Page 1
저 시-비 리- 경 지 2.0 한민
는 아래 조건 르는 경 에 한하여 게
l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.
다 과 같 조건 라야 합니다:
l 하는, 저 물 나 포 경 , 저 물에 적 된 허락조건 명확하게 나타내어야 합니다.
l 저 터 허가를 면 러한 조건들 적 되지 않습니다.
저 에 른 리는 내 에 하여 향 지 않습니다.
것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.
Disclaimer
저 시. 하는 원저 를 시하여야 합니다.
비 리. 하는 저 물 리 목적 할 수 없습니다.
경 지. 하는 저 물 개 , 형 또는 가공할 수 없습니다.
Page 6
i
- ABSTRACT -
The Role of Annexin A6
in Osteoporosis
Osteoporosis is a common calcium and metabolic skeletal disease which is
characterized by decreased bone mass, microarchitectural deterioration of bone tissue and
impaired bone strength, thereby leading to enhanced risk of bone fragility.
In this study, we aimed to discover a novel herbal therapeutic drug for effective
osteoporosis treatment and to further clarify its molecular mechanism of action. At first,
ethanol or methanol extracts of 68 edible Korean native plants were screened and Poncirus
trifoliata (PT) was selected as a final candidate because of its high inhibitory activity on
glucocorticoid (GC)-induced apoptosis plus its novelty. The hexane extract of PT (PT-H)
inhibited apoptotic cell death of osteoblastic cell lines, C3H10T1/2 and MC3T3-E1 induced
by synthetic GC, dexamethasone (Dex). In vivo mouse results indicated that PT-H not only
had an inhibitory effect on the bone loss caused by GC, but also promoted bone formation.
We further clarified the molecular mechanisms behind the effect of PT-H on GC-
induced osteoporosis (GIO) by screening of differentially-expressed genes (DEGs) between
Dex-induced osteoblastic cells with or without PT-H treatment. Finally, we found that the
expression level of AnxA6 in Dex-induced osteoblastic cells and prednisolone-treated GIO-
model mice was significantly decreased by PT-H treatment. These findings suggest that PT-
H has a strong in vitro and in vivo inhibitory effect on GIO, and decreased expression of
Page 7
ii
AnxA6 may play a key role in this inhibition. As the next step, we aimed to determine
whether ANXA6 gene was associated with the susceptibility to osteoporosis and further
identify novel genes for susceptibility to osteoporosis. At first, we performed a whole-
genome comparative expression analysis. Ten genes were identified as the DEGs in the Dex-
treated MC3T3-E1 cells. To validate and evaluate the identified DEGs, we performed
quantitative real-time RT-PCR using the gene-specific primers and compared the expression
levels of these genes between the Dex-treated and untreated MC3T3-E1 cells, and between
the ovariectomized (OVX) and sham mice and found that the expression levels of 7 genes,
Anxa6, Col5a1, Col6a2, Eno1, Myof, Nfib and Scara5, were significantly altered in the in
vitro and in vivo osteoporosis models.
Lastly, to determine whether the genetic variations of these 7 genes were associated
with bone density and osteoporosis phenotypes in humans, we performed the quantitative
bone density analysis and osteoporosis case-control analysis of 116 ingle nucleotide
polymorphism (SNPs) in these 7 genes in the Korean Women’s Cohort (3570 subjects).
There was a significant association between the SNPs in the 5 genes, ANXA6, COL5A1,
ENO1, MYOF and SCARA5, and bone density and/or osteoporosis. Especially, the SNPs in
the ANXA6 gene showed a highly significant association with bone density and their p-values
satisfied the Bonferroni-corrected significance level. These results indicate that genetic
variation in the ANXA6 gene is significantly associated with bone density and osteoporosis.
This study may provide insight into the genetic basis of osteoporosis.
Key words: osteoporosis, Poncirus trifoliata, glucocorticoids, Annexin A6 (ANXA6), osteoblast, bone mineral density (BMD), differentially expressed genes (DEGs), single nucleotide polymorphism (SNP), association, mouse, human
Page 8
iii
TABLE OF CONTENTS
ABSTRACT ················································································································ ⅰ
TABLE OF CONTENTS ······························································································ iii
LIST OF FIGURES ······································································································ vi
LIST OF TABLES ···································································································· viii
. Ⅰ INTRODUCTION ···································································································· 1
A. In vitro and in vivo inhibition of glucocorticoid-induced osteoporosis by the
hexane extract of Poncirus trifoliata ································································· 1
B. Genetic association between single nucleotide polymorphisms in the ANXA6 gene
and bone density/osteoporosis ············································································· 3
. Ⅱ MATERIALS AND METHODS ············································································ 6
1. Chemicals ·········································································································· 6
2. Plant materials and preparation of hexane extracts ··········································· 6
3. Cell culture ········································································································ 7
4. Cell viability assay ···························································································· 8
5. Terminal deoxynucleotidyl Transferase (TdT)-mediated dUTP nick end
labeling (TUNEL) staining ················································································ 8
6. GIO mouse model experiment ··········································································· 9
7. Measurement of bone mineral density for density ············································ 10
8. Tissue sample preparation ················································································· 10
Page 9
iv
9. Annealing control primer (ACP)-based differential display reverse-transcriptase
polymerase chain reaction (RT-PCR) ······························································· 10
10. Cloning and sequence analysis ······································································ 12
11. Gene-specific quantitative real-time RT-PCR ··············································· 12
12. Protein extraction and western blot analysis ················································· 14
13. Ovariectomized (OVX) mouse model ····························································· 15
14. Human subjects ······························································································· 15
15. Genotyping and selection of SNPs ·································································· 17
16. Statistical analysis ························································································· 17
. Ⅲ RESULTS ·············································································································· 19
A. In vitro and in vivo inhibition of glucocorticoid-induced osteoporosis by the
hexane extract of Poncirus trifoliata ······························································· 19
1. Screening of the novel, effective natural sources on GIO ······························· 19
2. In vitro inhibition of PT-H on Dex-induced apoptosis ···································· 23
3. Inhibitory effect of PT-H on an in vivo GIO model ········································ 26
4. Screening and identification of DEGs in Dex-induced osteoblastic cells with
and without PT-H treatment ············································································ 28
5. Validation of the identified DEGs by real-time RT-PCR and western blot
analysis ············································································································ 31
6. Effect of PT-H on the expression of AnxA6 in GIO-mice ································ 34
B. Genetic association between single nucleotide polymorphisms in the ANXA6
gene and bone density/osteoporosis ···································································· 36
Page 10
v
1. Study design ······································································································ 36
2. Screening and identification of the DEGs in Dex-treated osteoblastic cell line
model ················································································································· 38
3. Validation of the identified DEGs in the cell line model by quantitative
real-time RT-PCR ······························································································ 43
4. Evaluation of the identified DEGs in the ovariectomized mouse model by
quantitative real-time RT-PCR ·········································································· 45
5. Association analysis of the genetic variation in the identified DEGs with bone
density and osteoporosis in humans ·································································· 47
. Ⅳ DISCUSSION ······································································································· 60
A. In vitro and in vivo inhibition of glucocorticoid-induced osteoporosis by the
hexane extract of Poncirus trifoliata ······························································· 60
B. Genetic association between single nucleotide polymorphisms in the ANXA6
gene and bone density/osteoporosis ·································································· 65
Ⅴ. CONCLUSION ····································································································· 71
REFERENCES ············································································································ 72
국문요약 ····················································································································· 85
Page 11
vi
LIST OF FIGURES
Fig. 1. Effect of Poncirus trifoliata hexane extract (PT-H) on Dex-induced apoptosis
of osteoblastic cells ··························································································· 24
Fig. 2. Effect of Poncirus trifoliata hexane extract (PT-H) on the bone mineral
density (BMD) of mice treated with glucocorticoid ······································· 27
Fig. 3. Differential banding patterns of the 8 identified differentially-expressed
genes (DEGs) ···································································································· 29
Fig. 4. Validation of 8 identified differentially-expressed gene (DEG) mRNAs
by quantitative real-time RT-PCR analysis ······················································· 32
Fig. 5. Validation of 2 representative differentially-expressed genes (DEGs),
AnxA6 and Col6a2, at the protein level by Western blot analysis ···················· 33
Fig. 6. Effect of Poncirus trifoliata hexane extract (PT-H) on the expression of
AnxA6 in GIO-mice ·························································································· 35
Fig. 7. The flow chart of the study ················································································ 37
Page 12
vii
Fig. 8. Effect of dexamethasone on apoptosis in mouse osteoblastic MC3T3-E1 cell line ·
··························································································································· 40
Fig. 9. Differential banding patterns of the 10 identified differentially expressed
genes (DEGs). ··································································································· 41
Fig. 10. Validation of the mRNA expression level of the 10 DEGs in the Dex-
treated MC3T3-E1 cells by quantitative real-time RT-PCR ····························· 44
Fig. 11. Comparison of the bone mineral density and the mRNA expression level of
the 10 DEGs between the sham and ovariectomized mice ······························ 46
Fig. 12. Location and basic linkage disequilibrium (LD) of the analyzed SNPs
in the ANXA6 (A), COL5A1 (B), MYOF (C) and SCARA5 (D) genes ·············· 57
Page 13
viii
LIST OF TABLES
Table 1. Inhibitory effects of the extracts from 68 Korean plants against dexamethasone
(Dex)-induced apoptosis of osteoblastic C3H10T1/2 cell line ····················· 20
Table 2. Inhibition of dexamethasone-induced apoptosis of osteoblastic cells by the
extracts from the selected Korean plants ···················································· 22
Table 3. List of significantly differentially-expressed genes (DEGs) in osteoblastic
cells with and without Poncirus trifoliata hexane extract (PT-H) treatment
························································································································ 30
Table 4. List of the significantly differentially expressed genes (DEGs)
in the dexamethasone-treated mouse MC3T3-E1 cells ··································· 42
Table 5. Basic characteristics of the women subjects in the KARE study cohort
························································································································ 49
Table 6. Information on the SNPs in the seven analyzed genes ···································· 50
Table 7. The results of association analysis between the SNPs in the seven genes
and bone density in the KARE women subjects ············································· 54
Page 14
ix
Table 8. The results of case-control association analysis between the SNPs in the
seven genes and osteoporosis in the KARE women subjects ························· 56
Table 9. The summary of the results from each step of the experiments in the cell
line, mouse model and humans ······································································· 67
Page 15
- 1 -
I. INTRODUCTION
A. In vitro and in vivo inhibition of glucocorticoid-induced
osteoporosis by the hexane extract of Poncirus trifoliata
Osteoporosis is a calcium and metabolic disorder characterized by decreased bone
mass, enhanced risk of bone fragility and susceptibility to fracture (Raisz, 2005; Sambrook
and Cooper, 2006) caused by a failure of bone homeostasis, which is due to both an
increase in osteoclastic bone resorption and a decrease in osteoblastic bone formation
(Teitelbaum, 2000; Khosla et al., 2008). Osteoporotic fractures are an important cause of
morbidity and mortality, particularly in elderly women and men (Johnell and Kanis, 2005).
Glucocorticoids (GCs) have strong anti-inflammatory effects and are used
extensively for the treatment of a wide variety of disorders, including autoimmune,
pulmonary and gastrointestinal diseases, as well as inflammatory diseases (Gudbjornsson
et al., 2002). One of the most serious complications brought about by long-term GC
therapy is rapid bone loss and increased risk of fracture (Gudbjornsson et al., 2002; Angeli
et al., 2006; Canalis et al., 2007). The therapeutic use of GCs has contributed to the
increase of the most prevalent form of secondary osteoporosis, glucocorticoid-induced
osteoporosis (GIO), which is observed in patients chronically exposed to GCs (Alesci et
al., 2005; Mazziotti et al., 2006). It is now clear that long-term use of GCs modifies the
proliferative and metabolic activity of the bone cells, osteoblasts/osteocytes and
osteoclasts. GCs can cause excessive bone loss by decreasing bone formation and
increasing bone resorption (Canalis and Delany, 2002; Alesci et al., 2005; Olney, 2009).
Page 16
- 2 -
For the pharmacological therapy of osteoporosis, two main classes of medications are
available; antiresorptive agents such as bisphosphonates, estrogen/sex hormones, the
estrogen agonist/antagonist raloxifene, and calcitonin, in addition to anabolic agents such as
parathyroid hormone, sodium fluoride, vitamin D metabolites, growth factors, statins and
anabolic steroids (Sambrook and Cooper, 2006; Bonura, 2009; Lewiecki, 2009). However,
some of these medications have side effects, including increased risk of endometrial and
breast cancers (Bonura, 2009). So far, several botanicals such as Carthamus tinctorius,
Drynaria fortunei, Gardenia jasminoides, Schizandra chinensis and Ulmus davidiana, which
are used in folk medicine, have been reported to be potential alternative treatments for
osteoporosis (Ha et al., 2003; Jeong et al., 2005; Suh et al., 2007; Kim et al., 2008;
Caichompoo et al., 2009), but there have been only two reports on the in vivo activity against
GIO by these botanicals (Kim et al., 2002; Wong and Rabie, 2006).
In this study, 68 Korean native plants were screened to search for novel, effective
botanical-based treatments for GIO. The dried immature fruit of Poncirus trifoliata (L.)
(Rutaceae, PT) (Kim et al., 1999; Lee et al., 2005; Shim et al., 2009), which is widely used
in eastern Asia as a traditional medicine, was selected as a potential natural-source candidate
for the treatment of GIO. The effects of a hexane extract of PT (PT-H) on GIO were
examined in vitro and in vivo. In order to clarify the molecular mechanisms behind the effect
of PT-H on GIO, a whole genome gene expression comparison study was performed in
dexamethasone (Dex)-induced osteoblastic cells with and without PT-H, and several
differentially expressed genes (DEGs) were found. The DEGs were further evaluated in
osteoblasts and bones of GIO-mice. The results suggested that PT-H may inhibit GIO both in
vitro and in vivo.
Page 17
- 3 -
B. Genetic association between single nucleotide polymorphisms in
the ANXA6 gene and bone density/osteoporosis
Osteoporosis is involved in the interactions of multiple genetic and environmental risk
factors (Torgerson et al., 1996; Sigurdsson et al., 2008). Recently, genetic factors have
attracted much attention of many investigators due to their high importance in the
pathogenesis of osteoporosis. Severe osteoporosis may be related to mutation in a single
gene, otherwise, BMD or bone mineral mass can be accounted for by the common genetic
variations in multiple genes with relatively small effects or by the rare genetic variations in
specific genes with relatively large effects (Hosoi, 2010; Ralston, 2010; Ralston and
Uitterlinden, 2010). Heritability studies in twins and families have demonstrated that
between 50% and 85% of the variance in peak BMD is genetically determined (Pocock et al.,
1987; Gueguen et al., 1995; Ralston and Uitterlinden, 2010).
The identification of genetic variants that contribute to osteoporosis and BMD
phenotypes can be helpful not only for elucidation of the molecular mechanisms of
osteoporosis, but also for the development of effective treatment for osteoporosis. So far,
many osteoporosis susceptibility loci and genes have been identified by genome-wide
linkage analysis (Styrkarsdottir et al., 2003; Xiao et al., 2006; Hsu et al., 2007; Kaufman et
al., 2008), candidate gene association studies (Richards et al., 2009) and genome-wide
association studies (GWAS) (Karasik et al., 2008; Richards et al., 2008; Cho et al., 2009;
Styrkarsdottir et al., 2009; Xiong et al., 2009), and recent important and representative
findings through molecular genetic studies of gene identification for osteoporosis have been
Page 18
- 4 -
well summarized (Xu et al., 2010). However, the vast majority of the monogenic and
polygenic genetic factors in osteoporosis still remain to be discovered.
In this study, we aimed to identify the novel genes for susceptibility to osteoporosis
that influence the pathogenesis of osteoporosis in humans in a particular way, by using the in
vitro and in vivo models for osteoporosis. As an in vitro model for osteoporosis, we used the
glucocorticoid (GC)-treated mouse osteoblastic MC3T3-E1 cell line in this study. GC causes
osteoporosis-like bone loss due to decreasing bone formation and increasing bone resorption
(Alesci et al., 2005; Canalis et al., 2007; Olney, 2009). GC-induced apoptosis in osteoblastic
cells has been reported (Yun et al., 2009). The mouse MC3T3-E1 cell line has been
demonstrated to be a suitable in vitro model of osteoblast development due to typical
osteoblast differentiation and formation of a bone-like mineralized extracellular matrix
(Quarles et al., 1992; Choi et al., 1996). Therefore, GC-treated osteoblastic MC3T3-E1 cells
may provide a useful in vitro system for the first screening step of the differentially
expressed genes (DEGs) between controls and osteoporosis models.
In case of the in vivo models for osteoporosis, many animal models have been
established for osteoporosis research (Turner et al., 2001; Lelovas et al., 2008). Although, the
ovariectomized (OVX) rat exhibits most of the characteristics of human postmenopausal
osteoporosis, mouse is also very useful laboratory animal model for osteoporosis due to easy
management. Among the mouse models for osteoporosis, OVX mice and GC-induced mice
represent a reliable in vivo model to investigate bone loss in osteoporosis (Jee and Yao, 2001).
We used OVX mice as an in vivo model for osteoporosis in this study.
