Downloaded from //aem.asm.org/content/aem/early/2012/09/04/AEM...2012/09/04  · 103 immersed in DAB solution (80 ml of Jemson s solution + 10 ml of 100 mM 104 Menthol-NaOH +10 ml

1

Title: Effects of engineered Sinorhizobium meliloti on cytokinin synthesis and 1

tolerance of alfalfa to extreme drought stress 2

Running title: Effects of Sinorhizobium expressing the ipt gene 3

4

Ji Xu, Xiao-Lin Li, Li Luo* 5

6

State Key Lab of Plant Molecular Genetics, Institute of Plant Physiology and Ecology, 7

Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 8

200032, China; 9

10

11

12

Correspondent footnote: 13

Li Luo 14

State Key Lab of Plant Molecular Genetics, Institute of Plant Physiology and Ecology, 15

Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences 16

300 Fenglin Rd, Shanghai, 200032, China 17

Tel: +86-21-54924167 18

Fax: +86-21-54924015 19

E-mail: [email protected] 20

21

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.01276-12 AEM Accepts, published online ahead of print on 7 September 2012

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

2

Abstract 22

Cytokinin is required for the initiation of leguminous nitrogen-fixation nodules 23

elicited by rhizobia and the delay of the leaf senescence induced by drought stress. A 24

few free-living rhizobia have been found to produce cytokinin. However, the effects 25

of engineered rhizobia capable of synthesizing cytokinin on host tolerance to abiotic 26

stresses have not yet been described. In this study, two engineered Sinorhizobium 27

strains overproducing cytokinin were constructed. The tolerance of inoculated alfalfa 28

plants to severe drought stress was assessed. The engineered strains, which expressed 29

the Agrobacterium ipt gene under the control of different promoters, synthesized more 30

zeatins than the control strain under free-living conditions, but their own growth was 31

not affected. After a four-week inoculation period, the effects of engineered strains on 32

alfalfa growth and nitrogen fixation were similar to those of the control strain under 33

non-drought conditions. After being subjected to severe drought stress, most of the 34

alfalfa plants inoculated with engineered strains survived, and the nitrogenase activity 35

in their root nodules showed no apparent change. A small elevation in zeatin 36

concentration was observed in the leaves of these plants. The expression of 37

antioxidant enzymes increased and the level of reactive oxygen species decreased 38

correspondingly. Although the ipt gene was transcribed in the bacteroids of 39

engineered strains, the level of cytokinin in alfalfa nodules was identical to that of the 40

control. These findings suggest that the engineered Sinorhizobium synthesizing more 41

cytokinin could improve the tolerance of alfalfa to severe drought stress without 42

affecting alfalfa nodulation or nitrogen fixation. 43

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

3

Introduction 44

Cytokinin (CK) is a classical phytohormone. It regulates cell growth, cell 45

differentiation, apical dominance, and leaf senescence. It can be classified into two 46

types, adenine and phenylurea. Adenine-type CKs (zeatin, kinetin, and 47

6-benzylaminopurine) are mainly synthesized in roots by multiple enzymes, including 48

an adenosine phosphate-isopentenyltransferase (IPT), which acts in the first 49

biosynthetic reaction (13, 14). Some plant-pathogenic bacteria (such as 50

Agrobacterium) containing ipt genes can also synthesize CK and so affect their host 51

plant’s growth and development (1, 2). CK can also be produced by recycled tRNAs 52

in plants and bacteria (25). 53

CK is required for the symbiotic interactions between leguminous plants and 54

rhizobia (a group of mutualistic soil bacteria) and for the formation of nitrogen-fixing 55

root nodules (20, 23, 27). The Lotus japonicus HIT1 (encoding a sensor kinase gene 56

of CK) null mutant does not form root nodules (20). In a model rhizobium, 57

Sinorhizbium meliloti nodA- and nodB- mutants failed to produce active nodulation 58

factors (Nod factors), so no root nodules formed on the host alfalfa (Medicao sativa). 59

However, overexpression of a foreign ipt gene in these strains was found to rescue 60

this deficiency (8). 61

Drought tolerance is an important agronomic trait among land crops. This trait 62

can be enhanced by constructing a transgenic plant that overexpresses an IPT gene. 63

The plant then synthesizes more zeatins, and experiences delayed leaf senescence (13, 64

19, 24, 31). However, it is unclear whether S. meliloti overexpressing ipt can produce 65

