Differential monocyte STAT6 activation and CD4+CD25+Foxp3+ T cells in kidney operational tolerance transplanted individuals

Page 1

Do

PSa

b

c

d

A

ARAA

KKOFSM

1

fttshaegt

mmitpt

Human Immunology 71 (2010) 442–450

Contents lists available at ScienceDirect

0rd

ifferential monocyte STAT6 activation and CD4�CD25�Foxp3� T cells in kidneyperational tolerance transplanted individuals

edro Manoel M. Moraes-Vieira a,b, Hernandez M. Silva a,b, Maisa C.S. Takenaka a,b,andra Maria Monteiro a,b, Francine Lemos c, David Saitovitch b,d, Jorge Kalil a,b, VerÕnica Coelho a,b,*Laboratory of Immunology, Heart Institute (InCor), University of Sâo Paulo Medical School, Sâo Paulo, BrazilInstitute for Investigation in Immunology, iii–National Institute of Science and Technology, Sâo Paulo, BrazilDivision of Nephrology, University of Sâo Paulo Medical School, Sâo Paulo, BrazilDivision of Nephrology, Sâo Lucas Hospital, Pontifìcia Universidade Catòlica do Rio Grande do Sul, Porto Alegre, RS, Brazil

R T I C L E I N F O

rticle history:eceived 27 October 2009ccepted 15 January 2010vailable online 13 February 2010

eywords:idney transplantationperational toleranceoxp3TAT6onocytes

A B S T R A C T

In organ transplantation, the immunosuppression withdrawal leads, in most cases, to rejection. Nonetheless, aspecial group of patients maintain stable graft function after complete withdrawal of immunosuppression,achieving a state called “operational tolerance.” The study of such patients may be important to understand themechanisms involved inhumantransplantation tolerance.Wecompared theprofileofCD4�CD25�Foxp3�T cellsand the signaling pathways IL-6/STAT3 (signal transducers and activators of transcription) and IL-4/STAT6 inperipheral blood mononuclear cells of four kidney transplant groups: (i) operational tolerance (OT), (ii)chronic allograft nephropathy (CR), (iii) stable graft function under standard immunosuppression (Sta), (iv)stable graft function under low immunosuppression, and (v) healthy individuals. Both CR and Sta displayedlower numbers and percentages of CD4�CD25�Foxp3� T cells comparedwith all other groups (p � 0.05). TheOT patients displayed a reduced activation of the IL-4/STAT6 pathway inmonocytes, comparedwith all othergroups (p � 0.05). The lower numbers of CD4�CD25�Foxp3� T cells observed in CR individuals may be afeature of chronic allograft nephropathy. The differential OT signaling profile, with reduced phosphorylationof STAT6, in monocytes’ region, suggests that some altered function of STAT6 signalingmay be important forthe operational tolerance state.

Crown copyright � 2010 Published by Elsevier Inc. on behalf of American Society for Histocompatibility

and Immunogenetics. All rights reserved.

mio

acptaHtloti

umts

. Introduction

Transplantation has become a worldwide accepted treatmentor irreversible organ failure. Nonetheless, one major drawback tohis treatment is the need for continuous immunosuppressiono prevent graft rejection. The improvement in the criteria used toelect donors and the development of new immunosuppressorsave contributed to increasing graft survival and limiting the risk ofcute rejection [1]. However, long-term graft survival has persistedssentially unchanged, and an effective treatment for chronic allo-raft nephropathy remains one of the main challenges in organransplantation.

In human beings, immunosuppression withdrawal leads, inost cases, to rejection. Nonetheless, a special group of patientsaintain stable graft function after the complete withdrawal of

mmunosuppression. These patients are in a state of “operationalolerance.” This indicates that tolerance may, indeed, be accom-lished in human transplantation [2–4]. The study of operationalolerance patients may help the understanding of a variety of

p* Corresponding author.

E-mail address: [email protected] (V. Coelho).

198-8859/10/$32.00 - see front matter Crown copyright � 2010 Published by Elsevier Inights reserved.oi:10.1016/j.humimm.2010.01.022

echanisms involved in human allograft tolerance, as well as todentify parameters thatmaydiscriminate this homeostatic state inther transplanted individuals.Several immune response components have been reported to be

ssociated with human allograft tolerance, including regulatory Tells [5,6]. In human beings, there are some reports describingrotocols for the induction of graft acceptance, such as the induc-ion of mixed chimerism, the use of anti-CD52 (Campath-1), andnti-CD3monoclonal antibodies [7–9] although,with little success.owever, despite the effort to understand how transplantationolerance might be accomplished in human beings, there are stillimited data on potential mechanisms that lead to the state ofperational tolerance. There are three works in which a participa-ion of peripheral CD4�CD25� T cells was suggested to be involvedn this process [10–12].

Although it has been reported that kidney transplanted individ-als with long-term graft survival have an altered expression ofolecules related with T-cell activation [13], it has not been inves-

igated whether these alterations modulate and activate differentignaling pathways. We hypothesize that intracellular signaling

athways activated by cytokines might have an important role in

c. on behalf of American Society for Histocompatibility and Immunogenetics. All

Page 2

ta

mainvtsriptuc

2

2

aetNGSsa

pibc(na�

m1pg

scismbuhcts

2c

fphSsC

2

chRtaFiS

2a

TutmS

TC

S

ASN

TI

HDBAV

R

D

Oihd

P. M. M. Moraes-Vieira et al. / Human Immunology 71 (2010) 442–450 443

he establishment of tolerance, as cytokines modulate the functionnd the differentiation of T cells.In the context of transplantation, Th1 cytokines have been

ostly implicated in acute rejection, and Th2 cytokines in graftcceptance [14,15], despite the existence of some reports on Th2nvolvement in rejection [16]. The key mediators of cytokine sig-aling transduction pathways are the signal transducers and acti-ators of transcription (STAT) [17]. To date, there are no data abouthe way operationally tolerant individuals respond to cytokinetimuli in different cell types. STAT3 has been reported to inhibitegulatory T-cell differentiation [18], STAT6 was described as annhibitor of Foxp3 transcription, and IL-4 signaling in T cells ap-ears to compromise Treg-mediated suppression [19,20]. Despitehe role of both STAT 3 and 6 in the regulatory T-cell function, it isnknown whether STAT 3 and 6 activities are modulated in theontext of transplantation.

