Drivers of microbial community composition in mesophilic and thermophilic temperature-phased anaerobic digestion pre-treatment reactors Hasina M. Pervin a , Paul G. Dennis a,b , Hui J. Lim a , Gene W. Tyson a,b , Damien J. Batstone a , Philip L. Bond a, * a Advanced Water Management Centre, The University of Queensland, Brisbane, Queensland 4072, Australia b Australian Centre for Ecogenomics, School of Chemistry and Molecular Biosciences, The University of Queensland, Brisbane, Queensland 4072, Australia article info Article history: Received 8 April 2013 Received in revised form 2 July 2013 Accepted 4 July 2013 Available online xxx Keywords: Temperature-phased anaerobic digestion Molecular microbial ecology Thermophilic pre-treatment Hydrolysisefermentation abstract Temperature-phased anaerobic digestion (TPAD) is an emerging technology that facilitates improved performance and pathogen destruction in anaerobic sewage sludge digestion by optimising conditions for 1) hydrolytic and acidogenic organisms in a first-stage/pre- treatment reactor and then 2) methogenic populations in a second stage reactor. Pre- treatment reactors are typically operated at 55e65 C and as such select for thermophilic bacterial communities. However, details of key microbial populations in hydrolytic com- munities and links to functionality are very limited. In this study, experimental thermophilic pre-treatment (TP) and control mesophilic pre-treatment (MP) reactors were operated as first- stages of TPAD systems treating activated sludge for 340 days. The TP system was operated sequentially at 50, 60 and 65 C, while the MP rector was held at 35 C for the entire period. The composition of microbial communities associated with the MP and TP pre-treatment reactors was characterised weekly using terminal-restriction fragment length polymorphism (T- RFLP) supported by clone library sequencing of 16S rRNA gene amplicons. The outcomes of this approach were confirmed using 454 pyrosequencing of gene amplicons and fluorescence in-situ hybridisation (FISH). TP associated bacterial communities were dominated by pop- ulations affiliated to the Firmicutes, Thermotogae, Proteobacteria and Chloroflexi. In particular there was a progression from Thermotogae to Lutispora and Coprothermobacter and diversity decreased as temperature and hydrolysis performance increased. While change in the composition of TP associated bacterial communities was attributable to temperature, that of MP associated bacterial communities was related to the composition of the incoming feed. This study determined processes driving the dynamics of key microbial populations that are correlated with an enhanced hydrolytic functionality of the TPAD system. ª 2013 Elsevier Ltd. All rights reserved. Abbreviations: AD, Anaerobic Digestion; BLAST, Basic Local Alignment Search Tool; FISH, Fluorescent In situ Hybridization; HRT, Hydraulic Retention Time; MP, Mesophilic Pre-treatment; OTU, Operational Taxonomic Unit; RFLP, Restriction Fragment Length Poly- morphism; TP, Thermophilic Pre-treatment; TPAD, Temperature-Phased Anaerobic Digestion; T-RF, Terminal Restriction Fragment; T- RFLP, Terminal Restriction Fragment Length Polymorphism. * Corresponding author. Advanced Water Management Centre (AWMC), The University of Queensland, Level 6 Gehrmann Building (60), Research Rd., St. Lucia, Queensland 4072, Australia. Tel.: þ61 (0)7 3446 3226; fax: þ61 (0)7 3365 4726. E-mail address: [email protected](P.L. Bond). Available online at www.sciencedirect.com ScienceDirect journal homepage: www.elsevier.com/locate/watres water research xxx (2013) 1 e11 Please cite this article in press as: Pervin, H.M., et al., Drivers of microbial community composition in mesophilic and ther- mophilic temperature-phased anaerobic digestion pre-treatment reactors, Water Research (2013), http://dx.doi.org/10.1016/ j.watres.2013.07.053 0043-1354/$ e see front matter ª 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.watres.2013.07.053
11
Embed
Drivers of microbial community composition in mesophilic ......Drivers of microbial community composition in mesophilic and thermophilic temperature-phased anaerobic digestion pre-treatment
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
ww.sciencedirect.com
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 1