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

4

more zeatins and thus improve its drought tolerance. In this study, two S. meliloti 66

strains expressing a foreign ipt gene (engineered S. meliloti) were constructed and 67

inoculated onto alfalfa seedlings. After a 4-week inoculation and drought treatment 68

period, the zeatin content, plant biomass, nodulation kinetics, nitrogenase activity, 69

accumulation of reactive oxygen species (ROS), and expression of antioxidant genes 70

were analyzed. The alfalfa plants inoculated with the engineered strains exhibited 71

superior drought tolerance, and a preliminary study into a possible mechanism was 72

performed. 73

Materials and Methods 74

Bacterial strains and plant materials 75

Sinorhizobium 1021 and derivative strains were grown in LB/MC medium 76

supplemented with 500 μg/ml streptomycin and 100 μg/ml neomycin at 28ºC. They 77

were shaken overnight at 200 rpm. Alfalfa (Medicago sativa cv. xinjiang) plants 78

inoculated with rhizobia were grown as described by Wang et al. (29). 79

Construction of engineered S. meliloti 80

The ipt gene from A. tumefaciens C58 was amplified with primers P1 and P2 81

(Table 1), digested with restriction enzymes Nde I and Pst I (BioLab, U.S.), ligated 82

into pSRK-Km with T4 DNA ligase (Takara, Dalian, China), and transformed into 83

DH5α competent cells (15). The colonies carrying recombinant plasmid were 84

screened on a LB agar plate containing kanamycin. The recombinant plasmids were 85

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

5

extracted using a plasmid extraction kit (Transgen, Beijing, China) and identified 86

using PCR, Nde I and Pst I digestion, and DNA sequencing (Invitrogen, Shanghai, 87

China). The ipt gene was under the control of a lac promoter called plac-ipt (18). The 88

recombinant plasmid was transferred into S. meliloti 1021 by conjugation with the 89

help of MT616/pRK600, also called LMG201 (17). The plasmid of pTZS (controlled 90

by a trp promoter) was transferred in Rm1021, called LMG202, and Rm1021 carrying 91

an empty vector (pSRK-Km) was used as a negative control (8). These Sinorhizobium 92

strains were inoculated onto alfalfa seedlings. 93

Severe drought treatment 94

Fifteen alfalfa plants inoculated with rhizobia were grown in barrels (50 cm in 95

diameter) in a greenhouse (29). The plants were watered with 80 ml of Jensen’s liquid 96

medium per barrel per week. After 4 weeks, alfalfa plants were not watered with 97

Jensen’s medium; this represented extreme drought (24). The plants were 98

photographed every day, and fresh and dry weight were measured. 99

ROS assay 100

DAB staining was used for ROS assay (26). Four weeks after inoculation, alfalfa 101

plants were subjected to 4 days of severe drought. Then their leaves were picked and 102

immersed in DAB solution (80 ml of Jemson’s solution + 10 ml of 100 mM 103

Menthol-NaOH +10 ml of 1% DAB-HCl) for 1 hour. They were then washed 3 times 104

with 95% boiled ethanol. The color of the leaves was observed under an optical 105

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

6

microscope (Leica, Germany). Pictures were taken using a digital camera (Nikon, 106

Japan). 107

RT-PCR assay of ipt and antioxidant enzyme genes 108

Primers of A. tumefaciens C58 ipt, S. meliloti rpsF, and the Medicago sativa genes 109

homologous to SOD, CAT, sAPX, thylAPX, DHAR, MDHAR, GR, GPX, and ACTIN 110

were designed and synthesized by Invitrogen and used in RT-PCR (Shanghai, China) 111

(11, 24, 30). The total RNA from freshly collected rhizobia (OD600=0.8) and 112

3-week-old root nodules collected 4 weeks after inoculation of roots and leaves were 113

extracted using RNA Extraction and Purification kits (Transgen, Beijing, China). The 114

total RNA was reverse transcribed as cDNA with a Takara Reverse Transcription Kit 115

(Takara, Dalian, China). RT-PCR was performed according to the protocol provided 116

with a PrimeScript RT Reagent Kit (Takara, Dalian, China). All primers are listed in 117

Table 1. 118

Zeatin content assay 119

An extraction and quantification protocol for CK was carried out as described by Pan 120

et al. with some modifications (21). The supernatant of 50 ml rhizobial LB/MC 121

cultures was prepared by centrifugation at 13,000 g for 10 minutes at 4°C. Then 0.5 g 122

of fresh tissue per sample was ground in 5 ml mixture of 2-propanol, H2O, and 123

concentrated HCl at a ratio of 2:1:0.002 by volume. After centrifugation, supernatants 124

were subjected to 6520 Accurate-Mass Q-TOF LC/MS analysis (Agilent, U.S.). 125

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

7

Purification and analysis conditions were as follows: column, Zorbax extend -C18 126

