1 DNA Fingerprinting Because there’s lots of ways you are unique Looking at DNA AGCTAGCT .... DNA is made up of three things. The backbone of phosphate and sugar (which sugar? how is it different to RNA?) and the nucleotide or base. There are four bases. A________ G________ T________ C__________. These pair specifically. A always pairing with ___ and G always pairing with ___. (Again, what’s different in RNA?) The DNA Code The order those letters go into can be very different between individuals. But how different? Do you think the whole DNA code of one individual will be completely different to that of another? Or do you think there will be similarities? Remember: Three base pairs make a codon which make an amino acid. Keeping this in mind use the amino acid table on the back to help you crack this code. Unravel this message Dear Reader .... GGTCAAAAATTTCAAATGGAAATTGCCATTCATCAAGAAATGGCCATGTCTATGTC TATGGTGGATCATCAAAACGGCCAACATATGGAACCCGAAAAACAACATACT? Scribble down the answer on a piece of paper and show me. Write a short code for someone else in the class to unravel.
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
1
DNA FingerprintingBecause there’s lots of ways you are unique
Looking at DNAAGCTAGCT....DNA is made up of three things. The backbone of phosphate and sugar (which sugar? how is it different to RNA?) and the nucleotide or base. There are four bases. A________ G________ T________ C__________. These pair specifically. A always pairing with ___ and G always pairing with ___. (Again, what’s different in RNA?)
The DNA CodeThe order those letters go into can be very different between individuals. But how different? Do you think the whole DNA code of one individual will be completely different to that of another? Or do you think there will be similarities?
Remember: Three base pairs make a codon which make an amino acid. Keeping this in mind use the amino acid table on the back to help you crack this code.
Unravel this messageDear Reader....GGTCAAAAATTTCAAATGGAAATTGCCATTCATCAAGAAATGGCCATGTCTATGTCTATGGTGGATCATCAAAACGGCCAACATATGGAACCCGAAAAACAACATACT?
Scribble down the answer on a piece of paper and show me. Write a short code for someone else in the class to unravel.
2
Codon Amino Acid Letter
ATT, ATC, ATA Isoleucine A
CTT, CTC, CTA, CTG Leucine B
GTT, GTC, GTG Valine C
TTT, TTC Phenylalanine D
ATG Methionine E
TGT, TGC Cysteine F
GCT, GCC Alanine G
GGT, GGC Glycine H
CCT, CCC Proline I
ACT, ACC, ACA Threonine K
TCT, TCC, TCA Serine L
TAT, TAC Tyrosine M
TGG Tryptophan N
CAA, CAG Glutamine O
AAT, AAC Asparagine P
CAT, CAC Histidine R
GAA, GAC Glutamic Acid S
GAT, GAC Aspartic Acid T
AAA, AAG Lysine W
CGT, CGC Arginine U
Related Documents
