetes ResearchJournal of
Hindawiwwwhindawicom Volume 2018
Hindawiwwwhindawicom Volume 2018
Research and TreatmentAIDS
Hindawiwwwhindawicom Volume 2018
Gastroenterology Research and Practice
Hindawiwwwhindawicom Volume 2018
Parkinsonrsquos Disease
Evidence-Based Complementary andAlternative Medicine
Volume 2018Hindawiwwwhindawicom
Submit your manuscripts atwwwhindawicom
Related Documents