We first screened and selected the candidate genes that have a higher possibility to be
Page 19
- 5 -
linked with osteoporosis by comparative analysis of gene expression between controls and in
vitro osteoporosis model. Subsequently, we carried out evaluation of the candidate genes
using the in vivo osteoporosis model. Finally, we performed an association analysis between
the genetic variants in the selected genes and bone density and osteoporosis in human
subjects. This approach may provide an accurate identification of novel genes for
susceptibility to osteoporosis.
Page 20
- 6 -
II. MATERIALS AND METHODS
1. Chemicals
Cell culture media (DMEM and α-MEM), antibiotics (penicillin and streptomycin) and
fetal bovine serum (FBS) were purchased from Invitrogen (Carlsbad, USA). Dex, DMSO,
MTT assay kits, protease inhibitors (phenylmethylsulphonyl fluoride [PMSF], leupeptin and
aprotinin) and strontium chloride (SrCl2) were purchased from Sigma-Aldrich Co. (St Louis,
USA). Ethanol and hexane were purchased from Duksan Pure Chemicals (Ansan, Korea).
2. Plant materials and preparation of hexane extracts
Ethanol or methanol extracts of 68 Korean native plants were gifts from the
pharmaceutical company, HL Genomics Co., Ltd (Yongin, Korea), and were originally
provided from the Korean Plant Extract Bank in the Korea Research Institute of Bioscience
and Biotechnology (KRIBB) (http://extract.pdrc.re.kr). The preparation procedure of
botanical extracts is described briefly as follows. Plant materials were collected from various
locations in Republic of Korea or purchased from local Korean herb drug markets and
identified taxonomically by a botanist, Dr H. K. Lee at the KRIBB. The voucher specimens
are deposited at the herbarium of KRIBB. One hundred grams of air-dried botanical
materials was extracted with 500 mL of methanol or ethanol at room temperature for 5 days.
The methanol or ethanol extracts were passed through Whatman filter paper (No. 2) in order
Page 21
- 7 -
to remove debris and concentrated using a rotary evaporator under vacuum and then
lyophilized. The extract yields of 68 plants were approximately 5–20% (w/w). The dried
extracts were reconstituted to concentrations of 1 mg/mL with deionized water containing
5% (v/v) DMSO, and subsequently used for screening.
Hexane extracts of Poncirus trifoliata (PT-H) were prepared as follows. The dried
fruits of PT (1.6 kg) were extracted three times with ethanol (3×1.2 L) at 100 °C for 3 h. The
PT ethanol extract (292.12 g) was suspended in water and then sequentially partitioned with
equal volumes of n-hexane and ethyl acetate. Each fraction was evaporated under vacuum to
yield residues from the n-hexane (30.50 g) and water (29.13 g) extracts. The PT-H extract
was further assessed both in vitro and in vivo for its inhibitory activity against GIO.
3. Cell culture
Mouse osteoblastic MC3T3-E1 cells were purchased from the RIKEN cell bank
(Tsukuba, Japan) and grown in α-MEM medium supplemented with 10% FBS, penicillin
(100 U/mL) and streptomycin (100 μg/mL). Mouse embryonic mesenchymal C3H10T1/2
cells were purchased from the Korean Cell Line Bank (Seoul, Korea) and grown in DMEM
medium supplemented with 10% FBS, penicillin (100 U/mL) and streptomycin (100 μg/mL).
All cultured cells were incubated at 37 °C in a humidified atmosphere containing 5% CO2.
Page 22
- 8 -
4. Cell viability assay
Cells (3×103 cells/well) were seeded in a 96-well plate, incubated overnight, and
cotreated with Dex (1 μM) and different concentrations of PT-H (10, 50 or 100 μg/mL) in
the medium for 48 h. MTT (20 μL, 5 mg/mL in PBS) was added per well, cells were
incubated for another 4 h, and the media were carefully removed. The formazan crystals
were dissolved in acidified isopropyl alcohol (40 mM HCl in isopropanol) and absorbances
were measured at 570 nm using a microplate reader (BioTek, Winooski, USA).
5. Terminal deoxynucleotidyl Transferase (TdT)-mediated dUTP
nick end labeling (TUNEL) staining
Cells were seeded on glass in a 6-well plate, incubated overnight, and cotreated with
Dex (1 μM) and different concentrations of PT-H (10, 50 or 100 μg/mL) in the medium for
48 h. The assay was performed using a commercial In Situ Cell Death Detection kit (Roche
Applied Science, Indianapolis, USA) according to the manufacturer’s protocol. The cells
were then mounted with VectaShield reagent (Vector Laboratories, Burlingame, CA) and
analysed using a fluorescence microscope excited at a wavelength of 480 nm for fluorescein
and 360 nm for 4′, 6-diamidino-2-phenylindole (DAPI). Quantification of TUNEL staining
was performed by counting positive cells in three random regions of the slide at a
magnification of × 200.
Page 23
- 9 -
6. GIO mouse model experiment
Twenty-eight 6-month-old male ICR mice were obtained from Central Laboratory
Animal Inc. (Seoul, Korea). Mice were maintained on a diet (5.0 g/day) of Formula-M07
(Feedlab Co., Ltd, Hanam, Korea) and tap water (15 mL/day). All mice were housed
individually in clear plastic cages under controlled temperature (23±2°C), humidity (55±5%)
and illumination (12 h light/dark cycle). Mice were acclimated for 10 days prior to
experimentation. Except for the sham‐operated group of seven mice, slow release pellets (5
mg, 60‐day slow-release) of prednisolone (PD) (Innovative Research of America, Sarasota,
USA) were implanted subcutaneously in the lateral neck region of 21 mice. Four weeks after
PD implantation, three groups of seven mice each were fed different experimental diets and
water with or without supplementation for another 4 weeks. In the PD+PT‐H group, the mice
were fed a custom‐made pellet diet of Formula-M07 mixture containing PT-H (100
mg/kg/day) (Feedlab Co., Ltd, Hanam, Korea) and normal distilled water and in the
PD+SrCl2 groups, the mice were fed a normal diet and distilled water supplemented with
SrCl2 (positive control) (1800 mg/kg/day). In the PD group, the mice were fed a normal diet
and allowed normal distilled water. The animal research protocol was approved by the
Animal Care and Use Committee of the Ajou University School of Medicine, and all
experiments were conducted in accordance with the institutional guidelines established by
the Committee.
Page 24
- 10 -
7. Measurement of bone mineral density
Bone mineral density (BMD) was measured using a PIXI-mus bone densitometer (GE
Lunar, Madison, USA). After anesthetization using tiletamine/zolazepam (Zoletil; Virbac
Laboratories, Carros, France), the mice were placed on the specimen tray for measurements.
All mice were placed carefully in the same position. Whole body BMD was measured using
on-board PIXI-mus software for small animals, and adjusted in relation to body weight.
8. Tissue sample preparation
After measurement of BMD, the mice were killed by CO2 asphyxiation and cervical
dislocation. Mice femurs were excised, and the isolated femur bones and skeletal muscles
were then frozen by liquid nitrogen and deep-freeze, respectively. The frozen samples were
homogenized using a porcelain mortar and pestle and then lysed using RIPA lysis buffer and
used for Western blot analysis.
9. Annealing control primer (ACP)-based differential display
reverse-transcriptase polymerase chain reaction (RT-PCR)
Cells were treated with DMSO alone (control), 1 μM of Dex alone or 1 μM of Dex
plus 50 μg/mL PT-H for 2 days. Total RNA was extracted from cells using TRIzol reagent
(Invitrogen, Carlsbad, USA), following the manufacturer’s instructions. Extracted RNA was
Page 25
- 11 -
quantified by a spectrophotometer (Beckman Coulter, Brea, USA). First-strand cDNA was
synthesized from 3 μg of RNA using the Revert Aid First Strand cDNA Synthesis Kit
(Fermentas, Burlington, Canada). Then ACP-based differential display RT-PCR was carried
out using the predesigned arbitrary annealing control primer (Seegene, Seoul, Korea) (Kim
et al., 2004). First-strand cDNA synthesis was performed for 1.5 h at 42°C in a final reaction
volume of 20 μL containing purified total RNA, 3 μg; 4 μL of 5× reaction buffer; 5 μL of
dNTPs (each 2 mM); 2 μL of 10 mM cDNA synthesis primer dT-ACT1 (5′-
CTGTGAATGCTGCGACTACGATIIIII(T)18-3′, inosine [I]); 0.5 μL of Ribolock
ribonuclease inhibitor (40 U/μL) (Fermentas) and 1 μL of M-MLV reverse transcriptase (200
U/μL) (Fermentas). Synthesized first-strand cDNA samples were diluted by the addition of
80 μL of ultra-purified water. Polymerase chain reaction (PCR) amplification was conducted
using GeneFishing DEG kit (Seegene) in 20 μL reaction volumes containing 10 μL of 2×
SeeAmp ACP Master Mix; 2 μL of 5 μM each arbitrary ACP; 1 μL of 10 μM dT-ACP2 (5′-
CTGTGAATGCTGCGACTACGATIIIII(T)15-3′,); and 3 μL of diluted first-strand cDNA;
using a PTC-200 thermal cycler (Bio-Rad Laboratories, Hercules, USA). Each kit comprises
120 different arbitrary annealing control primers. PCR was carried out using the following
parameters: 1 cycle at 94°C for 5 min, 50°C for 3 min and 72°C for 1 min; 40 cycles at 94°C
for 40 s, 65°C for 40 s, 72°C for 40 s and 72°C for 5 min. The amplified PCR products were
separated in a 2% agarose gel and stained with ethidium bromide.
Page 26
- 12 -
10. Cloning and sequence analysis
RT-PCR bands of interest were extracted and reamplified with each ACP used for
ACP-based differential display RT-PCR and an adapter primer (5′-
CTGTGAATGCTGCGACTACGAT- 3′). The reamplified PCR products were cloned into a
TA-cloning plasmid vector, pGEM-T Easy Vector (Promega, Madison, USA), according to
the manufacturer’s instructions. The cloned vectors were sequenced using an automatic
sequencer, ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, USA). Complete
sequences were analysed by similarity searching using the BLASTN and BLASTX programs
from the National Center for Biotechnology Information (NCBI) Web page
(http://www.ncbi.nlm.nih.gov/blast/).
11. Gene-specific quantitative real-time RT-PCR
To validate the results of ACP-based differential display and to determine the mRNA
expression level of target genes, quantitative real-time PCR was performed. Total RNAs
from cells were treated with RNase-free DNase I (Invitrogen) at room temperature for 15
min to avoid amplification of genomic DNA; denatured at 70°C for 10 min; and
subsequently reverse transcribed by Superscript II reverse transcriptase (Invitrogen) with 0.5
µg of oligo (dT)15-18 primer in a volume of 20 µl according to manufacturer instructions.
Primers for real-time PCR of the target genes were designed using Primer Express Software
(Applied Biosystems) and confirmed to be unique sequences against target genes. The
Page 27
- 13 -
specific primers used were as follows: 5′-CACAGGGTGCCATGTACCG-3′ and 5′-
GAGGTCCTTGCCATACAGGG-3′ for mouse AnxA6; 5′-
GCTCTCCGCCGAAGTTAAGAA-3′ and 5′-TTCGCACAATATGATGCCGTC-3′ for
mouse Cnn3; 5′-CAATTTGCCCTCAGGGGTAAC-3′ and 5′-
TCCTCGGGAAAACCAGACTCA-3′ for mouse Col5a1; 5′-
GCTCCTGATTGGGGGACTCT-3′ and 5′-CCAACACGAAATACACGTTGAC-3′ for
mouse Col6a2; 5′-ACACTGGGCTTCATCATGCC-3′ and 5′-
ACTGCGAAGATCATCCTCAGG-3′ for mouse Gper; 5′-
CCCTGAAGACTCGGGCCTA-3′ and 5′-CAATTACAAGCGAAATGAGAGCC-3′ for
mouse Kitl; 5′-TGATCGAGGGCCGTCAGTTAT-3′ and 5′-
CTGTCACTCACCTTAAATTCCCC-3′ for mouse Myof; 5′-
AGCACCATCATCCCGGAATAC-3′ and 5′-GTACCAGGACTGGCTCGTTTG-3′ for
mouse Nfib; 5′-ACCGGACAGCTCGTTTTGG-3′ and 5′-
AGGGGACAGTACAAGTCACCC-3′ for mouse Scara5; 5′-
TGGAAACCATGATGCTTACGTT-3′ and 5′-GAAGCCCACTTTGCCATCTC-3′ for
mouse S100a10; 5′-GCTGCCTCCGAGTTCTACAG-3′ and 5′-
GCAGGGATTCGGTCACAGAG-3′ for mouse Eno1. To normalize the efficiency of real-
time RT-PCR reactions, the mouse Gadph gene was used as an internal standard with the
following primers: 5′-TGACCACAGTCCATGCCATC-3′ and 5′-
GACGGACACATTGGGGGTAG-3′. Real-time RT-PCR was performed using SYBR
Green PCR premix (Applied Biosystems). PCR reactions were performed in 20 µl of
reaction buffer containing 10 µl, 2× SYBR Green premix, 1 µl of forward and reverse
Page 28
- 14 -
primers (5 pmole/µl), and 1µl of cDNA. The following amplification parameters were used:
15 min preincubation for hot start polymerase activation at 95°C, followed by 45
amplification cycles at 95°C for 20 sec, 62°C for 20 sec, and 72°C for 40 sec. After the end
of the last cycle, the melting curve was generated by starting fluorescence acquisition at
60°C, and taking measurements every 0.2°C until 95°C. All measurements were performed
in triplicate. All real-time measurements were performed using the ABI Prism 7500
Sequence Detection System (Applied Biosystems) and melting curve analysis performed for
each gene.
12. Protein extraction and Western blot analysis
Cells were lysed in cell lysis buffer (10 mM HEPES, pH 7.4, 150 mM NaCl)
supplemented with protease inhibitors (25 mg/mL PMSF, 2 mg/mL leupeptin and 5 mg/mL
aprotinin). Protein concentrations were measured using a commercial reagent (Bio-Rad
Laboratories), and 20~80 μg of each sample was separated in an 8% sodium dodecyl sulfate-
polyacrylamide gel. The gels were electroblotted onto a polyvinylidene difluoride membrane.
The membrane was blocked for 1 h with 5% (w/v) bovine serum albumin (BSA). Blots were
incubated with primary antibodies for 2 h and then for 1 h with horseradish peroxidase
(HRP)-conjugated secondary antibody, prior to development using an ECL western blotting
chemiluminescence detection system (iNtRON, Seoul, Korea). Antibodies used for
immunoblotting analysis were: rabbit anti-Annexin A6 (AnxA6) antibody (Abcam,
Cambridge, UK; 1:500 dilution), rabbit anti-collagen type VI alpha 2 (Col6a2) antibody
Page 29
- 15 -
(Abcam, 1:500 dilution), rabbit anti-cleaved caspase-3 antibody (Cell Signaling, Boston,
USA; 1:500 dilution), rabbit anti-actin antibody (Santa Cruz Biotechnology, Santa Cruz,
USA; 1:5000 dilution) and HRP-conjugated goat anti-rabbit antibody (Santa Cruz
Biotechnology, 1:5000 dilution).
13. Ovariectomized (OVX) mouse model
The ovariectomized (OVX, n=10) and sham-operated (Sham, n=10) 8-weeks-old
female ddY mice were purchased from Shizuoka Laboratory Center Inc. (Hamamatsu,
Japan). Mice were maintained on a diet (5.0 g/day) of Formula-M07 (Feedlab Co., Ltd.,
Hanam, Korea) and tap water (15 ml/day). All mice were housed individually in clear plastic
cages under controlled temperature (23 ± 2°C), humidity (55 ± 5%), and illumination (12-
hour light/dark cycle). After 8 weeks of feeding, the bone mineral density (BMD) between
the two groups of mice was measured. The animal research protocol was approved by the
Animal Care and Use Committee of the Ajou University School of Medicine, and all
experiments were conducted in accordance with the institutional guidelines established by
the Committee.
14. Human subjects
The subjects from the Korean Association Resource (KARE) study which were used in
this study have been described in the previous report (Cho et al., 2009). Briefly, the
Page 30
- 16 -
participants were recruited from two community-based epidemiological cohorts, the rural
community of Ansung and the urban community of Ansan cities. A total of 8842 participants
(4183 men and 4659 women) aged from 40 to 69 years were recruited. Among the women
participants, 855 subjects who had been treated with any kind of drugs and 234 subjects who
did not participate in the measurement of bone density were excluded, and the remaining
3570 women subjects were finally investigated in this study. The basic characteristics of the
study subjects are described in Table 5.
The bone density is used as a proxy measure for bone strength, resistance to fracture,
and is widely used to screen bones for osteoporosis. Bone density was estimated by T-score
by dividing the difference of measured speed of sound (SOS) from mean SOS in healthy
young adult population by the standard deviation of SOS in young adult population. Bone
SOS was measured by quantitative ultrasound at the distal radius and mid-shaft tibia, using
the Omnisense 7000P QUS (Sunlight Medical Ltd, Tel-Aviv, Israel). For the case-control
analysis of osteoporosis, the subjects whose bone density T-scores at either the distal radius
or mid-shaft tibia were less than -2.5 SD were allocated to case and the subjects whose bone
densities T-scores at both the distal radius and mid-shaft tibia were more than -1 SD were
allocated to control, according to the general diagnostic categories to be established for adult
women (Kanis et al., 1994). This study was approved by the institutional review board of the
Korean National Institute of Health. Written informed consent was obtained from all subjects.