Available online at w
ScienceDirect
journal homepage: www.elsevier .com/locate/watres
Drivers of microbial community composition inmesophilic and thermophilic temperature-phasedanaerobic digestion pre-treatment reactors
Hasina M. Pervin a, Paul G. Dennis a,b, Hui J. Lim a, Gene W. Tyson a,b,Damien J. Batstone a, Philip L. Bond a,*aAdvanced Water Management Centre, The University of Queensland, Brisbane, Queensland 4072, AustraliabAustralian Centre for Ecogenomics, School of Chemistry and Molecular Biosciences, The University of Queensland,
Brisbane, Queensland 4072, Australia
a r t i c l e i n f o
Article history:
Received 8 April 2013
Received in revised form
2 July 2013
Accepted 4 July 2013
Available online xxx
Keywords:
Temperature-phased anaerobic
digestion
Molecular microbial ecology
Thermophilic pre-treatment
Hydrolysisefermentation
Abbreviations: AD, Anaerobic Digestion;Hydraulic Retention Time; MP, Mesophilic Pmorphism; TP, Thermophilic Pre-treatment;RFLP, Terminal Restriction Fragment Length* Corresponding author. Advanced Water Ma
Research Rd., St. Lucia, Queensland 4072, AuE-mail address: [email protected]
Please cite this article in press as: Pervinmophilic temperature-phased anaerobicj.watres.2013.07.053
0043-1354/$ e see front matter ª 2013 Elsevhttp://dx.doi.org/10.1016/j.watres.2013.07.053
a b s t r a c t
Temperature-phased anaerobic digestion (TPAD) is an emerging technology that facilitates
improved performance and pathogen destruction in anaerobic sewage sludge digestion by
optimising conditions for 1) hydrolytic and acidogenic organisms in a first-stage/pre-
treatment reactor and then 2) methogenic populations in a second stage reactor. Pre-
treatment reactors are typically operated at 55e65 �C and as such select for thermophilic
bacterial communities. However, details of key microbial populations in hydrolytic com-
munities and links to functionality are very limited. In this study, experimental thermophilic
was characterised weekly using terminal-restriction fragment length polymorphism (T-
RFLP) supported by clone library sequencing of 16S rRNA gene amplicons. The outcomes of
this approachwere confirmedusing 454 pyrosequencing of gene amplicons andfluorescence
in-situ hybridisation (FISH). TP associated bacterial communities were dominated by pop-
ulations affiliated to the Firmicutes, Thermotogae, Proteobacteria and Chloroflexi. In particular
there was a progression from Thermotogae to Lutispora and Coprothermobacter and diversity
decreased as temperature and hydrolysis performance increased. While change in the
composition of TP associated bacterial communitieswas attributable to temperature, that of
MP associated bacterial communities was related to the composition of the incoming feed.
This study determined processes driving the dynamics of keymicrobial populations that are
correlated with an enhanced hydrolytic functionality of the TPAD system.
ª 2013 Elsevier Ltd. All rights reserved.
BLAST, Basic Local Alignment Search Tool; FISH, Fluorescent In situ Hybridization; HRT,re-treatment; OTU, Operational Taxonomic Unit; RFLP, Restriction Fragment Length Poly-TPAD, Temperature-Phased Anaerobic Digestion; T-RF, Terminal Restriction Fragment; T-Polymorphism.nagement Centre (AWMC), The University of Queensland, Level 6 Gehrmann Building (60),stralia. Tel.: þ61 (0)7 3446 3226; fax: þ61 (0)7 3365 4726.
.au (P.L. Bond).
, H.M., et al., Drivers of microbial community composition in mesophilic and ther-digestion pre-treatment reactors, Water Research (2013), http://dx.doi.org/10.1016/
centre, UK). Although the T-RFs identities are putative, the
confidence of the suggested identifications was increased by
using two enzyme digestions and coinciding T-RFLP abun-
dance patterns of the two digestions during the reactor
operation (Figure S3). The TAP t-RFLP tool (Marsh et al., 2000)
of the Ribosomal Database Project was used to verify the
affiliation of peaks and to infer matches when those were not
available from the clone library database. Both the MSPI and
HaeIII digest results were used for identifications, and the T-
RFLP profiles of the different digestions were in good agree-
ment (Fig. S3). However, as MSPI generated the more detailed
T-RFLP profiles, further analysis and results presented in this
study are based on those.