4.6*50 mm 1.8 μm; 5 μl injection; flow, 0.2 ml/min; flow phase, A= 0.1% FA H2O, 127

B=0.1% FA menthol; detection wavelength, DAD, 210, 254, 280, 320, 360, 226 nm; 128

mass range 50–400; nebulizer pressure 40 psig, drying gas N2 350C 9 L/min, ESIV 129

cap 3500 V; capillary, fragmentor 160 V, skimmer 65 V, Oct RFV pp750V; scanning 130

mode, negative ms scan mode 2 GHz Ext Dyn (1700). 131

Results 132

CK produced by engineered Sinorhizobium under free living conditions 133

The growth of engineered strains was analyzed in the complex medium. As shown 134

in Fig. 1A, the growth curve of LMG201 was identical to that of the control strain. 135

The growth of LMG202 increased after 36 hours of incubation (Fig. 1A). These data 136

suggest that the ipt gene on the plasmid does not suppress the growth of S. meliloti 137

under free-living conditions. 138

To determine whether the ipt gene carried by the plasmid is expressed in 139

free-living rhizobia, total RNA was extracted and RT-PCR was performed. No ipt 140

transcript was detected in the control strain (Fig. 1B). This was consistent with the 141

genomic data of S. meliloti 1021 (9). Unlike the control, the introduced ipt gene was 142

transcribed in the engineered rhizobia LMG201 and LMG202. The level of ipt 143

transcription was lower in LMG201 than in LMG202 (Fig. 1B). This suggests that the 144

introduced ipt gene is expressed in engineered S. meliloti stains. 145

To verify that the transcription of ipt is correlated with CK biosynthesis, zeatin 146

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

8

content was assessed using Q-TOF LC-MS. Although S. meliloti 1021 does not 147

contain any ipt homologous gene, the control strain still synthesized and secreted a 148

small amount of zeatin under free-living conditions (Fig. 1C). In contrast, the two 149

engineered strains produced 2.6 and 4.3 times the zeatin produced by the control 150

strain (Fig. 1C). This was consistent with the level of transcription of the ipt gene 151

(Fig. 1B). From this, it can be concluded that the genetically modified S. meliloti 152

synthesized more CK under free-living conditions than the control strain did. 153

Effects of genetically modified S. meliloti on alfalfa tolerance to extreme drought 154

stress 155

Because transgenic plants overexpressing an IPT gene are usually tolerant to 156

severe drought, the tolerance of alfalfa plants to drought after four-week inoculation 157

with engineered strains was evaluated (13, 19, 24, 31). After a four-week inoculation 158

and incubation period, the alfalfa plants appeared similar in appearance under the 159

ordinary conditions (Fig. 2A). From the beginning of the 5th week, these plants were 160

subjected to severe drought (no watering). After 3–4 days, alfalfa plants inoculated 161

with the control strain started to wilt. After 6 days, these plants became completely 162

wilted. However, plants inoculated with the engineered strains were only partially 163

wilted after 6 days (Fig. 2B). After the drought treatment, all plants were re-watered. 164

Alfalfa plants inoculated with engineered strains regained full or partial turgor, but 165

those inoculated with the control strain did not recover and died (Fig. 2C). 166

Before drought treatment, the biomass (fresh weight) showed no apparent 167

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

9

difference across alfalfa plants (both shoots and roots) inoculated with each rhizobial 168

strain (Figs. 3C–3D). However, the fresh weight of alfalfa plants inoculated with 169

LMG 202 was significantly higher than that of plants inoculated with the control 170

strain after drought treatment (Figs. 3C–3D). The dry weight of all alfalfa plants was 171

almost identical (whole plant, 0.041±0.004, 0.044±0.002 and 0.041±0.002 g/plant; 172

leaves, 0.026±0.002, 0.028±0.001 and 0.028±0.001g/plant). Therefore, water content 173

of alfalfa plants with treatment of extreme drought had about 50%, 30% and 5% after 174

inoculation of the control and two engineered strains, respectively. These data suggest 175

that alfalfa plants inoculated with engineered S. meliloti may maintain water content 176

more effectively than control plants under drought stress conditions. 177

Effects of engineered S. meliloti strains on nitrogen fixation 178

The transcription of ipt in bacteroids was first analyzed by RT-PCR. The 179

transcript of ipt was detected in bacteroids of both engineered strains, but no transcript 180

was observed in the control bacteroids (Fig. 4A), indicating that the ipt gene carried 181

by the plasmid is transcribed in the bacteroids of alfalfa nodules. 182

To determine whether S. meliloti expressing an introduced ipt gene affects 183

nodulation and nitrogen fixation in alfalfa, nodulation kinetics and nitrogenase 184

activity were assessed. The number of nodules from four-week alfalfa induced by the 185

two engineered strains was a little lower than in controls (13.3 % and 12.5%) 186

