DNA Barcoding From DNA to ID Inspiring Excellence.

DNA BarcodingFrom DNA to ID

Inspiring Excellence

ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG

What is DNA Barcoding?

=?

Inspiring Excellence

What DNA Barcoding Works On

matKrbcL

CHLOROPLAST MITOCHONDRION

CO1

Fail: Sequence is completely conserved, good for PCR, but uninformative as barcode

Fail: Sequence shows no conservation, impossible for PCR, but good as barcode

Win: Sequence shows ~70% conservation, good for PCR, good as barcode

Why DNA Barcoding Works

Why DNA Barcoding Works

matKrbcL

CHLOROPLAST MITOCHONDRION

CO1

ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG

1. Sample Organism

4. Sequence DNA

2. Extract DNA 3. Amplify “Barcode” DNA

5. Compare sequence against database

How DNA Barcoding Works

ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG

Why is DNA Barcoding Important?

Inspiring Excellence

Issue #1: No one knows how many species there are.

How Many Species Can You Name?

How many Animals did you name?How many mammals?

How many plants?How many insects?

“Cat”Felis catus

“Dog”Canis lupus familiaris

“Oak Tree”Quercus alba

“Shark”Ginglymostoma cirratum

“Beetle”Popillia japonica

• Currently between 1.5 and 2 million species are described/known

• This number may represent as little as half of the true number of species

• Perhaps more than 1/3 of all species are threatened(IUCN Red list version 2010.1)

Vertebrates

Species

Mammals 5,490

Birds 9,998

Reptiles 9,084

Amphibians 6,433

Fishes 31,300

Total 62,305

Invertebrates

Species

Insects 1,000,000

Mollusks 85,00

Crustaceans 47,000

Corals 2,175

Arachnids 102,248

Total (+others)

1,305,250

Plants Species

Angiosperms

281,821

Gymnosperms

1,021

Ferns and Allies

12,000

Mosses 16,236

Algae 10,134

Total 321,212

Issue #2: There is a lack of agreement of what “species” means.

Canis lupus Canis lupus (familiaris)

Anas platyrhynchos

Defining “species” is complex and

depends on many factors:

• Interbreeding capabilities

• Morphological variation

• Ecological context

• Genetic similarities

??

Issue #3: Traditional taxonomic identification methods may be inadequateand too slow to capture vanishing biodiversity

Classical taxonomy is difficult for non-experts to understand

Leaves alternate proximally, opposite and ultimately decussate distally, 6–16 × 4–13 cm; petiole ca. as long as blade, winged, base clasping, basal lobes stipulate, growing as extensions of wings, less than 1 mm wide; blade 5–7-veined, ovate, glabrous, base typically sagittate, margins entire, apex acute to acuminate. Staminate inflorescences axillary, 1–2 per axil, paniculate, fasciculate; panicles bearing flowers singly,bracteolate, in a zigzag pattern along rachis, internodes less than 2 mm; rachis to 25 cm, secondary axes 1–3(–6), fasciculate, less than 3 cm, each subtended by deltate-ovate bracteole shorter than 1 mm. Pistillate inflorescences solitary, 4–8(–20)-flowered, 6–35 cm, internodes ca. 1 cm.

Adding to the complexity: immature, damaged or incomplete specimen may make identification impossible.

Issue #4: DNA Barcoding provides opportunities to investigate things

DNA Barcoding Engages and Transforms CuriosityInto Practical Inquiry

Kate StoeckleAugust 23, 2008

Research questions can be about any living thing or about non-living things (foods or other products) that

have DNA.

• Are there invasive (non-native) plants in my local park?

• What are the most popular types of flowers in my city?

• Do the teas I buy at my supermarket really contain the ingredients on the package?

• How many different living organisms can I find in an office building?

• Whose droppings are these?

What research questions could you ask?

Examples:

Inspiring Excellence

• DNA extraction Kit

• PCR machine and reagents

• DNA sequencing (Genewiz, other)

• Bioinformatic tools (analysis of DNA sequence)

Materials & Equipment for DNA Barcoding

Inspiring Excellence

• Sequence

• Prepare

• Compare

• Identify

• Share

DNA Barcoding Analysis

Inspiring Excellence

Contributing to big science

Inspiring Excellence

GenBank

BOLD

ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG

1. Sample Organism

4. Sequence DNA

2. Extract DNA 3. Amplify “Barcode” DNA

5. Compare sequence against database

How DNA Barcoding Works

• Find NCBI’s MapViewer; identify difference between human and chimpanzee genome; check situation in all 4 other primate genomes provided

• Make sea shell phylogenetic tree, work through hhmi.org/biointeractive/activities/shells/online/index.html

• Review users.ugent.be/~avierstr/principles/phylogeny.html*

• Review http://www.hiv.lanl.gov/content/sequence/TUTORIALS/TREE_TUTORIAL/Tree-tutorial.html*

• Review Constructing an Evolutionary Tree (Binder)

• Review Stockle paper on DNA, Taxonomy & Barcode of Life (pre-Readings)

* Links worked on 2012 05 31; if they fail, find the 2 sites through Google

Assignments

Questions?

Inspiring Excellence