Page 31
- 17 -
15. Genotyping and selection of SNPs
The genotype data were provided by the Center for Genome Science, the Korea
National Institute of Health. The detailed genotyping and quality control processes have been
described in the previous report (Cho et al., 2009). Briefly, most DNA samples were isolated
from the peripheral blood of participants and genotyped using the Affymetix Genome-Wide
Human SNP array 5.0 (Affymetrix, Santa Clara, USA). The accuracy of the genotyping was
calculated by Bayesian Robust Linear Modeling using the Mahalanobis Distance (BRLMM)
genotyping algorithm (Rabbee and Speed, 2006). Samples that had lower genotyping
accuracies (≤ 98%), high missing genotype call rates (≥ 4%), high heterozygosity (> 30%) or
gender biases were excluded from this study. The SNPs in the seven genes that we analyzed
were selected based on their locations within the gene boundary (5 kb upstream and
downstream of the first and last exons, respectively) according to NCBI human genome
build 36 (Table 6). The locations of the SNPs were validated with the Ensemble BioMart
database (http://www.ensembl.org/biomart).
16. Statistical analysis
In the quantitative real-time RT-PCR analysis, all experiments were repeated at least 3
times unless stated otherwise and results were presented as the means ± SD as indicated.
Statistical significance between groups was calculated by a two-tailed Student’s t-test.
Probability values less than 0.05 (p < 0.05) were considered statistically significant.
Page 32
- 18 -
Most statistical analyses for association analysis were performed using the PLINK
version 1.07 (http://pngu.mgh.harvard.edu/~purcell/plink) and PASW Statistics version 17.0
(SPSS Inc., Chicago, USA). In the association analysis, linear regression was used to analyze
BD-RT (bone density estimated by T-score at distal radius) and BD-TT (bone density
estimated by T-score at midshaft tibia) as quantitative traits in the final 3570 women subjects,
controlling for cohort and age as covariates. The SNPs selected were also analyzed in the
osteoporosis case-control (n=651 vs. 1711) study using logistic regression analysis. All
association tests were performed under the additive, dominant and recessive models, and p-
values were adjusted for multiple tests by using the Bonferroni-corrected significance level
(p < 0.00185). Standard statistical significance (p < 0.05) was determined by the two-tailed
Student’s t-test. The Haploview version 4.2 program (Whitehead Institute for Biomedical
Research, Cambridge, USA) was used to examine the structure of the linkage disequilibrium
(LD) block (Barrett et al., 2005) using the KARE genotype data and the HapMap database
(International HapMap Project, http://www.hapmap.org/). We examined the LD coefficient r2
between all pairs of biallelic loci (Hedrick, 1987).
Page 33
- 19 -
III. RESULTS
A. In vitro and in vivo inhibition of glucocorticoid-induced
osteoporosis by the hexane extract of Poncirus trifoliata 1. Screening of the novel, effective natural sources on GIO
In order to discover novel natural sources effective against GIO, 68 edible Korean
native plants were screened. The Dex-induced apoptosis of osteoblastic cells through the
pathways involved in GC receptor and caspase activation were reported previously (Yun et
al., 2009). The inhibitory abilities of tested plants on Dex-induced apoptosis were compared
in osteoblastic cell line. Each of the plant extracts (50 μg/mL) was used to treat the
osteoblastic C3H10T1/2 cells, cotreated with 1 μM of Dex. The cells were cultured for 2
days and then the cell viability was determined by MTT assay (Table 1). Four plants that had
a protective effect against apoptosis were selected, and their activities in two osteoblastic cell
lines, C3H10T1/2 and MC3T3-E1, were further investigated. The inhibitory activities of the
extracts of the plants on Dex-induced apoptosis are summarized in Table 2. Three plants,
Poncirus trifoliata (L.), Schizandra chinensis and Ulmus davidiana, exhibited statistically
significant inhibitory effects on Dex-induced apoptosis in both cell lines, while Gardenia
jasminoides showed an inhibitory effect against apoptosis only in the MC3T3-E1 cell line.
Since three plants, except for Poncirus trifoliata (PT), have already been reported potentially
to inhibit osteoporosis in vitro (Ha et al., 2003; Suh et al., 2007; Caichompoo et al., 2009),
PT was selected as a final candidate and our study was focused on PT.
Page 34
- 20 -
Table 1. Inhibitory effects of the extracts from 68 Korean plants against
dexamethasone (Dex)-induced apoptosis of osteoblastic C3H10T1/2 cell line
No. Plant name Viability (%) No. p name Viability (%)
Control 100.0
Dex 68.0
1 Achyranthes japonica a 62.2 35 Ginkgo biloba b 61.1
2 Actinidia arguta b 70.2 36 Glycyrrhiza uralensis a 71.6
3 Agaricus bisporus a 64.0 37 Juglans sinensis b 60.7
4 Allium cepa b 54.8 38 Lenttinula edodes a 55.3
5 Allium fistulosum b 65.6 39 Leonurus sibiricus b 62.8
6 Allium sativum b 62.2 40 Lindera strychnifolia b 68.7
7 Allium tuberosum b 61.8 41 Lithospemum erythorhizon b 60.6
8 Angelica gigas b 71.3 42 Lycium chinense a 55.3
9 Angelica keiskei a 72.9 43 Maackia amurensis b 48.0
10 Aralia cordata a 66.0 44 Morus bombycis a 68.6
11 Artemisa capillaris b 62.3 45 Osmanthus heterophylla b 62.2
12 Atractylodes japonica b 67.8 46 Panax ginseng b 68.2
13 Atractylodes macrocephala a 67.1 47 Phyllostachys bamusoides a 64.8
14 Capsella bursa-pastoris b 66.3 48 Perilla frutescens a 71.9
15 Caragana sinica b 58.8 49 Phaseolus radiatus a 70.5
16 Celastrus orbiculatus b 61.1 50 Phellinus linteus a 62.3
17 Cercidiphyllum japonicum b 71.4 51 Phlomis umbrosa b 56.3
18 Chaenomeles sinensis b 69.2 52 Pinus densiflora b 50.7
19 Clematis mandshurica a 69.2 53 Pinus koraiensis b 67.5
20 Cnidium officinale a 58.8 54 Poncirus trifoliata a 75.3
21 Coix lachryma-jobi b 55.0 55 Pueraria thunbergiana b 56.8
22 Cordyceps militaris a 60.5 56 Pyrus pyrifolia b 68.0
23 Coriolus versicolor a 68.5 57 Quercus mongolica b 62.9
24 Cornus officinalis b 70.6 58 Rehmannia glutinosa b 64.5
25 Curcuma longa a 67.2 59 Rubus coreanus b 67.1
Page 35
- 21 -
26 Cuscuta chinensis a 66.2 60 Rumex crispus b 53.5
27 Daucus carota b 63.3 61 Schizandra chinensis a 84.9
28 Dictamnus dasycarpus b 64.2 62 Sorbus commixta b 58.8
29 Dioscorea quinqueloba b 69.4 63 Thea sinensis b 64.2
30 Diospyros kaki b 61.9 64 Trichosanthes kirilowii a 71.5
31 Elaeagnus macrophylla b 52.7 65 Ulmus davidiana b 89.7
32 Fraxinus rhychophylla a 60.5 66 Viscum album var. coloratum b 58.9
33 Ganoderma lucidum a 60.0 67 Zingiber officinale b 71.3
34 Gardenia jasminoides a 79.5 68 Zizyphus jujuba b 47.7
aEthanol or bmethanol extracts of 68 Korean native plants were gifts from the pharmaceutical
company, HL Genomics Co., Ltd (Yongin, Korea), and that were originally provided from the Korean
Plant Extract Bank (http://extract.pdrc.re.kr). Each of the 68 ethanol or methanol plant extracts (50
μg/ml) was used to treat the osteoblastic cell line, C3H10T1/2, cotreated with 1 μM of Dex. The cells
were cultured for 2 days and then cell viability was determined by MTT assay.
Page 36
- 22 -
Table 2. Inhibition of dexamethasone-induced apoptosis of osteoblastic cells by the
extracts from the selected Korean plants
Plant name Viability (%)
C3H10T1/2 MC3T3-E1
Control 100.0 100.0
Dex (1 μM) 64.9 ± 6.1** 70.0 ± 0.6**
Gardenia jasminoides a 71.9 ± 9.3 100.2 ± 8.4##
Poncirus trifoliata a 77.4 ± 4.9# 80.9 ± 1.9##
Schizandra chinensis a 89.1 ± 13.8# 91.4 ± 4.2##
Ulmus davidiana b 104.2 ± 5.3## 92.2 ± 3.0##
The values are means ± SD. The concentration of each plant ethanol extract was 50 μg/ml. aEthanol
extract, b Methanol extract. ** p < 0.01: significantly different from the control. # p < 0.05, ## p < 0.01:
significantly different from Dex-only treatment.
Page 37
- 23 -
2. In vitro inhibition of PT-H on Dex-induced apoptosis
The ethanol extract of PT was sequentially fractionated by n-hexane and water. The
inhibitory effect of each fraction was examined using the Dex-induced apoptosis model in
the osteoblastic C3H10T1/2 cell line. PT-H showed significant inhibitory effects, but not the
aqueous extract. For further detailed examination of the PT-H fraction, both C3H10T1/2 and
MC3T3-E1 were cotreated with each of three different concentrations of PT-H (10, 50 and
100 μg/mL) plus 1 μM of Dex, and after 48 h, the cell viabilities were determined by MTT
assay, TUNEL staining and caspase 3 cleavage test (Fig. 1). Dex significantly induced
apoptosis in both osteoblastic cell lines. PT-H protected against apoptotic cell death in both
cell lines; the significantly effective concentration of PT-H was 50 μg/mL. PT-H itself (50
μg/mL of PT-H in non-Dex-treated cells) did not influence cell viability in both cell lines
(Fig. 1A). These results indicate that increased osteoblastic cell viability by PT-H
cotreatment in Dex-treated cells resulted from inhibition of apoptosis rather than stimulation
of cell proliferation.
Page 39
- 25 -
Fig. 1. Effect of Poncirus trifoliata hexane extract (PT-H) on Dex-induced apoptosis of
osteoblastic cells. (A) Two osteoblastic cell lines, C3H10T1/2 and MC3T3-E1, were treated
with 1 μM dexamethasone (Dex), cotreated with 1 μM Dex and the indicated concentration
of PT-H, or treated with 50 μg/ml of PT-H, cultured for 2 days, and then tested for effect of
PT-H on Dex-induced apoptosis by MTT assay (A), TUNEL staining (B) and Caspase-3
cleavage test (C). For the Caspase-3 cleavage test, cells were lysed in cell lysis buffer and
protein samples (80 µg) were used for Western blot analysis. Actin was used as the internal
control. The values shown are the means ± SD from 3 independent experiments. ** p < 0.01
vs. control, # p < 0.05 vs. Dex.
Page 40
- 26 -
3. Inhibitory effect of PT-H on an in vivo GIO model
Next, the effects of PT-H were examined in vivo. To avoid the confounding effects of
female sex hormones, only male mice were used. The GIO-model mice were generated by
subcutaneous implantation of slow-release PD pellets (5 mg) for 4 weeks. The sham group of
seven mice was not treated with PD. Three groups of seven implanted mice each either
received daily PT-H extracts, SrCl2 (positive control), or nothing additional for an another 4
weeks, and then whole-body BMDs of the mice were determined using a PIXI-mus bone
densitometer (Fig. 2). All mice had similar initial body weights, and after 8 weeks, the rates
of mouse weight gain were not significantly different between the three groups. Furthermore,
throughout the 8-week experiment, no other abnormal clinical findings except osteoporosis
were seen in any of the mice. The mouse group treated with PD treatment (PD group)
revealed a significant reduction in BMD (approximately 3.8-fold) compared with the non-PD
treated mice group (sham). The positive controls treated with SrCl2 after PD treatment
(PD+SrCl2 group) showed an approximately 4.6-fold increase in BMD compared with the
PD group.
Surprisingly, the group treated with PT-H after PD treatment (PD+PT-H group)
exhibited significantly increased BMD (approximately 6.8-fold) compared with the PD
group. In addition, the BMD of the PD+PT-H group was approximately 4.8-fold higher than
the BMD of the sham group, indicating that PT-H may function not only to prevent BMD
reduction induced by PD, but also stimulates bone formation. The in vivo results suggest that
PT-H is more effective (approximately 2.2-fold) in GIO-mice than SrCl2.
Page 41
- 27 -
Fig. 2. Effect of Poncirus trifoliata hexane extract (PT-H) on the bone mineral density
(BMD) of mice treated with glucocorticoid. After 4 weeks of subcutaneous prednisolone
(PD) implantation, mice (7 mice/group) were fed either an experimental diet containing PT-
H extracts (100 mg/kg/day) (PD+PT-H), water containing strontium chloride (1,800
mg/kg/day) (PD+ SrCl2) or neither of them (PD) for 4 weeks. Sham represents mice with no
PD treatment. Whole-body BMD was measured using on-board PIXI-mus software for small
animals, and adjusted for mouse body weight. Results are expressed as percentage of change
of whole-body BMD adjusted for body weight. ** p < 0.01 vs. Sham, ## p < 0.01 vs. PD, ++ p
< 0.01 vs. PD+SrCl2.
Page 42
- 28 -
4. Screening and identification of DEGs in Dex-induced
osteoblastic cells with and without PT-H treatment
In order to clarify the molecular mechanisms behind the effect of PT-H on GIO, a
whole genome expression comparison study was performed. Differentially expressed genes
(DEGs) were screened and identified in Dex-induced osteoblastic cells with and without PT-
H treatment, using a gene expression differential display, the ACP-based PCR GeneFishing
DEG screening method (Kim et al., 2004). Two cell lines, C3H10T1/2 and MC3T3-E1, were
treated with dimethyl sulfoxide (DMSO) alone (control), 1 μM of Dex alone, or 1 μM of Dex
plus 50 μg/mL PT-H for 2 days. Total RNAs were isolated from the cells and used for first-
strand cDNA synthesis. The first-strand cDNAs were subjected to gene expression analysis.
Using 120 arbitrary ACP primers, GeneFishing DEG screening was performed and a total of
eight DEGs were found with clear differences in the three treatment groups. Figure 3 shows
the gel images for the eight DEGs, four DEGs in C3H10T1/2 cells and four DEGs in
MC3T3-E1 cells. All eight DEGs had increased mRNA expression levels in the Dex-treated
cells compared with the controls, and the levels decreased in cells cotreated with PT-H,
suggesting that mRNA expression of the DEGs may be controlled by PT-H.
To identify the DEGs, the RT-PCR bands were extracted, reamplified and PCR
fragments were isolated from gels and cloned and sequenced. BLASTN and BLASTX
searches in the NCBI GenBank revealed that all eight DEGs were known genes as listed in
Table 3. Interestingly, two DEGs screened from two different cell lines, DEGs 2 and 6 and
DEGs 3 and 7, were the same genes, AnxA6 and Col6a2, respectively.
Page 43
- 29 -
Fig. 3. Differential banding patterns of the 8 identified differentially-expressed genes
(DEGs). Two osteoblastic cell lines, C3H10T1/2 (A) and MC3T3-E1 (B), were treated with
1 μM DMSO (C), 1 μM dexamethasone (Dex) (D) or 1 μM Dex plus 50 μg/ml of Poncirus
trifoliata hexane extract (D+PT-H), and then cultured for 2 days. Annealing control primer
(ACP)-based RT-PCR was performed on the total RNAs isolated from the treated cells, and
RT-PCR products were resolved on 2% agarose gels and visualized by staining with
ethidium bromide. The ACP primer numbers are indicated at the bottom of the image of each
gel. The arrows with a number indicate DEGs.
Page 44
- 30 -
Table 3. List of significantly differentially-expressed genes (DEGs) in osteoblastic cells
with and without Poncirus trifoliata hexane extract (PT-H) treatment
DEG Expression level Gene GenBank Gene definition
No. C D D+PT-H symbol Accession No.
(A) C3H10T1/2 Cell line
1 + ++ + Gper NM_029771 G protein-coupled estrogen receptor 1
2 + ++ + AnxA6 NM_013472 Annexin A6
3 + ++ + Col6a2 NM_146007 Collagen type VI alpha 2
4 + ++ + Cnn3 NM_028044 Calponin 3
(B) MC3T3-E1 Cell line
5 + ++ + Scara5 NM_028903 Scavenger receptor class A member 5
6 + ++ + AnxA6 NM_013472 Annexin A6
7 + ++ + Col6a2 NM_146007 Collagen type VI alpha 2
8 + ++ + Kitl NM_013598 Stem cell growth factor, kit ligand
C, control; D, dexamethasone; D+PT-H, dexamethasone plus hexane extract of Poncirus trifoliata
Page 45
- 31 -
5. Validation of the identified DEGs by real-time RT-PCR and
Western blot analysis
To confirm the efficacy and accuracy of screening by ACP-based differential display
RT-PCR, fluorescence monitored quantitative real-time RT-PCR analysis was employed.
