-
DEVELO
PMENT
3411RESEARCH ARTICLE
INTRODUCTIONPrimordial germ cells (PGCs) are the founding
population of cells thatwill ultimately give rise to the mature
gametes. Unlike organisms thathave a mosaically determined
germline, PGCs in the mouse embryoare specified by an inductive
mechanism that requires the presence ofseveral bone morphogenetic
proteins (BMPs) emanating from thesurrounding somatic cells
(Fujiwara et al., 2001; Lawson et al., 1999;Ying et al., 2000; Ying
and Zhao, 2001). PGCs can first be detected inthe extra-embryonic
mesoderm at 7.25 days post-coitus (dpc)(Ginsburg et al., 1990). By
8.5 dpc, PGCs enter the embryo proper andactively migrate through
the hindgut endoderm, colonizing thedeveloping gonads between 10.5
and 11.5 dpc. During this time,PGCs proliferate from an initial
population of 45 cells at 7.5 dpc to25,000 cells at 13.5 dpc when
proliferation ceases (Tam and Snow,1981). Sexual differentiation of
the germline begins at 13.5 dpc withfemale germ cells entering
prophase I of meiosis. Within the malegonad, a signal thought to
originate from the testis cords prevents entryinto meiosis and male
PGCs enter a mitotic arrest by 14.5 dpc(McLaren, 1983). Prior to
these changes, male and female PGCs aresexually indifferent,
capable of following either the male or femalepathway (McLaren and
Southee, 1997).
Shortly after PGCs enter the urogenital ridges, both male
andfemale germ cells undergo a common set of changes independentof
sexual differentiation. Changes in cell morphology and cell-
adhesion properties occur as the germ cells transition to a
non-migratory state (De Felici et al., 1992; Donovan et al.,
1986;Garcia-Castro et al., 1997). Male and female PGCs also
ceaseproliferating, have decreased potential to form pluripotent
stemcell lines (Matsui et al., 1992; McLaren, 1984; Resnick et
al.,1992), and undergo a wave of apoptosis (Coucouvanis et al.,
1993;Wang et al., 1998). These differentiation events are
accompaniedby changes in gene expression as some germ cell marker
genes,such as Tnap (Akp2 – Mouse Genome Informatics) and Zfp148,
aredownregulated (Donovan et al., 1986; Hahnel et al.,
1990;Takeuchi et al., 2003). Other genes, including Mvh (Ddx4 –
MouseGenome Informatics), Scp3 (Sycp3 – Mouse Genome
Informatics),Dazl, Mageb4 and Gcna1 are upregulated during this
time (Cookeet al., 1996; Di Carlo et al., 2000; Fujiwara et al.,
1994; Osterlundet al., 2000).
In addition to the differentiation events mentioned above,
PGCsmediate two essential epigenetic processes. First, female
PGCsreactivate their silenced X chromosome, thereby ensuring that
eachoocyte carries an active X chromosome (Monk and McLaren,
1981;Tam et al., 1994). Interestingly, the ability to reactivate
the inactiveX chromosome is not confined to female germ cells, as
XXY malegerm cells also possess this reactivation capability (Mroz
et al.,1999). Second, migratory germ cells carry
parent-of-origin-specificimprinting marks and high levels of
allele-specific methylation thatcontribute to monoallelic
expression in migratory PGCs. Thesedifferentially methylated
regions become hypomethylated as PGCscolonize the gonads, leading
to a loss of imprinting and biallelicgene expression (Hajkova et
al., 2002; Lee et al., 2002; Szabo et al.,2002). However, this wave
of demethylation is not restricted toimprinted loci and genes of
the X chromosome, as several non-imprinted genes and repetitive
sequences also show decreasedmethylation at this time (Hajkova et
al., 2002; Lane et al., 2003;Lees-Murdock et al., 2003).
DNA methylation is a primary mechanism for
silencingpostmigratory primordial germ cell genes in both germ
celland somatic cell lineagesDanielle M. Maatouk1, Lori D. Kellam1,
Mellissa R. W. Mann2, Hong Lei3, En Li3, Marisa S. Bartolomei2
andJames L. Resnick1,*
DNA methylation is necessary for the silencing of endogenous
retrotransposons and the maintenance of monoallelic geneexpression
at imprinted loci and on the X chromosome. Dynamic changes in DNA
methylation occur during the initial stages ofprimordial germ cell
development; however, all consequences of this epigenetic
reprogramming are not understood. DNAdemethylation in postmigratory
primordial germ cells coincides with erasure of genomic imprints
and reactivation of the inactive Xchromosome, as well as ongoing
germ cell differentiation events. To investigate a possible role
for DNA methylation changes ingerm cell differentiation, we have
studied several marker genes that initiate expression at this time.
Here, we show that thepostmigratory germ cell-specific genes Mvh,
Dazl and Scp3 are demethylated in germ cells, but not in somatic
cells. Premature lossof genomic methylation in Dnmt1 mutant embryos
leads to early expression of these genes as well as GCNA1, a widely
used germcell marker. In addition, GCNA1 is ectopically expressed
by somatic cells in Dnmt1 mutants. These results provide in vivo
evidencethat postmigratory germ cell-specific genes are silenced by
DNA methylation in both premigratory germ cells and somatic cells.
Thisis the first example of ectopic gene activation in Dnmt1 mutant
mice and suggests that dynamic changes in DNA methylationregulate
tissue-specific gene expression of a set of primordial germ
cell-specific genes.
Key words: Mouse, Primordial germ cells
Development 133, 3411-3418 (2006) doi:10.1242/dev.02500
1Department of Molecular Genetics and Microbiology, PO Box
100266, University ofFlorida, Gainesville, FL 32610-0266, USA.
2Howard Hughes Medical Institute andDepartment of Cell and
Developmental Biology, University of Pennsylvania School
ofMedicine, Philadelphia, PA 19104, USA. 3Epigenetics Program,
Models of DiseaseCenter, Novartis Institute for Biomedical
Research, 250 Massachusetts Avenue,Cambridge, MA 02139, USA.
*Author for correspondence (e-mail: [email protected])
Accepted 19 June 2006
-
DEVELO
PMENT
3412
We have been investigating regulatory mechanisms
underlyingpostmigratory germ cell differentiation. Several studies
suggest thatcontinuing PGC development is regulated by a cell
intrinsic programrather than by inductive signals from the gonads.