2.2.3. 16S rRNA gene amplicon cloning and sequencingBacterial and archaeal 16S rRNA genes of the communities
were determined by PCR, cloning and sequencing at 100 days
operation for MP and TP, and also at 240 days operation for TP.
Please cite this article in press as: Pervin, H.M., et al., Drivers ofmophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
Amplicons were generated by PCR, as described previously
(Bond et al., 1995), using the primer pairs 27F (50eTTTGATCCTGGCTCAGe30) and 1492R (50eGGTTACCTTGTACGACTTe30) forbacteria, and Arc8F (50eTCCGGTTGATCCTGCCe30) and
Arc927R (50e CCCGCCAATTCCTTTAAGTTTCe30) for archaea
(Singh et al., 2006). Clone librarieswere constructed based on a
total of 187 positive clones (Supplementary information). The
full length clone sequences were phylogenetically analysed
using representative bacterial sequences (ARB database,
greengenes.lbl.gov) and evolutionary distance analysis in
the ARB software package (Ludwig et al., 2004). The topology of
the phylogenetic tree was used to aid probe design (Section
2.2.5).
2.2.4. 16S rRNA gene amplicon pyrosequencingBacterial and archaeal 16S rRNA gene amplicons were exam-
ined by pyrosequencing from MP and TP reactor samples at
days 240 and 324, this was when TP was operated at 60 �C and
65 �C respectively. Gene amplicons were generated by PCR with
primers 926F and 1392R (Engelbrektson et al., 2010) that were
modified on the 50 end to contain the 454 FLX Titanium Lib L
adapters B and A, respectively. The reverse primers also
contained a 5-6 base barcode sequence positioned between
the primer sequence and the adapter. A unique barcode was
used for each sample. Following amplification (see Supple-
mentary Information) purified and normalised amplicons
were submitted to Macrogen (South Korea) for 454 pyrose-
over the general population. At least 25 images were used to
obtain an accurate biovolume fraction of the target microbe.
All biovolume fractions obtained have a minimum congru-
ency level of 90% to ensure that the quantification values
obtained were reliable.
2.3. Statistical analyses
Turnover in the composition of T-RFs between samples was
visualised using Principle Component Analysis (PCA). Data
were Hellinger transformed prior to analysis. The effect of
treatment parameters on the composition of microbial com-
munities was determined using permutational multivariate
analysis of variance (PERMANOVA). Statistical analyses were
conducted using R statistical package (R Development Core
Team, 2004).
3. Results
3.1. Reactor operation and performance
A detailed report and comparison of the performance of the
TPADs is presented in Ge et al. (2011). Briefly, both TPAD sys-
tems successfully produced methane throughout the 340 day
operation and the thermophilic pre-treatment (TP) reactor
demonstrated significantly enhanced AD performance.
Increased volatile solids destruction, solubilisation and pro-
duction of volatile fatty acids was evident in the TP reactor in
Table 2 e Putative identification of the most abundant T-RFs iphylogenetic analysis of cloned sequences. TP 50, TP 60, TP 65microorganisms during the periods of the TP reactor operationreactor operation (at 35 �C throughout the experiment).
in the TP reactor was constantly higher than that in the MP
reactor (Ge et al., 2011). Model based analysis determined key
kinetic parameters related to the extent (fd) and speed (khyd) of
organic solid degradation (Table 1). Both the speed and amount
of hydrolysis increased with increasing temperature in the TP
reactor, but these parameters did not differ between the MP
reactor at 35 �C and the TP reactor at 50 �C.