. Subjects and methods

.1. Study groups

All individuals in this study gave informed consent, and blindednalyses were performed. We studied 42 blood samples from sev-ral groups, obtained from patients belonging to the Transplanta-ion Unit of the Clinical Hospital, University of SÄo Paulo and to theephrology Unit of the PontifÎcia Universidade CatÔlica do Riorande do Sul, enrolled in The Multicenter Operational Tolerancetudy, coordinated at Heart Institute, School of Medicine, Univer-ity of SÄo Paulo, Brazil. The Ethics Committee of the Hospitalpproved this study (CAPPESQ 08/00468; CEP06/03537).Study groups: (i) Operational tolerance (OT: n� 5) group: trans-

lanted individuals with stable graft function in the absence ofmmunosuppression for at least 1 year. No biopsy was performedecause these individuals had stable graft function. Mean serumreatinine level: 1.12 mg/dl; (ii) Low immunosuppression groupLI � 5): transplanted individuals with stable graft function, withormal serum creatinine level and immunosuppressants doses:zathioprine: �1 mg/kg, prednisone �0.10 mg/kg/d, cyclosporin1.5 mg/kg/d, rapamycin �1 mg/d, mycophenolate mophetil �15g/kg/d, tacrolimus �0.05 mg/kg/d. Mean serum creatinine level:.20 mg/dl; (iii) Stable graft function under standard immunosup-ression group (Sta: n � 12): transplanted individuals with stableraft function, under standard immunosuppression and with no

able 1linical history of transplanted kidney recipients

tudy individual OT1 OT2 OT3

ge (yr) 32 53 42ex (F/M) M M Mumber of grafts 1 1 2

ime of Transplantation (yr) 13 23 5nduction therapy No NA Anti-IL2R

LA (A,B, DR) mismatches 3 3 4onor (living/deceased) Living Living Deceasedlood transfusion (Y/N) N NA Ycute rejection episode (Y/N) N N Yiral infections (Y/N) NA NA Y

eason for IS interruption Noncompliance

Noncompliance

Noncompliance

rug-free time (yr) 3 6 1.5

T � operational tolerance; LI � low immunosuppression; EST � stable graft function anmmunosuppression; ATG � anti-thymocyte globulin; IVIG � intravenous immunoglob

umanized-Daclizumab; monoclonal antibody anti the alpha subunit of the IL-2 receptor; CMV �

eviation.

igns of rejection. Mean serum creatinine level: 0.98 mg/dl; (iv)hronic allograft nephropathy (CR: n � 11) group: transplantedndividuals with high serum creatinine concentration and progres-ive renal function deterioration.Mean serumcreatinine level: 2.19g/dl. In all cases, chronic allograft nephropathywas confirmed byiopsy according to Banff criteria [21]. All CR individuals werender immunosuppression. (v) Healthy individuals (HI: n � 10):ealthy kidney donors, with normal kidney function. Mean serumreatinine level: 1.05 mg/dl. All transplanted individuals had morehan 1 year of transplantation. The demographic/clinical features ofubjects in the study groups are shown in Table 1.

.2. Blood sample test and peripheral blood mononuclearells purification

The ethylenediamine tetraacetic acid blood samples were usedor complete blood count analysis and for RNA extraction. Humaneripheral blood mononuclear cells (PBMCs) were isolated fromeparinized blood by Ficoll-Hypaque (Pharmacia Biotech, Uppsala,weden). The cells were cryopreserved in a solution of fetal bovineerum 90%/10% dimethyl sulfoxide and stored in liquid nitrogen.ell viability was routinely �85%.

.3. CD4+CD25+Foxp3+ flow cytometry analysis

The PBMC were stained with fluorescein isothyocyanate–onjugated anti-human CD4, allophycocyanin-conjugated anti-uman CD25, and phycoeritrin (PE)-conjugated Foxp3 (Humanegulatory TCell StainingKit, eBioscience, SanDiego, CA) accordingo the manufacturer’s instructions. At least 200,000 events werecquired for CD4/CD25/Foxp3 analysis in the gate of lymphocytes.ACSCalibur flow cytometer and Cell Quest Software (Becton Dick-nson, San Jose, CA)were used for acquisition and FlowJo 8.4.3 (Treetar, Ashland, OR) for compensation and analysis.

