DNA, RNA and Proteins Ms. Hughes
Feb 23, 2016
DNA, RNA and Proteins
Ms. Hughes
Mendel showed that traits are passed from parent to offspring.
Instructions for how genes are inherited. Genes are made up of segments of DNA:
Deoxyribonucleic acid. DNA is the primary material that causes
recognizable, inheritable characteristics in related groups of organisms.
DNA Genetic Material
DNA is composed of four nucleotide subunits:
◦ Each nucleotide has the same five carbon sugar molecule and phosphate group but different nitrogenous bases: Adenine Guanine Cytosine Thymine
Genetic Material
Winding stair case – 1 Parts of the nucleotide subunits – 2
1’s find another 1 and compare notes! 2’s find another 2 and compare notes!
Shape of DNA
If you are a 1 find a 2 If you are a 2 find a 1
Share your information but DO NOT COPY!!! You must explain it to your partner!!!
Pyrimidines: Thymine and Cytosine Purines: Adenine and Guanine
DNA is in the shape of a spiral stair case/ double helix of two complementary strands of nucleotides.
Information in DNA
A always binds with T G always binds with C
So A=T and G=C
Purine always binds to pyrimidine Watson, Franklin and Crick discovered 3D
model .
Base Pairing Rule
A = T G = C
Base pair rule
Chargaff’s observation
Read and summarize watson and cricks model of DNA.
K,W,L ◦ Knew◦ Would like to learn more about◦ Learned
Activity
Draw, label and explain a strand of DNA including the nucleotide subunits, base pairing and complimentarity of the strands.
Activity/homework
DNA replication: the process of making a copy of DNA.
In DNA replication, the DNA molecule unwinds, and the two sides split. Then new nucleotides are added to each side until two identical sequences result. DNA replication occurs before a cell divides so that each cell has a complete copy of DNA. The basic steps of DNA are:
DNA Replication
DNA replication McGraw Hill
http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120076/micro04.swf::DNA%20Replication%20Fork
Video
The double helix unwinds. Complementary strands of DNA separate
from each other and form Y shapes areas are called replication forks.
Unwinding and Separating DNA Strands
At the replication fork, new nucleotides are added to each side and new base pairs are formed according to the base pairing rules.
The original two strands serve as a template for two new strands.
Adding Complementary Bases
DNA replication produces two identical DNA molecules
Formation of Two Identical DNA Molecules
During the replication of DNA, many proteins form a machinelike complex of moving parts.
Replication Proteins
DNA helicases unwind the DNA double helix during DNA replication.
This process causes the helix to unwind and forms a replication fork.
DNA Helicase
Proteins called DNA polymerases catalyze the formation of the DNA molecule.
The polymerases add nucleotides that pair with each base to form two new double helixes.
DNA polymerases also have a “proofreading” function. During DNA replication, errors sometimes occur, and the wrong nucleotide is added to the new strand. DNA polymerase cannot add another nucleotide unless the previous nucleotide is correctly paired.
DNA Polymerase
In prokaryotic cells, replication starts at a single site. In eukaryotic cells, replication starts at many sites along the chromosome.
Prokaryotic and Eukaryotic
Prokaryotic cells usually have a single DNA molecule, or chromosomes. Prokaryotic chromosomes are a closed loop, may contain protein, and are attached to the inner cell membrane.
Prokaryotic DNA Replication
While prokaryotes have a single chromosome/loop, eukaryotic cells often have several chromosomes.
By starting DNA replication at many sites along the chromosome they can replicate their DNA faster than prokaryotes, two distinct replication forks form at each start site, and replication occurs in opposite directions.
Eukaryotic DNA Replication
Eukaryotic vs. Prokaryotic
Activity: DNA replication
Create a comic strip explaining DNA replication of a eukaryotic organism using all proteins and correct terminology.
Activity
Proteins perform most of the functions of cells. DNA provides the original “recipe”.
RNA: ribonucleic acid allows genetic information to be taken from DNA and proteins be made.
Gene expression: the manifestation of genes into specific traits.
RNA and Gene Replication
The first stage of gene expression. RNA is making proteins from the information
found in DNA.
Transcription: DNA to RNA
Second stage of gene expression. Information form RNA is used to make
specific proteins.
Translation: RNA to Proteins
In cells three types of RNA complement DNA and translate the genetic code into proteins.
RNA vs. DNA◦ Both have four bases and carry genetic
information.◦ RNA is composed of one strand of nucleotides and
DNA is composed of two strands of nucleotides.◦ RNA substitutes Uracil for Thymine.
RNA: Major Player
1 – messenger RNA 2 – transfer RNA 3 – ribosomal RNA
1 share with other 1’s Then 1, 2, 3
1, 2, 3
Messenger RNA: carries instructions for a gene to the site of translation.
Transfer RNA: reads the messenger mRNA sequence.
Ribosomal RNA: found in ribosomes, transports proteins from the ER as they are produced.
Types of RNA
During transcription , the information in a specific region of DNA is transcribed, or copied into RNA.
Step 1: RNA polymerase binds to the promoter ( a specific DNA sequence/start location).
Step 2: RNA polymerase unwinds the dbl helix to expose both paired nucleotide bases.
Step 3: RNA polymerase links and binds complementary base units to each strand of DNA.
The result once the stop codon is reached is one strand of mRNA is produced.
Transcription: Reading the Gene
Both use DNA as a template. Transcription – mRNA is made, using
portions of each strand of DNA Translation – DNA is made, using both entire
strands of DNA.
Transcription vs. Replication
Transcribe and then translate this sequence:
A T C G G C G G G A T T T A T T C C C G
Transcribe and then translate this sequence:
ATCGGCGGGATTTATTCCCG
Create a comic strip for the steps of transcription and translation of a eukaryotic organism.
Homework
Each 3 nucleotide sequence is called a codon.
Each codon unit codes for a specific amino acid.
Turn to page 307 and look at the amino acids that are possible there are 20.
Genetic Code: 3 letter “words”
Translation occurs in a sequence of steps, involves three kinds of RNA and results in a complete polypeptide.
Translation: RNA to proteins
The relationship of gene expression is complex.
Despite the neatness of the genetic code, every gene cannot be simply linked to a single outcome.
Complexities of Gene Expression
Transcribe and then translate this sequence:
ATC GGC GGG ATT TAT TCC CG
Now use the codon chart to determine which amino acids this codes for.