PGCs located inectopic locations enter meiosis and initiate
expression of thepostmigratory marker GCNA1 on schedule without
exposure to theurogenital ridges (Wang et al., 1997). Embryonic
stem cells havebeen shown to differentiate to form PGC-like cells
that can go on toform cells resembling both oocytes and
spermatocytes, furtherdemonstrating that PGC differentiation can
occur independently ofthe gonadal environment (Geijsen et al.,
2004; Hubner et al., 2003;Toyooka et al., 2003). Last, cessation of
germ cell proliferation hasalso been suggested to be cell intrinsic
(Ohkubo et al., 1996).
We previously tested the potential of premigratory germ cells
todifferentiate in culture and reported that 8.5 dpc premigratory
PGCsin feeder culture can differentiate to express GCNA1 on the
correcttemporal schedule (Richards et al., 1999). Surprisingly, the
rate ofdifferentiation in culture increased when PGCs were exposed
to theDNA demethylating agent 5-azacytidine or the histone
deacetylaseinhibitor trichostatin A (Maatouk and Resnick, 2003).
This suggeststhat epigenetic mechanisms may contribute to the
regulation of germcell differentiation.
Here, we further investigate the role of DNA methylation in
theprocess of PGC differentiation. We present evidence that
severalpostmigratory germ cell-specific genes are demethylated in
germcells as they colonize the genital ridges and that DNA
demethylationcontrols the temporal expression of these genes in
vivo. In addition,we show that these postmigratory germ
cell-specific genes areectopically expressed in DNA
methyltransferase mutant embryos,suggesting that DNA methylation is
a mechanism of silencing germcell-specific genes in somatic
tissues. These results provide the firstin vivo evidence of
tissue-specific embryonic gene regulationmediated by dynamic
changes in DNA methylation.
MATERIALS AND METHODSMouse strainsPrimordial germ cells were
purified from embryos obtained from timedmatings of B6C3F1 mice
(Jackson Laboratories, Bar Harbor, ME). Noon ofthe day on which a
mating plug was first visible was taken to be 0.5 dpc. For
RNA analysis, mice carrying either the Dnmt1n (Li et al., 1992)
or Dnmt1c
allele (Lei et al., 1996) were maintained on the B6(CAST7)
mixedbackground (Mann et al., 2003). Dnmt1c embryos used for
immunostainingwere also maintained on a mixed background (129/SvJae
� C57BL/6).
Primordial germ cell isolation and purificationGonads were
collected from 10.5 dpc and 13.5 dpc embryos. At 13.5 dpc,embryos
were sex segregated based on the presence of testis cords in
themale gonad. PGCs were immunomagnetically purified using the
TG-1antibody as described (Pesce and De Felici, 1995). Purified
fractions weregreater than 85% (10.5 dpc) and 90% (13.5 dpc) germ
cells, as judged byalkaline phosphatase staining. Immunodepleted
fractions contained less than1% PGCs and primarily contained
somatic cells from the gonad andmesonephros.
Bisulfite conversion and DNA sequencingGenomic DNA isolated from
both purified and immunodepleted fractionswas subjected to
bisulfite conversion as described (Clark et al., 1994).Bisulfite
primers were designed against the converted DNA sequences andare
listed in Table 1. PCR amplification was performed on 10% of
onepurification (approximately one embryo equivalent) with HotStar
Taq(Qiagen) using the following cycling conditions: 95°C for 15
minutesfollowed by 35 cycles of 95°C for 45 seconds, 53°C for 30
seconds and 72°Cfor 1.5 minutes. Bisulfite PCR amplifications were
performed on twoindependent germ cell purifications to avoid
inconsistencies that might arisefrom conducting PCR on small
amounts of DNA. PCR products were gelpurified using Wizard DNA
Clean-up System (Promega) and cloned usingthe pGEM-T Easy Vector
System (Promega). Plasmid sequencing wascarried out using ABI Prism
BigDye terminator (PerkinElmer) by the Centerfor Mammalian Genetics
DNA Sequence Core.
RNA analysisRNA was isolated from 9.5 dpc embryos using the
HighPure RNA TissueKit (Roche Molecular Biochemicals) with minor
modifications of themanufacturer’s recommendations. Random-primed
cDNA was preparedwith Superscript II as recommended (Invitrogen).
For RT-PCR, forward andreverse primers were located in separate
exons to exclude any bands thatmight arise from genomic DNA
contamination. Primer sequences are listedin Table 1. RT-PCR was
performed using Triplemaster Taq (Eppendorf) andPCR products were
run on 2% agarose gels, Southern blotted andhybridized with
�-[32PO4]-dCTP labeled probes. Probe fragments weregenerated by gel
purification of the RT-PCR products obtained from testiscDNA.
RESEARCH ARTICLE Development 133 (17)
Table 1. PCR primers used in this studyPrimer name Primer
sequence (5�-3�) Region analyzed
Mvh-F TTTGGCTCATATGATGCGGG 210 bpMvh-R
ACACCCTTGTACTATCTGTCGAACTGAATGACC
Mage-b4-F ACGCGAGGTATCTCGGGC 180 bpMage-b4-R
GGGCGTAAGTTGGCAACC
Dazl-F TTCTGCTCCACCTTCGAGGTT 335 bpDazl-R
CTATCTTCTGCACATCCCAGTCATTA
Scp3-F CCAATCAGCAGAGAGCTTGG 450 bpScp3-R
AGCTGTCGCTGTCCCCACAC
Hprt-F GCTGGTGAAAAGGACCTCT 250 bpHprt-R CACAGGACTAGAACACCTGC
B-Daz-F GGAAGAAAAAAACTAAGTCCTGATGGC 360 bp (–540 to –180)B-Daz-R
AAACCCCCCCAATCCCTCAC
B-Mvh-F TGAATGAATATAATGGAATTGATGAGTT 248 bp (–378 to –77)B-Mvh-R
AAAACAACAAATAACATCAAA
B-Scp3-F GAATGAGGATTTATGAGTAAAGATGGTT 381 bp (–241 to
+141)B-Scp3-R CCCCCATCTCCTTAACCTCAA
B-Tnap-F GGAAGAAAAAAACTAAGTCCTGATGGC 128 bp (–213 to
–85)B-Tnap-B AAACCCCCCCAATCCCTCAC
-
DEVELO
PMENT
Immunochemical methodsEmbryos were collected at 8.5 and 9.5 dpc
and fixed overnight inmethanol:dimethyl sulfoxide (4:1) at 4°C.
Endogenous peroxidase activitywas inactivated by a 2-hour
incubation in methanol:dimethyl sulfoxide: 30%hydrogen peroxide
(4:1:1) at room temperature. Embryos were stored in100% methanol at
–20°C.
Antibody to GCNA1 was generously provided by George Enders.
ForGCNA1 staining of paraffin sections, fixed embryos were
dehydratedthrough an ethanol series, cleared in Citrisolv (Fisher)
and embedded inparaffin. Cross-sections were cut at 7 �m.