.4. PBMC cytokine stimulation and signal transducers andctivators of transcription phosphorylation

In this set of experiments 2.106 PBMCswere used per condition.he cells were washed with PBS and incubated on ice for 20 min-tes, and then centrifuged for 5 minutes at 600g. For stimulation,he cells were ressuspended in 300 �l of RPMI/10% fetal calf serumedium, prewarmed at 37 �C. Two STAT proteins were evaluated:TAT3 and STAT6. Conditions with and without stimulation were

OT5 Group LI(n � 5)

Group CR(n � 11)

Group Sta(n � 12)

49 61 � 12 44 � 14 47 � 10F 3/2 3/8 6/61 1 (n � 5) 1 (n � 11) 1 (n � 11)

2 (n � 1)23 15 � 9 8 � 3 5 � 6No 1/5

Anti-IL2R � 15/11Anti-IL2R � 2ATG � 1hAnti-IL2R � 2

11/12Anti-IL2R � 5ATG � IVIG � 1hAnti-IL2R � 5

0 3.4 � 1.14 4.72 � 1.34 3.83 � 1.26Living 4/1 4/7 10/2Y 4/5 5/11 4/12N 2/5 8/11 4/12N 2/5 5/11

CMV (n � 1)4/12

plianceNoncompliance

NA NA NA

8 NA NA NA

dard immunosuppression; CR � chronic allograft nephropathy; NA � not available; IS �

NA � does not apply; Anti-IL-2R � chimeric mouse-human-Basilixmab; hAnti-IL-2R �

OT4

43F1

7No

0LivingNNNA

Noncom4.1

d stanulin;

cytomegalovirus; IL-2R � IL-2 receptor. The data are represented as mean � standard

Page 3

c(Dmtb9NcifshmSiffgiwpci

2

gt[ovg(a(etp

d6tPTC3pdisri

2

oT(s0

3

3

ott

3t

CCsaa

Fgcn

P. M. M. Moraes-Vieira et al. / Human Immunology 71 (2010) 442–450444

ompared. For the stimulation of STAT3,weused 5ng of interleukinIL)-6 and for STAT6 phosphorylation 3 ng of IL-4 (BD, Bectonickinson, NJ). These cytokines were added to the prewarmededium and incubated for 12 minutes at 37 �C. After stimulation,

he cells were fixed with 300 �l of 4% paraformaldehyde and incu-ated at 37 �C for 10minutes. After centrifugation, 1ml ofmethanol0%was added and the PBMCwere incubated for 30minutes on ice.ext, 10 ml of phosphate buffered saline (PBS) were added and theells were centrifuged at 600g for 7 minutes. The PBMC were thenncubated for 15minutes at room temperature with 100 �l of PBS 2%etal calf serum. The PBMCswerewashed twicewith PBS 2% calf fetalerumand stainedwithfluorescein isothyocyanate–conjugated anti-uman CD3 mAb, cychrome (Cy)-conjugated anti-human CD4Ab, and either phycoerythrin (PE)-conjugated anti-humanTAT3pY705 or STAT6pY641 mAbs (BD, Becton Dickinson), depend-ng on the signaling pathway analyzed. The cells were incubatedor 30 minutes on ice, and then washed three times with PBS 2%etal calf serum. At least 200,000 events were acquired in theate of lymphocytes. FACSCalibur flow cytometer (Becton Dick-nson, San Jose, CA) and CellQuest Software (Becton Dickinson)ere used for acquisition and FlowJo 8.4.3 (Tree Star) for com-ensation and analysis. The percentages of phosphorilationwerealculated based on the ratio between the median fluorescencentensity detected for stimulated and nonstimulated PBMC.

.5. IL-4R� expression by real time PCR

Total cellular RNA was extracted using Trizol reagent (Invitro-en, Carlsbad, CA) from 5.106 PBMCs. Total RNA was reverse-ranscribed using Superscript II reverse-transcriptase, with oligo(dT)12–18] primer and random primers (Invitrogen) in a final volumef 20 �l. RNA samples were treated with RNase-free DNase I (In-itrogen) before reverse transcription to eliminate contaminatingenomic DNA. For detection of IL-4R� messenger ribonucleic acidmRNA), the reaction mixture (10 �l) contained 0.3 �M of forwardnd reverse IL-4R� primers and the SYBR-Green PCR Master MixApplied Biosystems, Foster City, CA), according to themanufactur-rs’ recommendations. ThemRNA expression was quantified usinghe PerkinElmer ABI Prism 7500 Sequence Detection System (Ap-lied Biosystems). Reactions consisted of an initial 10minutes 95 �C

ig. 1. CD4�CD25� T-cell populations in the study groups. The percentage of periphroups of study. (C) The cell numbers of peripheral CD25High CD4� T cells and (D) CD2

ount of each individual performed at the same time the bloodwas collected. Operational tormal immunosuppression: (Sta: n � 12); chronic allograft nephropathy: (CR: n � 11);

enaturation step, followed by 40 cycles of 15 second at 95 �C and0 seconds at 60 �C. All reported mRNA levels were normalized tohe glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA.rimers sequences were as follows. GAPDH primers: forward 5=GGTCTCCTCTGACTTCAACA 3= and reverse 5= AGCCAAATTCGTTGT-ATACC 3=; IL-4-R� primers: forward 5= CCCAGTGCCCTCTACTCTCAT= and reverse 5= AAATCGTGAACTTTGTCTCCGT 3=. To eliminate am-lifications from contaminating genomic DNA, these primers wereesigned to span an intron/exon boundary and thus to anneal specif-cally to cDNA.Normalizedvalues for IL-4R�mRNAexpression ineachamplewere calculatedusing thePfafflmethod [22]. All sampleswereun in triplicates. All RNA had a 260/280 ration �1.7 and had theirntegrity visualized by agarose gel electrophoresis.

.6. Statistical analysis

Comparisons among groups weremade using one-way analysisf variance and Kruskal–Wallis Dunn’s multiple comparison test.he statistical analyses were performed using Prism 5.0 softwareGraphPad Software, SanDiego CA, EUA). A p�0.05was consideredignificant. Significant differenceswere shownas *(p�0.05), **(p�

.01), ***(p � 0.001).

. Results

.1. Clinical history of and patient characteristics

All transplanted individuals in this study had more than 1 yearf transplantation. The transplanted individuals were included inhe study between 2007 and 2009. The demographic clinical fea-ures of subjects in the study groups are shown in Table 1.