Gene-specific primers were designed to amplify RT-PCR products ranging from 100 to 250
bp. Quantitative real-time RT-PCR results of the eight DEGs are shown in Fig. 4, and
presented as relative ratios compared with the mouse Gapdh gene control with a value of 1.0.
The mRNA expression levels of six genes, Gper, AnxA6, Col6a2, Cnn3, Scara5 and Kitl,
were increased significantly in the Dex-treated cells compared with the controls, but the
mRNA levels were decreased in the Dex-plus-PT-H treated cells. These results are consistent
with the results of ACP-based differential-display RT-PCR, demonstrating the efficacy and
accuracy of GeneFishing DEG screening.
Two genes, AnxA6 and Col6a2, were selected for further study because they were both
identified in the two cell lines and their mRNA expression levels were highly influenced by
PT-H treatment. To further confirm AnxA6 and Col6a2 expression levels at the protein level,
western blot analysis was performed using specific antibodies (Fig. 5). In both cell lines, the
expression levels of annexin A6 (AnxA6) and collagen type VI alpha 2 (Col6a2) were
significantly increased in Dex-treated cells, but significantly decreased almost to the control
level in Dex-plus-PT-H-cotreated cells. Together with real-time RT-PCR results, western
blot analysis demonstrated that at least two genes, AnxA6 and Col6a2, are involved in PT-H
inhibition of Dex-induced apoptosis in osteoblastic C3H10T1/2 cells.
Page 46
- 32 -
Fig. 4. Validation of 8 identified differentially-expressed gene (DEG) mRNAs by
quantitative real-time RT-PCR analysis. Real-time RT-PCR was performed using the
same total RNAs as in Fig. 3. The mRNA expression level for each gene was quantified and
the data represent the relative ratio of dexamethasone-treated samples (Dex) and Dex-plus-
Poncirus trifoliata hexane extract-(PT-H)-cotreated samples (Dex+PT-H) compared to
DMSO-only-treated samples (control) in C3H10T1/2 (A) and MC3T3-E1 (B) cell lines. The
Dex-insensitive housekeeping gene, Gapdh, was used for plotting the relative standard curve
(internal control). Each experiment was repeated 3 times.
*p < 0.05, **p < 0.01 vs. control; # p < 0.05, ## p < 0.01 vs. Dex.
Page 47
- 33 -
(A)
(B)
Fig. 5. Validation of 2 representative differentially-expressed genes (DEGs), AnxA6 and
Col6a2, at the protein level by Western blot analysis. Two osteoblastic cell lines,
C3H10T1/2 (A) and MC3T3-E1 (B), were treated with 1 μM DMSO (Control), 1 μM
dexamethasone (Dex), 1 μM Dex plus 50 μg/ml of Poncirus trifoliata hexane extract
(Dex+PT-H), or 50 μg/ml PT-H (PT-H), and then cultured for 2 days. Cells were lysed in
cell lysis buffer and protein samples (20 µg) were used for Western blot analysis. Actin was
used as the internal control. Western blots of 3 independent experiments were quantified and
normalized to actin. * p < 0.05 vs. control, # p < 0.05 vs. Dex.
Page 48
- 34 -
6. Effect of PT-H on the expression of AnxA6 in GIO-mice
The study investigated whether PT-H changed the in vivo expression levels of two
gene proteins, AnxA6 and Col6a2, using western blot analysis. After BMD was measured,
the mice were killed and the bones and skeletal muscles of the lower limbs were isolated and
used for western blot analysis (Fig. 6). In bones, the expression level of AnxA6 was
significantly increased in the PD group compared with the sham group, but the expression of
AnxA6 was dramatically decreased in the PD + PT-H group compared with the PD group.
Col6a2 was not detected in bones for unknown reasons. In contrast, in skeletal muscles, the
expression levels of AnxA6 were similar among the three treatment groups. These results
indicate that PT-H influences the change in AnxA6 expression level in bones, but not in
skeletal muscles of PD-induced GIO-mice, suggesting that AnxA6 plays a key role in the in
vivo inhibition of GIO by PT-H.
Page 49
- 35 -
(A)
(B)
Fig. 6. Effect of Poncirus trifoliata hexane extract (PT-H) on the expression of AnxA6 in
GIO-mice. Western blotting of AnxA6 and Col6a2 was performed using protein samples (80
µg) isolated from bone (A) and skeletal muscle (B) of the same mice used in Fig. 2. Mean
band intensities of 3 representative mice from each group were calculated. Actin was used as
an internal control. * p < 0.05 vs. Sham, # p < 0.05 vs. PD.
Page 50
- 36 -
B. Genetic association between single nucleotide polymorphisms in
the ANXA6 gene and bone density/osteoporosis
1. Study design
The flow chart of the study design is shown in Fig. 7. We carried out a series of
experiments on cell line model, mouse model and humans step-by-step for identifying novel
genes for susceptibility to osteoporosis. The first experiment was the screening and
identification of the differentially expressed genes (DEGs) in dexamethasone (Dex)-treated
osteoblastic MC3T3-E1 cell line, using a RT-PCR-based gene expression differential display
approach, the ACP-based PCR GeneFishing DEG screening method. Next, the identified
DEGs were validated by quantitative real-time PCR with the gene-specific primers in the
Dex-treated cells. In the next step, we tried to evaluate the accuracy of the identified DEGs
in vivo, and carried out quantitative real-time PCR with the gene-specific primers in the
ovariectomized mice. Lastly, in order to determine whether the genetic variations of the
selected DEGs were associated with bone density and osteoporosis, we performed
association analysis in a large Korean Women’s Cohort (n= 3570).
Page 51
- 37 -
Fig. 7. The flow chart of the study.
Page 52
- 38 -
2. Screening and identification of the DEGs in Dex-treated
osteoblastic cell line model
To identify the differentially expressed genes (DEGs) in the in vitro osteoporosis
model, we performed a whole-genome comparative expression study using a RT-PCR based
gene expression differential display, the Annealing control primer (ACP)-based PCR
GeneFishing DEG screening method (Kim et al., 2004). To establish an in vitro osteoporosis
model, mouse osteoblastic cell line, MC3T3-E1, was treated with 1 μM of synthetic
glucocorticoid, dexamethasone (Dex) for 2 days. The cells were cultured for 2 days and then
cell viability and cell apoptosis were analyzed by the MTT assay and TUNEL assay,
respectively (Fig. 8). Dex-induced apoptosis in MC3T3-E1 cells was confirmed. Total RNAs
were isolated from the cells and used for first-strand cDNA synthesis. The first-strand
cDNAs were subjected to gene expression differential display.
Using 120 arbitrary ACP primers, GeneFishing DEG screening was performed and a
total of 10 DEGs that showed clear differences between the two treatment groups were found.
Fig. 9 shows the gel images for the 10 DEGs; 9 DEGs had increased mRNA expression
levels in the Dex-treated cells compared with the controls and 1 DEG showed decreased
mRNA expression level in the Dex-treated cells.
To identify the DEGs, the RT-PCR bands were extracted, re-amplified, and PCR
fragments were isolated from gels, cloned and sequenced. BLASTN and BLASTX searches
in the NCBI GenBank revealed that all the 10 DEGs were known genes as listed in Table 4.
The expression levels of Annexin A6 (AnxA6), Calponin 3 (Cnn3), Collagen type V alpha 1
Page 53
- 39 -
(Col5a1), Collagen type VI alpha 2 (Col6a2), Kit ligand (Kitl), Myoferlin (Myof), Nuclear
factor I/B (Nfib), Scavenger receptor class A member 5 (Scara5), and S100 calcium binding
protein A10 (S100a10), were increased in the Dex-treated cells, however the expression
level of Enolase 1 (Eno1) was decreased in the Dex-treated cells.
Page 54
- 40 -
Fig. 8. Effect of dexamethasone on apoptosis in mouse osteoblastic MC3T3-E1 cell line.
MC3T3-E1 cells were treated with 1 μM dexamethasone (Dex) or 1×PBS (control), cultured
for 2 days, and then tested for the effect of Dex on apoptosis by the MTT assay (A) and
TUNEL staining (B). The values shown are the means ± SD from three independent
experiments. ** p < 0.01 vs. control.
Page 55
- 41 -
Fig. 9. Differential banding patterns of the 10 identified differentially expressed genes
(DEGs). The arrows with the gene name indicate the up-regulated (A) or down-regulated (B)
DEGs in the Dex-treated cells compared to untreated control cells. Osteoblastic MC3T3-E1
cell line was treated with 1×PBS (Con) or 1 μM dexamethasone (Dex), and then cultured for
2 days. Annealing control primer (ACP)-based RT-PCR was performed on the total RNAs
isolated from the treated cells, and RT-PCR products were resolved on 2% agarose gels and
visualized by staining with ethidium bromide.
Page 56
- 42 -
Table 4. List of the significantly differentially expressed genes (DEGs) in the
dexamethasone-treated mouse MC3T3-E1 cells
DEG Expression level Gene
symbol
GenBank
Accession No. Gene definition
No. Con Dex
(A) Up-regulation
1 + ++ AnxA6 NM_013472 Annexin A6
2 + ++ Cnn3 NM_028044 Calponin 3
3 + ++ Col5a1 NM_015734 Collagen, type V, alpha 1
4 ++ +++ Col6a2 NM_146007 Collagen, type VI, alpha 2
5 + ++ Kitl NM_013598 Kit ligand
6 + +++ Myof NM_177035 Myoferlin
7 + ++ Nfib NM_008687 Nuclear factor I/B
8 + +++ Scara5 NM_028903 Scavenger receptor class A, member 5
9 + +++ S100a10 NM_009112 S100 calcium binding protein A10
(B) Down-regulation
10 +++ ++ Eno1 NM_023119 Enolase 1
Abbreviations: Con, Control; Dex, dexamethasone
Page 57
- 43 -
3. Validation of the identified DEGs in the cell line model by
quantitative real-time RT-PCR
To confirm the efficacy and accuracy of screening by the ACP-based differential
display RT-PCR, fluorescence-monitored quantitative real-time RT-PCR analysis was
employed for the 10 genes. Gene-specific primers were designed to amplify RT-PCR
products ranging from 100 to 250 bp. Quantitative real-time RT-PCR results of the 10 genes
are shown in Fig. 10, and are presented as relative ratios compared with the mouse Gapdh
gene (internal control) with a value of 1.0. The mRNA expression levels of 8 genes, AnxA6,
Col5a1, Col6a2, Kitl, Myof, Nfib, Scara5 and S100a10, were increased significantly in the
Dex-treated cells compared with the controls, and Eno1 gene expression was decreased
significantly, thereby indicating that these results are consistent with the results of ACP-
based differential display shown in Fig. 9. The expression level of the Cnn3 gene, however,
was not different between the Dex-treated and untreated cells.
Page 58
- 44 -
Fig. 10. Validation of the mRNA expression levels of the 10 DEGs in the Dex-treated
MC3T3-E1 cells by quantitative real‐time RT‐PCR. Real-time RT-PCR was performed
using the same total RNAs as in Fig. 9. The mRNA expression level for each gene was
quantified and the data represents the relative ratio of dexamethasone-treated samples (Dex)
compared to 1× PBS-treated samples (Con) in MC3T3-E1 cells. The Dex-insensitive
housekeeping gene, Gapdh, was used for plotting the relative standard curve (internal
control). Each experiment was repeated three times. *p < 0.05, **p < 0.01 vs. control.
Page 59
- 45 -
4. Evaluation of the identified DEGs in the ovariectomized mouse
model by quantitative real-time RT-PCR
To evaluate the accuracy of the identified DEGs in vivo, we carried out comparative
analysis of gene expression levels in the identified DEGs between the ovariectomized
(OVX) mice group and sham-operated (Sham) control mice group. Each of the ten 8-week-
old female OVX and sham ddY mice was purchased and maintained in our laboratory for 4
weeks. Five OVX mice died during maintenance. At 16 weeks after ovariectomy, whole-
body BMD of the 10 sham mice and 5 OVX mice was calculated using a PIXI-mus bone
densitometer (Fig. 11). The OVX mice group demonstrated a significant reduction in BMD
(approximately 1.5 fold) compared with the sham-operated mice group. Then the mice were
sacrificed, and the femur bones were excised and frozen in liquid nitrogen. Total RNAs were
isolated from the frozen samples.
The mRNA expression levels of the identified DEGs were examined using the in vivo
samples by fluorescence-monitored quantitative real-time RT-PCR analysis. The expression
levels of 7 genes, AnxA6, Col5a1, Col6a2, Eno1, Kitl, Myof, and Scara5, among the 10
identified DEGs were significantly altered in the OVX group compared with the sham group,
but the expression level of Nfib and S100a10 genes were not significantly different between
the groups. These results suggested that these 7 genes may be involved in the development
of osteoporosis in the OVX mice model.
Page 60
- 46 -
Fig. 11. Comparison of the bone mineral density and the mRNA expression levels of the
10 DEGs between the sham and ovariectomized mice. (A) Whole-body BMD was
measured in the ovariectomized (OVX) or sham-operated control (Sham) mice (10 mice per
group) using on-board PIXI-mus software for small animals, and adjusted for the mouse
body weight. Results are expressed as a percentage change of whole-body BMD adjusted for
body weight (mean ± SD). **p < 0.01 vs. Sham mouse group. (B) Real-time RT-PCR was
performed using the total RNAs from the two mouse groups. The mRNA expression level
for each gene was quantified and the data represents the relative ratio of OVX mice
compared to Sham mice. The housekeeping gene, Gapdh, was used for plotting the relative
standard curve (internal control). Each experiment was repeated three times. *p < 0.05, ** p <
0.01 vs. Sham mouse group.
Page 61
- 47 -
5. Association analysis of the genetic variation in the identified
DEGs with bone density and osteoporosis in humans
We finally selected the 7 genes, AnxA6, Col5a1, Col6a2, Eno1, Kitl, Myof, and Scara5
that were evaluated both in the in vitro and in vivo osteoporosis models, as the target genes
for further study in human subjects. To investigate whether the genetic variations in these 7
selected genes influenced the bone density and susceptibility to osteoporosis, we performed
the quantitative trait analysis for bone density and osteoporosis case-control analysis for the
SNPs of the 7 genes in the Korean Association Resource (KARE) Women’s Study Cohort
(3570 subjects). The basic characteristics of the study subjects are shown in Table 5. The
mean age of the women subjects was 51.02 years, the mean BD-RT (bone density estimated
by T-score at the distal radius) was 0.20±1.55, and the mean BD-TT (bone density estimated
by T-score at the midshaft tibia) was -0.81±1.55 (Table 5). Linear regression analysis was
used to associate the genotypes with bone density traits, controlling for age and cohort as
covariates. The 116 single nucleotide polymorphisms (SNPs) were genotyped in the 7 genes
(Table 6). The genotyped 116 SNPs of the 7 genes were partitioned into a total 27 linkage
disequilibrium (LD) blocks, which was demonstrated by the Haplotype and PLINK program
using the KARE data. Therefore, the Bonferroni-corrected significance p-value threshold
was calculated as 0.00185 (0.05/27 LD blocks).
The results of association analysis between the 116 SNPs in the 7 genes and bone
density in the 3570 KARE women subjects are summarized in Table 7. Total 12 SNPs in the
4 genes (2 SNPs in ANXA6, 3 SNPs in COL5A1, 6 SNPs in MYOF and 1 SNP in SCARA5)
Page 62
- 48 -
were significantly associated with BD-RT trait, and total 28 SNPs in the 5 genes (4 SNPs in
ANXA6, 6 SNPs in COL5A1, 3 SNPs in ENO1, 9 SNPs in MYOF and 6 SNPs in SCARA5)
were significantly associated with BD-TT trait. Particularly, 1 SNP, rs868641 in the ANXA6
gene and 2 SNPs, rs7875570 and rs6537942 in the COL5A1 gene showed a highly
significant association with BD-TT trait and their p-values satisfied the Bonferroni-corrected
significance level (p < 0.001852).
For osteoporosis case-control association analysis, the control subjects (n=1711) and
osteoporosis case subjects (n=651) were analyzed. The results of case-control association
analysis between the 116 SNPs in the 7 genes and osteoporosis in the KARE women subjects
are summarized in Table 8. Total 14 SNPs in 5 genes (1 SNP in ANXA6, 6 SNPs in COL5A1,
1 SNP in ENO1, 4 SNPs in MYOF and 2 SNPs in SCARA5) were significantly associated
with osteoporosis.
Notably, 8 SNPs in the 5 genes (1 SNP in ANXA6, 1 SNP in COL5A1, 1 SNP in ENO1,
4 SNPs in MYOF and 1 SNP in SCARA5) were significantly associated with both the bone
density and osteoporosis traits (Tables 7 and 8). In all the 8 SNPs, their β-values in BD-RT
and BD-TT traits were in the same direction and showed consistent trends with the odds
ratios of osteoporosis. The location and basic LD of the analyzed SNPs in the ANXA6,
COL5A1, MYOF and SCARA5 genes are shown in Fig. 12. The SNPs that were significantly
associated with bone density and/or osteoporosis in the KARE women subjects are also
indicated. Interestingly, the 4 SNPs in the MYOF gene showing a significant association with
both bone density and osteoporosis were located in the same LD block of the gene (Fig. 12C).
