Do Now: Tongue rolling (T) is dominant to not being able to roll (t). In a group of 20 people, 18 can roll their tongues, and 2 cannot. What % of people.

Population GeneticsDo Now:

Tongue rolling (T) is dominant to not being able to roll (t).

In a group of 20 people, 18 can roll their tongues, and 2 cannot.

What % of people have the tongue rolling phenotype?

What is the minimum % of all of the alleles in the population that are recessive (t)?

Phenotype frequency is the % of individuals in a population (group of organisms of the same species) that have a certain phenotype.

18/20 = 90%

Phenotype Frequency

A gene pool is the complete set of all alleles found in all individuals in a population

Gene Pool

OO

oo

Oo

OO

Oo

Gene Pool:6 O4 o

Allele frequency is a measurement of how common an allele is in a population.

P is typically used to represent the frequency of the dominant allele, and Q represents the recessive

PA = f(AA) + ½ f(Aa) Qa = f(aa) + ½ f(Aa)

By definition, P + Q = 1

Allele Frequency

In a population of 100 humans, 90 are homozygous dominant for albinism (non-albino)

8 are heterozygous 2 are homozygous recessive

P = f(AA) + ½ f(Aa) = .90 + ½ (.08) = .94 Q = f(aa) + ½ f(Aa) = .02 + ½ (.08) = .06

Check◦ P + Q = 1… .94 + .06 = 1

Allele Frequency Example

A genome is all of the genetic information of an individual.

A genome includes both genes AND non-gene information (“junk” DNA)

The human genome is 3.2 billion bases long.

ATGCTTATGCTGGCTAGCTGCGCTATCGAT…

Genome

“Everything is everywhere, the environment selects.”

We will be playing a game to simulate the effect of the environment on a population

Genome Wars

Locked in a desperate struggle for survival…

You are a Prokaryote

You will select 4 alleles to make up your genome. Each allele gives you a bonus in a specific environment…

Part 1: Make a genome

What does the gene pool look like?

Part 2: Determine Allele Frequencies

Extinctions, mutations, and environmental change… can your genome make it?

Part 3: Evolve!

What’s a genome?

Allele frequency?

Gene pool?

And what does the selecting in biology?

Review