Immunostaining for GCNA1 inparaffin sections was performed using
the 10D9G11 monoclonal antibodyas previously described (Richards et
al., 1999). Whole-mount embryos wereimmunostained using the same
procedure with several adjustments.Blocking was performed in PBSMT
(PBS, 2% w:v nonfat dry milk, 0.1%Triton X-100) and a horseradish
peroxidase (HRP)-conjugated mouse anti-rat IgM (Zymed) secondary
antibody was used. Color development wasperformed using the Liquid
DAB (3,3�-diaminobenzidine) Substrate Kitfollowing the
manufacturer’s instructions (Zymed). Paraffin sections werestained
for SSEA1 immediately after GCNA1 staining as previouslydescribed
(Richards et al., 1999).
RESULTSPostmigratory germ cell-specific genes aredemethylated as
PGCs colonize the urogenitalridgesWe have previously shown that
initial expression of thepostmigratory germ cell marker GCNA1 is
controlled by a cell-intrinsic timing mechanism. PGCs removed from
8.5 dpc embryosand plated in feeder culture initiate GCNA1
expression after a 2- to3-day delay, consistent with their in vivo
temporal expression pattern(Richards et al., 1999). Furthermore, we
found that the DNAdemethylating agent 5-azacytidine accelerates the
rate and extent ofgerm cell differentiation in culture (Maatouk and
Resnick, 2003).Because the expression of GCNA1 in cultured PGCs is
sensitive tochanges in DNA methylation, we explored whether
induction ofother postmigratory germ cell genes could be regulated
by ademethylation event. As the gene encoding GCNA1 remainsunknown,
we investigated the methylation status of several
postmigratory germ cell-specific genes that share a
similarexpression pattern with GCNA1. Mvh, Scp3 and Dazl
areexclusively expressed by both male and female germ cells as
theyenter the urogenital ridges between 10.5-11.5 dpc (Cooke et
al.,1996; Di Carlo et al., 2000; Fujiwara et al., 1994). Fig. 1
shows thatthe first exon of each of these genes is contained within
a CpGisland.
To examine the methylation status of these postmigratory
germcell genes, genomic DNA obtained from
immunomagneticallypurified 10.5 and 13.5 dpc PGCs was subjected to
bisulfite sequenceconversion. Approximately 20 CpG residues were
analyzed for thepresence of methylation. For each gene, 10.5 dpc
PGCs showed highlevels of methylation, but by 13.5 dpc all three
genes showed asignificant loss of methylation with most clones
being completelyunmethylated (Fig. 2). No significant differences
in methylationwere observed between male and female PGCs,
consistent with theidea that PGCs are indifferent prior to 12.5
dpc. These resultssuggest that DNA demethylation of the germline
between 10.5 and12.5 dpc functions not only to reprogram imprinted
loci andreactivate the X chromosome, but may contribute to
additionalpostmigratory differentiation events.
Although most clones isolated from the PGC fraction
weresignificantly hypomethylated at 13.5 dpc, some clones retained
highlevels of methylation. Some of these clones may be explained by
thepresence of contaminating somatic cells in the purified germ
cellpreparations, as cells of the immunodepleted fraction
remainedhighly methylated at 13.5 dpc (Fig. 2). However, because
13.5 dpcPGC preparations are routinely more than 90% pure, we favor
theexplanation that some PGC genomes have not
undergonedemethylation by 13.5 dpc. Consistent with this
interpretation, somegerm cells initiate GCNA1 expression by 11.5
dpc, but many germcells do not express the marker until 14.5 dpc
(Enders and May,1994).
Fig. 2 demonstrates that the germ cell-specific genes Mvh,
Dazland Scp3 exhibit loss of methylation as they first become
expressed.In contrast to this pattern of expression, several genes
are negativelyregulated in PGCs as they differentiate into
gonocytes. Tnap isexpressed as germ cells are initially allocated
in the extra-embryonicmesoderm at 7.25 dpc, but expression is lost
between 13.5 and 14.5dpc (Donovan et al., 1986; Ginsburg et al.,
1990). We examined theTnap locus to explore any potential role of
dynamic DNAmethylation changes on a gene that is negatively
regulated ingonocytes. Bisulfite analysis of eight CpG
dinucleotides upstreamof exon 1 shows that this region of Tnap is
unmethylated at 10.5,13.5 and 14.5 dpc in both germ cells and
somatic cells. This resultis consistent with the notion that DNA
demethylation occurs ingenes that are positively regulated as germ
cells transition intogonocytes, rather than a characteristic of all
genes expressed in germcells.
Expression of GCNA1 is sensitive to DNAmethylation in primordial
germ cellsPrimordial germ cells in culture express the
postmigratory germ cellmarker GCNA1 on an accelerated schedule when
exposed to theDNA demethylating agent 5-azacytidine (Maatouk and
Resnick,2003). Although many genes respond to this agent in
culture, Walshand Bestor (Walsh and Bestor, 1999) found that few
genes aresubject to dynamic DNA methylation changes in vivo. To
determinewhether GCNA1 expression is regulated by DNA methylation
invivo, we next tested whether GCNA1 is prematurely expressed
byPGCs in DNA methyltransferase 1 (Dnmt1) mutant embryos.Dnmt1
maintains methylation patterns during DNA replication and
3413RESEARCH ARTICLEDNA methylation silences gonocyte genes
Fig. 1. CpG island location in several germ cell-specific genes.
Thegenomic structures from –2 kb to +2 kb relative to the
transcriptionstart site are depicted for Dazl, Mvh, Scp3 and Tnap.
For each gene,exon 1 (exon 1a for Tnap) is surrounded by a CpG
island defined aspreviously described (Gardiner-Garden and Frommer,
1987). Blackboxes represent exons, gray bars represent CpG islands.
The regionsamplified for bisulfite analysis are indicated by black
bars below eachCpG island.
ATG
ATG
ATG
Dazl
Mvh
Scp3
Tnap
1 kb
-
DEVELO
PMENT
3414
the null Dnmt1c mutation results in a 98% loss of
genomicmethylation (Lei et al., 1996). Dnmt1c/c mutant embryos were
cross-sectioned and immunostained for the PGC marker SSEA1 and
forthe postmigratory germ cell marker GCNA1. GCNA1 is normallynot
detectable prior to 10.5 dpc (Enders and May, 1994). In 8.5
dpcDnmt1c/c embryos, PGCs located in the yolk sac
endodermsimultaneously expressed GCNA1 and SSEA1, with GCNA1
beingdetected 2-3 days earlier than expected (Fig. 4B). PGCs in
theposterior region of 9.5 dpc embryos also prematurely
expressedGCNA1 (Fig. 4C). These results indicate that in vivo
expression ofGCNA1 is temporally controlled by DNA methylation.