(Fig. 4B). However, a few large nodules were observed on some alfalfa plants 187

inoculated with both engineered strains, and the average fresh weight of nodules per 188

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

10

plant induced by each strain was not significantly different (0.005±0.02, 0.0052±0.01 189

and 0.0049±0.01 g/plant). Therefore, there was no significant difference in the 190

nitrogen-fixing capacity of alfalfa nodules hosting the two rhizobium strains (Fig. 4C). 191

This indicated that the transcription of the introduced ipt gene in S. meliloti does not 192

affect the nitrogen-fixing capabilities of inoculated alfalfa plants. 193

Because drought stress induces premature senescence and suppresses nitrogen 194

fixation in leguminous nodules, it seemed likely that engineered strains might delay 195

this process (10). Alfalfa nodules hosting the control strain appeared pale pink or gray 196

after drought treatment and during rewatering, but those exposed to the engineered 197

strains were completely pink. The nitrogenase activity of alfalfa nodules elicited by 198

the control strain was also significantly lower after drought stress and even after 199

rewatering than in plants not subjected to drought (by about 50% and 90%, 200

respectively) (Fig. 4C). The nitrogenase activity was only a little lower (by about 10% 201

and 15%, respectively) in nodules containing LM201, but it was not decreased in 202

nodules containing LMG202 (Fig. 4C). This suggests that engineered S. meliloti 203

strains delay the premature senescence that can be induced in alfalfa nodules by 204

drought stress and maintain nitrogenase activity. 205

CK biosynthesis, accumulation of ROS, and expression of antioxidant genes in 206

alfalfa leaves 207

The drought tolerance of alfalfa plants inoculated with engineered strains 208

inspired us to assay the level of CK in alfalfa nodules and leaves. The zeatin levels 209

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

11

were found to be slightly increased (17.79% and 13.97%) in alfalfa leaves inoculated 210

with engineered strains, but no difference was observed in root nodules (Figs. 3A–B). 211

It has been reported that CK delays leaf senescence by upregulating the 212

expression of antioxidant genes, causing decomposition of the reactive oxygen species 213

(ROS) induced by drought stress (24). For this reason, the level of H2O2 in alfalfa 214

leaves subjected to drought stress was tested by DAB staining. Our results showed 215

that less H2O2 accumulated in leaves of alfalfa plants inoculated with the engineered 216

strains than in those of controls (Fig. 5A). The transcription of ROS-scavenging 217

enzymes was analyzed by RT-PCR. Consistently, the transcripts of SOD, CAT, sAPX, 218

thylAPX, DHAR, MDHAR, GR, and GPX were all higher in leaves of alfalfa plants 219

inoculated with LMG202 after 4 days of drought treatment than in the control strain 220

(Fig. 5B). These results suggested that the inoculation of the engineered S. meliloti 221

strain probably promoted decomposition of ROS by increasing the expression of 222

antioxidant enzymes. 223

Discussion 224

It has been reported that engineered rhizobia expressing foreign IAA biosynthetic 225

genes can cause host plants to form fewer, larger nodules and so improve their 226

tolerance to salt and low-phosphate stresses (3–6). However, there has not yet been 227

description of the effects of engineered cytokinin-producing rhizobia on the tolerance 228

of host plants to abiotic stresses. In this study, we described that engineered 229

Sinorhizobium strains synthesied more CK and improved host tolerance to severe 230

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

12

drought stress during the period analyzed. 231

The production of zeatins from Bradyrhizobium japonicum was first determined 232

four decades ago (22). Here, the wild-type S. meliloti was also found to synthesize 233

zeatins (Fig. 1C). These zeatins are probably derived from tRNA molecules, as 234

indicated by the fact that no gene homologous to ipt was found in the genomes of 235

symbiotic Rhizobium (25). 236

Cytokinin is required for the formation of leguminous nodules (18, 21, 25). The 237

slight decrease in the number of alfalfa nodules induced by engineered strains 238