3.2. Identification of key populations
Sequencing of 16S rRNA amplicons from the clone library
revealed a range of organisms that were associated with the
pre-treatment reactors (Table 2 and Fig. 1). These sequences
were subjected to in-silico restriction enzyme digests which
facilitated their association with peaks from the T-RFLP anal-
ysis (Fig. 2). The composition of microbial communities asso-
ciated with the MP and TP reactors differed significantly
(PERMANOVA, P < 0.001), with the TP reactor (50e65 �C) beingassociated with members of the Thermotogae, Lutispora and
Coprothermobacter (Fig. 3). The TP reactor communities were
dominated by these key populations, particularly at the higher
temperatures of 60 �C and 65 �C (Fig. 2). In comparison, the MP
reactor (35 �C) communities were not dominated by particular
n the pre-treatment reactors as determined from theand MP 35 indicate average abundance of particularat 50 �C, 60 �C, and 65 �C respectively, and during the MP
Average abundance (%) as per MSPI
TP 50 TP 60 TP 65 MP 35
0.28 0.02 0.06 1.06
1.40 5.79 2.60 2.21
3.58 1.65 2.33 5.21
3.67 1.63 1.35 4.20
12.18 28.58 3.77 0.73
0.15 3.92 10.45 0.35
3.94 17.23 21.46 0.68
5.15 2.64 3.42 2.14
0.41 3.33 2.02 3.67
4.37 1.85 1.81 6.58
3.30 0.33 0.81 1.79
4.91 1.91 2.79 2.01
0.00 0.03 0.02 3.57
respective pyrotag sequence analysis.
f microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
Fig. 2 e Abundance patterns of bacteria in (A) TP and (B) MP as revealed by T-RFLP with MspI enzyme; T-RFs having
abundance <5% of the total community were pooled into a group called ‘others’. Different T-RFs are indicated by the
colours and the taxonomic affiliation of those with a corresponding taxonomic affiliation from in-silico restriction enzyme
digests of 16S rRNA gene amplicon sequences (Table 2) is shown. The temperature in the thermophilic reactor was 50 �C on
days 35e186, 60 �C on days 187e287, and 65 �C on days 288e340. The temperature in the mesophilic reactor was 35 �Cthroughout the experiment. (For interpretation of the references to colour in this figure legend, the reader is referred to the
web version of this article.)
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 16
3.4. Changes in bacterial community composition overtime
The largest changes in community composition in the TP
reactor were associated with changes in operating
Please cite this article in press as: Pervin, H.M., et al., Drivers omophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
temperature (Figs. 2 and 3). However, approximately, 6% and
19% of variation in bacterial community composition was
attributable to changes that occurred over time within a
temperature level in the TP and MP pre-treatment reactors,
respectively (PERMANOVA, P < 0.05; Fig. 3). The changes that
f microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
Fig. 4 e PCA ordination representing variation in the composition of feed-associated bacterial communities. Samples are
represented by circles. The size of the circles is proportional to the number of weeks since the start of the experiment.
Arrows indicate the progression of time. The crosses represent T-RFs of which the most discriminating are labelled. T-RF
labelled in bold font represents those with a corresponding taxonomic affiliation from in-silico restriction enzyme digests of
16S rRNA gene amplicon sequences (Table 2). The first feed sample was characterised 100 days into the experiment after
that each new batch of feed was subjected to T-RFLP fingerprinting. The temperature in the thermophilic reactor was 50 �Con days 35e186, 60 �C on days 187e287, and 65 �C on days 288e340. The temperature in the mesophilic reactor was 35 �Cthroughout the experiment.
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 18
correlated microbial community changes, particularly those
of the bacteria, to operating conditions of increased temper-
ature in anaerobic digestion.
The TP reactor communities were dominated by particular
bacteria at the different stages of temperature operation. This
is likely to be related to the different temperature optimums of
the bacteria. For example, at 65 �C Thermotogae sp. was out
competed in the TP reactor by Lutispora thermophila and other
thermophiles; possibly this temperature being above the or-
ganisms optimal range. Another possibility was the Thermo-
togae sp. abundance was not favoured by the high
concentrations of ammonium or organic acids, since the total
VFA concentration increased three fold when the temperature
increased from 60 to 65 �C in the TP reactor (Ge et al., 2011).
Thus, reactor conditions influenced the presence and domi-
nance of specific populations resulting in the community dy-
namics at various temperatures.
The Feed community was seen to significantly affect the
bacterial community structure in the MP reactor. Correla-
tion of variation of Feed communities with that in MP
reactor communities was evident by PCA ordination (Fig. 3).