DNA methylation is a primary silencingmechanism for the
postmigratory germ cellmarker GCNA1 in somatic cellsIn addition to
demonstrating that DNA methylation regulatesGCNA1 expression in
germ cells, Fig. 4 suggested that somesomatic cells also express
this germ cell-specific marker when DNAmethylation is reduced by
mutation of Dnmt1. To further investigatethe expression pattern of
GCNA1 in Dnmt1 embryos, 9.5 dpc
Dnmt1n/n embryos were subjected to whole-mount
immunostaining.This hypomorphic mutation leads to a 70% reduction
in DNAmethylation, compared with the 98% reduction observed in
Dnmt1c/c
embryos (Lei et al., 1996). Surprisingly, not only was
GCNA1prematurely expressed in PGCs, but ectopic expression
wasobserved in somatic cells scattered throughout the entire
embryo(Fig. 5C,D). Because these cells do not express the PGC
markersSSEA1 (Fig. 4) or OCT4 (Hattori et al., 2004), we suggest
that theyare not PGCs that have migrated to aberrant locations.
As only a small number of cells ectopically expressed GCNA1,
itseemed likely that the low levels of functional Dnmt1
enzymepresent in the hypomorphic Dnmt1n/n mutants might
attenuatepromiscuous gene activation. To test this idea
GCNA1immunostaining was also performed on 9.5 dpc Dnmt1c/c
embryos.The more severe mutation consistently caused much higher
levels ofectopic expression than observed in the Dnmt1n/n embryos
(Fig.5F,G). As expected, wild-type and heterozygous embryos at
thesestages exhibited no GCNA1 expression (Fig. 5A,E).
Developmentof Dnmt1-deficient mutants is frequently retarded such
that 9.5 dpcDnmt1c/c embryos more closely resemble wild-type 8.5
dpc
RESEARCH ARTICLE Development 133 (17)
A. Mvh
B. Scp3
C. Dazl
10.5 dpc germ cells
10.5 dpc somatic cells
13.5 dpc female germ cells 13.5 dpc male germ cells
13.5 dpc female somatic cells 13.5 dpc male somatic cells
10.5 dpc somatic cells
10.5 dpc germ cells
10.5 dpc germ cells
10.5 dpc somatic cells
13.5 dpc female germ cells
13.5 dpc female germ cells
13.5 dpc female somatic cells
13.5 dpc female somatic cells
13.5 dpc male germ cells
13.5 dpc male germ cells
13.5 dpc male somatic cells
13.5 dpc male somatic cells
Fig. 2. DNA methylation analysis ofpostmigratory germ
cell-specificgenes. (A-C) Bisulfite sequence analysisof (A) Mvh,
(B) Scp3 and (C) Dazl wasperformed on immunomagneticallypurified
germ cell and depleted somaticcell fractions from 10.5 and 13.5
dpcembryos. Each line represents anindividually sequenced clone and
circlesrepresent CpG residues. White circlesindicate unmethylated
CpG sites; blackcircles represent methylated CpG sites.
-
DEVELO
PMENT
embryos. Fig. 5H demonstrates that GCNA1 expression is
notreadily detected in a more closely stage-matched 8.5 dpc
Dnmt1+/c
embryo. Together, these results indicate that the postmigratory
germcell marker GCNA1 is ectopically expressed both temporally
andspatially in embryos lacking a functional Dnmt1 enzyme.
Premature expression of postmigratoryprimordial germ cell genes
in Dnmt1 mutantembryosSeveral postmigratory germ cell-specific
genes are demethylated asthe germ cells colonize the developing
gonads (Fig. 2). Additionally,GCNA1 is ectopically expressed under
conditions of reducedmethylation. To determine if additional
postmigratory germ cell-specific genes are prematurely expressed in
Dnmt1 mutant embryos,RT-PCR analysis was performed to examine the
expression profilesof Mvh, Scp3, Dazl and another PGC-specific gene
that shares asimilar expression pattern, Mageb4 (Osterlund et al.,
2000) (Fig. 6).As these genes are expressed only after PGCs enter
the developinggonads, little or no expression was detected in
wild-type andheterozygous 9.5 dpc embryos, as expected. However,
embryoshomozygous for either the Dnmt1n or Dnmt1c mutation
precociously
expressed each of the germ cell genes analyzed. In
addition,expression seemed to be greater in the more severe Dnmt1c
mutant.These results support the notion that postmigratory PGC
geneexpression is dependent upon the genome-wide demethylation
eventthat occurs during colonization of the gonads.
DISCUSSIONDNA methylation regulates germ cell-specificgene
expressionRecent results from several laboratories demonstrate that
between10.5 and 12.5 dpc the germ cell genome undergoes a wave
ofgenomic demethylation that affects genes on the inactive
Xchromosome, imprinted loci and some repetitive elements (Hajkovaet
al., 2002; Lane et al., 2003; Lee et al., 2002; Lees-Murdock et
al.,2003). Although most CpG islands are unmethylated regardless
oftissue or expression status (Ioshikhes and Zhang, 2000; Rollins
etal., 2006), we found that several germ cell-specific genes are
highlymethylated at 10.5 dpc and are included in this wave of germ
celldemethylation as they are first expressed (Fig. 2). These
genesremain methylated and silent in somatic cells. Loss of
methylation,as observed in Dnmt1 mutants, correlates with their
premature
3415RESEARCH ARTICLEDNA methylation silences gonocyte genes
11
16
34
19
23
26
7
20
13
9
8
10.5 dpc germ cells 10.5 dpc somatic cells
13.5 dpc female germ cells 13.5 dpc female somatic cells
13.5 dpc male germ cells 13.5 dpc male somatic cells
14.5 dpc female germ cells 14.5 dpc female somatic cells
14.5 dpc male germ cells 14.5 dpc male somatic cells
Fig. 3. DNA methylation analysis of Tnap. Bisulfitesequence
analysis of Tnap was performed onimmunomagnetically purified germ
cell and somaticcell fractions from 10.5, 13.5 and 14.5 dpc
embryos.Each line represents an individually sequenced
clone.Numbers indicate the frequency of each observedclone. White
circles indicate unmethylated CpG sites;black circles indicate
methylated CpG sites.