(Fig. 4B) may be due to the modification of cytokinin/auxin balance (5, 23). It has 239

been reported that overproduction of IAA by Rhizobium can reduce the number of 240

Medicago nodules (6). And CRE1-dependent inhibition of PINs changes the polar 241

transportation of auxins (CRE1 is a sensor kinase of CK, and PINs are the transporters 242

of auxin. 12, 23, 28). 243

The lack of any significant difference in nitrogen fixation capacity and growth of 244

alfalfa plants during the period analyzed suggests that larger nodules fix nitrogen 245

more efficiently (Figs. 4C, 2A, 3C, 3D). The use of our engineered S. meliloti strains 246

might not affect the yield of alfalfa plants under the conditions tested. Longer term 247

studies must be performed to confirm this. 248

The high nitrogenase activity of alfalfa nodules hosting engineered strains under 249

severe drought conditions (Fig. 4C) could be attributed to the delay of leaf senescence. 250

By maintaining leaves, photosynthate may thus be provided to nodules. It is possible 251

that the synthesized zeatins are transported from nodules to leaves, which may 252

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

13

increase the level of this phytohomone in leaves. 253

The increase in zeatin content from plants inoculated with engineered strains was 254

determined by both immunological and chromatographic methods, which may play a 255

key role in alfalfa tolerance to severe drought stress by increasing the expression of 256

scavenging genes and fostering the decomposition of ROS (Fig. 5). These data are 257

consistent with those from a study of transgenic plants expressing an ipt gene (24). 258

The increased concentration of zeatins in alfalfa leaves could also be attributed to 259

synthesis by colonized engineered strains, considering that Chi et al. reported that S. 260

meliloti lives freely in the plant roots, stems, and leaves (7). 261

In summary, the engineered Sinorhizobium strain carrying different ipt constructs 262

secreted more CKs. They did not affect the ability of alfalfa nodules to fix nitrogen, 263

but they did improve host tolerance to severe drought stress during the period 264

analyzed. This engineered Rhizobium strain has shown potential for development as a 265

new biotechnological approach to improving the tolerance of host legumes to abiotic 266

stresses. 267

Acknowledgements 268

We would like to thank Dr. Sharon Long for providing the pTZS plasmid, Ms. 269

Haiying Xue for preparing the plant materials, and Dr. Yi-Ning Liu for Q-TOF 270

LC-MS analysis. This work was supported by the National Key Program for Basic 271

Research (2011CB100702 and 2010CB126501), Natural Science Foundation of China 272

(31070218), Natural Science Foundation of Shanghai (09ZR1436500), and 273

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

14

Knowledge Innovation Program of Shanghai Institutes for Biological Sciences, 274

Chinese Academy of Sciences (2009KIP206) to L.L. 275

276

References 277

1. Akiyoshi DE, Klee H, Amasino RM, Nester EW, Gordon PM. 1984. T-DNA of 278

Agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis. Proc. Natl. 279

Acad. Sci. U. S. A. 81: 5994–98. 280

2. Barry GF, Rogers SG, Fraley RT, Brand L. 1984. Identification of a cloned 281

cytokinin biosynthetic gene. Proc. Natl. Acad. Sci. U. S. A. 81: 4776–4780. 282

3. Bianco C, Defez R. 2009. Medicago truncatula improves salt tolerance when 283

nodulated by an indole-3-acetic acid-overproducing Sinorhizobium meliloti strain. J. 284

Exp. Bot. 60: 3097-107. 285

4. Bianco C, Defez R. 2010. Improvement of phosphate solubilization and Medicago 286

plant yield by an indole-3-acetic acid-overproducing strain of Sinorhizobium meliloti. 287

Appl. Environ. Microbiol. 76: 4626-4632. 288

5. Bianco C, Imperlini E, Defez R. 2009. Legumes like more IAA. Plant Signal 289

Behav. 4:763-5. 290

6. Camerini S, Senatore B, Lonardo E, Imperlini E, Bianco C, Moschetti G, 291

Rotino GL, Campion B, Defez R. 2008. Introduction of a novel pathway for IAA 292

biosynthesis to rhizobia alters vetch root nodule development. Arch Microbiol. 190: 293

67-77. 294

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

15

7. Chi F, Shen SH, Cheng HP, Jing YX, Yanni YG, Dazzo FB. 2005. Ascending 295

migration of endophytic rhizobia, from roots to leaves, inside rice plants and 296

assessment of benefits to rice growth physiology. Appl. Environ. Microbiol. 71: 297

