Iman Rusmana ([email protected]) ironmental Microbiologist ESEARCH INTEREST: Current Research Topics: • Methanotrophic bacteria as biofertilizers and methane emission reducers in rice fields • N 2 O reducing bacteria to reduce N2O emission from agriculture system • Nitrate reducing bacteria and Bacillus spp. as bioactive of biofilter in close system of larval rearing and nursery of aquacultures • Nitrate reducing and nitrifying bacteria as bioconditioner controlling nitrite and ammonia in shrimp Nitrogen cycling and N 2 O emission in tropical estuaries and agricultural system Student involved (9 master, 1 PhD)
Dr. Iman Rusmana ([email protected]) Environmental Microbiologist
Jan 13, 2016
Dr. Iman Rusmana ([email protected]) Environmental Microbiologist. RESEARCH INTEREST:. Nitrogen cycling and N 2 O emission in tropical estuaries and agricultural system. Student involved (9 master, 1 PhD). Current Research Topics: - PowerPoint PPT Presentation
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Dr. Iman Rusmana ([email protected]) Environmental Microbiologist
RESEARCH INTEREST:
Current Research Topics:• Methanotrophic bacteria as biofertilizers and methane emission reducers in rice
fields
• N2O reducing bacteria to reduce N2O emission from agriculture system
• Nitrate reducing bacteria and Bacillus spp. as bioactive of biofilter in close system of larval rearing and nursery of aquacultures
• Nitrate reducing and nitrifying bacteria as bioconditioner controlling nitrite and ammonia in shrimp ponds
Nitrogen cycling and N2O emission in tropical estuaries and agricultural
systemStudent involved (9 master, 1 PhD)
Amplification of mmoX gene
Amplification of pmoA gene
Size of DNA fragments
Molecular characterization of methane monooxygenase genesForward sequence of BGM9 mmoX gene:
ATAANCGCAGCGTGTTNCAGGTCCGCGAGATCGCCGACCAGTCCGCCGCCGNCAGCNAGCAGACCGCCAGCTCCAGCAACGAACTGGCGCACCTGGGCAACGAGCTGCAACTGCAGGTGGGACGTTTCCGCCTGTGACACGCCNGTCGGTCGGTACGCCCGCTCCGGCCGATAACGGCAGGACAGTTGTCATGCGCATGGCGTAGGATCGGACACTCGCCATGAAGGGAGAGTGACCATGCGCCCGCTGACCATCGATATCGACGAACTGGACCTTCGCGCTTGATACCCAGGGTATCGATCACTACCTCGACCTGTTCAGTGGCCAGGTGCTGCTGATACCGGAGGACGACCCCGACCCGGAGCTCGCCGAACTGCTGCACCGCGAGCCGGAGCGCTACGAGTG
Reverse sequence of BGM9 mmoX gene:GGTATCANCAGCACCATGGCCACTGAACAGGTCGAGGTAGTGATCGATACCCTGGGTATCAAGCGCGAAGGCCAGTTCGTCGATATCGATGGTCAGCGGGCGCATGGTCACTCTCCCTTCATGGCGAGTGTCCGATCCTACGCCATGCGCATGACAACTGTCCTGCCGTTATCGGCCGGAGCGGGCGTACCGACCGACAGGCGCGTCACAGGCGGAAACGTCCCACCTGCAGTTGCAGCTCGTTGCCCAGGCGCGCCAGTTCGGTGCTGGAGCTGGCGGTCTGCTCGCTGGCGGCGGCGGACTGGTCGGCGATCTCGCGGACCTGCACCACGCTGCGGTTGATCTCCTCGGCAACGCTGCTCTGCTCCTCGGCGGCCGANGCGATCTGCAGGTTCATGCCCTTCCACAGCGGATATAATA
Sampling for measurement and molecular analysis of nitrate reducing bacteria in sediment of tropical estuaries
Bacteriocins purification and its antimicrobial activity from Bacillus spp. isolated from shrimp ponds
FROM MOLECULAR TO ECOLOGY
Related Documents
