DNA is the carrier of genetic information in all living species The double-helix structure consists of two strands of DNA wound around each other -Each.

• DNA is the carrier of genetic information in all living species• The double-helix structure consists of two strands of DNA wound around each

other- Each strand has a long polymer backbone built from repeating sugar

molecules and phosphate groups- Each sugar group is attached to one of four bases

Guanine (G) Cytosine (C)Adenine (A) Thymine (T)

• Order or sequence of this genetic alphabet along the molecule constitutes the genetic code

• In double-stranded DNA, hydrogen bonds between the bases couple the two strands together

- Chemical coupling is such that

- The base pairs look like the rungs of a helical ladder

A only pairs with T

G only pairs with C

• DNA Polymerase- Given a strand of DNA, under appropriate conditions, DNA polymerase

produces a complementary strand in which every C is replaced by G, every G by a C, every A by a T and every T by an A

- The polymerase enables DNA to reproduce• Ligases bind molecules together. DNA ligase will take two strands of DNA in

proximity and covalently bond them into a single strand- The cell uses DNA ligase to repair any breaks in DNA

• Nucleases cut nucleic acid• Gel eletrophoresis separating DNA strands by length

- A solution of DNA molecules is placed on one end of a slab of gel and an electric field is applied

- Negatively charged DNA molecules move toward the anode- Their mobility is dependent on length; shorter ones move faster

• DNA synthesis- Routine, commercial, fairly inexpensive

• DNA chips have patterns with many short pieces of single-strand DNA, each with a different sequence of bases

- The target DNA, extracted from a cell, is first labeled with a fluorescent marker

- The target DNA will bind only to those fragments of the probe DNA that have exactly the right genetic code

• Optical read-outs are used widely now

• Electronic read-outs are not as common. They will exploit different electrochemical responses of SS- and ds- DNAs

attaching to a surface

• The gene chips are produced using microfabrication techniques

• Fabrication of the system- Construction of a high sensitivity diode detector on a

silicon substrate- Channel is filled with 1% agarose gel

• Operation- DNA sample is loaded

into the inlet reservoir- Electric field applied

along the channel fordriving and separatingthe DNA molecule

- With this setup, separation by 500 µmbasepairs 5 minutes, 4.6 mm channel

• Dense array of 100 nm wide Si3N4 posts (spaced 100 nm) on polysilicon

• E-beam lithography followed by selective etching• This ‘sieve’ instead of the randomly arranged long-chain polymers

in a gel• DNA piece lengths of 43 and

7.2 kbase had a factor of 2 difference in velocity for a 18 V potential difference over 15 mm.

• Genetic diagnostics- Thermal cycling for DNA amplification (PCR)- Mixing with reagents- Labeling (using dyes)- Fragmentation

• Integrated systems, doing all functions, are becoming popular- On flexible plastics or silicon MEM technology- Complete computer control, internal values, external pumps

• Single chip system, 3 cm long- Injectors, mixers, heating chamber, separation channels with electrodes- Detection using diode detectors

• Pioneering work by Leonard M. Adleman of USC• To build a computer, it is necessary to have

(1) a method to store information(2) a few simple operations to act on that information

• Early Turing machines (1930s) stored information as sequences of letters on tape and manipulated that information with simple instructions in the finite control• Modern electronic computers store information as sequences of zeroes and ones

in memory and manipulate this information using the operations available on the processor chip

• DNA is a great way to store information. Enzymes such as polymerases and ligases operate on this information. This is the basis for DNA computing.

• Adleman solved the Hamitonian Path problem using this idea. The following material is based on his work.

• Consider the map of cities (called graph)• The arrows (directed edges) represent nonstop flights between the

cities (vertices)• Determine if a sequence of connecting flights (path) exists that

starts in Atlanta (the start vertex) and ends in Detroit (the end vertex), while passing through each of the remaining cities - Boston & Chicago - only once. Hamiltonian Path Problem

• The case shown here is trivial; a Hamiltonian path does exist: Atlanta, Boston, Chicago, Detroit

• If the start city was Detroit andthe end city, Atlanta, then, no Hamiltonian Path exists

DETROIT

BOSTON

ATLANTA

CHICAGO

• Given a graph with directed edges, and a specified start vertex and an end vertex,

- There is a Hamiltonian Path if and only if- There is a path that starts on the start vertex and ends on a end

vertex and passes through each remaining vertex only once

• Hamiltonian path problem is to decide for any given graph with any number of vertices and with start and end vertices specified, if a Hamiltonian path exists or not

• No efficient algorithm exists- Even with best algorithms and computers, some graphs with

about 100 vertices for which solving Hamiltonian path problem would take hundreds of years!

• Given a graph with N vertices(1) Generate a set of random paths through the graph(2) For each path in the set

(a) Check if that path starts on the start vertex and ends with the end vertex; if not, remove that path from

the set(b) Check if that path passes through exactly N vertices;

if not, remove that path from the set(c) For each vertex, check if that path passes through that

vertex; if not, remove that path from the set(3) If the set is not empty, there is a Hamiltonian path; if the set is

empty, then there is no Hamiltonian path

• Generation of paths should be random and the resulting set should be large enough

• Each city assigned an arbitrary DNA sequence

- Think of the first 4 letters as first name

- The last 4 letters as last name• DNA flight number is the

combination of the last name of originating city and first name of ending city

• Complementary city names consists of replacements:C G; G C; A T; T A

• The actual Hamiltonian Path (Atlanta Boston Chicago Detroit) is given by GCAGTCGGACTGGGCTATGTCCGA a DNA sequence of length 24

How do you actually do this?

• Synthesize the complementary DNA city names and DNA flight numbers

• Take a sample (1014 molecules) in a test tube; add water, salt, ligase…

• The solution to the problem is in the tube:

How do you distinguish it from all other molecules?

(1) PCR with primers of the last name of the start city (GCAG) and complement of the first name of end city (GGCT)

(2) Gel electrophoresis to identify the right length (24)(3) Affinity separation process:

• Extremely dense information storage- 1 gm of DNA (when dried, occupies 1 cm3) equivalent to 1 trillion CDs

• Enormous parallelism• Extraordinary energy efficiency

- 1 J is good for 2 x 1019 ligation operations- 2nd Law of Thermodynamics dictates a theoretical maximum

of 34 x 1019 (irreversible) operations per J at room temperature- Current computers are for less efficient (109 operations/J)

• Error correcting codes are needed- Biological operations are imperfect- Information coded in DNA decays at a finite rate

• Application- Cryptography- Computer-aided design- Factoring large numbers