7271-7278. 298

8. Cooper JB, Long SR. 1994. Morphogenetic rescue of Rhizobium meliloti 299

nodulation mutants by trans-zeatin secretion. Plant Cell. 6: 215-225. 300

9. Galibert F, Finan TM, Long SR, Puhler A, Abola P, Ampe F, Barloy-Hubler F, 301

Barnett MJ, Becker A, Boistard P, Bothe G, Boutry M, Bowser L, Buhrmester J, 302

Cadieu E, Capela D, Chain P, Cowie A, Davis RW, Dreano S, Federspiel NA, 303

Fisher RF, Gloux S, Godrie T, Goffeau A, Golding B, Gouzy J, Gurjal M, 304

Hernandez-Lucas I, Hong A, Huizar L, Hyman RW, Jones T, Kahn D, Kahn ML, 305

Kalman S, Keating DH, Kiss E, Komp C, Lelaure V, Masuy D, Palm C, Peck MC, 306

Pohl TM, Portetelle D, Purnelle B, Ramsperger U, Surzycki R, Thebault P, 307

Vandenbol M, Vorholter FJ, Weidner S, Wells DH, Wong K, Yeh KC, Batut 308

J.2001. The composite genome of the legume symbiont Sinorhizobium meliloti. 309

Science. 293: 668-672. 310

10. Goicoechea N, Merino S, Sánchez-Díaz M. 2005. Arbuscular mycorrhizal fungi 311

can contribute to maintain antioxidant and carbon metabolism in nodules of Anthyllis 312

cytisoides L. subjected to drought. J Plant Physiol. 162:27-35. 313

11. Goodner B, Hinkle G, Gattung S, Miller N, Blanchard M, Qurollo B, 314

Goldman BS, Cao Y, Askenazi M, Halling C, Mullin L, Houmiel K, Gordon J, 315

Vaudin M, Iartchouk O, Epp A, Liu F, Wollam C, Allinger M, Doughty D, Scott 316

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

16

C, Lappas C, Markelz B, Flanagan C, Crowell C, Gurson J, Lomo C, Sear C, 317

Strub G, Cielo C, Slater S. 2001. Genome sequence of the plant pathogen and 318

biotechnology agent Agrobacterium tumefaciens C58. Science. 294: 2323-2328. 319

12. Grunewald W, van Noorden G, van Isterdael G, Beeckman T, Gheysen G, 320

Mathesius U. 2009. Manipulation of auxin transport in plant roots during rhizobium 321

symbiosis and nematode parasitism. Plant Cell. 21:2553–62 322

13. Huynh LN, Van Toai T, Streeter J, Banowetz G. 2005. Regulation of flooding 323

tolerance of SAG12:ipt Arabidopsis plants by cytokinin. J. Exp.Bot. 56: 1397-1407. 324

14. Kamada-Nobusada T, Sakakibara H. 2009. Molecular basis for cytokinin 325

biosynthesis. Phytochemistry. 70: 444-449. 326

15. Khan SR, Gaines J, Roop 2nd RM, Farrand SK. 2008. Broad-host-range 327

expression vectors with tightly regulated promoters and their use to examine the 328

influence of TraR and TraM expression on Ti plasmid quorum sensing. Appl. Environ. 329

Microbiol. 74: 5053–5062. 330

16. Kudo T, Kiba T, Sakakibara H. 2010. Metabolism and long-distance 331

translocation of cytokinins. J. Integr. Plant Biol. 52: 53-60. 332

17. Leigh JA, Signer ER, Walker GC. 1985. Exopolysaccharide-deficient mutants 333

of Rhizobium meliloti that form ineffective nodules. Proc. Natl. Acad. Sci. U. S. A. 82: 334

6231–6235. 335

18. Luo L, Xu J, Li XL. 2010. Chinese Patent: a new approach improving plant 336

quality. 2010101330890 337

19. Ma QH. 2008. Genetic engineering of cytokinins and their application to 338

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

17

agriculture. Crit. Rev. Biotechno. 28: 213-32. 339

20. Murray JD, Karas BJ, Sato S, Tabata, S, Amyot, L, and Szczyglowski, K. 340

2007. A cytokinin perception mutant colonized by Rhizobium in the absence of nodule 341

organogenesis. Science. 315: 101–104. 342

21. Pan X, Welti R, Wang X. 2010. Quantitative analysis of major plant hormones in 343

crude plant extracts by high-performance liquid chromatography–mass spectrometry. 344