.2. Higher numbers of CD4+ CD25+ Foxp3+ T cells in operationalolerance individuals than in chronic allograft nephropathy

To quantify the percentages and absolute numbers ofD4�CD25� cells in PBMC, we subdivided the population of totalD4�CD25� cells in CD25High and CD25Low (Fig. 1). We observed noignificant quantitative differences in these two populationsmong the different study groups (Fig. 1). In contrast, OT individu-ls presented significantly higher absolute numbers and percent-

D25High (A) and CD25Low (B) CD4� T cells was analyzed in the blood of the differentD4� T cells. The absolute cell numberswere calculated based on the complete blood

eral C5LowC

olerance: (OT: n� 5); low immunosuppressed: (LI: n� 5), stable graft function andhealthy individuals: (HI: n � 10). No statistical differences were observed.

Page 4

aw

CcfTln0tpp

3

gTccp

lipsms

dgiScopsms

FCCcs upprec 0.05),

P. M. M. Moraes-Vieira et al. / Human Immunology 71 (2010) 442–450 445

ges of circulating CD4�CD25�Foxp3� lymphocytes comparedith CR individuals (p � 0.05) (Fig. 2).The CR individuals also displayed significantly reduced

D4�CD25�Foxp3� T cells than HI and LI individuals, both in per-entages and absolute numbers (p � 0.05) (Fig. 2D, G). Individualsromboth theOT and the LI groups displayed a similar profile of this-cell population in relation to HI. The CD4�CD25LowFoxp3� popu-ation was significantly higher in both percentage and absoluteumbers in theOT, LI, andHI groups comparedwith CR and Sta (p�.05) (Fig. 2B, E). This difference was less significant in the popula-ion of CD4�CD25HighFoxp3� T cells, although both OT and HI didresent higher absolute numbers and percentages of this T-cellopulation compared with CR individuals (p � 0.05) (Fig. 2C, F).

.3. Altered IL-6/STAT3 and IL-4/STAT6 signaling pathways

We evaluated the phosphorylation of STAT3 and STAT6 in theate ofmonocytes, CD3�, CD3�CD4�, and CD3�CD4� lymphocytes.he percentages were calculated comparing the median fluores-ence intensity between the stimulated and the nonstimulatedells. In Fig. 3, we illustrate the regions analyzed for the STAT6

ig. 2. Analysis of intracellular Foxp3 expression in CD4�CD25� T cells. (A) ReprD4�CD25LowFoxp3� T cells. The percentage of peripheral CD25LowFoxp3� T cellsD25�Foxp3� T cells. (E) The absolute cell numbers of peripheral CD25LowFoxp3� Tell number of peripheral total CD4�CD25�Foxp3� T cells. The absolute cell numberame time the bloodwas collected. Operational tolerance: (OT: n� 5); low immunoshronic allograft nephropathy: (CR n � 11); healthy individuals: (HI n � 10). *(p �

hosphorylation. b

The STAT3 phosphorylation showed no difference in the popu-ations of lymphocytes analyzed among all study groups. However,n the gate of monocytes, Sta individuals presented a higher phos-horylation of STAT3 compared with HI (p � 0.05). OT individualseem to display a lower phosphorylation of STAT3 in the gate ofonocytes, comparedwith the other study groups, but thiswas nottatistically significant (Fig. 4A–D).

The IL-4/STAT6 signaling pathway showed more pronouncedifferences among the study groups. In CD3� cells, the OT and LIroups showed a similar profile compared with Sta, HI, and CRndividuals (Fig. 5A). For T cells, the LI group presented a higherTAT6 phosphorylation in the CD3�CD4� T-cell population,ompared with all other groups (p � 0.05) (Fig. 5C). In the regionf monocytes, the OT group showed a significantly reduced ca-acity to phosphorylate STAT6 compared with all the othertudy groups (p � 0.01 and p � 0.001) (Fig. 5D). The region ofonocytes displayed constantly �1.0% of CD3� cells (data nothown).To evaluate whether the differential STAT6 activation could

tive CD25 Foxp3 Dot Plot analysis of each group studied. (B) The percentage ofhe percentage of CD4�CD25HighFoxp3� T cells. (D) The percentage of total CD4�

F) The absolute cell numbers of peripheral CD25HighFoxp3� T cells. (G) The absolutee calculated based on the complete blood count of each individual performed at thessed: (LI: n� 5), stable graft function andnormal immunosuppression: (Sta n� 12);**(p � 0.01), ***(p � 0.001).

esenta. (C) Tcells. (s wer

e due to different IL-4 receptor expression, we analyzed the

Page 5

F(lc

P. M. M. Moraes-Vieira et al. / Human Immunology 71 (2010) 442–450446

ig. 3. IL-4/STAT6 signaling, representative of one transplanted individual. The signaling pathway was analyzed by flow cytometry. The peripheral blood mononuclear cellsPBMC) were stimulated with IL-4. First, we delimitated the regions for lymphocytes and monocytes (A). Inside the lymphocyte region we delimitated regions for the

� � � � �

ymphocyte subsets: CD3 CD4 , CD3 CD4 , CD3 (B). In each regionwe analyzed the IL-4 stimulated and nonstimulated populations (C–F). Histogram: blue, IL-4 stimulatedells; red, nonstimulated cells. MFI, median fluorescence intensity.

Page 6

ese(

4

s

cgtr

TeC

FCa n � 1

FCf

P. M. M. Moraes-Vieira et al. / Human Immunology 71 (2010) 442–450 447

xpression of IL-4R� transcripts in PBMC of individuals from alltudy groups. We observed that the OT individuals had a higherxpression of this gene compared with LI individuals (p � 0.05)Fig. 6).