Likely, contributing to the MP communities were: survival of
facultative anaerobic Feed populations due to the similar
temperature conditions of the MP reactor and WAS, changes
in the batches of Feed community composition and dead
Please cite this article in press as: Pervin, H.M., et al., Drivers omophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
cell DNA from the Feed. Contributions of the Feed commu-
nities were not so evident in the TP reactor communities
and this could be explained by the selection pressure of
temperature in TP having a stronger influence on microbial
community composition in comparison with the feed
material.
Some variation in the TP reactor bacterial communities
were detected within periods of constant operating tempera-
ture. Variation in bacterial communities has been detected
during the stable operation of AD reactors (Fernandez et al.,
1999; Pycke et al., 2011). However, this variation in TP could
be attributed to adjustment of population abundance
following reactor temperature changes and consequential
performance changes, such as changing VFA levels, occurring
through the periods of constant temperature operation.
4.2. Microbial community composition and reactorperformance
The principal parameters for performance of anaerobic
digestion are stated in Section 3.1. However, it is important
that hydrolysis in TP at 50 �C was similar to that in MP, and
only increased once temperature increased to 60 �C, and the
as the temperature increased to 65 �C. This indicates that
while at 50 �C the community was strongly directed by tem-
perature (to Thermotogae), it was only once temperature
increased and caused a population shift particularly to Lutis-
pora thermophila and Coprothermobacter that performance in
terms of hydrolysis increased substantially. While the com-
munity changes could be related to increased hydrolysis,
these changes also coincided with other changes, including
increases in ammonia and organic acid concentrations (Ge
et al., 2011). It should be noted also that these increases in
digestion performance were related to increased protein hy-
drolysis, a particularly important feature for WAS digestion.
In the TP reactor methane production was significantly
higher than in the MP reactor. This coincided with the pres-
ence ofMethanosarcina thermophila which was abundant in TP.
In contrast, FISH (results not shown) and pyrosequencing
indicated that archaea were in very low abundance in MP.
4.3. Possible functions of key organisms in thepre-treatment reactors
We assume the abundant organisms in the pre-treatment
reactors were playing important roles in the AD perfor-
mance. While detection of particular 16S rRNA genes is not
proof of phenotype activity, it is possible to suggest potential
functions of the abundant microorganisms in the pre-
treatment reactors. Thermotogae has been previously detec-
ted in thermophilic anaerobic digesters (Chen et al., 2004;
Leven et al., 2007), and in mesophilic AD (Nesbo et al., 2006),
however, on this occasion they were not detected in the MP
reactor. Members of the Thermotogae are thermophilic anaer-
obes that excrete hydrolytic enzymes to catalyse a wide range
of polysaccharides to acetate, carbon dioxide and hydrogen as
the main fermentation products (Huber and Hanning, 2007).
Thermotogae are also implicated with interspecies hydrogen
transfer (Johnson et al., 2006), and the presence of Meth-
anosarcina thermophila, implicates a possible syntrophy
contributing to the methane production in TP.
Lutispora thermophila were originally isolated from an
anaerobic bioreactor operating at 55 �C (Shiratori et al., 2008),
and is a fermentater that strictly utilises amino acids for
growth. Coprothermobacter, like Lutispora are within the Clos-
trida subphylum of the Firmicutes. Also, similar to Lutispora,
Coprothermobacter are detected in thermophilic andmesophilic
anaerobicdigestionand theyhavepreference for fermentation
of protein and amino acids as opposed to carbohydrate
fermentation (Etchebehere et al., 1998). This function of these
organisms coincides with the abundance of these sequences
detected with the higher levels of NH4þ and VFA in the TP
reactor at higher temperatures. Additionally, it highlights the
importance of protein degradation and fermentation for the
performance of AD systems.Coprothermobacter also produceH2
and improved growth of these is detected in the presence of H2
utilising methanogens (Sasaki et al., 2011).