Nat. Protoc. 5: 986-992 345

22. Phillips DA, Torrey JG. 1972. Studies on cytokinin production by Rhizobium. 346

Plant Physiol. 49:11-15. 347

23. Plet J, Wasson A, Ariel F, Le Signor C, Baker D, Mathesius U, Crespi M, 348

Frugier F. 2011. MtCRE1-dependent cytokinin signaling integrates bacterial and 349

plant cues to coordinate symbiotic nodule organogenesis in Medicago truncatula. 350

Plant J. 65: 622-633. 351

24. Rivero RM, Kojima, M, Gepstein A, Sakakibara H, Mittler R, Gepstein S, 352

Blumwald E. 2007. Delayed leaf senescence induces extreme drought tolerance in a 353

flowering plant. Proc. Natl. Acad. Sci. U. S. A. 104: 19631–19636. 354

25. Sakakibara H. 2006. Cytokinins: activity, biosynthesis, and translocation. Annu. 355

Rev. Plant Biol. 57: 431-449. 356

26. Thordal-Christensen H, Zhang Z, Wei Y, Collinge DB. 1997. Subcellular 357

localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive 358

response during the barley-powdery mildew interaction. Plant J. 11: 1187-1194. 359

27. Tirichine L, Sandal N, Madsen LH, Radutoiu S, Albrektsen AS, Sato S, 360

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

18

Asamizu E, Tabata S, Stougaard J. 2007. A gain-of-function mutation in a 361

cytokinin receptor triggers spontaneous root nodule organogenesis. Science. 315: 362

104–107. 363

28. van Noorden GE, Ross JJ, Reid JB, Rolfe BG, Mathesius U. 2006. Defective 364

long-distance auxin transport regulation in the Medicago truncatula super numeric 365

nodules mutant. Plant Physiol. 140:1494–506. 366

29.Wang Y, Xu J, Chen A, Wang Y, Zhu J, Yu G, Xu L, Luo L. 2010. GGDEF and 367

EAL proteins play different roles in the control of Sinorhizobium meliloti growth, 368

motility, exopolysaccharide production, and competitive nodulation on host alfalfa. 369

Acta Biochim.Biophys. Sin. (Shanghai) 42:410-417. 370

30. Yao SY, Luo L, Har KJ, Becker A, Rüberg S, Yu GQ, Zhu JB, Cheng HP. 371

2004. Sinorhizobium meliloti ExoR and ExoS proteins regulate both succinoglycan 372

and flagellum production. J. Bacteriol. 186:6042-9. 373

31. Zhang J, Van Toai T, Huynh L, Preiszner J. 2000. Development of 374

flooding-tolerant Arabidopsis thaliana by autoregulated cytokinin production. 375

Molecular Breeding. 6: 135–144. 376

Table 1 Primers used in PCR 377

378

Gene Primer Sequence

iptc forward CGTCATATGTTACTCCATCTCATCTACGGACC

reverse TAGCTGCAGTCACCGAATTCGCGTCAGC

Actin forward TGGCATCACTCAGTACCTTTCAAG

reverse ACCCAAAGCATCAAATAATAAGTCAACC

SOD forward AATGTCACCGTCGGTGATGATG

reverse GTTCATCCTTGCAAACCAATAATACC

CAT forward CCTATTTGATGATGTGGGTGTCC

reverse GTCTTGAGTAGCATGGCTGTGGT

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

19

sAPX forward ACCAACCTCGTTCAGTGTCCAT

reverse AGAGCGCTGTCTGCGTTCTATT

thylAPX forward TCATCCTCTTTTGATTCGTTTGG

reverse CTTTGATTGGCTGGAGAAGTTTC

DHAR forward GATTGGAGACTGCCCTTTTAGC

reverse CTGTAGCCTTTTCAGGTGGTGT

MDHAR forward AGCGTTCGTTTACGTGATTCTTG

reverse CATTTGGGAGTTAGCCTTTCCTC

GR forward TTTGAACAAAGGTGCAGAAGAAGG

reverse TGGGAACACAACCACGAATGAC

GPX forward TGGACAGGAGCCAGGATCTAGT

reverse ATTTTCAGAGGAGCGGTGGTAG

iptrt forward TTCGGACGCCTTTCTCAC

reverse GCCGCCCTGCATCAATAT

rpsF forward CCTCGCTCGGCAGGACAT

reverse GCCTTGCGGTTCTTCTTGAT

iptc, primers used to clone the ipt open reading frame; iptrt, primers used for analysis 379

of the expression of ipt during RT-PCR. 380

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

20

381

Fig. 1 Effects of engineered S. meliloti strains on cytokinin production under 382

free-living conditions. A. Growth curve of S. meliloti strains in LB/MC medium. B. 383