. Discussion

The existence of kidney-transplanteddrug-free individualswithtable graft function indicates that tolerance can, indeed, occur in

ig. 4. The STAT3 phosphorylation of peripheral mononuclear cells in the groupsD3�CD4� lymphocytes; (C) in CD3�CD4� lymphocytes, and (D) in monocytes. Opend normal immunosuppression: (Sta n � 11); chronic allograft nephropathy: (CR:

ig. 5. The STAT6 phosphorylation of peripheral mononuclear cells in the groups� � � �

D3 CD4 lymphocytes, (C) in CD3 CD4 lymphocytes, and (D) in monocytes. Operatio

unction and normal immunosuppression: (Sta: n � 12); chronic allograft nephropathy: (C

linical transplantation, and offers a “human model” to study allo-raft tolerance. These patients, who achieve a state of operationalolerance, are extremely rare and little data exist in the literatureegarding this special group of individuals.

In this study, we analyzed the profile of potentially regulatorycells and STAT signaling in kidney recipients displaying differ-nt clinical status. Besides quantifying the potentially regulatoryD4�CD25�Foxp3� T-cell population, our aim was to verify

dy. (A) Phosphorylation of STAT3 in CD3� cells in the gate of lymphocytes; (B) inal tolerance: (OT: n � 4); low immunosuppressed: (LI: n � 5), stable graft function0); healthy individuals: (HI: n � 7). **(p � 0.01).

dy. (A) Phosphorylation of STAT6 in CD3� cells in the gate of lymphocytes, (B) in

of sturation

of stu

nal tolerance: (OT: n � 5); under low immunosuppression: (LI: n � 5), stable graftR: n � 8); healthy individuals: (HI: n � 10). *(p � 0.05), **(p � 0.01), ***(p � 0.001).

Page 7

wSp

tgoHaMCtCnsoi

ttTtvalbwaaTrcnticiti

tp

bbfucwppa

ogsbnSs[ipmtrltmai

omcdawrrt

soipLceipdfafTwtl

mpSgC

FcrTqPpc

P. M. M. Moraes-Vieira et al. / Human Immunology 71 (2010) 442–450448

hether the state of OT involves a differential activation ofTAT3 and STAT6 signaling in different peripheral blood cellopulations.We did not observe a differential recruitment and phosphoryla-

ion of STAT3 and STAT6 in CD4� T cells in the operational toleranceroup, which could influence the differentiation and maintenancef regulatory T cells, as reported in the published data [19,23].owever,we did observe that OT individuals presented diminishedctivation of IL-4/STAT6 pathway in the region of monocytes.oreover, we also report the Foxp3 protein expression inD4�CD25� T cells, in OT individuals, in the context of human renalransplantation. We observed that the numbers of total CD4�

D25�Foxp3� as well as of CD4�CD25HighFoxp3� T cells were sig-ificantly higher in OT individuals in relation to those with CR andimilar to HI and LI individuals. This suggests that the low numbersf this T-cell population, likely to be regulatory T cells, in CR, maynfluence this inflammatory clinical course.

In several experimental models, this regulatory T-cell popula-ion has been shown to contribute to the maintenance of allograftolerance [24–27]. However, despite the importance of regulatorycells in transplantation tolerance, there are limited data about

hese cells in the blood of transplanted individuals, comparingarious clinical situations, such as OT, CR, and LI individuals. Therere reports describing that OT individuals, in the context of bothiver and renal transplantation, display numbers of peripherallood CD4�CD25High T cells similar toHI, contrasting thosewith CR,ho display lower numbers of this cell population [10,11]. Theseuthors also analyzed Foxp3 mRNA levels in CD4� T cells andssociated these resultswith the bloodphenotype of CD4�CD25High

cells. Moreover, another work reported that OT individuals, inenal transplant, have similar numbers of CD4�CD25HighFoxp3� Tells to HI, whereas individuals with CR presented a decreasedumber of these cells [12]. Our results add new information tohose previously described as we analyzed the expression of Foxp3n both CD4�CD25High and CD4�CD25Low T cells. Although Foxp3an be expressed in several other activated T cells [28,29], aswell asn CD8� T cells [30] and CD3�CD25� T cells, which bear no regula-ory activity [31], it seems informative to analyze Foxp3 expression

ig. 6. Expression of IL-4-R� in humanperipheral bloodmononuclear cells (PBMCs).DNA samples prepared from PBMC of the different individuals were subjected toeal-time quantitative PCR analyses using primers specific for IL-4R� and GAPDH.he relative quantity of IL-4R�, in each sample, was normalized to the relativeuantity of GAPDH using the Pfaffl method [22], and compared with the expression inBMCs of healthy individuals. Operational tolerance: (OT: n � 4); low immunosup-ressed: (LI:n�5), stablegraft functionandnormal immunosuppression: (Sta:n�12);hronic allograft nephropathy: (CR: n � 8). All data are represented asmean � SEM.

n CD4�CD25High T cells. We believe these data reinforce the idea l

hat the preservation of regulatory T cells may be relevant to therocess of human allograft tolerance.Wealso analyzed the population of CD4�CD25LowFoxp3� T cells,

ased on the observation that human CD4�CD25Low T cells haveeen shown to display regulatory activity [32]. Accordingly, weound a marked difference in the CD4�CD25LowFoxp3� T-cell pop-lation among the study groups. OT individuals had higher per-entages and absolute numbers of this T-cell population comparedith the CR individuals. On the basis of our present findings, weropose that the CD4�CD25LowFoxp3� T-cell population may alsolay an important role in the achievement of allotolerance, amech-nism yet to be elucidated in human transplantation.There are multiple pathways to tolerance, and possibly several

