Discussion of Ecological Speciation in South Atlantic Island Finches by Peter G. Ryan, Paulette Bloomer, Coleen L. Moloney, Tyron J. Grant and Wayne Delport University of Cape Town University of Pretoria South Africa Science 315:1420-1423 BIO101, Oct. 3, 2011
24
Embed
Discussion of Ecological Speciation in South Atlantic Island Finches by Peter G. Ryan, Paulette Bloomer, Coleen L. Moloney, Tyron J. Grant and Wayne Delport.
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Discussion of
Ecological Speciation in South Atlantic Island Finches
byPeter G. Ryan, Paulette Bloomer, Coleen L. Moloney, Tyron J. Grant and Wayne Delport
University of Cape TownUniversity of Pretoria
South Africa
Science
315:1420-1423
BIO101, Oct. 3, 2011
What’s the overall question?
What’s the overall conclusion?
Ecological Speciation in South Atlantic Island Finches
Peter G. Ryan, Paulette Bloomer, Coleen L. Moloney, Tyron J. Grant and Wayne Delport
Examples of sympatric speciation in nature are rare and hotly debated. We describe the parallel speciation of finches on two small islands in the Tristan da Cunha archipelago in the South Atlantic Ocean. Nesospiza buntings are a classic example of a simple adaptive radiation, with two species on each island: an abundant small-billed dietary generalist and a scarce large-billed specialist. Their morphological diversity closely matches the available spectrum of seed sizes, and genetic evidence suggests that they evolved independently on each island. Speciation is complete on the smaller island, where there is a single habitat with strongly bimodal seed size abundance, but is incomplete on the larger island, where a greater diversity of habitats has resulted in three lineages. Our study suggests that the buntings have undergone parallel ecological speciation.
Where in the world is Tristan da Cunha?
The most remote inhabited islands in the world
Where in the world is Tristan da Cunha?
Approx. 250 milesSouth
Approx. 12 milesbetween
Inaccessible Island
Rough circle, 2 miles in diameter.
3 million years old.Ecology largely stable for 20,000 years.
Low coast with high cliffs.Extensive plateau of 300-600 m.
Nightingale IslandSeveral small islands.Largest is approx. 1 mile diameter
18 million years old.Ecology largely stable for 20,000 years.
Mostly low lying (<300 m)
The Flora
Tall tussock grass, Spartina arundinacea
Trees, Phylica
Heath, Blechnum palmiforme
The Flora
Inaccessible Island: Low-lying coast is mostly tussock grasses with a few clumps of trees
East side of plateau is mostly Phylica trees
West side of plateau is mostly heath
Nightingale Island: Mostly tussock grass with a few clumps of trees
Fig. 1A
Nesospiza Finches/Buntings
Evolved from South American finches (crossed 4800 miles of ocean!)
Two species:N. acunhae – also called Tristan Bunting
wide variety dietsmall billfound on both islandsdifferences in ‘upland’ and ‘lowland’ types on Inaccessible
N. wilkinsi – also called Wilkins’ Buntingeats Phylica fruitlarge billfound on both islands
Nesospiza Finches/Buntings
N. dunneisubspecies of N. wilkinsionly found on Inaccessible Island
N. questisubspecies of N. acunhaeonly found on Nightingale Island
Hybrids of dunnei x acunhae
Hybrids only occur on Inaccessible
Each species has a different subspecies
Nesospiza Finches/Buntings Fig. 1BC
Allopatric Speciation:Species developed in geographic isolation,then dispersed and mixed
Sympatric Speciation:One species inhabited both islands,
large and small bills evolved on both islands
Morphological Analyses
Found on Nightingale Island
Found on Inaccessible Island
More extreme morphological differences on Nightingale
Fig. 2A
Ecological Analyses Fig. 2B
Inaccessible
Inaccessible
Inaccessible
Inaccessible
Ecological Analyses Fig. S1
Morphological and Ecological Analyses
Which model do these data support?
Allopatry? Sympatry? Both? Neither?
Genetic Analyses
Analysis of a mitochondrial gene
9 birds on Nightingale analyzed. One genotype found, which is different from those on Inaccessible.
Fig. S2
Which model do these data support? Allopatry? Sympatry? Both? Neither?Which factor is more important – species or location?
Genetic Analyses
For higher resolution, conducted an analysis of a microsatellites
Short, repetitive DNA sequencesHigh levels of variation within speciesVariation in the number of repeatsGenerally between genes, so not selected for or against
372 birds analyzed for 7 microsatellites each
CCGTAGATCGATCGATCTTACTGGT
CCGTAGATCGATCGATCGATCGATCTTACTGGT
Table S2aGenetic Analyses
Does the variation deviate from Hardy-Weinberg?
p-values for a statistically significant deviation from Hardy-Weinberg:
Mic
rosa
telli
te N
ames
Five of the 42 loci/species combinations show evidence of evolution. (may be due to ongoing speciation)
37 of 42 show neutral variation.
Fig. 3BGenetic Analyses
Visual representation of the microsatellite data.Each vertical line is one bird, with location and species/subspecies indicated.Colors code for genotypes at the four microsatellites
26 finches
First bird shows ~65% “green” lineage~25% “blue” lineage~10% “gray” lineageslight amount of “red” lineage
All N. wilkinsi finches on Nightingaleare genetically similar to each other
Figure 3BCGenetic Analyses
Each island/species grouping is well-resolved by the genetic data
Figure 3AGenetic Analyses
Distance of lines corresponds to genetic distance .(Nei’s Genetic Distance, D)
Can also present the microsatellite data as a tree:
Figure 3AGenetic Analyses
Which model do these data support?
Allopatry? Sympatry? Both? Neither?
Which factor is more important – species or location?