Page 63
- 49 -
Table 5. Basic characteristics of the women subjects in the KARE study cohort
Characteristics Quantitative analysis
for bone density
Case-control analysis for osteoporosis
Control Case p value*
no. 3570 1711 651
Age (year) 51.02 ± 8.76 47.20 ± 6.57 59.46 ± 7.34 < 0.0001
BMI (kg/m2) 24.65 ± 3.19 24.20 ± 2.96 25.37 ± 3.51 < 0.0001
Distal Radius T score 0.20 ± 1.55 0.99 ± 1.14 -1.26 ± 1.64 < 0.0001
Midshaft Tibia T score -0.81 ± 1.55 0.31 ± 0.93 -3.11 ± 0.99 < 0.0001
Osteoporosis was defined as any bone density T score of -2.5 SD or below and control was defined as
both bone densities T-score of -1 SD over. *Significant differences in characteristics between the
control and case were determined by the two-tailed Student’s t-test. Abbreviation: BMI, body mass
index; KARE, Korean Association REsource.
Page 64
- 50 -
Table 6. Information on the SNPs in the seven analyzed genes
Gene Symbol
(gene name,
location)
No. SNP Position, bp Minor allele MAF Position within the gene
ANXA6 (Annexin A6, 5q32-q34)
1 rs7707871 150458487 A 0.142 DOWNSTREAM
2 rs17728338 150458511 T 0.095 DOWNSTREAM
3 rs868641 150465434 T 0.283 INTRONIC
4 rs4958893 150467184 A 0.283 INTRONIC
5 rs4958895 150467388 T 0.331 INTRONIC
6 rs7716383 150481440 T 0.098 INTRONIC
7 rs3792774 150483570 G 0.450 INTRONIC
8 rs10037814 150485709 A 0.240 INTRONIC
9 rs17659056 150485866 A 0.062 INTRONIC
10 rs9324676 150493483 T 0.085 INTRONIC
11 rs3815725 150498725 T 0.189 INTRONIC
12 rs2228458 150499181 G 0.485 SYNONYMOUS_CODING
13 rs13185827 150502813 C 0.087 INTRONIC
14 rs883887 150503356 G 0.310 INTRONIC
15 rs6871624 150505343 C 0.091 INTRONIC
16 rs4958899 150508292 G 0.091 INTRONIC
17 rs6859236 150515837 A 0.220 INTRONIC
18 rs1030199 150517822 A 0.083 UPSTREAM
COL5A1 (Collagen, type V, alpha 1, 9q34.2-q34.3)
1 rs7875570 136678649 A 0.054 INTRONIC
2 rs10858265 136683695 C 0.055 INTRONIC
3 rs4335205 136692219 G 0.430 INTRONIC
4 rs6537942 136699377 G 0.089 INTRONIC
5 rs10858270 136726337 A 0.493 INTRONIC
6 rs3922982 136726816 C 0.071 INTRONIC
7 rs6537946 136734315 A 0.082 INTRONIC
8 rs4319175 136736092 G 0.369 INTRONIC
Page 65
- 51 -
9 rs7848938 136736205 A 0.286 INTRONIC
10 rs11103479 136750244 A 0.411 INTRONIC
11 rs3109684 136751707 A 0.460 INTRONIC
12 rs12004951 136752105 G 0.399 INTRONIC
13 rs9409917 136755895 G 0.065 INTRONIC
14 rs10115005 136771257 T 0.360 INTRONIC
15 rs12684637 136773364 A 0.361 INTRONIC
16 rs7849193 136790645 C 0.320 INTRONIC
17 rs11103505 136793446 G 0.292 INTRONIC
18 rs11103507 136793484 A 0.292 INTRONIC
19 rs10858278 136793557 T 0.291 INTRONIC
20 rs12005720 136817841 G 0.127 INTRONIC
21 rs10776906 136831910 A 0.230 INTRONIC
22 rs11103535 136840820 T 0.144 INTRONIC
23 rs7874142 136844603 A 0.471 INTRONIC
24 rs3811149 136848624 C 0.470 INTRONIC
25 rs10858284 136853470 A 0.148 INTRONIC
26 rs9308278 136856967 G 0.254 INTRONIC
27 rs4842173 136857934 C 0.253 INTRONIC
28 rs4504708 136876365 C 0.389 3PRIME_UTR
29 rs3124937 136877931 G 0.387 DOWNSTREAM
COL6A2 (Collagen, type VI, alpha 2, 21q22.3)
1 rs4819202 46351697 A 0.047 INTRONIC
2 rs4819203 46351936 G 0.131 INTRONIC
3 rs2839109 46360608 T 0.353 INTRONIC
ENO1 (Enolase 1, alpha, 1p36.2)
1 rs10864368 8840900 A 0.115 DOWNSTREAM
2 rs11121247 8841382 T 0.067 DOWNSTREAM
3 rs6660137 8855829 G 0.067 INTRONIC
KITLG (Kit ligand, 12q22)
1 rs1472899 87475616 C 0.339 INTRONIC
2 rs3782179 87477457 G 0.339 INTRONIC
3 rs3782180 87477530 C 0.339 INTRONIC
Page 66
- 52 -
4 rs3782181 87477692 G 0.339 INTRONIC
5 rs4474514 87478090 G 0.339 INTRONIC
6 rs11104952 87480531 A 0.339 INTRONIC
7 rs1798011 87480756 A 0.020 INTRONIC
8 rs1352947 87484858 G 0.339 INTRONIC
9 rs10777129 87485844 T 0.338 INTRONIC
MYOF (Myoferlin, 10q24)
1 rs2797581 95060070 C 0.108 INTRONIC
2 rs787665 95062526 G 0.109 INTRONIC
3 rs787667 95063036 T 0.109 INTRONIC
4 rs787668 95063249 A 0.109 INTRONIC
5 rs1614065 95087527 A 0.052 INTRONIC
6 rs1891565 95088484 C 0.052 INTRONIC
7 rs4917747 95092192 T 0.164 INTRONIC
8 rs787695 95092211 T 0.052 INTRONIC
9 rs11187389 95092649 C 0.163 INTRONIC
10 rs787633 95109238 T 0.037 INTRONIC
11 rs787622 95126940 A 0.146 INTRONIC
12 rs10882229 95129516 A 0.186 INTRONIC
13 rs701863 95152238 G 0.350 INTRONIC
14 rs1617402 95157731 C 0.318 INTRONIC
15 rs10430653 95159046 G 0.331 INTRONIC
16 rs17108637 95161527 A 0.332 INTRONIC
17 rs701878 95162878 T 0.331 INTRONIC
18 rs788086 95168236 T 0.310 INTRONIC
19 rs7909892 95187051 C 0.071 INTRONIC
20 rs766083 95193394 T 0.220 INTRONIC
21 rs788104 95199686 A 0.226 INTRONIC
22 rs17108718 95211770 G 0.259 INTRONIC
23 rs17108751 95219488 A 0.254 INTRONIC
24 rs7911195 95221170 A 0.261 INTRONIC
25 rs7913298 95223365 G 0.026 INTRONIC
26 rs871427 95223383 C 0.499 INTRONIC
Page 67
- 53 -
27 rs2004558 95224472 C 0.478 INTRONIC
28 rs17108780 95224963 C 0.236 INTRONIC
29 rs7921092 95233798 T 0.262 UPSTREAM
SCARA5 (Scavenger receptor class A, member 5 (putative), 8p21.1)
1 rs10090925 27781432 G 0.374 DOWNSTREAM
2 rs6558023 27787698 G 0.272 INTRONIC
3 rs11778759 27796156 T 0.347 INTRONIC
4 rs11774576 27796336 G 0.425 INTRONIC
5 rs10092001 27796794 G 0.347 INTRONIC
6 rs4276642 27797075 G 0.355 INTRONIC
7 rs10090871 27800283 C 0.078 INTRONIC
8 rs2726959 27805263 T 0.298 INTRONIC
9 rs7002829 27814295 A 0.122 INTRONIC
10 rs7002838 27814310 G 0.077 INTRONIC
11 rs2726985 27818521 G 0.430 INTRONIC
12 rs2859667 27832922 C 0.386 INTRONIC
13 rs11136019 27837517 C 0.378 INTRONIC
14 rs4732792 27843228 A 0.381 INTRONIC
15 rs2685313 27848981 C 0.383 INTRONIC
16 rs4496925 27853141 C 0.422 INTRONIC
17 rs2726955 27853293 C 0.400 INTRONIC
18 rs2726948 27865306 A 0.194 INTRONIC
19 rs2726943 27873403 A 0.193 INTRONIC
20 rs2726941 27878513 A 0.398 INTRONIC
21 rs2726940 27879787 T 0.195 INTRONIC
22 rs2685399 27880817 C 0.386 INTRONIC
23 rs17393091 27881479 G 0.011 INTRONIC
24 rs2726934 27882821 T 0.395 INTRONIC
25 rs2727006 27888085 A 0.394 INTRONIC
Abbreviations: MAF, minor allele frequency.
Page 68
- 54 -
Table 7. The results of association analysis between the SNPs in the seven genes and
bone density in the KARE women subjects
Gene
SNP Minor MAF Women (n=3,570)
allele beta±s.e.m. Add p beta±s.e.m. Dom p beta±s.e.m. Rec p
BD-RT ( T-score at distal radius)
ANXA6 rs3815725 T 0.189 0.005 ± 0.04 0.895 0.043 ± 0.05 0.360 -0.244 ± 0.12 0.048
rs883887 G 0.310 0.038 ± 0.03 0.267 0.091 ± 0.05 0.044 -0.076 ± 0.08 0.326
COL5A1 rs6537946 A 0.082 0.120 ± 0.06 0.041 0.125 ± 0.06 0.043 0.196 ± 0.29 0.505
rs7874142 A 0.471 0.041 ± 0.03 0.194 -0.039 ± 0.05 0.439 0.162 ± 0.05 2.5E-03
rs3811149 C 0.470 0.032 ± 0.03 0.313 -0.042 ± 0.05 0.406 0.140 ± 0.05 9.4E-03
MYOF rs1614065 A 0.052 -0.007 ± 0.07 0.925 -0.021 ± 0.07 0.775 1.553 ± 0.77 0.045
rs1891565 C 0.052 -0.006 ± 0.07 0.931 -0.021 ± 0.07 0.780 1.553 ± 0.77 0.045
rs787695 T 0.052 -0.007 ± 0.07 0.923 -0.021 ± 0.07 0.772 1.553 ± 0.77 0.045
rs787633 T 0.037 0.013 ± 0.08 0.875 -0.005 ± 0.09 0.951 1.553 ± 0.77 0.045
rs17108751 A 0.254 -0.067 ± 0.04 0.079 -0.091 ± 0.05 0.046 -0.024 ± 0.10 0.811
rs871427 C 0.499 0.056 ± 0.03 0.086 0.038 ± 0.05 0.475 0.109 ± 0.05 0.038
SCARA5 rs11778759 T 0.347 0.067 ± 0.03 0.044 0.089 ± 0.05 0.051 0.083 ± 0.07 0.224
BD-TT (T-score at midshaft tibia)
ANXA6 rs17728338 T 0.095 -0.146 ± 0.06 8.6E-03 -0.128 ± 0.06 0.032 -0.707 ± 0.25 4.6E-03
rs868641 T 0.283 0.112 ± 0.04 1.6E-03 0.141 ± 0.05 2.0E-03 0.142 ± 0.08 0.086
rs4958893 A 0.283 0.104 ± 0.04 3.5E-03 0.136 ± 0.05 2.7E-03 0.112 ± 0.08 0.177
rs4958895 T 0.331 0.073 ± 0.03 0.033 0.081 ± 0.05 0.079 0.126 ± 0.07 0.082
COL5A1 rs7875570 A 0.054 0.095 ± 0.07 0.187 0.058 ± 0.08 0.444 1.272 ± 0.39 1.2E-03
rs10858265 C 0.055 0.096 ± 0.07 0.178 0.063 ± 0.08 0.405 1.113 ± 0.38 3.2E-03
rs6537942 G 0.089 0.076 ± 0.06 0.187 0.036 ± 0.06 0.558 0.892 ± 0.26 5.3E-04
Page 69
- 55 -
rs4319175 G 0.369 0.054 ± 0.03 0.106 0.109 ± 0.05 0.020 -0.005 ± 0.07 0.934
rs9308278 G 0.254 0.083 ± 0.04 0.025 0.090 ± 0.05 0.049 0.155 ± 0.09 0.100
rs4842173 C 0.253 0.084 ± 0.04 0.025 0.093 ± 0.05 0.043 0.145 ± 0.09 0.128
ENO1 rs10864368 A 0.115 -0.090 ± 0.05 0.077 -0.077 ± 0.05 0.161 -0.450 ± 0.22 0.043
rs11121247 T 0.067 -0.175 ± 0.06 6.3E-03 -0.184 ± 0.07 6.5E-03 -0.268 ± 0.32 0.405
rs6660137 G 0.067 -0.160 ± 0.06 0.012 -0.176 ± 0.07 9.2E-03 -0.108 ± 0.31 0.730
MYOF rs2797581 C 0.108 0.064 ± 0.05 0.209 0.046 ± 0.06 0.414 0.393 ± 0.20 0.047
rs787665 G 0.109 0.063 ± 0.05 0.221 0.042 ± 0.06 0.457 0.461 ± 0.21 0.027
rs787667 T 0.109 0.058 ± 0.05 0.256 0.035 ± 0.06 0.527 0.447 ± 0.20 0.027
rs787668 A 0.109 0.059 ± 0.05 0.248 0.034 ± 0.06 0.543 0.489 ± 0.20 0.017
rs1614065 A 0.052 -0.017 ± 0.07 0.817 -0.032 ± 0.07 0.666 1.626 ± 0.79 0.039
rs1891565 C 0.052 0.002 ± 0.07 0.980 -0.013 ± 0.07 0.863 1.625 ± 0.78 0.038
rs787695 T 0.052 -0.015 ± 0.07 0.841 -0.030 ± 0.07 0.689 1.626 ± 0.79 0.039
rs787633 T 0.037 0.073 ± 0.09 0.395 0.055 ± 0.09 0.525 1.626 ± 0.79 0.039
rs7913298 G 0.026 -0.225 ± 0.10 0.025 -0.234 ± 0.10 0.024 -0.243 ± 0.68 0.721
SCARA5 rs7002829 A 0.122 -0.033 ± 0.05 0.500 -0.007 ± 0.05 0.895 -0.360 ± 0.18 0.043
rs2859667 C 0.386 0.046 ± 0.03 0.154 0.092 ± 0.05 0.048 0.008 ± 0.06 0.903
rs2726941 A 0.398 -0.079 ± 0.03 0.015 -0.082 ± 0.05 0.085 -0.145 ± 0.06 0.018
rs2685399 C 0.386 -0.086 ± 0.03 8.4E-03 -0.089 ± 0.05 0.058 -0.158 ± 0.06 0.012
rs2726934 T 0.395 -0.083 ± 0.03 0.011 -0.096 ± 0.05 0.042 -0.133 ± 0.06 0.032
rs2727006 A 0.394 -0.089 ± 0.03 6.4E-03 -0.102 ± 0.05 0.031 -0.144 ± 0.06 0.020
The p-values below the Bonferroni-corrected significance level (p < 0.001852) are indicated in bold and
underlined, and the p-values below the standard significance level (p < 0.05) are indicated in bold.
Abbreviations: Add p, additive genetic model p-value; BD-RT, bone density estimated by T-score at distal
radius; BD-TT, bone density estimated by T-score at midshaft tibia; Dom p, dominant genetic model p-value;
KARE, Korean Association REsource; MAF, minor allele frequency; Rec p, recessive genetic model p-value;
s.e.m, standard error.
Page 70
- 56 -
Table 8. The results of case-control association analysis between the SNPs in the seven
genes and osteoporosis in the KARE women subjects
Gene SNP Minor MAF Women (1711 controls, 651 cases)
allele OR (95% CI) Add p OR (95% CI) Dom p OR (95% CI) Rec p
ANXA6 rs17728338 T 0.095 1.39 (1.06-1.83) 0.018 1.36 (1.01-1.82) 0.041 3.53 (1.07-11.62) 0.038
COL5A1 rs4335205 G 0.430 1.20 (1.02-1.43) 0.031 1.40 (1.08-1.81) 0.010 1.13 (0.83-1.53) 0.434
rs4319175 G 0.369 0.88 (0.74-1.05) 0.154 0.78 (0.61-0.99) 0.039 1.02 (0.72-1.43) 0.931
rs9409917 G 0.065 1.16 (0.83-1.61) 0.377 1.23 (0.87-1.74) 0.243 NA 0.998
rs12005720 G 0.127 0.85 (0.67-1.10) 0.214 0.90 (0.68-1.19) 0.448 0.39 (0.15-0.99) 0.048
rs11103535 T 0.144 1.21 (0.96-1.53) 0.106 1.16 (0.89-1.52) 0.264 2.17 (1.04-4.51) 0.039
rs10858284 A 0.148 0.73 (0.58-0.93) 0.012 0.72 (0.55-0.95) 0.022 0.49 (0.22-1.11) 0.087
ENO1 rs11121247 T 0.067 1.41 (1.02-1.97) 0.041 1.44 (1.01-2.04) 0.042 1.68 (0.28-10.07) 0.573
MYOF rs2797581 C 0.108 0.81 (0.61-1.06) 0.121 0.86 (0.63-1.15) 0.307 0.20 (0.05-0.80) 0.022
rs787665 G 0.109 0.83 (0.63-1.09) 0.186 0.87 (0.65-1.18) 0.374 0.25 (0.06-0.99) 0.048
rs787667 T 0.109 0.84 (0.64-1.10) 0.202 0.89 (0.67-1.20) 0.461 0.21 (0.05-0.81) 0.024
rs787668 A 0.109 0.84 (0.64-1.10) 0.192 0.89 (0.66-1.20) 0.442 0.21 (0.05-0.81) 0.024
SCARA5 rs2726959 T 0.298 1.19 (0.99-1.43) 0.064 1.11 (0.88-1.41) 0.390 1.79 (1.18-2.71) 6.1E-03
rs7002829 A 0.122 1.18 (0.92-1.52) 0.185 1.09 (0.82-1.45) 0.534 2.93 (1.32-6.50) 8.2E-03
The p-values below the standard significance level (p < 0.05) are indicated in bold. Abbreviations: Add p, additive
genetic model p-value; CI, confidence interval; Dom p, dominant genetic model p-value; KARE, Korean
Association REsource; MAF, minor allele frequency; OR, odds ratio; Rec p, recessive genetic model p-value; NA,
not applicable.