f them act together directing how the immune response to theraft will evolve. There is almost no information on intracellularignaling pathways in transplantation and, to date, no studies haveeen published on how OT patients respond to extracellular sig-als, such as cytokines. We chose two signaling pathways, IL-6/TAT3 and IL-4/STAT6, because of their relationwith Foxp3 expres-ion and regulatory T-cell differentiation, as previously described18,19].We here report, for the first time, how kidney transplantedndividuals, in different clinical statuses, activate their signalingathways in response to two cytokines, IL-4 and IL-6. There are twoajor advantages for using PhosFlow [33,34] to investigate how

he transcriptional factors STAT3 and STAT6 are phosphorylated, inesponse to IL-6 and IL-4, respectively. It allows the use of relativelyow number of cells and simultaneous evaluation in different cellypes by combining the use of surface markers. The conventionalethodologies, such as Western blots and electromobility shiftssays, require higher quantity of cells, limiting the study of signal-ng pathways in human transplanted individuals.

We observed that the STAT3 phosphorylation displayed onlyne significant difference among all study groups in the region ofonocytes. The Sta group showed a higher STAT3 phosphorylationompared with HI. It is worth mentioning that the OT individualsisplayed a STAT3 signaling profile similar to HI. The STAT3 isctivated by both IL-6 and IL-10 cytokines but it is not understoodhether this pathway induces immune stimulatory or tolerogenicesponses. Thus, this pathway does not seem to be differentiallyecruited in renal OT, and we found no plausible interpretation tohe difference observed in the Sta group.

In contrast, we observed a significant difference in IL-4/STAT6ignaling pathway among the various study groups. The relevancef this signaling pathway to immunoregulation relies on its capac-ty to drive the polarization toward a Th2 profile, limiting IFN-�roduction by Th1 cells [35]. In CD3�CD4� T cells, we observed thatI individuals presented a higher capacity to phosphorylate STAT6omparedwith the other study groups. Although itmay seem inter-sting, the LI individuals are under different immunosuppressive reg-men and under double therapy. Therefore, the importance of onearticular drug and its implication in these minor STAT6 signaling isifficult to be accomplished. Nevertheless, this signaling pathwayavors the development of Th2 cells and cytokines that have beenssociated with the establishment and maintenance of stable graftunction [36,37]. Thehigher STAT6phosphorylation in the CD3�CD4�

-cell population in LI individuals indicates that this signaling path-ay is differentially activated in this group with graft stability, andhat itmayhavea role in inducing/keeping thishomeostatic immuno-ogic state, which requires less immunosuppression.

The analysis of the STAT6 phosphorylation in the region ofonocytes showed that the OT individuals displayed a lower phos-horylation compared with all the other groups. It is known thatTAT6 regulates the expression of several genes related with anti-en presentation, such as MHCII, adhesion molecules, CD11b, andD86 [38–41]. Thus, it is possible that this low STAT6 phosphory-

ation in the region of monocytes may be implicated in a less

Page 8

eaeomotvsr

cPOlamcO

CspMtmkgpIipstmppaedtli

A

FawiPtaMsFcrKp

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

P. M. M. Moraes-Vieira et al. / Human Immunology 71 (2010) 442–450 449

fficient antigen presentation and induction of effector response. Inddition, the lower capacity to respond to IL-4may limit the differ-ntiation of monocytes into dendritic cells, as well as the secretionf IL-12. This context may favor the differentiation toward an im-ature and more tolerogenic dendritic cell phenotype, as previ-usly reported [42–44]. Although this hypothesis awaits to beested as soon as we dispose of new blood samples from OT indi-iduals, we would like to propose that the diminished IL-4/STAT6ignaling could be an additional way by which OT individuals mayeach this homeostatic state.

To investigate whether low IL-4 receptor expression could be aause of the diminished phosphorylation of STAT6,we analyzed theBMCmRNA expression of IL-4R� and found a higher expression inT individuals. This result makes it unlikely that the mechanismseading to a diminished STAT6 phosphorylation may be due to anltered IL-4 receptor expression. Nevertheless, we analyzed theRNA expression in total PBMC and not in monocytes. Thus, weannot exclude that the higher IL-4R� expression observed in theT group is related to other cell types.In summary, we have shown the protein expression of Foxp3 in

D4�CD25� T cells and that operational tolerance individuals haveignificantly higher numbers of this potentially regulatory T-cellopulation � in both CD25High and CD25Low�than CR individuals.oreover, the operational tolerance individuals displayed an al-

ered signaling profile with reduced phosphorylation of STAT6 inonocytes and a distinct signaling profile compared with healthyidney donors and to low immunosuppressed individuals.We sug-est that the IL-4/STAT6 signaling pathway may participate in therocess of tolerance, observed in operational tolerance individuals.f confirmed, this may offer an additional tool to discriminate clin-cally tolerant patients from other clinical groups. It is relevant tooint out that despite the limited number of OT individuals, thetatistical significance observed may indicate a relevant opera-ional tolerance feature, at least to some patients. It should beentioned that these OT individuals are quite rare worldwide, asreviously reported by Brouard and collaborators that only fiveatientswere identified as being drug-free and operationally toler-nt among an estimated number of 25,000 or more kidney recipi-nts in France [45]. Therefore, we believe that any significantifferential immunologic information in regard to operationalolerant individuals is relevant to be reported because it may shedight into possible pathways to human transplantation tolerance,nspiring several groups to pursue future investigations.

cknowledgments

The authors thank Patricia Sesterheim, ElisÃngela S. Prado andabiana Agena in helping collecting samples and clinical data. Welso thank FAPESP (06/04133-7) for the provided studentship. Thisork was supported by grants from CNPqMCT/BID (BrazilianMin-

stry of Science and Technology). Authors contributions: Vieira.M.M.M.–experimental procedures, data analysis and interpreta-ion, and writing the manuscript; Silva H.M.–collection and/orssembly of data and discussion of the manuscript; Takenaka.–collection and/or assembly of data and discussion of themanu-cript; Monteiro S.M.–collection and/or assembly of data; Lemos.–provision of study materials, discussion of clinical data and dis-ussion of the manuscript; Saitovitch D.–provision of study mate-ials, discussion of clinical data and discussion of the manuscript;alil J.–discussion of data; Coelho V.–conception of study, inter-retation of data and writing the manuscript.

eferences

[1] Golshayan D, Pascual M. Tolerance-inducing immunosuppressive strategies inclinical transplantation: An overview. Drugs 2008;68:2113–30.