Fig. 4. The postmigratory germ cell marker GCNA1 is precociously
expressed in premigratory germ cells in Dnmt1-deficient
embryos.Embryos were immunostained for SSEA1 with TG-1 (red) and
for GCNA1 (black). (A) TG-1 and GCNA1 immunohistochemistry of a
12.5 dpcembryo, demonstrating that both markers specifically
recognize germ cells. The inset shows that GCNA1 reactivity at this
time is normally restrictedto the TG-1-positive population. Arrow
and arrowhead indicate GCNA1-expressing and non-expressing germ
cells, respectively. (B) 8.5 dpcDnmt1c/c yolk sac with a TG-1 and
GCNA1-expressing cell. The inset shows a higher magnification view
of the doubly stained cell. (C) NumerousTG-1- and GCNA1-positive
cells in a 9.5 dpc Dnmt1c/c embryo.
-
DEVELO
PMENT
3416
expression in germ cells and ectopic expression in somatic
cells.Together, these results strongly suggest that the naturally
occurringdemethylation of these genes in germ cells is rate
limiting for theirexpression, and that DNA methylation is necessary
to maintainsilencing of these genes in somatic cells.
The rapid rate of demethylation and the presence of nuclearDnmt1
protein led Hajkova et al. to propose that germ celldemethylation
results from an active mechanism, rather than thepassive process of
replication without further methylation (Hajkovaet al., 2002). Our
results are consistent with this proposal as weobserved individual
PGC genomes having intermediate levels ofmethylation, probably
representing PGCs in the process of beingactively demethylated
(Fig. 2). Precocious expression of germ cell-specific genes,
presumably owing to passive demethylation inDnmt1 mutants, suggests
that the hypomethylated state is sufficientfor transcription and
does not require the process of activedemethylation.
Several reports confirm a role for DNA methylation in
generegulation in vivo. Monoallelically expressed genes,
includingimprinted genes and X chromosome genes become
biallelically
expressed, and IAP elements are transcribed in Dnmt1
mutants(Caspary et al., 1998; Li et al., 1993; Sado et al., 2000;
Walsh et al.,1998). Bdnf expression is increased in neurons of mice
bearing aconditionally deleted Dnmt1 gene (Martinowich et al.,
2003).Although numerous genes are ectopically expressed in
Dnmt1-deficient cells in culture, we are aware of only one previous
reportof ectopic gene expression of a single copy gene in Dnmt1
mutantembryos. OCT4, a transcription factor present in premeiotic
germcells, was found to be ectopically expressed in placentas of
Dnmt1mutant embryos (Hattori et al., 2004). Here, we report
extensiveectopic expression of germ line-specific genes resulting
from loss ofDNA methylation.
Expression of postmigratory germ cell genes isattenuated in
DNA-deficient mutantsIf DNA methylation is necessary to silence
germ cell genes insomatic cells, why are only some cells positive
for GCNA1 in theDnmt1-deficient embryos? Although Dnmt1c/c embryos
lackdetectable Dnmt1 activity, Dnmt1n/n embryos produce low levels
offunctional Dnmt1 enzyme and retain about 30% of
genomicmethylation (Lei et al., 1996). The experiments reported
here werenot performed under directly comparable conditions;
however, Mvh,Dazl, Scp3 and Mageb4 all show greater expression in
the Dnmt1c/c
compared with the Dnmt1n/n mutants relative to the Hprt
control(Fig. 6). This was also observed for the expression of GCNA1
inDnmt1n/n compared with Dnmt1c/c embryos (Fig. 5).
Repressivechromatin structure or compensation by de novo
DNAmethyltransferases may maintain silencing in non-expressing
cells.Alternatively, DNA demethylation in mutant embryos, which
occursby a passive replication-dependent mechanism, may occur
moreslowly in some cells as loss of Dnmt1 may decrease the rate of
cellproliferation (Jackson-Grusby et al., 2001; Milutinovic et al.,
2003).Slower cell cycles could lengthen the time it takes to
passivelydemethylate, causing delayed gene activation. This may
account forthe large number of cells observed in the Dnmt1c/c
mutant that do notinitiate GCNA1 expression.
How could DNA methylation silence germ cell-specific genes
inboth germ and somatic lineages? Several mechanisms,
includingrestricted expression of positive acting transcription
factors, stericinterference with transcription factor binding
sites, attraction ofmethyl DNA binding proteins and DNA methylation
induced
RESEARCH ARTICLE Development 133 (17)
Fig. 5. The postmigratory germ cell marker GCNA1 isectopically
expressed in somatic cells of Dnmt1-deficient embryos. All embryos
were immunostained forGCNA1 expression. (A) 9.5 dpc Dnmt1+/n
embryo.(B) Enlarged view of the same embryo. (C) 9.5 dpcDnmt1n/n
embryo (n=4/4). (D) Enlarged view of embryo inC, demonstrating
scattered GCNA1 expression throughoutthe embryo. (E) 9.5 dpc
Dnmt1+/c embryo. (F) 9.5 dpcDnmt1c/c embryo (n=5/5). (G) Enlarged
view of embryo inF. (H) 8.5 dpc Dnmt+/c embryo. Micrographs in
A,C,E,F areat the same magnification. Ectopic GCNA1 expression
wasnot detected in any of 11 control littermate embryosstained in
parallel (not shown).
Fig. 6. Postmigratory germ cell-specific genes are
prematurelyexpressed in Dnmt1-deficient embryos. RT-PCR gene
expressionanalysis for Dazl, Mvh, Mageb4 and Scp3, and was
performed on 9.5dpc wild-type, heterozygous and mutant Dnmt1n and
Dnmt1c embryos.Hprt amplification was used as a loading
control.
-
DEVELO
PMENT
changes in histone modifications have been proposed (Jaenisch
andBird, 2003). Interestingly, recent reports suggest that the
repressivetranscription factor E2F6 is necessary to silence
severalspermatogenic genes in somatic cells, and that promoters of
thesegenes are hypomethylated in E2F6-deficient cells (Pohlers et
al.,2005; Storre et al., 2005). We are currently investigating
whetherE2F6 and DNA methylation share a common pathway to
repressgerm cell-specific genes.
DNA methylation mediated regulation of germcell developmentDNA
methylation has previously been proposed to regulate theexpression
of tissue-specific genes; however, the lack of substantialin vivo
evidence has narrowed the proposed role of methylation tosilencing
of endogenous retrotransposons and maintainingmonoallelic gene
expression within imprinted loci and on theinactive X chromosome in
females (Jaenisch, 1997; Walsh andBestor, 1999). Our data provide
strong evidence that methylationmay indeed control tissue-specific
gene expression for a set of germcell-specific genes that are
coordinately activated upon germ cellentry into the gonads.