Page 73
- 59 -
Fig. 12. Location and basic linkage disequilibrium (LD) of the analyzed SNPs in the
ANXA6 (A), COL5A1 (B), MYOF (C) and SCARA5 (D) genes. Gene structure of each gene
is depicted at the top of the figure with coding exons. The locations of the SNPs genotyped
in this study are indicated. The basic LD plot of the studied SNPs across each gene that are
generated by using the Haploview program from the KARE data of Korean population is
shown. The SNPs indicated by closed circles (●) in the bottom panel are the SNPs that were
significantly associated with bone density in the KARE women subjects. The SNPs indicated
by reverse triangles (▼) in the bottom panel are the SNPs that were significantly associated
with osteoporosis in the KARE women subjects.
Page 74
- 60 -
IV. DISCUSSION
A. In vitro and in vivo inhibition of glucocorticoid-induced
osteoporosis by the hexane extract of Poncirus trifoliata
Pharmacological therapies for preventing or treating GIO should be continued as long
as the patient is receiving glucocorticoids. Recently, as an alternative long-term therapeutic
option against GIO, herbal medicine has come to our attention because of the potential for
fewer side effects, making it suitable for long-term use. Extensive screening of natural
botanical sources for effective osteoporosis treatment has been performed mainly in Asian
countries. Two screened plants, Carthamus tinctorius and Drynaria fortunei, were tested in
vivo, and their effects were demonstrated in mice or rats with osteoporosis (Kim et al., 2002;
Wong and Rabie, 2006).
In this study, 68 Korean native plants were screened to find novel, effective botanical
sources for in vivo as well as in vitro treatment of GIO, and Poncirus trifoliata (L.) was
selected as the final botanical candidate. PT has been widely used in folk medicine as a
remedy for gastritis, dysentery, inflammation, digestive tract ulcers, uterine contraction,
relaxation and cardiovascular diseases (Kim et al., 1999; Lee et al., 2005; Shim et al., 2009).
Pharmacological studies have revealed that PT extracts (primarily water extracts) have
several biological activities, including antibacterial, anti-anaphylactic, anti-inflammatory and
anti-cancer activity (Yi et al., 2004; Park et al., 2005; Shin et al., 2006; Jayaprakasha et al.,
2007; Lee et al., 2008; Lee et al., 2009). Several compounds, such as auraptine, coumarins,
Page 75
- 61 -
hesperidin, naringin, neohesperidin, poncirin and 21-methymelianodiols have been identified
from PT (Park et al., 2005; Lee et al., 2008; Lee et al., 2009). Although there have not been
any published data associating PT or its extracts with bone metabolism, previous data
suggested that PT has a protective effect against tissue injury (Lee et al., 2009). Components
isolated from PT, neohesperidin and poncirin, were reported to have a strong protective
effect against HCl/ethanol-induced gastric mucosal lesions, in addition to anti-oxidative
activity (Lee et al., 2009).
This is the first report demonstrating that PT has an inhibitory effect on osteoporosis in
vitro and in vivo. Water and acetone extracts of PT were reported previously to induce
apoptosis in cancer cells (Yi et al., 2004; Jayaprakasha et al., 2007). By contrast, this study
demonstrated that the hexane extract of PT (PT-H) inhibited the apoptosis of osteoblastic
cells. It has been shown recently that the decreased bone formation seen in GIO is mainly
attributed to the apoptosis of bone cells (Spreafico et al., 2008). Glucocorticoids induce
apoptosis of both osteoblasts and osteocytes, resulting in the impairment of bone formation
(Alesci et al., 2005; Spreafico et al., 2008; Yun et al., 2009). Our in vitro results demonstrate
that PT-H inhibits apoptotic cell death of Dex-induced osteoblastic cells (Fig. 1).
Furthermore, our in vivo results provide strong evidence that PT-H has not only an inhibitory
effect on bone loss caused by prednisolone (PD), but also promotes bone formation (Fig. 2),
suggesting that the extract may be involved in cell differentiation as well as apoptosis
inhibition in osteoblastic cells. In addition, the animal results suggest that PT-H may be more
effective than SrCl2, which is known to prevent calcium loss and osteoporosis (Cabrera et al.,
1999). In comparison with in vivo data on Carthamus tinctorius and Drynaria fortunei (Kim
Page 76
- 62 -
et al., 2002; Wong and Rabie, 2006), PT-H appears to have a bone-protecting effect against
GC to a similar degree as those two plants.
To investigate the molecular mechanisms behind the inhibitory effect of PT-H against
GIO, DEGs were screened and identified in Dex-induced osteoblastic cells with or without
PT-H, using ACP-based differential display RT-PCR (GeneFishing DEG screening
technology) (Kim et al., 2004). This method has substantially improved the specificity and
sensitivity of PCR by eliminating the false-positives and poor reproducibility of previous
DEG discovery methods such as cDNA microarray, and has provided new insights into the
efficacious analysis of differential gene expression in tissues and cell lines, thereby allowing
accurate products to be amplified (Kim et al., 2004). In fact, validation of the identified
genes by quantitative real-time RT-PCR using gene-specific primers and Western blot
analysis demonstrated the efficacy and accuracy of this tool. Interestingly, the products of all
six identified DEGs are closely associated with bone homeostasis: Gper is a factor involved
in the regulation of bone mass (Heino et al., 2008); Cnn3 is known to be involved in the
regulation of bone morphogenetic protein (BMP)-dependent cellular responses (Haag and
Aigner, 2007); Scara5 promotes osteoclast differentiation (Takemura et al., 2009); Kitl is
known to play a role in the regulation of peak bone mass (Lotinun et al., 2005); Col6a2 is a
component of type VI collagen, a fibril-forming collagen (Leclerc et al., 2004); and AnxA6 is
in a family of Ca2+- and phospholipid binding proteins and involved in matrix vesicle
calcification (Chen et al., 2008).
It was previously reported that the expression level of annexin A6 (AnxA6) was
significantly increased in response to Dex treatment in human marrow stromal cells, a result
Page 77
- 63 -
similar to our data (Dieudonne et al., 1999). In addition, Dex treatment of osteoblastic cells
increased the expression of collagen type VI alpha 1 (Col6a1), another component of
collagen type VI, more than 2.5-fold (Leclerc et al., 2004). These results confirm the
accuracy of the ACP-based differential display RT-PCR in this study. Taken together with
these results, since AnxA6 and Col6a2 were identified in two different osteoblastic cell lines
(C3H10T1/2 and MC3T3-E1) by the DEG screening experiment, it is highly possible that
these two genes are closely associated with the bone-protecting effect of PT-H in GIO.
Furthermore, since the expression levels of AnxA6 were significantly changed by PT-H
treatment in the PD-treated GIO-model mice, AnxA6 is thought to be a key gene playing a
major role in the inhibitory effects of PT-H on GIO both in vivo and in vitro. Although the
molecular mechanism of PT-H-mediated change in AnxA6 expression remains unclear, the
relationships between AnxA6 and bone homeostasis have been demonstrated. A previous
study reported that polymorphisms in the AnxA6 gene were significantly associated with a
high risk for osteonecrosis of the femoral head in the Korean population (Kim et al., 2009),
and another demonstrated that AnxA6 is involved in the matrix vesicle calcification
necessary for the mineralization of bone and cartilage (Chen et al., 2008).
Osteoporosis is a common disease with a strong genetic component. Although several
genetic factors have been identified that contribute to the pathogenesis of osteoporosis by
influencing bone mineral density, bone mass, bone strength and bone turnover (Ralston and
de Crombrugghe, 2006), most causal genes remain to be discovered. Our results, together
with the results of a previous study (Kim et al., 2009), indicate that AnxA6 may be one of the
genetic regulators of bone mass and susceptibility to osteoporosis. Previous reports have
Page 78
- 64 -
provided strong evidence that the AnxA6 gene regulates cell survival and the death of bone
cells, including proliferation, growth, necrosis and apoptosis (Theobald et al., 1994; Kim et
al., 2009; Vila de Muga et al., 2009). Overexpression of AnxA6 suppresses proliferation, and
knockdown of AnxA6 increases Ras activity and cell proliferation in cancer cells (Theobald
et al., 1994; Vila de Muga et al., 2009). Our data support the previously identified functions
of AnxA6 in bone cells; the increased AnxA6 expression caused by Dex treatment induced
apoptosis of osteoblastic cells, and decreased AnxA6 expression caused by PT-H treatment
suppressed apoptosis of osteoblastic cells both in vitro and in vivo. Recently, the AnxA6-
related molecular mechanisms involved in Ras signaling have been clarified. Annexin A6
inhibits Ras signaling through the formation of a complex with the GTPase-activating
proteins, p120GAP and H-Ras (Vila de Muga et al., 2009). Further investigation is necessary
to elucidate the role of AnxA6 in Ras signaling in bone cells.
In summary, it was demonstrated that PT-H exhibited marked inhibition of
glucocorticoid-induced osteoporosis in vitro and in vivo, and AnxA6 may play a key role in
this effect. Further studies of the components isolated from PT-H may lead to the
identification of the active substance(s) that inhibit GIO, and provide invaluable information
toward elucidating the therapeutic properties of PT for the treatment of GIO.
Page 79
- 65 -
B. Genetic association between single nucleotide polymorphisms in
the ANXA6 gene and bone density/osteoporosis
Many approaches for identifying the genetic factors contributing to the pathogenesis of
osteoporosis have been studied and have contributed to the detection of numerous genes for
susceptibility to osteoporosis (Ralston and Uitterlinden, 2010). Among them, GWAS has
been extensively executed for identifying the loci and genes that are significantly associated
with bone density and osteoporosis. A major advantage of GWAS is that it offers the ranking
for significance in multiple association signals across the genome. Since the statistical
significance thresholds are very stringent due to the analysis of a large number of SNPs,
many polymorphisms having a true association with osteoporosis but with a relatively small
effect size can be missed (Ralston and Uitterlinden, 2010). This may lead to missing an
opportunity to identify the novel osteoporosis susceptibility genes. In this study, to identify
the novel genes more accurately as well as more effectively, we combined two methods, i.e
whole genome expression profiling for screening of candidate genes and candidate gene
association study.
In the series of experiments in the in vitro and in vivo osteoporosis models and
eventually in human subjects, we identified 5 novel osteoporosis susceptibility genes,
ANXA6, COL5A1, ENO1, MYOF and SCARA5. The results from each step of the
experiments in the cell line model, mouse model and humans are summarized in Table 5. In
the screening step of the DEGs in the cell line model, 10 candidate genes were screened.
During the validation and evaluation steps in the cell line and mouse models, respectively,
Page 80
- 66 -
the 5 genes showing false positive results were ruled out, and the 5 genes that passed all the
steps of the experiment were finally selected.
The ANXA6 gene encodes Annexin A6 which belongs to a family of calcium-
dependent membrane and phospholipid binding proteins, and is involved in matrix vesicle
calcification (Thomas et al., 2002; Gerke et al., 2005; Chen et al., 2008). Annexin A6 binds
to phospholipids in cellular membranes in a dynamic and reversible fashion and is implicated
in membrane-related events along the exocytotic and endocytotic pathways (Enrich et al.,
2011). Previous reports have documented that Annexin A6 is involved in cell proliferation,
growth and apoptosis (Theobald et al., 1994; Kim et al., 2011). Annexin A6 participates in
the regulation of EGFR/Ras signaling pathway and cholesterol homeostasis (Vila de Muga et
al., 2009; Grewal et al., 2010; Enrich et al., 2011). The SNPs in the ANXA6 gene have been
reported to be associated with osteonecrosis of the femoral head in the Korean population
(Kim et al., 2009). Although the phenotypes in this disease differ from those in osteoporosis,
since the polymorphisms in this gene are associated with the phenotypes related with bone
loss, it is very likely that the ANXA6 gene plays an important role in the pathogenesis of
osteoporosis.
Page 81
- 67 -
Table 9. The summary of the results from each step of the experiments in the cell line,
mouse model and humans
Mouse DD qRT-PCR (mean ± SD) Humans Number Number of associated SNPs (lowest p-value)
Gene Cell line Cell model Mouse model Gene of tested Human (women)
symbol Con Dex Con Dex Sham OVX symbol SNPs BD-RT BD-TT Osteoporosis
AnxA6 + ++ 1.0 2.8 ± 0.1** 1.0 1.5 ± 0.2# ANXA6 18 2 (0.044) 4 (1.6ⅹ10-3)† 1 (0.018)
Cnn3 + ++ 1.0 1.3 ± 0.2 1.0 1.1 ± 0.1 CNN3 - - - -
Col5a1 + ++ 1.0 2.1 ± 0.5* 1.0 1.9 ± 0.5# COL5A1 29 3 (2.5ⅹ10-3) 6 (5.3ⅹ10-4)† 6 (0.010)
Col6a2 ++ +++ 1.0 2.8 ± 0.2* 1.0 2.2 ± 0.6# COL6A2 3 0 0 0
Eno1 +++ ++ 1.0 0.8 ± 0.1* 1.0 0.7 ± 0.1# ENO1 3 0 3 (6.3ⅹ10-3) 1 (0.041)
Kitl + ++ 1.0 2.6 ± 0.6* 1.0 1.9 ± 0.5# KITLG 9 0 0 0
Myof + +++ 1.0 3.2 ± 0.2** 1.0 2.3 ± 0.4## MYOF 29 6 (0.038) 9 (0.017) 4 (0.022)
Nfib + ++ 1.0 2.6 ± 0.3* 1.0 1.1 ± 0.4 NFIB - - - -
Scara5 + +++ 1.0 3.0 ± 0.2** 1.0 2.2 ± 0.3## SCARA5 25 1 (0.044) 6 (6.4ⅹ10-3) 2 (6.1ⅹ10-3)
S100a10 +++ ++ 1.0 2.4 ± 0.4** 1.0 1.2 ± 0.1 S100A10 - - - -
Abbreviations: BD-RT, bone density estimated by T-score at the distal radius; BD-TT, bone density estimated
by T-score at the midshaft tibia; Con, control; DD, differential display; Dex, dexamethasone; OVX,
ovariectomy; qRT-PCR, quantitative reverse transcriptase polymerase chain reaction; - , not tested; * p < 0.05
vs. control; ** p < 0.01 vs. control; # p < 0.05 vs. sham; ## p < 0.01 vs. sham; †, the lowest p-value satisfying
the Bonferroni-corrected significance level (p < 0.00185).
Page 82
- 68 -
The COL5A1 gene encodes the alpha 1 chain of type V collagen, one of the low abundance
fibrillar collagens. The COL1A1 gene encoding the alpha 1 chain of type I collagen has long
been implicated in the pathogenesis of osteoporosis because type I collagen is the main
protein in bone. Many studies on the association between polymorphisms in the COL1A1
gene and osteoporosis have been published (Jin et al., 2009; Jin et al., 2011), however, none
of association results between the COL5A1 gene and osteoporosis have been reported. In the
meantime, it has been reported that the COL5A1 gene is associated with various diseases
including chronic Achilles tendinopathy (Collins et al., 2009), Achilles tendon injuries
(Mokone et al., 2006; Posthumus et al., 2009b) and anterior cruciate ligament rupture in
female participants (Posthumus et al., 2009a). In addition, mutations within the COL5A1
gene have been implicated in Ehlers-Danlos syndrome which is a multisystemic disorder that
primarily affects the soft connective tissues (Malfait and De Paepe, 2005). These results
suggested the COL5A1 gene can be a candidate high risk factor for osteoporosis and we
found a significant association between the SNPs in the COL5A1 gene and bone density and
osteoporosis phenotypes.
The ENO1 gene encodes a key glycolytic enzyme alpha-enolase that acts as a 2-
phospho-D-glycerate hydrolase. It is also involved in various processes such as growth
control, hypoxia tolerance and autoimmune responses (Pancholi, 2001; Kim and Dang, 2005;
Terrier et al., 2007). Previous report showed that the ENO1 gene was significantly down-
regulated in postmenopausal women compared with premenopausal women (Kosa et al.,
2009). Our results also showed that the expression level of the ENO1 gene was decreased in
both the cell line and mouse models for osteoporosis (Fig. 9-11). Based on the fact that
Page 83
- 69 -
deficiency of estrogen level due to menopause is closely related with an increase in
osteoclast life span and a concomitant decrease in osteoblast life span and further
osteoporosis (Sipos et al., 2009; Khosla, 2010), these results suggest that the ENO1 gene
may be involved in bone metabolism.