[2] Berlanda M, Di Cocco P, Mazzotta C, Rizza V, D’Angelo M, Bellini MI, et al.

Clinical operational tolerance after kidney transplantation: A short literaturereview. Transplant Proc 2008;40:1847–51.

[3] Brouard S, Mansfield E, Braud C, Li L, Giral M, Hsieh SC, et al. Identification of aperipheral blood transcriptional biomarker panel associated with operationalrenal allograft tolerance. Proc Natl Acad Sci USA 2007;104:15448–53.

[4] Vieira PM, Silva H, Takenaka M, Monteiro S, Lemos F, Saitovich D, et al. Differ-ential immunemolecular profile in kidney operational tolerance transplantedindividuals: Towards a regulatory profile. Clin Immunol 2009;131:S165.

[5] Akl A, Luo S, Wood KJ. Induction of transplantation tolerance-the potential ofregulatory T cells. Transpl Immunol 2005;14:225–30.

[6] Hara M, Kingsley CI, Niimi M, Read S, Turvey SE, Bushell AR, et al. IL-10 isrequired for regulatory T cells to mediate tolerance to alloantigens in vivo.J Immunol 2001;166:3789–96.

[7] Calne R, Friend P, Moffatt S, Bradley A, Hale G, Firth J, et al. Prope tolerance,perioperative campath 1H, and low-dose cyclosporin monotherapy in renalallograft recipients. Lancet 1998;351:1701–2.

[8] Spitzer TR, Delmonico F, Tolkoff-Rubin N, McAfee S, Sackstein R, Saidman S, etal. Combined histocompatibility leukocyte antigen-matched donor bone mar-row and renal transplantation for multiple myeloma with end stage renaldisease: The induction of allograft tolerance through mixed lymphohemato-poietic chimerism. Transplantation 1999;68:480–4.

[9] Chatenoud L. CD3�specific antibodies restore self-tolerance: Mechanisms andclinical applications. Curr Opin Immunol 2005;17:632.

10] Louis S, BraudeauC,GiralM,DupontA,Moizant F, RobillardN, et al. ContrastingCD25hiCD4�T cells/FOXP3 patterns in chronic rejection and operational drug-free tolerance. Transplantation 2006;81:398–407.

11] Pons JA, Revilla-Nuin B, Baroja-Mazo A, Ramirez P, Martinez-Alarcon L,Sanchez-Bueno F, et al. FoxP3 in peripheral blood is associated with opera-tional tolerance in liver transplant patients during immunosuppression with-drawal. Transplantation 2008;86:1370–8.

12] Braudeau C, RacapeM,GiralM, Louis S,MoreauA, Berthelot L, et al. Variation innumbers of CD4�CD25highFOXP3� T cells with normal immuno-regulatoryproperties in long-term graft outcome. Transpl Int 2007;20:845–55.

13] Alvarez CM, Paris SC, Arango L, Arbelaez M, Garcia LF. Kidney transplantpatients with long-term graft survival have altered expression of moleculesassociated with T-cell activation. Transplantation 2004;78:1541–7.

14] Chen N, Gao Q, Field EH. Prevention of Th1 response is critical for tolerance.Transplantation 1996;61:1076–83.

15] SayeghMH, Akalin E, HancockWW,RussellME, Carpenter CB, Linsley PS, TurkaLA. CD28�B7 blockade after alloantigenic challenge in vivo inhibits Th1 cyto-kines but spares Th2. J Exp Med 1995;181:1869–74.

16] Csencsits K, Wood SC, Lu G, Magee JC, Eichwald EJ, Chang CH, Bishop DK. Graftrejection mediated by CD4� T cells via indirect recognition of alloantigen isassociated with a dominant Th2 response. Eur J Immunol 2005;35:843–51.

17] Schindler C, Shuai K, Prezioso VR, Darnell JE, Jr. Interferon-dependent tyrosinephosphorylation of a latent cytoplasmic transcription factor. Science 1992;257:809–13.

18] HuberM, Steinwald V, Guralnik A, Brustle A, Kleemann P, Rosenplanter C, et al.IL-27 inhibits the development of regulatory T cells via STAT3. Int Immunol2008;20:223–34.

19] Takaki H, Ichiyama K, Koga K, Chinen T, Takaesu G, Sugiyama Y, et al. STAT6inhibits TGF-beta1-mediated Foxp3 induction through direct binding to theFoxp3 promoter, which is reverted by retinoic acid receptor. J Biol Chem2008;283:14955–62.

20] Pillemer BB, Qi Z, Melgert B, Oriss TB, Ray P, Ray A. STAT6 activation confersupon T helper cells resistance to suppression by regulatory T cells. J Immunol2009;183:155–63.

21] Racusen LC, Halloran PF, Solez K. Banff 2003 meeting report: New diagnosticinsights and standards. Am J Transplant 2004;4:1562–6.

22] Pfaffl MW. A new mathematical model for relative quantification in real-timeRT-PCR. Nucleic Acids Res 2001;29:e45.