Expression of ipt in free-living S. meliloti strains. C. Cytokinin content in cultures of 384

S. meliloti (OD600≈2.0). Data from three independent experiments. Control, S. meliloti 385

1021 carrying an empty plasmid. LMG201 and LMG202, S. meliloti 1021 expressing 386

constructs of Plac-ipt and Ptrp-ipt, respectively. T-testing was performed in C. Single 387

stars indicate significant differences (P<0.05); two stars indicate highly significant 388

differences (P<0.01). 389

390

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

21

391

Fig. 2 Tolerance of alfalfa plants to extreme drought stress after inoculation with 392

engineered S. meliloti strains. A. Alfalfa plants at 4-WAI not subjected to drought 393

stress treatment. B. Alfalfa plants at 4-WAI subjected to severe drought (absence of 394

watering) for 3–4 days. C. Alfalfa plants at 5-WAI were re-watered after 6 days of 395

drought treatment. 396

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

22

397

Fig. 3 Effects of engineered S. meliloti strains on alfalfa growth. A. Cytokinin content 398

in alfalfa leaves. B. Cytokinin content in alfalfa nodules. C. Fresh weight of alfalfa 399

shoots. D. Fresh weight of alfalfa roots. Data from three independent experiments, 400

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

23

mean±SD, n>20. T-testing was performed. Single stars indicate significant differences 401

(P<0.05) 402

403

404

Fig. 4 Effects of engineered S. meliloti strains on alfalfa nodulation and nitrogen 405

fixation. A. Expression of ipt in alfalfa nodules induced by Rhizobium. B. The number 406

of nodules at 4-WAI (weeks after inoculation) in alfalfa plants. C. Nitrogenase activity 407

of alfalfa nodules induced by S. meliloti strains. Data from three independent 408

experiments, the mean±SD, n>20. T-testing was performed in B and C. Single stars, 409

indicate significant differences (P<0.05); two stars indicate highly significant 410

differences (P<0.01). 411

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

24

412

413

Fig. 5 Levels of ROS were detected in alfalfa leaves after inoculation with engineered 414

S. meliloti strains. A. H2O2 accumulation in alfalfa leaves as detected by DAB staining. 415

B. Expression of ROS scavenging enzyme genes in leaves of alfalfa plants subjected 416

to 4 days of severe drought. Data from one representative experiment are shown. The 417

experiment was repeated at least three times. 418

419

420

421

422

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Table 1

Gene Primer Sequence

iptc forward CGTCATATGTTACTCCATCTCATCTACGGACC

reverse TAGCTGCAGTCACCGAATTCGCGTCAGC

Actin forward TGGCATCACTCAGTACCTTTCAAG

reverse ACCCAAAGCATCAAATAATAAGTCAACC

SOD forward AATGTCACCGTCGGTGATGATG

reverse GTTCATCCTTGCAAACCAATAATACC

CAT forward CCTATTTGATGATGTGGGTGTCC

reverse GTCTTGAGTAGCATGGCTGTGGT

sAPX forward ACCAACCTCGTTCAGTGTCCAT

reverse AGAGCGCTGTCTGCGTTCTATT

thylAPX forward TCATCCTCTTTTGATTCGTTTGG

reverse CTTTGATTGGCTGGAGAAGTTTC

DHAR forward GATTGGAGACTGCCCTTTTAGC

reverse CTGTAGCCTTTTCAGGTGGTGT

MDHAR forward AGCGTTCGTTTACGTGATTCTTG

reverse CATTTGGGAGTTAGCCTTTCCTC

GR forward TTTGAACAAAGGTGCAGAAGAAGG

reverse TGGGAACACAACCACGAATGAC

GPX forward TGGACAGGAGCCAGGATCTAGT

reverse ATTTTCAGAGGAGCGGTGGTAG

iptrt forward TTCGGACGCCTTTCTCAC

reverse GCCGCCCTGCATCAATAT

rpsF forward CCTCGCTCGGCAGGACAT

reverse GCCTTGCGGTTCTTCTTGAT

on April 26, 2020 by guest

http://aem.asm

.org/D

ownloaded from