Seki et al. (Seki et al., 2005) recently investigated
genome-widechanges in chromatin modifications during primordial
germ celldevelopment. Using antibodies to 5-methylcytosine, they
observedthat PGCs at the base of the allantois at 8.0 dpc have
similarmethylation levels as somatic cells; however, migrating PGCs
in thehindgut displayed lower methylation levels. This first wave
of germcell demethylation may signify the transition from a somatic
cell fateto a more pluripotent state, as germ cells at this stage
resemble cellsof the inner cell mass in their expression profiles
and their ability togive rise to pluripotent stem cell lines
(Donovan and de Miguel,2003; Matsui et al., 1992; Resnick et al.,
1992).
Our data suggest that the second wave of demethylation,
whichtemporally coincides with entry into the gonads, controls
theexpression of several genes required for gametogenesis, as well
ascontributing to imprint erasure, reactivation of the inactive
Xchromosome and expression of IAP retrotransposons. Other aspectsof
PGC differentiation may also be linked to DNA
dimethylation;however, the lethality of Dnmt1 mutant embryos prior
to 10.5 dpcprevents the examination postmigratory germ cell
differentiationevents. Conditional deletion of Dnmt1 in PGCs might
allow forfurther analysis of other changes that temporally overlap
this waveof demethylation.
Cancer testis antigensEfforts to identify cancer-derived gene
products as targets forimmunotherapy have revealed an association
between genesnormally expressed only in germ cells, but ectopically
activated intumors. Currently, 89 transcripts grouped into 44
families arerecognized as cancer testis (CT) antigens (Scanlan et
al., 2004).Boon and colleagues (De Smet et al., 1996; De Smet et
al., 2004)have demonstrated lower levels of promoter methylation in
tumorsexpressing the MAGEA1 cancer testis antigen compared with
non-expressing cells. Furthermore, MAGEA1 expression could
beinduced in response to demethylating agents. This led to
thesuggestion that the loss of DNA methylation that accompanies
tumorprogression may be responsible for MAGE gene expression.
Koslowski et al. (Koslowski et al., 2004) reported that more
thanhalf of CT genes are expressed in premeiotic germ cells and
thatseveral could be induced in peripheral blood leukocytes by
5-azacytidine treatment. Similarly we found that several
premeioticgerm cell-specific genes are expressed following loss of
DNA
methylation, including Mageb4, the murine homolog of a human
CTantigen. Our data provide direct in vivo evidence that
premeioticgene expression is linked to hypomethylation, and
provides a likelyexplanation for the frequent appearance of germ
cell-specific genesin certain tumors.
Evolution of the germ cell lineageBoule and Vasa, the Drosophila
homologs of Dazl and Mvh, wereoriginally identified as components
of Drosophila germ plasm, andare highly conserved in germ cell
development. While organismswith a mosaically determined germ line
inherit these gene productsas maternal factors, Dazl and Mvh are
expressed in postmigratorygerm cells in the mouse, 3-4 days after
the germ line is specified.Interestingly, divergent mechanisms of
germ cell specificationoperate within the amphibian class. The
Xenopus germline ismosaically determined, while salamanders
(Axolotl) specify germcells by an inductive mechanism similar to
mammals (Johnson et al.,2003). As salamanders delay expression of
axdazl and axvh untilgerm cells arrive at the gonad (Bachvarova et
al., 2004), it would beinteresting to investigate the potential
role of methylation in theexpression of axdazl and axvh. The
observation that methylationwere to regulate expression of these
genes in salamanders wouldsuggest that control of germ cell
differentiation by DNA methylationmay be a widely conserved
mechanism among species that useinductive signals to specify the
germ cell lineage. Additionally, thiswould suggest that DNA
methylation in the germ line initially aroseto regulate the timing
of germ cell differentiation rather thanepigenetic processes such
as genomic imprinting.
We gratefully acknowledge Kwon-Ho Hong, S. Paul Oh, Karen
Johnstone,Chris Futtner, Andrew Johnson and George Enders for
helpful advice andcomments. D.M.M. was supported by NIH Training
Grant T32 CA09126. L.D.Kis a University of Florida Alumni Fellow.
This work was supported by NIH GrantHD38429 to J.L.R.
ReferencesBachvarova, R. F., Masi, T., Drum, M., Parker, N.,
Mason, K., Patient, R. and
Johnson, A. D. (2004). Gene expression in the axolotl germ line:
Axdazl, Axvh,Axoct-4, and Axkit. Dev. Dyn. 231, 871-880.
Caspary, T., Cleary, M. A., Baker, C. C., Guan, X. J. and
Tilghman, S. M.(1998). Multiple mechanisms regulate imprinting of
the mouse distalchromosome 7 gene cluster. Mol. Cell. Biol. 18,
3466-3474.
Clark, S. J., Harrison, J., Paul, C. L. and Frommer, M. (1994).
High sensitivitymapping of methylated cytosines. Nucleic Acids Res.
22, 2990-2997.
Cooke, H. J., Lee, M., Kerr, S. and Ruggiu, M. (1996). A murine
homologue ofthe human DAZ gene is autosomal and expressed only in
male and femalegonads. Hum. Mol. Genet. 5, 513-516.
Coucouvanis, E. C., Sherwood, S. W., Carswell Crumpton, C.,
Spack, E. G.and Jones, P. P. (1993). Evidence that the mechanism of
prenatal germ celldeath in the mouse is apoptosis. Exp. Cell Res.
209, 238-247.
De Felici, M., Dolci, S. and Pesce, M. (1992). Cellular and
molecular aspects ofmouse primordial germ cell migration and
proliferation in culture. Int. J. Dev.Biol. 36, 205-213.
De Smet, C., De Backer, O., Faraoni, I., Lurquin, C., Brasseur,
F. and Boon, T.(1996). The activation of human gene MAGE-1 in tumor
cells is correlated withgenome-wide demethylation. Proc. Natl.
Acad. Sci. USA 93, 7149-7153.
De Smet, C., Loriot, A. and Boon, T. (2004). Promoter-dependent
mechanismleading to selective hypomethylation within the 5� region
of gene MAGE-A1 intumor cells. Mol. Cell. Biol. 24, 4781-4790.
Di Carlo, A., Travia, G. and De Felici, M. (2000). The meiotic
specificsynaptonemal complex protein SCP3 is expressed by female
and male primordialgerm cells of the mouse embryo. Int. J. Dev.
Biol. 44, 241.
Donovan, P. J. and de Miguel, M. P. (2003). Turning germ cells
into stem cells.Curr. Opin. Genet. Dev. 13, 463-471.
Donovan, P. J., Stott, D., Cairns, L. A., Heasman, J. and Wylie,
C. C. (1986).Migratory and postmigratory mouse primordial germ
cells behave differently inculture. Cell 44, 831-838.