23] Sanchez-Guajardo V, Tanchot C, O’Malley JT, Kaplan MH, Garcia S, Freitas AA.Agonist-driven development of CD4�CD25�FOXP3� regulatory T cells re-quires a second signal mediated by Stat6. J Immunol 2007;178:7550–6.

24] Wood KJ, Sakaguchi S. Regulatory T cells in transplantation tolerance. Nat RevImmunol 2003;3:199–210.

25] Velasquez-LoperaMM, Eaton VL, Lerret NM, Correa LA, Decresce RP, Garcia LF,et al. Induction of transplantation tolerance by allogeneic donor-derivedCD4(�)CD25(�)Foxp3(�) regulatory T cells. Transpl Immunol 2008;19:127–35.

26] Zhang F, Lv L, Pu LY, Li XC, Yao AH, ZhangW, et al. [CD4(�) CD25(�) Tr cells andtranscription factor Foxp3 in the naturally tolerance of rat liver transplanta-tion]. Zhonghua Wai Ke Za Zhi 2006;44:1463–6.

27] Adeegbe D, Bayer AL, Levy RB, Malek TR. Cutting edge: AllogeneicCD4�CD25�FOXP3� T regulatory cells suppress autoimmunity while estab-lishing transplantation tolerance. J Immunol 2006;176:7149–53.

28] Wang J, Ioan-Facsinay A, van der Voort EI, Huizinga TW, Toes RE. Transientexpression of FOXP3 in human activated nonregulatory CD4� T cells. EurJ Immunol 2007;37:129–38.

29] Pillai V, Ortega SB, Wang CK, Karandikar NJ. Transient regulatory T-cells: Astate attained by all activated human T-cells. Clin Immunol 2007;123:18–29.

30] Hahn BH, Singh RP, La Cava A, Ebling FM. Tolerogenic treatment of lupus micewith consensus peptide induces Foxp3-expressing, apoptosis-resistant, TGF-beta-secreting CD8� T cell suppressors. J Immunol 2005;175:7728–37.

31] Fu S, Zhang N, Yopp AC, Chen D, Mao M, Zhang H, et al. TGF-beta induces

Foxp3 � T-regulatory cells from CD4 � CD25�precursors. Am J Transplant2004;4:1614–27.

Page 9

[

[

[

[

[

[

[

[

[

[

[

[

[

[

P. M. M. Moraes-Vieira et al. / Human Immunology 71 (2010) 442–450450

32] Xu Q, Lee J, Jankowska-Gan E, Schultz J, Roenneburg DA, Haynes LD, et al.Human CD4� CD25 low adaptive T regulatory cells suppress delayed-typehypersensitivity during transplant tolerance. J Immunol 2007;178:3983–95.

33] Schulz KR, Danna EA, Krutzik PO, Nolan GP. Single-cell phospho-protein anal-ysis by flow cytometry. Curr Protoc Immunol 2007;8:1–20.

34] Hale MB, Nolan GP. Phospho-specific flow cytometry: Intersection of immu-nology and biochemistry at the single-cell level. Curr Opin Mol Ther 2006;8:215–24.

35] Wurtz O, Bajenoff M, Guerder S. IL-4-mediated inhibition of IFN-gamma pro-duction by CD4� T cells proceeds by several developmentally regulatedmech-anisms. Int Immunol 2004;16:501–8.

36] Ganschow R, Broering DC, Nolkemper D, Albani J, Kemper MJ, Rogiers X,Burdelski M. Th2 cytokine profile in infants predisposes to improved graftacceptance after liver transplantation. Transplantation 2001;72:929–34.

37] Davidson C, Verma ND, Robinson CM, Plain KM, Tran GT, Hodgkinson SJ, HallBM. IL-13 prolongs allograft survival: Association with inhibition of macro-phage cytokine activation. Transpl Immunol 2007;17:178–86.

38] Bennett BL, Cruz R, Lacson RG, Manning AM. Interleukin-4 suppression of

tumor necrosis factor alpha-stimulated E-selectin gene transcription is medi-ated by STAT6 antagonism of NF-kappaB. J Biol Chem 1997;272:10212–9.

39] Takeda K, Kamanaka M, Tanaka T, Kishimoto T, Akira S. Impaired IL-13-mediated functions ofmacrophages in STAT6-deficientmice. J Immunol 1996;157:3220–2.

40] Deszo EL, Brake DK, Kelley KW, Freund GG. IL-4-dependent CD86 expressionrequires JAK/STAT6 activation and is negatively regulated by PKCdelta. CellSignal 2004;16:271–80.

41] Hart PH, Bonder CS, Balogh J, Dickensheets HL, Donnelly RP, Finlay-Jones JJ.Differential responses of human monocytes and macrophages to IL-4 andIL-13. J Leukoc Biol 1999;66:575–8.

42] Yi H, Zhang L, Zhen Y, He X, Zhao Y. Dendritic cells induced in the presence ofGM-CSF and IL-5. Cytokines 2007;37:35–43.

43] Ahn JS, Agrawal B. IL-4 ismore effective than IL-13 for in vitro differentiation ofdendritic cells from peripheral blood mononuclear cells. Int Immunol 2005;17:1337–46.

44] Ebner S, Ratzinger G, Krosbacher B, Schmuth M, Weiss A, Reider D, et al.Production of IL-12 by human monocyte-derived dendritic cells is optimalwhen the stimulus is given at the onset of maturation, and is further enhancedby IL-4. J Immunol 2001;166:633–41.

45] Brouard S, Dupont A, Giral M, Louis S, Lair D, Braudeau C, et al. Operationally

tolerant andminimally immunosuppressed kidney recipients display stronglyaltered blood T-cell clonal regulation. Am J Transplant 2005;5:330–40.