The MYOF gene encodes Myoferlin which is a member of the ferlin family of proteins
that promotes endomembrane fusion with the plasma membrane in muscle cells and
endothelial cells (Bernatchez et al., 2009). Since Myoferlin was identified as a protein highly
homologous to Dysferlin, the gene product of the limb girdle muscular dystrophy (LGMD)
2B locus, MYOF has been suggested as a candidate gene and potential modifier for muscular
dystrophy (Davis et al., 2000). The SCARA5 gene encodes scavenger receptor class A
member 5 which is involved in the host defense properties of populations of human
epithelial cells (Jiang et al., 2006). Scara5 is also known to be a ferritin receptor mediating
non-transferrin iron delivery (Li et al., 2009). Class A scavenger receptor promotes
osteoclast differentiation (Takemura et al., 2009).
By in silico analysis of transcription factor binding of the significant SNPs using the
TRANSFAC database (http://www.cbrc.jp/research/db/TFSEARCH.html), we found the
binding sites of transcription factors in several SNPs. The sequence region in the minor allele
of the SNP, rs12005720 in the COL5A1 gene contained the binding site for ETS1 (93.1
scoring point). ETS1 has been reported to be associated with systemic lupus erythematosus
(SLE) (Han et al., 2009). SLE often accompanies osteoporosis. The sequence region in the
minor allele of the SNP, rs787667 in the MYOF gene contained the binding site for GATA1
(93.0 scoring point). In addition, POU2F could bind to the sequence regions of the SNP,
Page 84
- 70 -
rs6660137 in the ENO1 gene (90.0 scoring point) and the SNP, rs2726941 in the SCARA5
gene (94.5 scoring point).
In conclusion, we identified 5 novel osteoporosis susceptibility genes through
candidate gene selection, evaluation and association analysis. Among them, SNPs in the
ANXA6 gene showed a highly significant association with bone density and osteoporosis-
related traits. Together with the previous study, our study suggests that these two genes may
play a key role in regulation of bone metabolism including bone formation and resorption.
Replication studies in other ethnic populations and future functional studies on these five
genes are needed. Our systematic approach with careful design and interpretation using the
cell line model, mice model and human subjects may be a useful tool for the identification of
susceptibility genes of other complex diseases in humans.
Page 85
- 71 -
V. CONCLUSION
We performed this study to discover a novel herbal therapeutic drug for effective
osteoporosis treatment and to further clarify its molecular mechanism of action. The dried
immature fruit of Poncirus trifoliata (PT) was selected as a potential natural-source
candidate for the treatment of glucocorticoid-induced osteoporosis (GIO). The hexane
extract of PT (PT-H) inhibited apoptotic cell death in dexamethasone-induced osteoblastic
cell lines. In vivo mouse results indicated that PT-H had an inhibitory effect on the bone loss
caused by glucocorticoid. The expression level of AnxA6 in dexamethasone-induced
osteoblastic cells and prednisolone (PD)-treated GIO-model mice was significantly
decreased by PT-H treatment.
Next, to determine whether ANXA6 gene is associated with the susceptibility to
osteoporosis and to identify novel genes for susceptibility to osteoporosis, we performed a
whole-genome comparative expression analysis. The expression levels of 7 genes, AnxA6,
Col5a1, Col6a2, Eno1, Myof, Nfib, and Scara5 were significantly altered in the in vitro and
in vivo osteoporosis models. Subsequently, we performed the quantitative bone density
association analysis and osteoporosis case-control association analysis of 116 SNPs in these
7 genes in the Korean Women’s Cohort (3570 subjects). There was a significant association
between the SNPs in the 5 genes, ANXA6, COL5A1, ENO1, MYOF and SCARA5, and bone
density and/or osteoporosis. Especially, the SNPs in the ANXA6 gene showed a highly
significant association with both bone density and osteoporosis phenotypes.
These results indicate that the ANXA6 gene may play an important role in regulation of
bone metabolism and further the pathogenesis of osteoporosis.
Page 86
- 72 -
REFERENCES
1. Alesci S, De Martino MU, Ilias I, Gold PW, Chrousos GP: Glucocorticoid-induced
osteoporosis: from basic mechanisms to clinical aspects. Neuroimmunomodulation
12: 1-19, 2005
2. Angeli A, Guglielmi G, Dovio A, Capelli G, de Feo D, Giannini S, Giorgino R, Moro
L, Giustina A: High prevalence of asymptomatic vertebral fractures in post-
menopausal women receiving chronic glucocorticoid therapy: a cross-sectional
outpatient study. Bone 39: 253-259, 2006
3. Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis and visualization of LD
and haplotype maps. Bioinformatics 21: 263-265, 2005
4. Bernatchez PN, Sharma A, Kodaman P, Sessa WC: Myoferlin is critical for
endocytosis in endothelial cells. Am J Physiol Cell Physiol 297: C484-492, 2009
5. Bonura F: Prevention, screening, and management of osteoporosis: an overview of
the current strategies. Postgrad Med 121: 5-17, 2009
6. Cabrera WE, Schrooten I, De Broe ME, D'Haese PC: Strontium and bone. J Bone
Miner Res 14: 661-668, 1999
7. Caichompoo W, Zhang QY, Hou TT, Gao HJ, Qin LP, Zhou XJ: Optimization of
extraction and purification of active fractions from Schisandra chinensis (Turcz.) and
its osteoblastic proliferation stimulating activity. Phytother Res 23: 289-292, 2009
8. Canalis E, Delany AM: Mechanisms of glucocorticoid action in bone. Ann N Y Acad
Sci 966: 73-81, 2002
Page 87
- 73 -
9. Canalis E, Mazziotti G, Giustina A, Bilezikian JP: Glucocorticoid-induced
osteoporosis: pathophysiology and therapy. Osteoporos Int 18: 1319-1328, 2007
10. Chen NX, O'Neill KD, Chen X, Moe SM: Annexin-mediated matrix vesicle
calcification in vascular smooth muscle cells. J Bone Miner Res 23: 1798-1805,
2008
11. Cho YS, Go MJ, Kim YJ, Heo JY, Oh JH, Ban HJ, Yoon D, Lee MH, Kim DJ, Park
M, Cha SH, Kim JW, Han BG, Min H, Ahn Y, Park MS, Han HR, Jang HY, Cho EY,
Lee JE, Cho NH, Shin C, Park T, Park JW, Lee JK, Cardon L, Clarke G, McCarthy
MI, Lee JY, Oh B, Kim HL: A large-scale genome-wide association study of Asian
populations uncovers genetic factors influencing eight quantitative traits. Nat Genet
41: 527-534, 2009
12. Choi JY, Lee BH, Song KB, Park RW, Kim IS, Sohn KY, Jo JS, Ryoo HM:
Expression patterns of bone-related proteins during osteoblastic differentiation in
MC3T3-E1 cells. J Cell Biochem 61: 609-618, 1996
13. Collins M, Mokone GG, September AV, van der Merwe L, Schwellnus MP: The
COL5A1 genotype is associated with range of motion measurements. Scand J Med
Sci Sports 19: 803-810, 2009
14. Davis DB, Delmonte AJ, Ly CT, McNally EM: Myoferlin, a candidate gene and
potential modifier of muscular dystrophy. Hum Mol Genet 9: 217-226, 2000
15. Dieudonne SC, Kerr JM, Xu T, Sommer B, DeRubeis AR, Kuznetsov SA, Kim IS,
Gehron Robey P, Young MF: Differential display of human marrow stromal cells
reveals unique mRNA expression patterns in response to dexamethasone. J Cell
Page 88
- 74 -
Biochem 76: 231-243, 1999
16. Enrich C, Rentero C, de Muga SV, Reverter M, Mulay V, Wood P, Koese M, Grewal
T: Annexin A6-Linking Ca(2+) signaling with cholesterol transport. Biochim
Biophys Acta 1813: 935-947, 2011
17. Gerke V, Creutz CE, Moss SE: Annexins: linking Ca2+ signalling to membrane
dynamics. Nat Rev Mol Cell Biol 6: 449-461, 2005
18. Grewal T, Koese M, Rentero C, Enrich C: Annexin A6-regulator of the EGFR/Ras
signalling pathway and cholesterol homeostasis. Int J Biochem Cell Biol 42: 580-584,
2010
19. Gudbjornsson B, Juliusson UI, Gudjonsson FV: Prevalence of long term steroid
treatment and the frequency of decision making to prevent steroid induced
osteoporosis in daily clinical practice. Ann Rheum Dis 61: 32-36, 2002
20. Gueguen R, Jouanny P, Guillemin F, Kuntz C, Pourel J, Siest G: Segregation
analysis and variance components analysis of bone mineral density in healthy
families. J Bone Miner Res 10: 2017-2022, 1995
21. Ha H, Ho J, Shin S, Kim H, Koo S, Kim IH, Kim C: Effects of Eucommiae Cortex
on osteoblast-like cell proliferation and osteoclast inhibition. Arch Pharm Res 26:
929-936, 2003
22. Haag J, Aigner T: Identification of calponin 3 as a novel Smad-binding modulator of
BMP signaling expressed in cartilage. Exp Cell Res 313: 3386-3394, 2007
23. Han JW, Zheng HF, Cui Y, Sun LD, Ye DQ, Hu Z, Xu JH, Cai ZM, Huang W, Zhao
GP, Xie HF, Fang H, Lu QJ, Li XP, Pan YF, Deng DQ, Zeng FQ, Ye ZZ, Zhang XY,
Page 89
- 75 -
Wang QW, Hao F, Ma L, Zuo XB, Zhou FS, Du WH, Cheng YL, Yang JQ, Shen SK,
Li J, Sheng YJ, Zuo XX, Zhu WF, Gao F, Zhang PL, Guo Q, Li B, Gao M, Xiao FL,
Quan C, Zhang C, Zhang Z, Zhu KJ, Li Y, Hu DY, Lu WS, Huang JL, Liu SX, Li H,
Ren YQ, Wang ZX, Yang CJ, Wang PG, Zhou WM, Lv YM, Zhang AP, Zhang SQ,
Lin D, Low HQ, Shen M, Zhai ZF, Wang Y, Zhang FY, Yang S, Liu JJ, Zhang XJ:
Genome-wide association study in a Chinese Han population identifies nine new
susceptibility loci for systemic lupus erythematosus. Nat Genet 41: 1234-1237, 2009
24. Hedrick PW: Gametic disequilibrium measures: proceed with caution. Genetics 117:
331-341, 1987
25. Heino TJ, Chagin AS, Savendahl L: The novel estrogen receptor G-protein-coupled
receptor 30 is expressed in human bone. J Endocrinol 197: R1-6, 2008
26. Hosoi T: Genetic aspects of osteoporosis. J Bone Miner Metab 28: 601-607, 2010
27. Hsu YH, Xu X, Terwedow HA, Niu T, Hong X, Wu D, Wang L, Brain JD, Bouxsein
ML, Cummings SR, Rosen CJ: Large-scale genome-wide linkage analysis for loci
linked to BMD at different skeletal sites in extreme selected sibships. J Bone Miner
Res 22: 184-194, 2007
28. Jayaprakasha GK, Mandadi KK, Poulose SM, Jadegoud Y, Nagana Gowda GA, Patil
BS: Inhibition of colon cancer cell growth and antioxidant activity of bioactive
compounds from Poncirus trifoliata (L.) Raf. Bioorg Med Chem 15: 4923-4932,
2007
29. Jee WS, Yao W: Overview: animal models of osteopenia and osteoporosis. J
Musculoskelet Neuronal Interact 1: 193-207, 2001
Page 90
- 76 -
30. Jeong JC, Lee JW, Yoon CH, Lee YC, Chung KH, Kim MG, Kim CH: Stimulative
effects of Drynariae Rhizoma extracts on the proliferation and differentiation of
osteoblastic MC3T3-E1 cells. J Ethnopharmacol 96: 489-495, 2005
31. Jiang Y, Oliver P, Davies KE, Platt N: Identification and characterization of murine
SCARA5, a novel class A scavenger receptor that is expressed by populations of
epithelial cells. J Biol Chem 281: 11834-11845, 2006
32. Jin H, Evangelou E, Ioannidis JP, Ralston SH: Polymorphisms in the 5' flank of
COL1A1 gene and osteoporosis: meta-analysis of published studies. Osteoporos Int
22: 911-921, 2011
33. Jin H, van't Hof RJ, Albagha OM, Ralston SH: Promoter and intron 1
polymorphisms of COL1A1 interact to regulate transcription and susceptibility to
osteoporosis. Hum Mol Genet 18: 2729-2738, 2009
34. Johnell O, Kanis J: Epidemiology of osteoporotic fractures. Osteoporos Int 16 Suppl
2: S3-7, 2005
35. Kanis JA, Melton LJ, 3rd, Christiansen C, Johnston CC, Khaltaev N: The diagnosis
of osteoporosis. J Bone Miner Res 9: 1137-1141, 1994
36. Karasik D, Shimabuku NA, Zhou Y, Zhang Y, Cupples LA, Kiel DP, Demissie S: A
genome wide linkage scan of metacarpal size and geometry in the Framingham
Study. Am J Hum Biol 20: 663-670, 2008
37. Kaufman JM, Ostertag A, Saint-Pierre A, Cohen-Solal M, Boland A, Van Pottelbergh
I, Toye K, de Vernejoul MC, Martinez M: Genome-wide linkage screen of bone
mineral density (BMD) in European pedigrees ascertained through a male relative
Page 91
- 77 -
with low BMD values: evidence for quantitative trait loci on 17q21-23, 11q12-13,
13q12-14, and 22q11. J Clin Endocrinol Metab 93: 3755-3762, 2008
38. Khosla S: Update on estrogens and the skeleton. J Clin Endocrinol Metab 95: 3569-
3577, 2010
39. Khosla S, Westendorf JJ, Oursler MJ: Building bone to reverse osteoporosis and
repair fractures. J Clin Invest 118: 421-428, 2008
40. Kim BY, Yoon HY, Yun SI, Woo ER, Song NK, Kim HG, Jeong SY, Chung YS: In
Vitro and In Vivo Inhibition of Glucocorticoid-induced Osteoporosis by the Hexane
Extract of Poncirus trifoliata. Phytother Res, 2011
41. Kim HJ, Bae YC, Park RW, Choi SW, Cho SH, Choi YS, Lee WJ: Bone-protecting
effect of safflower seeds in ovariectomized rats. Calcif Tissue Int 71: 88-94, 2002
42. Kim HM, Kim HJ, Park ST: Inhibition of immunoglobulin E production by Poncirus
trifoliata fruit extract. J Ethnopharmacol 66: 283-288, 1999
43. Kim JW, Dang CV: Multifaceted roles of glycolytic enzymes. Trends Biochem Sci
30: 142-150, 2005
44. Kim KW, Suh SJ, Lee TK, Ha KT, Kim JK, Kim KH, Kim DI, Jeon JH, Moon TC,
Kim CH: Effect of safflower seeds supplementation on stimulation of the
proliferation, differentiation and mineralization of osteoblastic MC3T3-E1 cells. J
Ethnopharmacol 115: 42-49, 2008
45. Kim TH, Hong JM, Shin ES, Kim HJ, Cho YS, Lee JY, Lee SH, Park EK, Kim SY:
Polymorphisms in the Annexin gene family and the risk of osteonecrosis of the
femoral head in the Korean population. Bone 45: 125-131, 2009
Page 92
- 78 -
46. Kim YJ, Kwak CI, Gu YY, Hwang IT, Chun JY: Annealing control primer system for
identification of differentially expressed genes on agarose gels. Biotechniques 36:
424-426, 428, 430 passim, 2004
47. Kosa JP, Balla B, Speer G, Kiss J, Borsy A, Podani J, Takacs I, Lazary A, Nagy Z,
Bacsi K, Orosz L, Lakatos P: Effect of menopause on gene expression pattern in
bone tissue of nonosteoporotic women. Menopause 16: 367-377, 2009
48. Leclerc N, Luppen CA, Ho VV, Nagpal S, Hacia JG, Smith E, Frenkel B: Gene
expression profiling of glucocorticoid-inhibited osteoblasts. J Mol Endocrinol 33:
175-193, 2004
49. Lee HT, Seo EK, Chung SJ, Shim CK: Prokinetic activity of an aqueous extract from
dried immature fruit of Poncirus trifoliata (L.) Raf. J Ethnopharmacol 102: 131-136,
2005
50. Lee IJ, Xu GH, Ju JH, Kim JA, Kwon SW, Lee SH, Han SB, Kim Y: 21-
Methylmelianodiols from Poncirus trifoliata as inhibitors of interleukin-5 bioactivity
in Pro-B cells. Planta Med 74: 396-400, 2008
51. Lee JH, Lee SH, Kim YS, Jeong CS: Protective effects of neohesperidin and
poncirin isolated from the fruits of Poncirus trifoliata on potential gastric disease.