Enders, G. C. and May, J. J. (1994). Developmentally regulated
expression of amouse germ cell nuclear antigen examined from
embryonic day 11 to adult inmale and female mice. Dev. Biol. 163,
331-340.
Fujiwara, T., Dunn, N. R. and Hogan, B. L. (2001). Bone
morphogenetic protein
3417RESEARCH ARTICLEDNA methylation silences gonocyte genes
-
DEVELO
PMENT
3418
4 in the extraembryonic mesoderm is required for allantois
development and thelocalization and survival of primordial germ
cells in the mouse. Proc. Natl. Acad.Sci. USA 98, 13739-13744.
Fujiwara, Y., Komiya, T., Kawabata, H., Sato, M., Fujimoto, H.,
Furusawa, M.and Noce, T. (1994). Isolation of a DEAD-family protein
gene that encodes amurine homolog of Drosophila vasa and its
specific expression in germ celllineage. Proc. Natl. Acad. Sci. USA
91, 12258-12262.
Garcia-Castro, M. I., Anderson, R., Heasman, J. and Wylie, C.
(1997).Interactions between germ cells and extracellular matrix
glycoproteins duringmigration and gonad assembly in the mouse
embryo. J. Cell Biol. 138, 471-480.
Gardiner-Garden, M. and Frommer, M. (1987). CpG islands in
vertebrategenomes. J. Mol. Biol. 196, 261-282.
Geijsen, N., Horoschak, M., Kim, K., Gribnau, J., Eggan, K. and
Daley, G. Q.(2004). Derivation of embryonic germ cells and male
gametes from embryonicstem cells. Nature 427, 148-154.
Ginsburg, M., Snow, M. H. and McLaren, A. (1990). Primordial
germ cells in themouse embryo during gastrulation. Development 110,
521-528.
Hahnel, A. C., Rappolee, D. A., Millan, J. L., Manes, T.,
Ziomek, C. A.,Theodosiou, N. G., Werb, Z., Pedersen, R. A. and
Schultz, G. A. (1990). Twoalkaline phosphatase genes are expressed
during early development in themouse embryo. Development 110,
555-564.
Hajkova, P., Erhardt, S., Lane, N., Haaf, T., El-Maarri, O.,
Reik, W., Walter, J.and Surani, M. (2002). Epigenetic reprogramming
in mouse primordial germcells. Mech. Dev. 117, 15.
Hattori, N., Nishino, K., Ko, Y. G., Ohgane, J., Tanaka, S. and
Shiota, K.(2004). Epigenetic control of mouse Oct-4 gene expression
in embryonic stemcells and trophoblast stem cells. J. Biol. Chem.
279, 17063-17069.
Hubner, K., Fuhrmann, G., Christenson, L. K., Kehler, J.,
Reinbold, R., De LaFuente, R., Wood, J., Strauss, J. F., 3rd,
Boiani, M. and Scholer, H. R.(2003). Derivation of oocytes from
mouse embryonic stem cells. Science 300,1251-1256.
Ioshikhes, I. P. and Zhang, M. Q. (2000). Large-scale human
promoter mappingusing CpG islands. Nat. Genet. 26, 61-63.
Jackson-Grusby, L., Beard, C., Possemato, R., Tudor, M.,
Fambrough, D.,Csankovszki, G., Dausman, J., Lee, P., Wilson, C.,
Lander, E. et al. (2001).Loss of genomic methylation causes
p53-dependent apoptosis and epigeneticderegulation. Nat. Genet. 27,
31-39.
Jaenisch, R. (1997). DNA methylation and imprinting: why bother?
Trends Genet.13, 323-329.
Jaenisch, R. and Bird, A. (2003). Epigenetic regulation of gene
expression: howthe genome integrates intrinsic and environmental
signals. Nat. Genet. 33, 245-254.
Johnson, A. D., Crother, B., White, M. E., Patient, R.,
Bachvarova, R. F.,Drum, M. and Masi, T. (2003). Regulative germ
cell specification in axolotlembryos: a primitive trait conserved
in the mammalian lineage. Philos. Trans. R.Soc. Lond. B Biol. Sci.
358, 1371-1379.
Koslowski, M., Bell, C., Seitz, G., Lehr, H. A., Roemer, K.,
Muntefering, H.,Huber, C., Sahin, U. and Tureci, O. (2004).
Frequent nonrandom activation ofgerm-line genes in human cancer.
Cancer Res. 64, 5988-5993.
Lane, N., Dean, W., Erhardt, S., Hajkova, P., Surani, A.,
Walter, J. and Reik,W. (2003). Resistance of IAPs to methylation
reprogramming may provide amechanism for epigenetic inheritance in
the mouse. Genesis 35, 88-93.
Lawson, K. A., Dunn, N. R., Roelen, B. A., Zeinstra, L. M.,
Davis, A. M.,Wright, C. V., Korving, J. P. and Hogan, B. L. (1999).
Bmp4 is required for thegeneration of primordial germ cells in the
mouse embryo. Genes Dev. 13, 424-436.
Lee, J., Inoue, K., Ono, R., Ogonuki, N., Kohda, T.,
Kaneko-Ishino, T., Ogura,A. and Ishino, F. (2002). Erasing genomic
imprinting memory in mouse cloneembryos produced from day 11.5
primordial germ cells. Development 129,1807-1817.
Lees-Murdock, D. J., De Felici, M. and Walsh, C. P. (2003).
Methylationdynamics of repetitive DNA elements in the mouse germ
cell lineage. Genomics82, 230-237.
Lei, H., Oh, S. P., Okano, M., Juttermann, R., Goss, K. A.,
Jaenisch, R. and Li,E. (1996). De novo DNA cytosine
methyltransferase activities in mouseembryonic stem cells.
Development 122, 3195-3205.
Li, E., Bestor, T. and Jaenisch, R. (1992). Targeted mutation of
the DNAmethylatrasferase gene results in embryonic lethality. Cell
69, 915-926.
Li, E., Beard, C. and Jaenisch, R. (1993). Role for DNA
methylation in genomicimprinting. Nature 366, 362-365.
Maatouk, D. M. and Resnick, J. L. (2003). Continuing primordial
germ celldifferentiation in the mouse embryo is a cell-intrinsic
program sensitive to DNAmethylation. Dev. Biol. 258, 201-208.
Mann, M. R., Chung, Y. G., Nolen, L. D., Verona, R. I., Latham,
K. E. andBartolomei, M. S. (2003). Disruption of imprinted gene
methylation andexpression in cloned preimplantation stage mouse
embryos. Biol. Reprod. 69,902-914.