Methanosarcina thermophila, the primary archaeon in the TP
reactor, are detected in previous studies of thermophilic
anaerobic digestion systems (Kobayashi et al., 2008; Leven
et al., 2007). In general, Methanosarcina are thought respon-
sible for methane production in anaerobic digestion systems
when acetate concentrations are high (Jetten et al., 1990;
Please cite this article in press as: Pervin, H.M., et al., Drivers ofmophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
McMahon et al., 2001). However, Methanosarcina thermophila
is capable of H2/CO2 conversion tomethane (Mladenovska and
Ahring, 2000), and consequently the nature of this methano-
genesis is of interest in terms of the metabolic pathway uti-
lised. Additionally, the growth rates of organisms in the TP
reactor (HRT of 2 days) would be faster than typically expected
for methanogens. However, high growth rates, such as a 12 h
doubling time on acetate, are reported for various Meth-
anosarcina spp. (Mladenovska and Ahring, 2000).
5. Conclusion
The mesophilic pre-treatment reactor bacterial communities
were heavily influenced by the feed, while the thermophilic
reactor was less diverse, and had dominant populations of
Thermotogae sp., Lutispora thermophila, and Coprothermobacter,
shifting progressively from the first to the last as temperature
was increased from 50 �C to 65 �C. Functionality was higher at
60 �C and 65 �C, when the process wasmore dominated by the
latter two organisms, indicating that while temperature can
direct community, there will be optimums related to the
emergence of key populations that we suggest are implicated
for the enhanced hydrolytic ability. A particularly important
outcome was the consistency in outputs from the multiple
methods applied, with key populations being quantified
consistently by FISH, T-RFLP (full 16S rRNA gene sequence)
and 454 pyrosequencing (partial 16S rRNA gene sequence).
Acknowledgements
We thank the Queensland Government and Environmental
Biotechnology Cooperative Research Centre (EBCRC),
Australia for supporting this work as a sub-project of “Small-
medium scale organic solids stabilization”. The authors
gratefully acknowledge the contributions of Dr. Frances
Slater, Dr. Huoqing Ge, and Dr. Paul Jensen.
Appendix A. Supplementary data
Supplementary data related to this article can be found at
http://dx.doi.org/10.1016/j.watres.2013.07.053.
r e f e r e n c e s
Amani, T., Nosrati, M., Sreekrishnan, T.R., 2010. Anaerobicdigestion from the viewpoint of microbiological, chemical,and operational aspects e a review. Environ. Rev. 18, 255e278.
Amann, R.I., Ludwig, W., Schleifer, K.H., 1995. Phylogeneticidentification and in-situ detection of individual microbial-cells without cultivation. Microbiol. Rev. 59 (1), 143e169.
Bond, P.L., Hugenholtz, P., Keller, J., Blackall, L.L., 1995. Bacterialcommunity structures of phosphate-removing and non-phosphate-removing activated sludges from sequencing batchreactors. Appl. Environ. Microbiol. 61 (5), 1910e1916.
Knights, D., Koenig, J.E., Ley, R.E., Lozupone, C.A.,McDonald, D., Muegge, B.D., Pirrung, M., Reeder, J.,Sevinsky, J.R., Tumbaugh, P.J., Walters, W.A., Widmann, J.,Yatsunenko, T., Zaneveld, J., Knight, R., 2010. QIIME allowsanalysis of high-throughput community sequencing data. Nat.Methods 7 (5), 335e336.
Chen, C.L., Macarie, H., Ramirez, I., Olmos, A., Ong, S.L.,Monroy, O., Liu, W.T., 2004. Microbial community structure ina thermophilic anaerobic hybrid reactor degradingterephthalate. Microbiology-Sgm 150, 3429e3440.
Chouari, R., Le Paslier, D., Daegelen, P., Ginestet, P.,Weissenbach, J., Sghir, A., 2005. Novel predominant archaealand bacterial groups revealed by molecular analysis of ananaerobic sludge digester. Environ. Microbiol. 7 (8), 1104e1115.
Daims, H., Lucker, S., Wagner, M., 2006. daime, a novel imageanalysis program for microbial ecology and biofilm research.Environ. Microbiol. 8 (2), 200e213.
Dennis, P.G., Guo, K., Imelfort, M., Jensen, P., Tyson, G.W.,Rabaey, K., 2013. Spatial uniformity of microbial diversity in acontinuous bioelectrochemical system. Bioresour. Technol.129, 599e605.
Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., Knight, R., 2011.UCHIME improves sensitivity and speed of chimera detection.Bioinformatics 27 (16), 2194e2200.