Phytother Res 23: 1748-1753, 2009
52. Lelovas PP, Xanthos TT, Thoma SE, Lyritis GP, Dontas IA: The laboratory rat as an
animal model for osteoporosis research. Comp Med 58: 424-430, 2008
53. Lewiecki EM: Emerging drugs for postmenopausal osteoporosis. Expert Opin Emerg
Drugs 14: 129-144, 2009
Page 93
- 79 -
54. Li JY, Paragas N, Ned RM, Qiu A, Viltard M, Leete T, Drexler IR, Chen X, Sanna-
Cherchi S, Mohammed F, Williams D, Lin CS, Schmidt-Ott KM, Andrews NC,
Barasch J: Scara5 is a ferritin receptor mediating non-transferrin iron delivery. Dev
Cell 16: 35-46, 2009
55. Lotinun S, Evans GL, Turner RT, Oursler MJ: Deletion of membrane-bound steel
factor results in osteopenia in mice. J Bone Miner Res 20: 644-652, 2005
56. Malfait F, De Paepe A: Molecular genetics in classic Ehlers-Danlos syndrome. Am J
Med Genet C Semin Med Genet 139C: 17-23, 2005
57. Mazziotti G, Angeli A, Bilezikian JP, Canalis E, Giustina A: Glucocorticoid-induced
osteoporosis: an update. Trends Endocrinol Metab 17: 144-149, 2006
58. Mokone GG, Schwellnus MP, Noakes TD, Collins M: The COL5A1 gene and
Achilles tendon pathology. Scand J Med Sci Sports 16: 19-26, 2006
59. Olney RC: Mechanisms of impaired growth: effect of steroids on bone and cartilage.
Horm Res 72 Suppl 1: 30-35, 2009
60. Pancholi V: Multifunctional alpha-enolase: its role in diseases. Cell Mol Life Sci 58:
902-920, 2001
61. Park SH, Park EK, Kim DH: Passive cutaneous anaphylaxis-inhibitory activity of
flavanones from Citrus unshiu and Poncirus trifoliata. Planta Med 71: 24-27, 2005
62. Pocock NA, Eisman JA, Hopper JL, Yeates MG, Sambrook PN, Eberl S: Genetic
determinants of bone mass in adults. A twin study. J Clin Invest 80: 706-710, 1987
63. Posthumus M, September AV, O'Cuinneagain D, van der Merwe W, Schwellnus MP,
Collins M: The COL5A1 gene is associated with increased risk of anterior cruciate
Page 94
- 80 -
ligament ruptures in female participants. Am J Sports Med 37: 2234-2240, 2009a
64. Posthumus M, September AV, Schwellnus MP, Collins M: Investigation of the Sp1-
binding site polymorphism within the COL1A1 gene in participants with Achilles
tendon injuries and controls. J Sci Med Sport 12: 184-189, 2009b
65. Quarles LD, Yohay DA, Lever LW, Caton R, Wenstrup RJ: Distinct proliferative and
differentiated stages of murine MC3T3-E1 cells in culture: an in vitro model of
osteoblast development. J Bone Miner Res 7: 683-692, 1992
66. Rabbee N, Speed TP: A genotype calling algorithm for affymetrix SNP arrays.
Bioinformatics 22: 7-12, 2006
67. Raisz LG: Pathogenesis of osteoporosis: concepts, conflicts, and prospects. J Clin
Invest 115: 3318-3325, 2005
68. Ralston SH: Genetics of osteoporosis. Ann N Y Acad Sci 1192: 181-189, 2010
69. Ralston SH, de Crombrugghe B: Genetic regulation of bone mass and susceptibility
to osteoporosis. Genes Dev 20: 2492-2506, 2006
70. Ralston SH, Uitterlinden AG: Genetics of osteoporosis. Endocr Rev 31: 629-662,
2010
71. Richards JB, Kavvoura FK, Rivadeneira F, Styrkarsdottir U, Estrada K, Halldorsson
BV, Hsu YH, Zillikens MC, Wilson SG, Mullin BH, Amin N, Aulchenko YS,
Cupples LA, Deloukas P, Demissie S, Hofman A, Kong A, Karasik D, van Meurs JB,
Oostra BA, Pols HA, Sigurdsson G, Thorsteinsdottir U, Soranzo N, Williams FM,
Zhou Y, Ralston SH, Thorleifsson G, van Duijn CM, Kiel DP, Stefansson K,
Uitterlinden AG, Ioannidis JP, Spector TD: Collaborative meta-analysis: associations
Page 95
- 81 -
of 150 candidate genes with osteoporosis and osteoporotic fracture. Ann Intern Med
151: 528-537, 2009
72. Richards JB, Rivadeneira F, Inouye M, Pastinen TM, Soranzo N, Wilson SG,
Andrew T, Falchi M, Gwilliam R, Ahmadi KR, Valdes AM, Arp P, Whittaker P,
Verlaan DJ, Jhamai M, Kumanduri V, Moorhouse M, van Meurs JB, Hofman A, Pols
HA, Hart D, Zhai G, Kato BS, Mullin BH, Zhang F, Deloukas P, Uitterlinden AG,
Spector TD: Bone mineral density, osteoporosis, and osteoporotic fractures: a
genome-wide association study. Lancet 371: 1505-1512, 2008
73. Sambrook P, Cooper C: Osteoporosis. Lancet 367: 2010-2018, 2006
74. Shim WS, Back H, Seo EK, Lee HT, Shim CK: Long-term administration of an
aqueous extract of dried, immature fruit of Poncirus trifoliata (L.) Raf. suppresses
body weight gain in rats. J Ethnopharmacol 126: 294-299, 2009
75. Shin TY, Oh JM, Choi BJ, Park WH, Kim CH, Jun CD, Kim SH: Anti-inflammatory
effect of Poncirus trifoliata fruit through inhibition of NF-kappaB activation in mast
cells. Toxicol In Vitro 20: 1071-1076, 2006
76. Sigurdsson G, Halldorsson BV, Styrkarsdottir U, Kristjansson K, Stefansson K:
Impact of genetics on low bone mass in adults. J Bone Miner Res 23: 1584-1590,
2008
77. Sipos W, Pietschmann P, Rauner M, Kerschan-Schindl K, Patsch J: Pathophysiology
of osteoporosis. Wien Med Wochenschr 159: 230-234, 2009
78. Spreafico A, Frediani B, Francucci CM, Capperucci C, Chellini F, Galeazzi M: Role
of apoptosis in osteoporosis induced by glucocorticoids. J Endocrinol Invest 31: 22-
Page 96
- 82 -
27, 2008
79. Styrkarsdottir U, Cazier JB, Kong A, Rolfsson O, Larsen H, Bjarnadottir E,
Johannsdottir VD, Sigurdardottir MS, Bagger Y, Christiansen C, Reynisdottir I,
Grant SF, Jonasson K, Frigge ML, Gulcher JR, Sigurdsson G, Stefansson K: Linkage
of osteoporosis to chromosome 20p12 and association to BMP2. PLoS Biol 1: E69,
2003
80. Styrkarsdottir U, Halldorsson BV, Gretarsdottir S, Gudbjartsson DF, Walters GB,
Ingvarsson T, Jonsdottir T, Saemundsdottir J, Snorradottir S, Center JR, Nguyen TV,
Alexandersen P, Gulcher JR, Eisman JA, Christiansen C, Sigurdsson G, Kong A,
Thorsteinsdottir U, Stefansson K: New sequence variants associated with bone
mineral density. Nat Genet 41: 15-17, 2009
81. Suh SJ, Yun WS, Kim KS, Jin UH, Kim JK, Kim MS, Kwon DY, Kim CH:
Stimulative effects of Ulmus davidiana Planch (Ulmaceae) on osteoblastic MC3T3-
E1 cells. J Ethnopharmacol 109: 480-485, 2007
82. Takemura K, Sakashita N, Fujiwara Y, Komohara Y, Lei X, Ohnishi K, Suzuki H,
Kodama T, Mizuta H, Takeya M: Class A scavenger receptor promotes osteoclast
differentiation via the enhanced expression of receptor activator of NF-kappaB
(RANK). Biochem Biophys Res Commun, 2009
83. Teitelbaum SL: Bone resorption by osteoclasts. Science 289: 1504-1508, 2000
84. Terrier B, Degand N, Guilpain P, Servettaz A, Guillevin L, Mouthon L: Alpha-
enolase: a target of antibodies in infectious and autoimmune diseases. Autoimmun
Rev 6: 176-182, 2007
Page 97
- 83 -
85. Theobald J, Smith PD, Jacob SM, Moss SE: Expression of annexin VI in A431
carcinoma cells suppresses proliferation: a possible role for annexin VI in cell
growth regulation. Biochim Biophys Acta 1223: 383-390, 1994
86. Thomas DD, Kaspar KM, Taft WB, Weng N, Rodenkirch LA, Groblewski GE:
Identification of annexin VI as a Ca2+-sensitive CRHSP-28-binding protein in
pancreatic acinar cells. J Biol Chem 277: 35496-35502, 2002
87. Torgerson DJ, Campbell MK, Thomas RE, Reid DM: Prediction of perimenopausal
fractures by bone mineral density and other risk factors. J Bone Miner Res 11: 293-
297, 1996
88. Turner RT, Maran A, Lotinun S, Hefferan T, Evans GL, Zhang M, Sibonga JD:
Animal models for osteoporosis. Rev Endocr Metab Disord 2: 117-127, 2001
89. Vila de Muga S, Timpson P, Cubells L, Evans R, Hayes TE, Rentero C, Hegemann A,
Reverter M, Leschner J, Pol A, Tebar F, Daly RJ, Enrich C, Grewal T: Annexin A6
inhibits Ras signalling in breast cancer cells. Oncogene 28: 363-377, 2009
90. Wong RW, Rabie AB: Systemic effect of crude extract from rhizome of Drynaria
fortunei on bone formation in mice. Phytotherapy Research 20: 313-315, 2006
91. Xiao P, Shen H, Guo YF, Xiong DH, Liu YZ, Liu YJ, Zhao LJ, Long JR, Guo Y,
Recker RR, Deng HW: Genomic regions identified for BMD in a large sample
including epistatic interactions and gender-specific effects. J Bone Miner Res 21:
1536-1544, 2006
92. Xiong DH, Liu XG, Guo YF, Tan LJ, Wang L, Sha BY, Tang ZH, Pan F, Yang TL,
Chen XD, Lei SF, Yerges LM, Zhu XZ, Wheeler VW, Patrick AL, Bunker CH, Guo
Page 98
- 84 -
Y, Yan H, Pei YF, Zhang YP, Levy S, Papasian CJ, Xiao P, Lundberg YW, Recker
RR, Liu YZ, Liu YJ, Zmuda JM, Deng HW: Genome-wide association and follow-
up replication studies identified ADAMTS18 and TGFBR3 as bone mass candidate
genes in different ethnic groups. Am J Hum Genet 84: 388-398, 2009
93. Xu XH, Dong SS, Guo Y, Yang TL, Lei SF, Papasian CJ, Zhao M, Deng HW:
Molecular genetic studies of gene identification for osteoporosis: the 2009 update.
Endocr Rev 31: 447-505, 2010
94. Yi JM, Kim MS, Koo HN, Song BK, Yoo YH, Kim HM: Poncirus trifoliata fruit
induces apoptosis in human promyelocytic leukemia cells. Clin Chim Acta 340: 179-
185, 2004
95. Yun SI, Yoon HY, Jeong SY, Chung YS: Glucocorticoid induces apoptosis of
osteoblast cells through the activation of glycogen synthase kinase 3beta. J Bone
Miner Metab 27: 140-148, 2009
Page 99
- 85 -
- 국문요약-
골다공증에서의
Annexin A6 의 역할
아주대학교 대학원 의생명과학과
김 보 영
(지도교수: 정 선 용)
골다공증은 골량의 감소와 뼈조직의 미세구조의 이상으로 뼈의 강도가
약해져서 가벼운 충격에도 쉽게 골절이 발생되는 질환이다. 골량은 조골세포에
의한 뼈형성과 파골세포에 의한 뼈의 재흡수 상호작용에 의해서 조절되며,
다양한 인자들이 조골세포와 파골세포의 작용에 관여함으로써 골의 형성, 성장
및 골 재형성의 과정에 영향을 미치게 된다. 골다공증은 다수의 유전적 요인과
환경적 요인이 복합적으로 관여하는 다인자성 질환으로 알려져 있으며, 그
발병원인에 따라 원발성인 폐경후 골다공증, 노인성 골다공증과 속발성인
당질코르티코이드 약제로 인한 골다공증으로 분류된다. 최근 고령화로 인한
골다공증 발병률이 크게 증가되고 있어 중요한 연구 주제로 대두되고 있다.
본 연구에서는 부작용이 적고 효과적인 당질코르티코이드-유도성 골다공증
치료제의 개발과 질병 작용기전 규명을 목적으로, 다양한 국내 자생식물로부터
유래된 천연추출물에서 조골세포사멸 억제 효과를 탐색하고, 선정된 추출물의
조골세포사멸 억제 기전을 유전자 수준에서 규명하고자 하였다.
당질코르티코이드-유도성 골다공증 세포 모델에서 국내 자생식물 68 종의
천연추출물을 대상으로 조골세포 사멸 억제 효과를 스크리닝 한 결과, 4 종류의
Page 100
- 86 -
천연물에서 효과를 확인하였다. 그 중, 아직까지 골다공증과의 관련성에 대한
보고가 없는 지실(Poncirus trifoliata)을 본 연구의 연구재료로 선정하였다.
유효물질 추출과정에서 지실의 헥산추출물 (hexane extract)에서
당질코르티코이드-유도 조골세포의 세포사멸 억제 효과를 확인하였다. 또한,
마우스 실험에서 지실 헥산추출물이 당질코르티코이드-유도 골다공증 유발
마우스의 골밀도 감소 억제에 큰 효과가 있음을 확인 하였다.
다음 연구로, 지실 헥산추출물의 작용 기전을 분자 수준에서 밝히기 위해,
당질코르티코이드-유도 조골세포에서 지실 헥산추출물의 첨가에 따라 발현량이
변화되는 유전자(differentially expressed gene, DEG)를 annealing control
primer 를 이용한 RT-PCR differential display 방법으로 스크리닝 하였다. 그
결과, C3H10T1/2 조골모세포와 MC3T3-E1 조골세포에서 당질코르티코이드
일종인 dexamethasone(Dex)처리에 의해 발현량이 증가되었으나 지실
헥산추출물의 동시 처리에 의해 증가된 발현량이 다시 감소된 AnxA6 유전자를
동정하였다. 이 결과를 in vitro 및 in vivo 에서 검정하기 위하여, gene specific
primer 를 이용한 real time RT-PCR 과 항체를 이용한 Western blotting 을
실시하였으며, 결과적으로 골다공증 유도 조골세포와 골다공증 유도 마우스에서
지실 헥산추출물에 의한 AnxA6 발현량의 변화를 확인하였다. 이러한
결과로부터, 지실 헥산추출물에 의한 골다공증 효과는 AnxA6 유전자의
발현량과 밀접한 관련이 있음을 알 수 있다.
다음으로 AnxA6 를 비롯하여 당질코르티코이드가 유도된 조골세포에서
발현량이 크게 변화되는 유전자들에 대한 단일 염기서열 다형성(single
nucleotide polymorphism, SNP)과 골다공증과의 상관성을 확인하여
골다공증에 관여하는 새로운 유전적 소인을 찾고자 하였다. 먼저,
당질코르티코이드 유도 조골세포와 난소 절제법으로 골다공증이 유발된
마우스에서 대조군과 비교하여 유전자의 발현양상에 변화가 확인된 7 종의
유전자, AnxA6, Col5a1, Col6a2, Eno1, Myof, Nfib, Scara5 를 선정하였다.
이들 유전자들의 다형성과 골밀도/골다공증 형질과의 상관관계를 사람에서
확인하기 위하여, 3570 명의 한국인 여성 코호트에서 SNP-질환 형질의
Page 101
- 87 -
상관관계 분석을 실시하였다. 최종적으로 5 종의 유전자들 (ANXA6, COL5A1,
ENO1, MYOF, SCARA5) 의 유전적 다형성이 골밀도/골다공증과 유의하게 연관
되어 있음이 밝혀졌다. 특히, ANXA6 유전자의 경우는 Bonferroni –correction
유의 수준을 만족하였다.
결론적으로, 당질코르티코이드로 유도된 골다공증의 예방 및 치료에
효과적인 천연물로서 지실 헥산추출물이 동정되었으며, ANXA6 유전자의 발현
정도가 이러한 효과에 밀접하게 연관되어 있음을 밝혔다. 또한, ANXA6
유전자의 다형성과 여성의 골밀도/골다공증 형질간에 매우 유의한 상관관계가
있음을 밝혔다. 이러한 결과로부터, ANXA6 유전자가 골다공증의 유전적 소인일
가능성이 시사된다. 본 연구 결과는, 당질코르티코이드로 유도된 골다공증의
기전을 이해하고 예방 및 부작용이 적은 치료제 개발에 유용하게 활용 될
것으로 기대된다.
________________________________________________________________________
핵심어: 골다공증, 지실, 당질코르티코이드, Annexin A6(ANXA6), 조골세포,
골밀도, differentially expressed gene (DEG), 단일 유전자 다형성(SNP),
상관관계, 마우스, 사람