DNA: History and Structure. A Brief History of DNA (deoxyribonucleic acid): –Discovery of DNA by many different scientists –1928 – Griffith – studied.

DNA:History and Structure

A Brief History of DNA (deoxyribonucleic acid):

– Discovery of DNA by many different scientists– 1928 – Griffith – studied how bacteria made

people sick; found that a gene could change harmless bacteria into disease-causing ones

– 1944 – scientists led by Avery – DNA is a nucleic acid that stores and transmits the genetic information from one generation of an organism to the next

– 1952 – Hershey & Chase – studied viruses that killed bacteria; viruses have DNA too

Structure of DNA

• Three important jobs of DNA:– Carry information from one generation to the

next– Put information to work by determining the

heritable characteristics of organisms– Has to be easily copied

Structure of DNA (continued)

• DNA is a long molecule made up of units called nucleotides and has two strands/sides

• Each nucleotide is made up of three basic parts– A 5-carbon sugar (deoxyribose)– A phosphate– A nitrogenous (nitrogen-containing) base

• 4 bases found in DNA– Adenine and Guanine (both purines)– Cytosine and Thymine (both pyrimidines)

• Backbone of DNA formed by sugar and phosphate groups

• Four nucleotides can be strung together in many different ways to carry coded genetic information

DNA NucleotidesPurines Pyrimidines

Adenine Guanine Cytosine Thymine

Phosphate group Deoxyribose

Structure of DNA

Hydrogen bonds

Nucleotide

Sugar-phosphate backbone

Key

Adenine (A)

Thymine (T)

Cytosine (C)

Guanine (G)

Chargoff’s Rule – “Base-Pairing”

– Adenine (A) can ONLY bond with one Thymine (T)

– Cytosine (C) can ONLY bond with one Guanine (G)

“Base-Pairing” Tool

• Here’s an excellent tool to help you remember which nucleotides bond together and why:

A = T

G = C

Using the Base-Pairing Rule

• Because of the structure of DNA, the Base-Pairing Rule, and the “tool” from the previous slide, if given ONE side of DNA, you can give the “other side.”

• Ex: What is the “other side,” or complimentary strand, to this strand of DNA:– GGGGTTCGAAATTTCGCGAAT

CCCCAAGCTTTAAAGCGCTTA

Double Helix

– 1953 – Watson & Crick – built a 3D model of DNA that was a double helix, in which two strands were wound around each other

– Hydrogen bonds form between certain bases to help form the helix