Engelbrektson, A., Kunin, V., Wrighton, K.C., Zvenigorodsky, N.,Chen, F., Ochman, H., Hugenholtz, P., 2010. Experimentalfactors affecting PCR-based estimates of microbial speciesrichness and evenness. ISME J. 4 (5), 642e647.
Etchebehere, C., Pavan, M.E., Zorzopulos, J., Soubes, M., Muxi, L.,1998. Coprothermobacter platensis sp. nov., a new anaerobicproteolytic thermophilic bacterium isolated from an anaerobicmesophilic sludge. Int. J. Syst. Bacteriol. 48, 1297e1304.
Fernandez, A., Huang, S.Y., Seston, S., Xing, J., Hickey, R.,Criddle, C., Tiedje, J., 1999. How stable is stable? Functionversus community composition. Appl. Environ. Microbiol. 65(8), 3697e3704.
Hori, T., Haruta, S., Ueno, Y., Ishii, M., Igarashi, Y., 2006. Dynamictransition of a methanogenic population in response to theconcentration of volatile fatty acids in a thermophilicanaerobic digester. Appl. Environ. Microbiol. 72 (2), 1623e1630.
Huber, R., Hanning, M., 2007. The Prokaryotes. Springer NewYork, New York, NY, pp. 899e922.
Johnson, M.R., Conners, S.B., Montero, C.I., Chou, C.J.,Shockley, K.R., Kelly, R.M., 2006. The Thermotoga maritimaphenotype is impacted by syntrophic interaction withMethanococcus jannaschii in hyperthermophilic coculture. Appl.Environ. Microbiol. 72 (1), 811e818.
Karakashev, D., Batstone, D.J., Angelidaki, I., 2005. Influence ofenvironmental conditions onmethanogenic compositions inanaerobic biogas reactors. Appl. Environ. Microbiol. 71 (1),331e338.
Kobayashi, T., Li, Y.Y., Harada, H., 2008. Analysis of microbialcommunity structure and diversity in the thermophilicanaerobic digestion of waste activated sludge. Water Sci.Technol. 57 (8), 1199e1205.
Kobayashi, T., Yasuda, D., Li, Y.-Y., Kubota, K., Harada, H., Yu, H.-Q., 2009. Characterization of start-up performance andarchaeal community shifts during anaerobic self-degradation
Please cite this article in press as: Pervin, H.M., et al., Drivers omophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
of waste-activated sludge. Bioresour. Technol. 100 (21),4981e4988.
Lee, S.-H., Kang, H.-J., Lee, Y.H., Lee, T.J., Han, K., Choi, Y.,Park, H.-D., 2012. Monitoring bacterial community structureand variability in time scale in full-scale anaerobic digesters. J.Environ. Monit. 14 (7), 1893e1905.
Leven, L., Eriksson, A.R.B., Schnurer, A., 2007. Effect of processtemperature on bacterial and archaeal communities in twomethanogenic bioreactors treating organic household waste.Fems Microbiol. Ecol. 59 (3), 683e693.
Li, Y.Y., Noike, T., 1992. Upgrading of anaerobic-digestion ofwaste activated-sludge by thermal pretreatment. Water Sci.Technol. 26 (3e4), 857e866.
Loy, A., Arnold, R., Tischler, P., Rattei, T., Wagner, M., Horn, M.,2008. probeCheck e a central resource for evaluatingoligonucleotide probe coverage and specificity. Environ.Microbiol. 10 (10), 2894e2898.
Ludwig, W., Strunk, O., Westram, R., Richter, L., Meier, H.,Yadhukumar, Buchner A., Lai, T., Steppi, S., Jobb, G.,Forster, W., Brettske, I., Gerber, S., Ginhart, A.W., Gross, O.,Grumann, S., Hermann, S., Jost, R., Konig, A., Liss, T.,Lussmann, R., May, M., Nonhoff, B., Reichel, B., Strehlow, R.,Stamatakis, A., Stuckmann, N., Vilbig, A., Lenke, M., Ludwig, T.,Bode, A., Schleifer, K.H., 2004. ARB: a software environment forsequence data. Nucleic Acids Res. 32 (4), 1363e1371.