Martinowich, K., Hattori, D., Wu, H., Fouse, S., He, F., Hu, Y.,
Fan, G. andSun, Y. E. (2003). DNA methylation-related chromatin
remodeling in activity-dependent BDNF gene regulation. Science 302,
890-893.
Matsui, Y., Zsebo, K. and Hogan, B. L. (1992). Derivation of
pluripotentialembryonic stem cells from murine primordial germ
cells in culture. Cell 70, 841-847.
McLaren, A. (1983). Primordial germ cells in mice. Bibl. Anat.
24, 59-66.McLaren, A. (1984). Meiosis and differentiation of mouse
germ cells. Symp. Soc.
Exp. Biol. 38, 7-23.McLaren, A. and Southee, D. (1997). Entry of
mouse embryonic germ cells into
meiosis. Dev. Biol. 187, 107-113.Milutinovic, S., Zhuang, Q.,
Niveleau, A. and Szyf, M. (2003). Epigenomic
stress response. Knockdown of DNA methyltransferase 1 triggers
an intra-S-phase arrest of DNA replication and induction of stress
response genes. J. Biol.Chem. 278, 14985-14995.
Monk, M. and McLaren, A. (1981). X-chromosome activity in foetal
germ cells ofthe mouse. J. Embryol. Exp. Morphol. 63, 75-84.
Mroz, K., Carrel, L. and Hunt, P. A. (1999). Germ cell
development in the XXYmouse: Evidence that X chromosome
reactivation is independent of sexualdifferentiation. Dev. Biol.
207, 229.
Ohkubo, Y., Shirayoshi, Y. and Nakatsuji, N. (1996). Autonomous
regulation ofproliferation and growth arrest in mouse primordial
germ cells studied by mixedand clonal cultures. Exp. Cell Res. 222,
291-297.
Osterlund, C., Tohonen, V., Forslund, K. O. and Nordqvist, K.
(2000). Mage-b4, a novel melanoma tumor antigen (MAGE) gene
specifically expressed duringgerm cell differentiation. Cancer Res.
60, 1054-1061.
Pesce, M. and De Felici, M. (1995). Purification of mouse
primordial germ cells byMiniMACS magnetic separation system. Dev.
Biol. 170, 722-725.
Pohlers, M., Truss, M., Frede, U., Scholz, A., Strehle, M.,
Kuban, R. J.,Hoffmann, B., Morkel, M., Birchmeier, C. and
Hagemeier, C. (2005). A rolefor E2F6 in the restriction of
male-germ-cell-specific gene expression. Curr. Biol.15,
1051-1057.
Resnick, J. L., Bixler, L. S., Cheng, L. and Donovan, P. J.
(1992). Long-termproliferation of mouse primordial germ cells in
culture. Nature 359, 550-551.
Richards, A. J., Enders, G. C. and Resnick, J. L. (1999).
Differentiation of murinepremigratory primordial germ cells in
culture. Biol. Reprod. 61, 1146-1151.
Rollins, R. A., Haghighi, F., Edwards, J. R., Das, R., Zhang, M.
Q., Ju, J. andBestor, T. H. (2006). Large-scale structure of
genomic methylation patterns.Genome Res. 16, 157-163.
Sado, T., Fenner, M. H., Tan, S. S., Tam, P., Shioda, T. and Li,
E. (2000). Xinactivation in the mouse embryo deficient for Dnmt1:
distinct effect ofhypomethylation on imprinted and random X
inactivation. Dev. Biol. 225, 294-303.
Scanlan, M. J., Simpson, A. J. and Old, L. J. (2004). The
cancer/testis genes:review, standardization, and commentary. Cancer
Immun. 4, 1.
Seki, Y., Hayashi, K., Itoh, K., Mizugaki, M., Saitou, M. and
Matsui, Y. (2005).Extensive and orderly reprogramming of
genome-wide chromatin modificationsassociated with specification
and early development of germ cells in mice. Dev.Biol. 278,
440-458.
Storre, J., Schafer, A., Reichert, N., Barbero, J. L., Hauser,
S., Eilers, M. andGaubatz, S. (2005). Silencing of the meiotic
genes SMC1beta and STAG3 insomatic cells by E2F6. J. Biol. Chem.
280, 41380-41386.
Szabo, P. E., Hubner, K., Scholer, H. and Mann, J. R. (2002).
Allele-specificexpression of imprinted genes in mouse migratory
primordial germ cells. Mech.Dev. 115, 157-160.
Takeuchi, A., Mishina, Y., Miyaishi, O., Kojima, E., Hasegawa,
T. and Isobe,K. (2003). Heterozygosity with respect to Zfp148
causes complete loss of fetalgerm cells during mouse embryogenesis.
Nat. Genet. 33, 172-176.
Tam, P. P. and Snow, M. H. (1981). Proliferation and migration
of primordial germcells during compensatory growth in mouse
embryos. J. Embryol. Exp. Morphol.64, 133-147.
Tam, P. P., Zhou, S. X. and Tan, S. S. (1994). X-chromosome
activity of the mouseprimordial germ cells revealed by the
expression of an X-linked lacZ transgene.Development 120,
2925-2932.
Toyooka, Y., Tsunekawa, N., Akasu, R. and Noce, T. (2003).
Embryonic stemcells can form germ cells in vitro. Proc. Natl. Acad.
Sci. USA 100, 11457-11462.
Walsh, C. P. and Bestor, T. H. (1999). Cytosine methylation and
mammaliandevelopment. Genes Dev. 13, 26.
Walsh, C. P., Chaillet, J. R. and Bestor, T. H. (1998).
Transcription of IAPendogenous retroviruses is constrained by
cytosine methylation. Nat. Genet. 20,116-117.
Wang, D. H., Ikeda, Y., Parker, K. L. and Enders, G. C. (1997).
Germ cell nuclearantigen (GCNA1) expression does not require a
gonadal environment orsteroidogenic factor 1, Examination of GCNA1
in ectopic germ cells and in Ftz-F1 null mice. Mol. Reprod. Dev.
48, 154-158.
Wang, R. A., Nakane, P. K. and Koji, T. (1998). Autonomous cell
death of mousemale germ cells during fetal and postnatal period.
Biol. Reprod. 58, 1250.
Ying, Y. and Zhao, G. Q. (2001). Cooperation of endoderm-derived
BMP2 andextraembryonic ectoderm- derived BMP4 in primordial germ
cell generation inthe mouse. Dev. Biol. 232, 484-492.
Ying, Y., Liu, X. M., Marble, A., Lawson, K. A. and Zhao, G. Q.
(2000).Requirement of Bmp8b for the generation of primordial germ
cells in themouse. Mol. Endocrinol. 14, 1053-1063.
RESEARCH ARTICLE Development 133 (17)