Marsh, T.L., Saxman, P., Cole, J., Tiedje, J., 2000. Terminalrestriction fragment length polymorphism analysis program,a web-based research tool for microbial community analysis.Appl. Environ. Microbiol. 66 (8), 3616e3620.
McMahon, K.D., Stroot, P.G., Mackie, R.I., Raskin, L., 2001.Anaerobic codigestion of municipal solid waste and biosolidsunder various mixing conditions e II: microbial populationdynamics. Water Res. 35 (7), 1817e1827.
Nelson, M.C., Morrison, M., Yu, Z.T., 2011. A meta-analysis of themicrobial diversity observed in anaerobic digesters. Bioresour.Technol. 102 (4), 3730e3739.
Nesbo, C.L., Dlutek, M., Zhwcybayeva, O., Doolittle, W.F., 2006.Evidence for existence of “mesotogas”, members of the orderthermotogales adapted to low-temperature environments.Appl. Environ. Microbiol. 72 (7), 5061e5068.
Paul, E., Carrere, H., Batstone, D.J., 2012. In: Paul, E., Liu, Y. (Eds.),Biological Sludge Minimization and Biomaterials/BioenergyRecovery Technologies. John Wiley & Sons, Inc., New Jersey,pp. 373e404.
Pycke, B.F.G., Etchebehere, C., Van de Caveye, P., Negroni, A.,Verstraete, W., Boon, N., 2011. A time-course analysis of fourfull-scale anaerobic digesters in relation to the dynamics ofchange of their microbial communities. Water Sci. Technol. 63(4), 769e775.
Riviere, D., Desvignes, V., Pelletier, E., Chaussonnerie, S.,Guermazi, S., Weissenbach, J., Li, T., Camacho, P., Sghir, A.,2009. Towards the definition of a core of microorganismsinvolved in anaerobic digestion of sludge. ISME J. 3 (6),700e714.
f microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/
wat e r r e s e a r c h x x x ( 2 0 1 3 ) 1e1 1 11
Sait, L., Galic, M., Strugnell, R.A., Janssen, P.H., 2003. Secretoryantibodies do not affect the composition of the bacterialmicrobiota in the terminal ileum of 10-week-old mice. Appl.Environ. Microbiol. 69 (4), 2100e2109.
Sasaki, K., Morita, M., Sasaki, D., Nagaoka, J., Matsumoto, N.,Ohmura, N., Shinozaki, H., 2011. Syntrophic degradation ofproteinaceous materials by the thermophilic strainsCoprothermobacter proteolyticus and Methanothermobacterthermautotrophicus. J. Biosci. Bioeng. 112 (5), 469e472.
Shiratori, H., Ohiwa, H., Ikeno, H., Ayame, S., Kataoka, N., Miya, A.,Beppu, T., Ueda, K., 2008. Lutispora thermophila gen. nov., spnov., a thermophilic, spore-forming bacterium isolated from athermophilic methanogenic bioreactor digesting municipalsolid wastes. Int. J. Syst. Evol. Microbiol. 58, 964e969.
Please cite this article in press as: Pervin, H.M., et al., Drivers ofmophilic temperature-phased anaerobic digestion pre-treatmenj.watres.2013.07.053
Singh, B.K., Nazaries, L., Munro, S., Anderson, I.C., Campbell, C.D.,2006. Use of multiplex terminal restriction fragment lengthpolymorphism for rapid and simultaneous analysis ofdifferent components of the soil microbial community. Appl.Environ. Microbiol. 72 (11), 7278e7285.
Supaphol, S., Jenkins, S.N., Intomo, P., Waite, I.S., O’Donnell, A.G.,2011. Microbial community dynamics in mesophilic anaerobicco-digestion of mixed waste. Bioresour. Technol. 102 (5),4021e4027.
Weiland, P., 2010. Biogas production: current state andperspectives. Appl. Microbiol. Biotechnol. 85 (4), 849e860.
Weiss, A., Jerome, V., Freitag, R., Mayer, H.K., 2008. Diversity ofthe resident microbiota in a thermophilic municipal biogasplant. Appl. Microbiol. Biotechnol. 81 (1), 163e173.
microbial community composition in mesophilic and ther-t reactors, Water Research (2013), http://dx.doi.org/10.1016/